NOVEL MRNA 5'-END CAP ANALOGS MODIFIED WITHIN PHOSPHATE RESIDUES, RNA MOLECULE INCORPORATING THE SAME, USES THEREOF AND METHOD OF SYNTHESIZING RNA MOLECULE OR PEPTIDE

20230295215 · 2023-09-21

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to new 5′mRNA end cap analogs, RNA molecules containing them, their uses and methods for their in vitro synthesis, as well as a method for protein or peptide synthesis in vitro or in cell cultures, which method translates the RNA molecule.

    Claims

    1. A compound of formula: ##STR00013## wherein: R.sub.1, R.sub.3, R.sub.4 are selected from the group consisting of: H, CH.sub.3, alkyl, where R substituents with different numbers may be the same or different, Base.sub.1 is selected from the group consisting of: ##STR00014## wherein R.sub.5 is selected from the group consisting of: H, CH.sub.3, alkyl, alkenyl, alkynyl, alkylaryl, X.sub.1, X.sub.3 are selected from the group consisting of: O, S, Se, where X substituents with different numbers can be the same or different, X.sub.2, X.sub.4 are selected from the group consisting of: O, S, Se, BH.sub.3, where X substituents with different numbers can be the same or different, X.sub.5 is selected from the group consisting of: O, CH.sub.2, CF.sub.2, CCl.sub.2, at least one of the substituents among of: X.sub.1, X.sub.2, X.sub.3, X.sub.4 and X.sub.5 is different from O, excluding the compound wherein: R.sub.1 is hydrogen or CH.sub.3, R.sub.2 is hydrogen, R.sub.3 is CH.sub.3, X.sub.1, X.sub.3, X.sub.4 and X.sub.5 are oxygen, X.sub.2 is sulfur and Base.sub.1 is G.

    2. A compound according to claim 1, wherein said compound is selected from the group consisting of: m.sup.7Gpp.sub.spApG compound of formula: ##STR00015## compound m.sup.7Gpp.sub.spA.sub.mpG of formula: ##STR00016## compound m.sup.7Gpp.sub.sp.sup.m6ApG of formula: ##STR00017## compound m.sup.7Gpp.sub.spm.sup.6A.sub.mpG of formula: ##STR00018## A compound m.sup.7GpppAp.sub.sG of formula: ##STR00019## A compound m.sup.7Gppp.sup.5′SApG of formula: ##STR00020## A compound m.sup.7Gppp.sup.5′SA.sub.mpG of formula: ##STR00021## A compound m.sup.7GppCH.sub.2pApG with the formula: ##STR00022## A compound m.sup.7GppCH.sub.2pA.sub.mpG with the formula: ##STR00023## A compound m.sup.7GppCH.sub.2p.sup.m6ApG with the formula: ##STR00024##

    3. A compound according to claim 1, wherein said compound consists essentially of a single stereoisomer or comprises a mixture of at least two stereoisomers, a first diastereoisomer and a second diastereoisomer, the diastereoisomers being identical except that they have different stereochemical configurations around a stereogenic phosphorus atom, said stereogenic phosphorus atom being bonded to a sulfur atom, a selenium atom, or a borane group.

    4. An RNA molecule which at the 5′ end has a compound as defined in claim 1.

    5. An in vitro method of synthesizing an RNA molecule, said method comprising reacting ATP, CTP, UTP and GTP, a compound according to claim 1 and a polynucleotide matrix in the presence of RNA polymerase under conditions permitting transcription by RNA copy RNA polymerase on a polynucleotide matrix; wherein some of the RNA copies will contain said compound as, to form an RNA molecule that has said compound at the 5′ end.

    6. An in vitro protein or peptide synthesis method, said method comprising translating the RNA molecule according to claim 4, in a cell-free protein synthesis system, the RNA molecule comprising an open reading frame under conditions that allow translation from the open reading frame of the RNA protein or peptide encoded by an open reading frame.

    7. A method for synthesizing a protein or peptide in vivo, characterized in that it comprises introducing the RNA molecule of claim 4 into the cell, wherein the RNA molecule comprises an open reading frame under conditions that allow translation from the open reading frame of the RNA molecule to form a coded protein or peptide through this open reading frame, wherein said cell is not contained in the patient's body.

    8-10. (canceled)

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0050] For a better understanding of the invention, it has been illustrated in the working examples and the attached drawings, in which:

    [0051] FIGS. 1 A and B presents an analysis of the capping efficiency for RNAs obtained using selected tri-nucleotide cap analogs according to the invention (used in a 6-fold excess over GTP) or dinucleotide cap analogs known in the art (also used in a 6-fold excess over GTP).

    [0052] FIG. 2 shows protein expression in 3T3-L1 cells as a function of time obtained for enzymatically treated and HPLC-purified mRNA.

    [0053] FIG. 3 shows protein expression in JAWSII cells as a function of time obtained for enzymatically treated and HPLC-purified mRNA.

    [0054] FIG. 4 shows the total protein expression in 3T3-L1 cells for enzymatically treated and HPLC-purified mRNA.

    [0055] FIG. 5 shows the total protein expression in JAWSII cells for enzymatically treated and HPLC-purified mRNA.

    [0056] FIG. 6 shows protein expression in JAWSII cells as a function of time obtained for mRNAs that have not been subjected to the procedure of uncapped mRNA removal.

    [0057] FIG. 7 shows the total protein expression in JAWSII cells for mRNAs that have not been subjected to the procedure of uncapped mRNA removal.

    [0058] The term “alkyl” refers to a saturated, linear or branched hydrocarbon substituent with the indicated number of carbon atoms, preferably from 1 to 10 carbon atoms. Examples of the alkyl substituent are -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, -n-octyl, -n-nonyl, and -n-decyl. Representative branched-(C1-C10) alkyls include -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, -neopentyl, -1-methylbutyl, -2-methylbutyl, -3-methylbutyl, -1,1-dimethylpropyl, -1,2-dimethylpropyl, -1-methylpentyl, -2-methylpentyl, -3-methylpentyl, -4-methylpentyl, -1-ethylbutyl, -2-ethylbutyl, -3-ethylbutyl, -1,1-dimethylbutyl, -1,2-dimethylbutyl, 1,3-dimethylbutyl, -2,2-dimethylbutyl, -2,3-dimethylbutyl, -3,3-dimethylbutyl, -1-methylhexyl, 2-methylhexyl, -3-methylhexyl, -4-methylhexyl, -5-methylhexyl, -1,2-dimethylpentyl, -1,3-dimethylpentyl, -1,2-dimethylhexyl, -1,3-dimethylhexyl, -3,3-dimethylhexyl, 1,2-dimethylheptyl, -1,3-dimethylheptyl, and -3,3-dimethylheptyl and the like.

    [0059] The term “alkenyl” refers to a saturated, linear or branched non-cyclic hydrocarbon substituent with the indicated number of carbon atoms and containing at least one carbon-carbon double bond. Examples of the alkenyl substituent are -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutyleneyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl, -isoprenyl, -2,3-di-methyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-heptenyl, -1-octetyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl and the like.

    [0060] The term “alkynyl” refers to a saturated, linear or branched non-cyclic hydrocarbon substituent with the indicated number of carbon atoms and containing at least one carbon-carbon triple bond. Examples of the alkynyl substituent are acetylenyl, propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, 4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexinyl and the like.

    [0061] The term “aryl” refers to an unsaturated, ring, aromatic or heteroaromatic (i.e. containing a heteroatom instead of carbon) substituent hydrocarbon having the indicated number of carbon atoms, preferably from 6 to 10 carbon atoms. Examples of aryl are: phenyl, naphthyl, anthracyl, phenanthryl.

    [0062] The term “alkylaryl” refers to an unsaturated hydrocarbon substituent constructed from an alkyl and aryl portion attached together (as defined above). Examples of alkylaryl are benzyl, phenylethyl, phenylpropyl, naphthylmethyl, naphthylethyl, etc.

    [0063] The term “heteroatom” means an atom selected from the group oxygen, sulfur, nitrogen, phosphorus and others.

    [0064] The term “HPLC” means high performance liquid chromatography, and the solvents designated as solvents for “HPLC” mean solvents of adequate purity for HPLC (High Performance Liquid Chromatography) analysis.

    [0065] The term “NMR” means Nuclear Magnetic Resonance.

    [0066] The term “HRMS” means High Resolution Mass Spectrometry

    Ways of Implementing the Invention

    [0067] The following examples are provided solely to illustrate the invention and to clarify its particular aspects, and not to limit it and should not be equated with its entire scope as defined in the appended claims. In the examples below, unless otherwise indicated, standard materials and methods used in the field were used or manufacturer's recommendations for specific materials and methods were followed.

    EXAMPLES

    [0068] The trinucleotide cap analogs were synthesized by combining solid supported synthesis and solution phase synthesis methods, followed by isolation of the compounds using a two step purification process. The starting point was the synthesis of dinucleotides (5′-monophosphates pNpG; 5′-tioesters p.sup.5′SNpG, 5′-methylenebisphosphonates pCH.sub.2pNpG, and dinucleotides with 3′,5′-phosphorothioate bonds pNpsG). The 3′,5′-phosphorothioate linkage was formed by using DDTT [((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazoline-3-thione] for oxidation of the phosphoramidite. Dinucleotides were cleaved off from the support, deprotected, and isolated by ion-exchange chromatography as triethylammonium salts, which were suitable for ZnCl.sub.2-mediated coupling reactions.

    [0069] p.sup.5′SNpG and pNpsG dinucleotides were subjected to coupling reaction with m.sup.7GDP-Im.sup.[15] to afford analogs of m.sup.7Gppp.sup.5′SNpG oraz m.sup.7GpppNp.sub.sG type, respectively, whereas pCH.sub.2pNpG dinucleotides were subjected to coupling reaction with m.sup.7GMP-Im.sup.[15] to afford analogs of m.sup.7GppCH.sub.2pNpG type. The synthesis of analogs carrying β-thiophosphate moiety required activation of the dinucleotide 5′-phosphates into corresponding P-imidazolides, which were subsequently coupled with m.sup.7GDP-β-S.sup.[15]. All compounds were isolated by ion-exchange chromatography and additionally purified by RP HPLC, to afford ammonium salts suitable for biological studies. In the case of analogs carrying β-thiophosphate or 3′,5′-phosphorothioate, diastereomers of the compounds were separated during RP HPLC purification step and marked D1 and D2 according to the elution order. Other trinucleotides modified within the triphosphate bridge according to the invention can be obtained using the synthetic strategies described in Examples 1-8 in combination with methods for introducing suitable phosphate bridge modifications described in the literature for dinucleotide cap analogs..sup.26,27,28,29,30

    Example 1: Synthesis of 5′-Phosphorylated Dinucleotides (pNpG)

    [0070] Synthesis of dinucleotides was performed using ÄKTA Oligopilot plus 10 synthesizer (GE Healthcare) on a 5′-O-DMT-2′-O-TBDMS-rG.sup.iBu 3′-Icaa PrimerSupport 5G (308 μmol/g) solid support (GE Healthcare). In the coupling step, 2.0 equivalents of 5′-O-DMT-2′-O-TBDMS/2′-O-Me-3′-O-phosphoramidite (rA.sup.Ac, rA.sub.m.sup.Pac, .sup.m6A.sup.Ac or .sup.m6A.sub.m.sup.Pac).sup.[12] or biscyanoethyl phosphoramidite and 0.30 M 5-(benzylthio)-1-H-tetrazole in acetonitrile were recirculated through the column for 15 min. A solution of 3% (v/v) dichloroacetic acid in toluene was used as a detritylation reagent and 0.05 M iodine in pyridine/water (9:1) for oxidation, 20% (v/v) N-methylimidazole in acetonitrile as Cap A and a mixture of 40% (v/v) acetic anhydride and 40% (v/v) pyridine in acetonitrile as Cap B. After the last cycle of synthesis, RNAs, still on the solid support, were treated with 20% (v/v) diethylamine in acetonitrile to remove 2-cyanoethyl protecting groups. Finally, the solid support was washed with acetonitrile and dried with argon. The product was cleaved from the solid support and deprotected with AMA (40% methylamine/33% ammonium hydroxide 1:1.sub.v/v; 55° C., 1 h), evaporated to dryness and redissolved in DMSO (200 μL). The TBDMS groups were removed using triethylammonium trihydrofluoride (TEA.Math.3HF; 250 μL, 65° C., 3 h), and then the mixture was cooled down and diluted with 0.25 M NaHCO.sub.3 in water (20 mL). The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-0.9 M TEAB) to afford after evaporation triethylammonium salt of pNpG dinucleotide. The yield was estimated by UV absorption at 260 nm, assuming the extinction coefficient ε=27.1 L/mmol/cm)

    TABLE-US-00001 Synthesis scale .sup.[a] Yield Yield RP HPLC .sup.[b] R.sub.t Compound [μmol] [mOD.sub.260 nm] [μmol] [min] m/z .sub.calcd. m/z .sub.found pApG 25 530 19.6 8.680 691.10324 691.10392 pA.sub.mpG 4 × 50 3840 141.7 12.070 705.11889 705.11981 p.sup.m6ApG 25 328 12.1 11.179 705.11889 705.11820 p.sup.m6A.sub.mpG 2 × 50 1645 60.7 14.434 719.13454 719.13537 .sup.[a] calculated as a product of solid support weight and loading; .sup.[b] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    [0071] p(m.sup.6A.sub.m)pG: .sup.1H NMR (500 MHz, D.sub.2O, 25° C.): δ=8.37 (s, 1H, H8.sub.A), 8.14 (s, 1H, H2.sub.A), 7.89 (s, 1H, H8.sub.G), 6.09 (d, .sup.3J.sub.H,H=4.4 Hz, 1H, H1′.sub.A), 5.81 (d, .sup.3J.sub.H,H=5.1 Hz, 1H, H1′.sub.G), 4.91 (m, 1H, H3′.sub.A), 4.68 (dd, .sup.3J.sub.H,H=5.1 Hz, .sup.3J.sub.H,H=5.1 Hz, 1H, H2′.sub.G), 4.48-4.43 (m, 3H, H2′.sub.A, H4′.sub.A, H3′.sub.G), 4.34 (m, 1H, H4′.sub.G), 4.25-4.08 (m, 4H, H5′.sub.A, H5″.sub.A, H5′.sub.G, H5″.sub.G), 3.53 (s, 3H, 2′-O—CH.sub.3), 3.46 (q, .sup.3J.sub.H,H=7.3 Hz, 18H, CH.sub.2[TEAH+]), 3.09 (s, overlapped with TEAH*, N.sup.6—CH.sub.3), 1.31 (t, .sup.3J.sub.H,H=7.3 Hz, 27H, CH.sub.3[TEAH+]) ppm; .sup.31P NMR (202.5 MHz, D.sub.2O, H.sub.3PO.sub.4, 25° C.): δ=1.1 (s, 1P, P.sub.A), 0.0 (s, 1P, P.sub.G) ppm;

    Example 2: Synthesis of Dinucleotide 3′,5′-Thiophosphodiester (pAp.SUB.s.G)

    [0072] The synthesis was performed in 25 μmol scale using ÄKTA Oligopilot plus 10 synthesizer (GE Healthcare) on a 5′-O-DMT-2′-O-TBDMS-rG.sup.iBu 3′-Icaa PrimerSupport 5G (308 μmol/g) solid support (GE Healthcare). In the coupling step, 5.0 equivalents of 5′-O-DMT-2′-O-TBDMS-rA.sup.Ac 3′-O-phosphoramidite or biscyanoethyl phosphoramidite and 0.30 M 5-(benzylthio)-1-H-tetrazole in acetonitrile were recirculated through the column for 15 min. A solution of 3% (v/v) dichloroacetic acid in toluene was used as a detritylation reagent, 20% (v/v) N-methylimidazole in acetonitrile as Cap A and a mixture of 40% (v/v) acetic anhydride and 40% (v/v) pyridine in acetonitrile as Cap B. Oxidation to phosphorothioate was performed using ((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazoline-3-thione (DDTT) and oxidation to 5′-phosphate was performed using 0.05 M iodine in pyridine/water (9:1). After the last cycle of synthesis, RNAs, still on the solid support, were treated with 20% (v/v) diethylamine in acetonitrile to remove 2-cyanoethyl protecting groups. Finally, the solid support was washed with acetonitrile and dried with argon. The product was cleaved from the solid support and deprotected with AMA (40% methylamine/33% ammonium hydroxide 1:1.sub.v/v; 55° C., 1 h), evaporated to dryness and redissolved in DMSO (200 μL). The TBDMS groups were removed using triethylammonium trihydrofluoride (TEA.Math.3HF; 250 μL, 65° C., 3 h), and then the mixture was cooled down and diluted with 0.25 M NaHCO.sub.3 in water (20 mL). The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-0.9 M TEAB) to afford after evaporation triethylammonium salt of pAp.sub.sG (395 mOD.sub.260 nm, 14.6 μmol) as a mixture of two diastereomers in ca. 2:3 ratio.

    [0073] pAp.sub.sG D1: RP-HPLC: R.sub.t=11.012 min*; HRMS ESI(−): m/z 707.08078 (calcd. for C.sub.20H.sub.25N.sub.10O.sub.13P.sub.2S.sup.− [M-H].sup.− 707.08040);

    [0074] pAp.sub.sG D2: RP-HPLC: R.sub.t=11.179 min*; HRMS ESI(−): m/z 707.08088 (calcd. for C.sub.20H.sub.25N.sub.10O.sub.13P.sub.2S.sup.− [M-H].sup.− 707.08040);

    [0075] *Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    Example 3: Synthesis of Dinucleotide 5′-Phosphorothiolates (p.SUP.5′S.ApG and p.SUP.5′S.A.SUB.m.pG)

    [0076] Synthesis of 5′-OH-NpG dinucleotides was performed in 50 μmol scale using ÄKTA Oligopilot plus 10 synthesizer (GE Healthcare) on a 5′-O-DMT-2′-O-TBDMS-rG.sup.iBu 3′-Icaa PrimerSupport 5G (308 μmol/g) solid support (GE Healthcare). In the coupling step, 2.5 equivalents of adenosine 3′-0-phosphoramidite (5′-O-DMT-2′-O-PivOM-rA.sup.Pac or 5′-O-DMT-rA.sub.m.sup.Pac) and 0.30 M 5-(benzylthio)-1-H-tetrazole in acetonitrile were recirculated through the column for 15 min. A solution of 3% (v/v) dichloroacetic acid in toluene was used as a detritylation reagent and 0.05 M iodine in pyridine/water (9:1) for oxidation, 20% (v/v) N-methylimidazole in acetonitrile as Cap A and a mixture of 40% (v/v) acetic anhydride and 40% (v/v) pyridine in acetonitrile as Cap B. After the last cycle of synthesis, the support was treated with 20% (v/v) diethylamine in acetonitrile to remove 2-cyanoethyl protecting groups, washed with acetonitrile and dried with argon.

    [0077] Dinucleotide, still on a solid support, was then converted into 5′-iodo derivative by pushing back and forth (using two syringes attached to the column) a solution of methyltriphenoxyphosphonium iodide (1.5 g) in DMF (5 mL) for 15 minutes. The resin was then washed with DMF (10 mL) and acetonitrile (10 ml), dried and transferred to a flask containing a solution of triethylammonium thiophosphate (ca. 0.16 M) and triethylamine (0.64 M) in DMF (1 mL). The slurry was stirred at 4° C. overnight, filtered and washed with acetonitrile. The product was cleaved and deprotected using AMA (40% methylamine/33% ammonium hydroxide 1:1.sub.v/v; 55° C., 1 h) and isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-0.9 M TEAB) to afford after evaporation triethylammonium salt of p.sup.5′SNpG dinucleotide.

    TABLE-US-00002 Synthesis scale .sup.[a] Yield Yield RP HPLC .sup.[b] R.sub.t Compound [μmol] [mOD.sub.260 nm] [μmol] [min] m/z .sub.calcd. m/z .sub.found p.sup.5′SApG 50 430 15.9 6.497** 707.08040 707.08101 p.sup.5′SA.sub.mpG 50 285 10.5 11.398* 721.09605 721.09686 .sup.[a] calculated as a product of solid support weight and loading; .sup.[b] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min (*) or 15 min (**)

    Example 4: Synthesis of Dinucleotide 5′-Methylenebisphosphonates (pCH.SUB.2.pApG, pCH.SUB.2.pA.SUB.m.pG and pCH.SUB.2.p.SUP.m6.ApG)

    [0078] Synthesis of 5′-OH-NpG dinucleotides was performed using ÄKTA Oligopilot plus 10 synthesizer (GE Healthcare) on a 5′-O-DMT-2′-O-TBDMS-rG.sup.iBu 3′-Icaa PrimerSupport 5G (308 μmol/g) solid support (GE Healthcare). In the coupling step, 5.0 equivalents of 5′-O-DMT-2′-O-TBDMS/2′-O-Me-3′-O-phosphoramidite (rA.sup.Ac, rA.sub.m.sup.Pac or .sup.m6A.sup.Ac) and 0.30 M 5-(benzylthio)-1-H-tetrazole in acetonitrile were recirculated through the column for 15 min. A solution of 3% (v/v) dichloroacetic acid in toluene was used as a detritilation reagent and 0.05 M iodine in pyridine/water (9:1) for oxidation, 20% (v/v) N-methylimidazole in acetonitrile as Cap A and a mixture of 40% (v/v) acetic anhydride and 40% (v/v) pyridine in acetonitrile as Cap B. After the synthesis, the support was washed with acetonitrile and dried with argon. A solution of methylenebis(phosphonic dichloride) (500 mg, 2 mmol) in trimethyl phosphate (5 mL) cooled to −18° C. was applied to the column and left at 2° C. for 7 hours. Then the solution was removed and the support was washed with trimethyl phosphate (5 mL) and acetonitrile (10 mL) and dried with argon. The column was washed with 5 mL of 0.9 M TEAB and the resin was incubated with fresh portion of TEAB at 2° C. overnight. The product was cleaved from the solid support and deprotected with AMA (40% methylamine/33% ammonium hydroxide 1:1.sub.v/v; 55° C., 1 h), evaporated to dryness and redissolved in DMSO (200 μL). The TBDMS groups were removed using triethylammonium trihydrofluoride (TEA.Math.3HF; 250 μL, 65° C., 3 h), and then the mixture was cooled down, diluted with water and pH was adjusted to 1 using hydrogen chloride and left for 7 days at room temperature to hydrolyze fluorobisphosphonate. The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-0.9 M TEAB) to afford after evaporation triethylammonium salt of pCH.sub.2pNpG dinucleotide.

    TABLE-US-00003 Synthesis scale .sup.[a] Yield Yield RP HPLC .sup.[b] Compound [μmol] [mOD.sub.260 nm] [μmol] R.sub.t [min] m/z .sub.calcd. m/z .sub.found pCH.sub.2pApG 25 118 4.35 7.200 769.09031 769.09100 pCH.sub.2pA.sub.mpG 50 345 12.7 9.728 783.10596 783.10695 pCH.sub.2p.sup.m6ApG 25 238 8.78 9.008 783.10596 783.10690 .sup.[a] calculated as a product of solid support weight and loading; .sup.[b] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    [0079] pCH.sub.2pApG: RP-HPLC: R.sub.t=7.200 min; .sup.1H NMR (500 MHz, D.sub.2O, 25° C.): δ=8.57 (s, 1H, H8.sub.A), 8.28 (s, 1H, H2.sub.A), 8.03 (s, 1H, H8.sub.G), 6.02 (d, .sup.3J.sub.H,H=4.7 Hz, 1H, H1′.sub.A), 5.84 (d, .sup.3J.sub.H,H=5.2 Hz, 1H, H1′.sub.G), 4.84-4.80 (m, overlapped with HDO, 1H, H3′.sub.A), 4.79 (m, overlapped with HDO, 1H, H2′.sub.A) 4.74 (dd, .sup.3J.sub.H,H=5.2 Hz, .sup.3J.sub.H,H 5.2 Hz, 1H, H2′.sub.G), 4.49 (m, 2H, H4′.sub.A, H3′.sub.G), 4.34 (m, 1H, H4′.sub.G), 4.27 (m, 1H, H5′.sub.G), 4.21-4.12 (m, 3H, H5″.sub.G, H5′.sub.A, H5″.sub.A), 3.20 (q, .sup.3J.sub.H,H=7.3 Hz, 1.5H, CH.sub.2[TEAH+]), 2.21 (t, .sup.2J.sub.H,P=18.9 Hz, 2H, P—CH.sub.2—P), 1.28 (t, .sup.3J.sub.H,H=7.3 Hz, 2.25H, CH.sub.3[TEAH+]) ppm; .sup.31P NMR (202.5 MHz, D.sub.2O, H.sub.3PO.sub.4, 25° C.): δ=19.1 (m, 1P, P.sub.α), 16.1 (m, 1P, P.sub.ρ), 0.3 (s, 1P, P.sub.G) ppm; HRMS ESI(−): m/z 769.09100 (calcd. for C.sub.21H.sub.28N.sub.10O.sub.16P.sub.3 [M-H].sup.− 769.09031);

    [0080] pCH.sub.2p(m.sup.6.sub.A)pG: RP-HPLC: R.sub.t=9.008 min; .sup.1H NMR (500 MHz, D.sub.2O, 25° C.): δ=8.42 (s, 1H, H8.sub.A), 8.16 (s, 1H, H2.sub.A), 7.89 (s, 1H, H8.sub.G), 5.99 (d, .sup.3J.sub.H,H=3.6 Hz, 1H, H1′.sub.A), 5.80 (d, .sup.3J.sub.H,H=5.1 Hz, 1H, H1′.sub.G), 4.84-4.76 (m, overlapped with HDO, 2H, H3′.sub.A, H2′.sub.A), 4.66 (dd, .sup.3J.sub.H,H=5.1 Hz, .sup.3J.sub.H,H=5.1 Hz, 1H, H2′.sub.G), 4.49 (m, 1H, H4′.sub.A), 4.46 (m, 1H, H3′.sub.G), 4.35-4.48 (m, 2H, H4′.sub.G, H5′.sub.G), 4.22-4.11 (m, 3H, H5″.sub.G, H5′.sub.A, H5″.sub.A), 2.80 (s, 3H, N.sup.6—CH.sub.3), 2.20 (t, .sup.2J.sub.H,P=19.7 Hz, 2H, P—CH.sub.2—P) ppm; .sup.31P NMR (202.5 MHz, D20, H.sub.3PO.sub.4, 25° C.): δ=19.2 (m, 1P, P.sub.α), 15.8 (td, .sup.2J.sub.P,H=19.7 Hz, .sup.2J.sub.P,P=9.1 Hz, 1P, P.sub.β), 0.3 (s, 1P, P.sub.G) ppm; HRMS ESI(−): m/z 783.10690 (calcd. for C.sub.22H.sub.30N.sub.10O.sub.16P.sub.3.sup.− [M-H].sup.− 783.10596);

    Example 5: Synthesis of β-Phosphorothioate Trinucleotide Cap Analogs (m.SUP.7.Gpp.SUB.s.pApG D1 and D2, m.SUP.7.Gpp.SUB.s.pA.SUB.m.pG D1 and D2, m.SUP.7.Gpp.SUB.s.pm.SUP.6.ApG D1 and D2, m.SUP.7.Gpp.SUB.s.pm.SUP.6.A.SUB.m.pG D1 and D2)

    [0081] Step 1. Activation of pNpG: Dinucleotide 5′-phosphate was dissolved in DMF (to obtain a 0.05 M solution) followed by addition of imidazole (16 equivalents), 2,2′-dithiodipiridine (6 equivalents), triethylamine (3 equivalents) and triphenylphosphine (6 equivalents). The mixture was stirred at room temperature for 48 h. The product was precipitated by addition of a solution of sodium perchlorate (10 equivalents) in acetonitrile (10 times the volume of DMF). The precipitate was centrifuged at 4° C., washed with cold acetonitrile 3 times and dried under reduced pressure to give a sodium salt of dinucleotide P-imidazolide (Im-pNpG).

    [0082] Step 2. Formation of triphosphate bridge: 7-Methylguanosine p-thiodiphosphate (m.sub.7GDP-β-S; obtained as described earlier and stored in TEAB at −20° C.).sup.[15] was evaporated to an oil and redissolved in DMF (to obtain a 0.05 M solution). Then ZnCl.sub.2 (8 equivalents) and Im-pNpG (0.5 equivalent) were added and the mixture was stirred at room temperature for 2 h. The reaction was quenched by addition of a solution of Na.sub.2EDTA (20 mg/mL; 8 equivalents) and NaHCO.sub.3 (10 mg/mL) in water and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-1.2 M TEAB) to afford after evaporation triethylammonium salt of m.sup.7Gpp.sub.spNpG. The diastereomers were separated by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous CH.sub.3COONH.sub.4 buffer pH 5.9 to give after repeated freeze-drying from water ammonium salts of single diastereomers of m.sup.7Gpp.sub.spNpG.

    TABLE-US-00004 Synthesis RP scale .sup.[a] Yield .sup.[b] HPLC .sup.[c] R.sub.t Compound [μmol] [μmol] [min] m/z.sub.calcd. m/z.sub.found m.sup.7Gpp.sub.SpApG 4.65 D1: 0.81 8.705 1146.10981 1146.11096 D2: 1.17 9.045 1146.11147 m.sup.7Gpp.sub.SpA.sub.mpG 33.0 D1: 6.50 10.493 1160.12546 1160.12689 D2: 6.16 10.713 1160.12696 m.sup.7Gpp.sub.Sp.sup.m6ApG 12.1 D1: 0.10 9.886 1160.12546 1160.12714 D2: 0.20 10.188 1160.12748 m.sup.7Gpp.sub.Sp.sup.m6A.sub.mpG 30.4 D1: 7.06 12.225 1174.14111 1174.14244 D2: 5.94 12.372 1174.14250 .sup.[a] based on the amount of pNpG used for the synthesis; .sup.[b] after RP HPLC; .sup.[c] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    Example 6: Synthesis of Thiophosphodiester Trinucleotide Cap Analog (m.SUP.7.GpppAp.SUB.s.G D1 and D2)

    [0083] Dinucleotide pAp.sub.sG (197 mOD, 7.27 μmol), 7-methylguanosine-5′-diphosphate P.sup.2-imidazolide m.sup.7GDP-Im.sup.[15] (10.0 mg, 18.2 μmol) and ZnCl.sub.2 (19.8 mg, 145 μmol) were dissolved in DMSO (145 μL) and the mixture was stirred at room temperature for 24 h. The reaction was quenched by addition of a solution of Na.sub.2EDTA (54 mg, 145 μmol) and NaHCO.sub.3 (27 mg, 321 μmol) in water (2.7 mL) and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-1.2 M TEAB) to afford after evaporation triethylammonium salt of m.sup.7GpppAp.sub.sG. The diastereomers were separated by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous CH.sub.3COONH.sub.4 buffer pH 5.9 to give after repeated freeze-drying from water ammonium salts of single diastereomers of m.sup.7GpppAp.sub.sG (D1: 42.5 mOD, 1.33 μmol; D2: 77.0 mOD, 2.41 μmol).

    [0084] m.sup.7GpppAp.sub.sG D1: RP-HPLC: R.sub.t=8.974 min*; HRMS ESI(−): m/z 1146.11093 (calcd. for C.sub.31H.sub.40N.sub.15O.sub.23P.sub.4S [M-H].sup.− 1146.10981);

    [0085] m.sup.7GpppAp.sub.sG D2: RP-HPLC: R.sub.t=9.662 min*; HRMS ESI(−): m/z 1146.11137 (calcd. for C.sub.31H.sub.40N.sub.15O.sub.23P.sub.4S [M-H].sup.− 1146.10981);

    [0086] *Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    Example 7: Synthesis of 5′-Phosphorothiolate Trinucleotide Cap Analogs (m.SUP.7.Gppp.SUP.5′S.ApG and m.SUP.7.Gppp.SUP.5′S.A.SUB.m.pG)

    [0087] Dinucleotide 5′-phosphorothiolate p.sup.5′SNpG, 7-methylguanosine-5′-diphosphate P.sup.2-imidazolide m.sup.7GDP-Im.sup.[15] (2 equivalents) and ZnCl.sub.2 (20 equivalents) were dissolved in DMSO (to 0.05 M of p.sup.5′SNpG) and the mixture was stirred at room temperature for 3 days. The reaction was quenched by addition of a solution of Na.sub.2EDTA (20 mg/mL; 20 equivalents) and NaHCO.sub.3 (10 mg/mL) in water and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-1.2 M TEAB) to afford after evaporation triethylammonium salt of m.sup.7Gppp.sup.5′SNpG. Additional purification by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous CH.sub.3COONH.sub.4 buffer pH 5.9 provided (after repeated freeze-drying from water) ammonium salts of m.sup.7Gppp.sup.5′SNpG.

    TABLE-US-00005 Synthesis RP scale Yield .sup.[a] HPLC .sup.[b] R.sub.t Compound [μmol] [μmol] [min] m/z.sub.calcd. m/z.sub.found m.sup.7Gppp.sup.5′SApG 15.9 1.22 6.393 1146.10981 1146.11080 m.sup.7Gppp.sup.5′SA.sub.mpG 10.5 1.17 7.353 1160.12546 1160.12658 .sup.[a] after RP HPLC; .sup.[b] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 15 min

    Example 8: Synthesis of α,β-Methylenebisphosphonate Trinucleotide Cap Analogs (m.SUP.7.GppCH.SUB.2.pApG, m.SUP.7.GppCH.SUB.2.pA.SUB.m.pG and m.SUP.7.GppCH.SUB.2.p.SUP.m6.ApG)

    [0088] Dinucleotide 5′-methylenebisphosphonate pCH.sub.2pNpG, 7-methylguanosine-5′-monophosphate P-imidazolide m.sup.7GMP-Im.sup.[15] (5 equivalents) and ZnCl.sub.2 (20 equivalents) were dissolved in DMSO (to 0.05 M of pCH.sub.2pNpG) and the mixture was stirred at room temperature for 24 h. The reaction was quenched by addition of a solution of Na.sub.2EDTA (20 mg/mL; 20 equivalents) and NaHCO.sub.3 (10 mg/mL) in water and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution 0-1.2 M TEAB) to afford after evaporation triethylammonium salt of m.sup.7GppCH.sub.2pNpG. Additional purification by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous CH.sub.3COONH.sub.4 buffer pH 5.9 provided (after repeated freeze-drying from water) ammonium salts of m.sup.7GppCH.sub.2pNpG.

    TABLE-US-00006 Synthesis RP scale Yield .sup.[a] HPLC .sup.[b] R.sub.t Compound [μmol] [μmol] [min] m/z.sub.calcd. m/z.sub.found m.sup.7GppCH.sub.2pApG 4.35 1.26 8.395 1128.15339 1128.15467 m.sup.7GppCH.sub.2pA.sub.mpG 12.7 10.8 9.973 1142.16904 1142.17023 m.sup.7GppCH.sub.2p.sup.m6ApG 8.78 4.53 9.721 1142.16904 1142.17006 .sup.[a] after RP HPLC; .sup.[b] Linear gradient elution: 0-50% MeOH in CH.sub.3COONH.sub.4 pH 5.9 in 30 min

    [0089] m.sup.7GppCH.sub.2pApG: RP-HPLC: R.sub.t=8.395 min; .sup.1H NMR (500 MHz, D.sub.2O, 25° C.): δ=9.14 (s, 1H, H8.sub.m7G), 8.47 (s, 1H, H8.sub.A), 8.18 (s, 1H, H2.sub.A), 7.95 (s, 1H, H8.sub.G), 5.96 (d, .sup.3J.sub.H,H=5.1 Hz, 1H, H1′.sub.A), 5.92 (d, .sup.3J.sub.H,H=3.4 Hz, 1H, H1′.sub.m7G), 5.81 (d, .sup.3J.sub.H,H=5.5 Hz, 1H, H1′.sub.G), 4.85-4.76 (m, overlapped with HDO, 1H, H3′.sub.A), 4.75 (m, 2H, H2′.sub.A, H2′.sub.G) 4.60 (m, 1H, H2′.sub.m7G), 4.52-4.46 (m, 3H, H3′.sub.G, H3′.sub.m7G, H4′.sub.A), 4.38-4.32 (m, 3H, H4′.sub.m7G, H4′.sub.G, H5′.sub.G), 4.30-4.11 (m, 5H, H5′.sub.A, H5.sub.A, H5″.sub.G, H5′.sub.m7G, H5.sub.m7G), 4.03 (s, 3H, N.sup.7—CH.sub.3), 2.41 (t, .sup.2J.sub.H,P=19.8 Hz, 2H, P—CH.sub.2—P) ppm; .sup.31P NMR (202.5 MHz, D.sub.2O, H.sub.3PO.sub.4, 25° C.): δ=17.8 (m, 1P, P.sub.α), 8.7 (m, 1P, P.sub.β), 0.3 (s, 1P, P.sub.G), −10.2 (d, .sup.2J.sub.P,P=26.8 Hz, 1P, P.sub.γ) ppm; HRMS ESI(−): m/z 1128.15467 (calcd for C.sub.32H.sub.42N.sub.15O.sub.23P.sub.4 [M-H].sup.− 1128.15339);

    [0090] m.sup.7GppCH.sub.2p(m.sup.6.sub.A)pG: RP-HPLC: R.sub.t=9.721 min; .sup.1H NMR (500 MHz, D.sub.2O, 25° C.): δ=9.09 (s, 1H, H8.sub.m7G), 8.30 (s, 1H, H8.sub.A), 8.06 (s, 1H, H2.sub.A), 7.88 (s, 1H, H8.sub.G), 5.91 (d, .sup.3J.sub.H,H=4.6 Hz, 1H, H1′.sub.A), 5.88 (d, .sup.3J.sub.H,H=3.1 Hz, 1H, H1′.sub.m7G), 5.78 (d, .sup.3J.sub.H,H=5.3 Hz, 1H, H1′.sub.G), 4.78-4.70 (m, 2H, H3′.sub.A, H2′.sub.A), 4.65 (dd, .sup.3J.sub.H,H=5.3 Hz, 3J.sub.H,H=5.3 Hz, 1H, H2′.sub.G), 4.55 (m, 1H, H2′.sub.m7G), 4.50 (m, 1H, H4′.sub.A), 4.47 (m, 1H, H3′.sub.G), 4.44 (m, 1H, H3′.sub.m7G), 4.38-4.15 (m, 8H, H4′.sub.m7G, H5′.sub.m7G, H4′.sub.G, H5′.sub.G, H5′.sub.A, H5″.sub.m7G, H5″.sub.A, H5″.sub.G), 3.99 (s, 3H, N.sup.7—CH.sub.3), 3.04 (s, 3H, N.sup.6—CH.sub.3) 2.41 (t, .sup.2J.sub.H,P=19.0 Hz, 2H, P—CH.sub.2—P) ppm; .sup.31P NMR (202.5 MHz, D20, H.sub.3PO.sub.4, 25° C.): δ=17.8 (m, 1P, P.sub.α), 8.7 (m, 1P, P.sub.β), 0.3 (s, 1P, P.sub.G), −10.2 (d, .sup.2J.sub.P,P=24.5 Hz, 1P, P.sub.γ) ppm; HRMS ESI(−): m/z 1142.17009 (calcd for C.sub.33H.sub.44N.sub.15O.sub.23P.sub.4 [M-H].sup.− 1142.16904);

    [0091] Biological Properties of the Compounds According to the Invention

    [0092] Transcripts incorporating at the 5′ end compounds according to the invention or benchmark (reference) compounds were obtained using in vitro transcription method in the presence of RNA polymerase T7 and DNA template containing the CD6.5 promoter sequence for this polymerase. In order to analyze the capping efficiency, short RNA transcripts were obtained as described in Example 9. The transcription yielding RNAs of 35 nt in length was carried out in the presence of selected compounds according to the invention or reference compounds representing state of the art and containing the same modifications of phosphate groups as the analyzed compounds according to the invention. The resulting RNAs were treated with DNAzyme 10-23 in order to shorten them and reduce 3′ end heterogeneity and analyzed in 15% polyacrylamide gel, which enabled separation of capped and uncapped RNAs. The results of this analysis were shown in FIG. 1. In order to analyze protein expression yield in mammalian cells, mRNAs carrying compounds according to the invention or reference compounds and encoding Gaussia luciferase as a reporter gene were obtained. The in vitro transcription reaction was performed under conditions described in Example 10. The resulting mRNAs were subsequently subjected to a procedure of enzymatic removal of the uncapped (5′-triphosphate) RNA as described in Example 10, followed by RP HPLC purification to remove double stranded RNA impurities as described in Example 12. The obtained mRNAs were introduced into mammalian cell lines (fibroblasts—3T3-L1 and dendritic cells—JAWS II) using transfection with lipofectamine, followed by measuring Gaussia luciferase expression in the extracellular medium at appropriate time intervals by the luminescence method as described in Example 13. The results of these experiments as a function of time are shown in FIG. 2 and FIG. 3. Additionally, in FIG. 4 and FIG. 5 depicted are the overall (total) Gaussia luciferase expression levels achieved during the whole experiment duration (88 h), being the sum of Gaussia luciferase expression levels achieved at particular timepoints.

    [0093] Moreover, for selected compounds according to the invention, protein expression levels in JAWSII cells were also determined for in vitro transcribed mRNAs, which were not subjected to enzymatic removal of uncapped RNA impurities. The mRNAs used in these experiments were prepared as described in Example 11, whereas their purification by HPLC method and protein expression analysis were carried out as described in examples 12 and 13, respectively. The results of these experiments were depicted in FIG. 6 and FIG. 7.

    Example 9: In Vitro Transcription of Short Capped RNAs and Capping Efficiency Analysis

    [0094] RNAs were generated on template of annealed oligonucleotides (CAGTAATACGACTCACTATAGGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA and TGATCGGCTATGGCTGGCCGCATGCCCGCTTCCCCTATAGTGAGTCGTATTACTG) [16], which contains T7 promoter sequence (TAATACGACTCACTATA) and encodes 35-nt long sequence (GGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA). Typical in vitro transcription reaction (20 μl) was incubated at 37° C. for 2 h and contained: RNA Pol buffer (40 mM Tris-HCl pH 7.9, 10 mM MgCl.sub.2, 1 mM DTT, 2 mM spermidine), 10 U/μl T7 RNA polymerase (ThermoFisher Scientific), 1 U/μl RiboLock RNase Inhibitor (ThermoFisher Scientific), 2 mM ATP/CTP/UTP, 0.5 mM GTP, 2.5 mM cap analog of interests and 0.8 μM annealed oligonucleotides as a template. Following 2 h incubation, 1 U/μl DNase I (ThermoFisher Scientific) was added and incubation was continued for 30 min at 37° C. In order to generate homogenous 3′-ends in those RNAs, the transcripts (1 μM) were incubated with 1 μM DNAzyme 10-23 (TGATCGGCTAGGCTAGCTACAACGAGGCTGGCCGC) in 50 mM MgCl.sub.2 and 50 mM Tris-HCl pH 8.0 for 1 h at 37° C. [16], which allowed to produce 3′-homogenous 25-nt RNAs. The transcripts were precipitated with ethanol and treated with DNase I in order to remove DNAzyme. Concentration of transcripts was determined spectrophotometrically. Capping efficiency of obtained RNAs was checked on 15% acrylamide/7 M urea gels.

    Example 10: In Vitro Transcription of Capped mRNA with Subsequent Removal of RNAs

    [0095] Terminated with 5′-Triphosphate mRNAs encoding Gaussia luciferase were generated on template of pJET_T7_Gluc_128A plasmid digested with restriction enzyme AarI (ThermoFisher Scientifics). The plasmid was obtained by cloning the T7 promoter sequence and coding sequence of Gaussia luciferase into pJET_luc_128A.[12] aTypical in vitro transcription reaction (20 μl) was incubated at 37° C. for 2 h and contained: RNA Pol buffer (40 mM Tris-HCl pH 7.9, 10 mM MgCl.sub.2, 1 mM DTT, 2 mM spermidine), 10 U/μl T7 RNA polymerase, 1 U/μl RiboLock RNase Inhibitor, 2 mM ATP/CTP/UTP, 0.5 mM GTP, 3 mM cap analog of interest and 50 ng/μl digested plasmid as a template. Following 2 h incubation, 1 U/μl DNase I was added and incubation was continued for 30 min at 37° C. The crude mRNAs were purified with NucleoSpin RNA Clean-up XS (Macherey-Nagel). Quality of transcripts was checked on native 1.2% 1×TBE agarose gel, whereas concentration was determined spectrophotometrically. To remove uncapped RNA, transcripts were treated with 5′-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs). Briefly, mRNAs were incubated with 5′-polyphosphatase (20 U/5 μg of mRNA) in dedicated buffer for 30 min at 37° C., then mRNAs were purified with NucleoSpin RNA Clean-up XS. Purified mRNAs were subjected to incubation with Xrn-1 (1 U/1 μg of mRNA) in dedicated buffer for 60 min at 37° C., then mRNAs were purified with NucleoSpin RNA Clean-up XS.

    Example 11: In Vitro Transcription of Capped mRNA without Subsequent Removal of RNAs Terminated with 5′-Triphosphate

    [0096] mRNAs encoding Gaussia luciferase were generated on template of pJET_T7_Gluc_128.sub.A plasmid digested with restriction enzyme AarI (ThermoFisher Scientifics). The plasmid was obtained by cloning the T7 promoter sequence and coding sequence of Gaussia luciferase into pJET_luc_128A.[12] Typical in vitro transcription reaction (20 μl) was incubated at 37° C. for 2 h and contained: RNA Pol buffer (40 mM Tris-HCl pH 7.9, 10 mM MgCl.sub.2, 1 mM DTT, 2 mM spermidine), 10 U/μl T7 RNA polymerase, 1 U/μl RiboLock RNase Inhibitor, 2 mM ATP/CTP/UTP, 0.5 mM GTP, 3 mM cap analog of interest and 50 ng/μl digested plasmid as a template. Following 2 h incubation, 1 U/μl DNase I was added and incubation was continued for 30 min at 37° C. The crude mRNAs were purified with NucleoSpin RNA Clean-up XS (Macherey-Nagel). Quality of transcripts was checked on native 1.2% 1×TBE agarose gel, whereas concentration was determined spectrophotometrically.

    Example 12: Purification of Capped mRNA Using HPLC

    [0097] mRNAs were purified on Agilent Technologies Series 1200 HPLC using RNASep™ Prep—RNA Purification Column (ADS Biotec) at 55° C. as described in [11]. For mRNA purification a linear gradient of buffer B (0.1 M triethylammonium acetate pH 7.0 and 25% acetonitrile) from 35% to 55% in buffer A (0.1 M triethylammonium acetate pH 7.0) over 22 min at 0.9 ml/min was applied. mRNAs was recovered from collected fractions by precipitation with isopropanol. Quality of transcripts was checked on native 1.2% 1×TBE agarose gel, whereas concentration was determined spectrophotometrically.

    Example 13: Protein Expression Analysis

    [0098] 3T3-L1 (murine embryo fibroblast-like cells, ATCC CL-173) were grown in DMEM (Gibco) supplemented with 10% FBS (Sigma), GlutaMAX (Gibco) and 1% penicillin/streptomycin (Gibco) at 5% CO.sub.2 and 37° C. Murine immature dendritic cell line JAWS II (ATCC CRL-11904) was grown in RPMI 1640 (Gibco) supplemented with 10% FBS, sodium pyruvate (Gibco), 1% penicillin/streptomycin and 5 ng/ml GM-CSF (PeproTech) at 5% CO.sub.2 and 37° C. In a typical experiment, 104 of JAWS II cells and 4-103 of 3T3-L1 cells were seeded at the day of transfection in 100 μl medium without antibiotics per well of 96-well plate. Cells in each well were transfected for 16 h using a mixture of 0.3 μl Lipofectamine MessengerMAX Transfection Reagent (Invitrogen) and 25 ng mRNA in 10 μl Opti-MEM (Gibco). In order to assess Gaussia luciferase expression at multiple time points, medium was fully removed and replaced with the fresh one at each time point. To detect luminescence from Gaussia luciferase, 50 μl of 10 ng/ml h-coelenterazine (NanoLight) in PBS was added to 10 μl of cell cultured medium and the luminescence was measured on Synergy H1 (BioTek) microplate reader.

    CONCLUSIONS

    [0099] Examples 1-8 describe methods for obtaining trinucleotide cap analogs according to the inventon. The inventions covered by the claims, the synthesis of which has not been described in examples, can be obtained by methods identical or very similar to those exemplified.

    [0100] Example 9 describes the method of performing capping efficiency analysis for RNAs obtained using the compounds accroding to the invention and comparing them with reference compounds representing state of the art. The results of the analysis indicate that in the case of trinucleotide cap analogs, used at fivefold excess over GTP, the capping efficiencies are significantly higher than in the case of dinucleotide cap analogs containing the same type of modifications and used at the same excess. As shown in FIG. 1 application of trinucleotide cap analogs enables increase of the incorporation efficiency into mRNA for triphosphate chain modifications of the cap. Moreover, the incorporation of triphosphate chain modifications using the trinucleotide cap analogs does not require the application of additional modifications of ARCA type (e.g. methylations of the 2′-O or 3′-O positions of 7-mehtylguanosine).

    [0101] Examples 10, 11, 12 and 13 describe the approach to analyzing protein expression in mammalian cells from mRNAs according to the invention obtained with the use of compounds according to the invention. The analysis was performed in two cell lines representing cells of different origins (fibroblasts—3T3-L1 and dendritic cells—JAWS II) in two variants: (i) mRNA treated enzymatically to remove capped mRNA impurities (FIGS. 2, 3, 4 and 5) and (ii) enzymatically untreated mRNA (FIGS. 6 and 7). Each mRNA obtained with the use of compounds according to the invention showed higher protein expression compared to cap analogs representing the state of the art in at least one of the studied variants. Achieving augmented protein expression has found many applications in biotechnology and production of biopharmaceutics (production of recombinant proteins) as well as in mRNA based gene therapies. Increased protein expression in dendritic cells is particularly beneficial for applications in anti-cancer therapeutic vaccines. Augmented protein expression in cells derived from other tissues (lung, liver, other organs) is particularly beneficial in the case of gene replacement therapeutic applications..sup.[18] It can be expected that achieving the therapeutic effect for mRNAs according to the invention obtained with the use of compounds according to the invention will be possible at lower mRNA concentrations then in the case of mRNAs obtained using state of the art methods. Lowering the mRNA dose implicates lower risk of side effects related to toxicity of the therapy, and thereby increases the probability of therapeutic success.

    REFERENCES

    [0102] 1. Moore, M., From birth to death: The complex lives of eukaryotic mRNAs. Science 2005, 309 (5740), 1514-1518. [0103] 2. Ziemniak, M.; Strenkowska, M.; Kowalska, J.; Jemielity, J., Potential therapeutic applications of RNA cap analogs. Future Medicinal Chemistry 2013, 5 (10), 1141-1172. [0104] 3. Grudzien-Nogalska, E.; Stepinski, J.; Jemielity, J.; Zuberek, J.; Stolarski, R.; Rhoads, R. E.; Darzynkiewicz, E., Synthesis of anti-reverse cap analogs (ARCAs) and their applications in mRNA translation and stability. Translation Initiation: Cell Biology, High-Throughput Methods, and Chemical-Based Approaches 2007, 431, 203-227. [0105] 4. Sahin, U.; Kariko, K.; Tureci, O., mRNA-based therapeutics—developing a new class of drugs. Nature Reviews Drug Discovery 2014, 13 (10), 759-780. [0106] 5. Stepinski, J.; Waddell, C.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Synthesis and properties of mRNAs containing the novel “anti-reverse” cap analogs 7-methyl(3′-O-methyl)GpppG and 7-methyl(3′-deoxy)GpppG. Rna—a Publication of the Rna Society 2001, 7 (10), 1486-1495. [0107] 6. Jemielity, J.; Fowler, T.; Zuberek, J.; Stepinski, J.; Lewdorowicz, M.; Niedzwiecka, A.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Novel “anti-reverse” cap analogs with superior translational properties. Rna—a Publication of the Rna Society 2003, 9 (9), 1108-1122. [0108] 7. Jemielity, J.; Kowalska, J.; Rydzik, A. M.; Darzynkiewicz, E., Synthetic mRNA cap analogs with a modified triphosphate bridge—synthesis, applications and prospects. New Journal of Chemistry 2010, 34 (5), 829-844. [0109] 8. Grudzien-Nogalska, E.; Jemielity, J.; Kowalska, J.; Darzynkiewicz, E.; Rhoads, R. E., Phosphorothioate cap analogs stabilize mRNA and increase translational efficiency in mammalian cells. Rna—a Publication of the Rna Society 2007, 13 (10), 1745-1755. [0110] 9. Kuhn, A. N.; Diken, M.; Kreiter, S.; Selmi, A.; Kowalska, J.; Jemielity, J.; Darzynkiewicz, E.; Huber, C.; Tureci, O.; Sahin, U., Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo. Gene Therapy 2010, 17 (8), 961-971. [0111] 10. Grudzien, E.; Kalek, M.; Jemielity, J.; Darzynkiewicz, E.; Rhoads, R. E., Differential inhibition of mRNA degradation pathways by novel cap analogs. Journal of Biological Chemistry 2006, 281 (4), 1857-1867. [0112] 11. Katalin Karikó, Hiromi Muramatsu, János Ludwig, Drew Weissman, Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA, Nucleic Acids Research, Vol. 39, Issue 21, 1 Nov. 2011, 142. [0113] 12. Sikorski, Pawel J; Warminski, Marcin; Kubacka, Dorota; Ratajczak, Tomasz; Nowis, Dominika; Kowalska, Joanna; Jemielity, Jacek; The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5′ cap modulates protein expression in living cells. Nucleic Acids Research 2020, 305-1048. [0114] 13. M. Warminski et al. Journal of the American Chemical Society 2018, 140, 5987-5999. [0115] 14. M. Kalek, J. Jemielity, J. Stepinski, R. Stolarski, E. Darzynkiewicz, Tetrahedron Letters 2005, 46, 2417-2421. [0116] 15. J. Kowalska et al. RNA 2008, 14, 1119-1131. [0117] 16. Coleman, T., Wang, G. and Huang, F. (2004) Superior 5′ homogeneity of RNA from ATP-initiated transcription under the T7 phi 2.5 promoter. Nucleic Acids Research, 32:e14 [0118] 17. Norbert Pardi, Michael J. Hogan, Frederick W. Porter, Drew Weissman, N. Nature Reviews Drug Discovery vol. 17, 261-279 (2018). [0119] 18. Berraondo P, Martini P G V, Avila M A, et al Messenger RNA therapy for rare genetic metabolic diseases Gut 2019; 68:1323-1330. [0120] 19. Jin Wanga et. al., Nucleic Acids Research, Volume 47, Issue 20, 18 Nov. 2019, [0121] 20. Masahide Ishikawa, Ryuta Murai, Hiroyuki Hagiwara, Tetsuya Hoshino, Kamui Suyama, Nucleic Acids Symposium Series, Volume 53, Issue 1, September-October 2009, Pages 129-130. [0122] 21. Anand Ramanathan, G. Brett Robb, Siu-Hong Chan, Nucleic Acids Research, Volume 44, Issue 16, 19 Sep. 2016, Pages 7511-7526, [0123] 22. Pawel J Sikorski, Marcin Warminski, Dorota Kubacka, Tomasz Ratajczak, Dominika Nowis, Joanna Kowalska, Jacek Jemielity, Nucleic Acids Research, Volume 48, Issue 4, 28 Feb. 2020, Pages 1607-1626, [0124] 23. Sylwia Walczak et al., Chem. Sci., 2017, 8, 260-267. [0125] 24. U.S. Pat. No. 7,074,596B2 [0126] 25. E. Grudzien Nogalska et al., Methods in Enzymology, Vol. 431, 2007, Pages 203-227. [0127] 26. Anna Maria Rydzik et. al., Organic & Biomolecular Chemistry, Issue 22, 2009. [0128] 27. M. Kalek et al., Bioorganic & Medicinal Chemistry, Vol. 14, Issue 9, 1 May 2006, Pages 3223-3230 [0129] 28. J. Kowalska et. al. (2009), Phosphoroselenoate Dinucleotides for Modification of mRNA 5′ End. ChemBioChem, 10: 2469-2473. [0130] 29. J. Kowalska, et. al., Nucleic Acids Research, Volume 42, Issue 16, 15 Sep. 2014, Pages 10245-10264, [0131] 30. A. Rydzik et. al., Nucleic Acids Research, Volume 45, Issue 15, 6 Sep. 2017, Pages 8661-8675,