Use of citronellol in preparing preparation for promoting expression of virulence gene <i>Toxa </i>of <i>Pseudomonas aeruginosa</i>

Abstract

A use of citronellol in preparing a preparation for promoting an expression of a virulence gene toxA of Pseudomonas aeruginosa is disclosed. It was found that citronellol slightly inhibits the growth of a Pseudomonas aeruginosa PAO1 strain and can promote the transcription of the toxA of Pseudomonas aeruginosa, which can increase the yield of an exotoxin A, namely, an encoded product of toxA. Therefore, citronellol is applicable to the preparation of a preparation for promoting the expression of the virulence gene toxA of Pseudomonas aeruginosa.

Claims

1. A method of using citronellol to promote expression of a virulence gene toxA in Pseudomonas aeruginosa, comprising: preparing a liquid LB culture medium with citronellol, wherein the concentration of the citronellol in the culture medium is 1.25 μL/mL; inoculating the medium with a bacterial suspension of Pseudomonas aeruginosa in the exponential growth phase, wherein the expression of the virulence gene toxA results in production of an exotoxin A in the Pseudomonas aeruginosa; up-regulating expression of a signaling molecule synthase gene lasI and a signaling molecule receptor protein gene lasR of a las system; up-regulating expression of a signaling molecule receptor protein gene rhIR in a rhI system; inhibiting expression of a signaling molecule synthase gene pqsA and a signaling molecule receptor protein gene pqsR of a pqs system; and inhibiting expression of virulence genes lasB, phzM, chiC and psIB.

2. The method of using citronellol to promote expression of a virulence gene toxA in Pseudomonas aeruginosa according to claim 1, wherein the Pseudomonas aeruginosa is the strain Pseudomonas aeruginosa PAO1.

3. The method of using citronellol to promote expression of a virulence gene toxA in Pseudomonas aeruginosa according to claim 1, wherein the citronellol is p-citronellol.

4. The method according to claim 2, wherein the citronellol is β-citronellol.

5. The method of using citronellol to promote expression of a virulence gene toxA in Pseudomonas aeruginosa according to claim 1, further comprising: incubating the bacterial suspension together with the citronellol; and collecting the expressed exotoxin A from the culture medium.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows growth curves of Pseudomonas aeruginosa PAO1 under the action of citronellol; and

(2) FIG. 2 shows effects of citronellol on the expressions of key genes of a quorum-sensing system of Pseudomonas aeruginosa and virulence genes regulated thereby.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(3) The embodiments below are intended to further explain the present invention, instead of limiting the present invention.

Embodiment 1

(4) Preparation of PAO1[(Pseudomonas aeruginosa) PAO1] bacterial suspension: a culture solution of Pseudomonas aeruginosa PAO1 in an exponential growth phase was sampled, centrifuged, washed once with a PBS buffer, resuspended in PBS, and diluted to 10.sup.8 CFU/mL to obtain the PAO1 bacterial suspension.

(5) 1. Experiment on effects of citronellol on the growth of Pseudomonas aeruginosa PAO1

(6) An LB culture medium and citronellol (0-citronellol) were added to test tubes respectively, and the PAO1 bacterial suspension in the exponential growth phase was inoculated to reach a total volume of 10 mL respectively. The bacterial concentration of PAO1 was each 10.sup.6′ CFU/mL, and the concentration of citronellol was 0 (control), 0.313 μL/mL, 0.625 μL/mL, 1.25 μL/mL, and 2.5 μL/mL, respectively. Samples from several test groups were added to a honeycomb culture plate dedicated to an automatic growth curve analyzer (Bioscreen C), and 350 μL of culture solution was added to each well, with three parallel for each test group. The honeycomb culture plate was placed in the automatic growth curve analyzer, and cultured over shaking at 37° C. for 3 days, and OD.sub.600 was measured every hour. Taking OD.sub.600 as the ordinate and a culture time as the abscissa, the growth curve of PAO1 under the action of citronellol was drawn to study the effect of the citronellol on the growth of PAO1. The results were shown as in FIG. 1.

(7) 2. Experiment on effects of citronellol on the expression of key genes in a quorum-sensing system of Pseudomonas aeruginosa and virulence genes regulated thereby

(8) The PAO1 bacterial suspension in a logarithmic growth phase was added to 50 mL of sterile LB liquid culture medium to reach a final concentration of 10.sup.6 CFU/mL for the bacterial solution. Citronellol (β-citronellol) was added to reach the final concentrations of 0 (three biological replicates in the control group were named A1, A2, and A3, respectively) and 1.25 μL/mL (three biological replicates in the test groups were named B1, B2, B3). Each group was cultured at 37° C. and 180 rpm for 5 h, and centrifuged to collect bacteria, which were then quick-frozen at −80° C. for later use.

(9) Total RNAs were extracted from the bacteria by a Trizol (Thermo Fisher Scientific) kit.

(10) After extraction, the purity of the RNAs were detected with an ultra-micro spectrophotometer (Implen, Munich, Germany). An A260/A280 value of each RNA sample should be between 1.8 and 2.0. Reverse transcription and real-time fluorescent quantitative PCR amplification were carried out by using a PrimeScript RT Master Mix kit (Takara, Dalian, China) and an ETC 811 PCR instrument (Eastwin Life Sciences, Inc.). A q-PCR reaction system included Takara SYBR Premix Ex TaqII (Tli RNaseH Plus) (Code No. RR820A), and PCR procedures included: pre-denaturation at 95° C. for 30 s; and denaturation at 95° C. for 5 s and annealing at 60° C. for 34 s, 40 cycles. Based on 10 gene sequences published on the website of GenBank, primers for q-PCR were designed by using software Primer Premier 5.0, and at the same time, a 16S rRNA gene was used as an internal reference gene. The primer sequence parameters are shown in Table 1.

(11) TABLE-US-00001 TABLE 1 Genes and printer sequences thereof used in real-time fluorescent quantitative PCR SEQ ID Gene name Locus Gene description Primer sequences (5′.fwdarw.3′) NO: 16S rRNA PA5369.5 16S ribosomal RNA GCGCAACCCTTGTCCTTAGTT (F) 1 TGTCACCGGCAGTCTCCTTAG (R) 2 lasI PA1432 Acyl-homoserine-lactone synthase TGCGTGCTCAAGTGTTCAAGG (F) 3 CGGCTGAGTTCCCAGATGTGC (R) 4 lasR PA1430 Transcriptional regulator LasR GACCAGTTGGGAGATATCGGTTA (F) 5 TCCGCCGAATATTTCCCATA (R) 6 rhlI PA3476 Acyl-homoserine-lactone synthase AAACCCGCTACATCGTCGC (F) 7 TCTCGCCCTTGACCTTCTGC (R) 8 rhlR PA3477 Transcriptional regulator RhlR ATCGCCATCATCCTGAGCATT (F) 9 TCGGAGGACATACCAGCACAC (R) 10 pqsA PA0996 Anthranilate-CoA ligase GCAATACACCTCGGGTTCCA (F) 11 TCCGCTGAACCAGGGAAAGA (R) 12 pqsR PA1003 Transcriptional regulator TCGTTCTGCGATACGGTGAG (F) 13 GCACTGGTTGAAGCGGGAG (R) 14 lasA PA1871 Protease LasA GCCGCTGAATGACGACCTGT (F) 15 TCAGGGTCAGCAACACTT (R) 16 lasB PA3724 Elastase LasB AAGGCCTTGCGGGTATCC (F) 17 CGTGTACAACCGTGCGTTCT (R) 18 phzM PA4209 Phenazine-specific GAATGGAAGTCCCGTTGC (F) 19 methyltransferase GCCCTCGACATCCCTCA (R) 20 chiC PA2300 Chitinase CTGGGAGTTCCGCAAGCGTTAC (F) 21 ATCGGTGGCGGTGACGAAATAG (R) 22 toxA PA1148 Exotoxin A CCCGGCGAAGCATGAC (R) 23 GGGAAATGCAGGCGATGA (R) 24 pslB PA2232 Biofilm formation protein PslB CAACGAATCCACCTTCATCC (F) 25 ACTCGCCGCTCTGTACCTC (R) 26
Experimental Results:

(12) The results on the growth curves of Pseudomonas aeruginosa PAO1 under the action of citronellol at different concentrations are shown in FIG. 1. The experimental results show that the growth of strains is slightly inhibited after PAO1 cells are treated with the citronellol. The citronellol treatment groups at different concentrations exhibit no significant difference in a lag phase and a logarithmic growth phase on the PAO1 growth curves, but have a certain effect on a stable phase and a decay phase. It can be seen from the graph that the time points when the absorbance values of the culture solutions in the treatment groups at different concentrations differ greatly: 26 h for the treatment group at 0.313 μL/mL, 37 h for the treatment group at 0.625 μL/mL, 39 h for the treatment group at 1.25 μL/mL, and 48 h for the treatment group at 2.5 μL/mL. The higher the concentration of the citronellol, the longer the time for the absorbance value of the culture solution to reach the maximum value, and the longer the stable phase. The citronellol at 0.313, 0.625, 1.25 and 2.5 μL/mL shows a certain yet weak inhibitory effect on the growth of PAO1. Therefore, citronellol slightly inhibits the growth of PAO1.

(13) FIG. 2 shows changes in the expression levels of key genes in the quorum-sensing system of PAO1 cells and virulence genes associated therewith after these cells are treated with 1.25 μL/mL citronellol for 5 h. The expressions of a signaling molecule synthase gene lasI and a signaling molecule receptor protein gene lasR of a las system are significantly up-regulated. The transcription levels of a signaling molecule receptor protein gene rhIR in a rhI system is also significantly up-regulated, but the transcription level of a signaling molecule synthase gene rhII changes a little. The expressions of a signaling molecule synthase gene pgsA and a signaling molecule receptor protein gene pqsR of a pqs system are both significantly down-regulated. The transcriptions of virulence genes lasB, phzM, chiC and psIB are all inhibited by the citronellol; the transcription level of toxA was significantly up-regulated; and the transcription level of lasA is also up-regulated, but with a less significant change. Therefore, the citronellol promotes the transcription of Pseudomonas aeruginosa toxA.

(14) In summary, the experimental results demonstrate that the citronellol slightly inhibits the growth of Pseudomonas aeruginosa PAO1 strains (FIG. 1), and can promote the transcription of Pseudomonas aeruginosa toxA (FIG. 2), which improves the yield of the exotoxin A, namely, the encoded product of toxA.