HYDROGEL MICRONEEDLES FOR BIOSENSING
20230363713 · 2023-11-16
Inventors
- Mahla Poudineh (Waterloo, CA)
- Amin Ghavami Nejad (Toronto, CA)
- HANJIA ZHENG (WATERLOO, CA)
- FATEMEH KEYVANI (WATERLOO, CA)
Cpc classification
International classification
A61B5/00
HUMAN NECESSITIES
Abstract
Microneedles for detecting targets are described. The microneedles may be made of a hydrogel and a probe coupled to the hydrogel for generating a measurable signal in the presence of the target. The hydrogel microneedles may be used for in-situ detection of targets, such as biomolecules found in interstitial fluid. Also described are methods or producing hydrogel microneedles, articles and apparatus comprising hydrogel microneedles, and methods and uses of the same. The hydrogel microneedles may be used for biosensing, such as in transdermal patches for detecting biomarkers in a subject. The biosensors may be used for continuous, real-time tracking of targets in-situ, without requiring further reagents or processing steps.
Claims
1. A microneedle for detecting a target, the microneedle comprising: a hydrogel; a probe coupled to the hydrogel, the probe for generating a measurable signal in the presence of the target.
2. The microneedle of claim 1, wherein the hydrogel comprises a polymer comprising at least one C═C functionality; an acrylated polymer, a methacrylated polymer, or a combination thereof; and/or methacrylated gelatin, methacrylated hyaluronic acid, methacrylated alginate, methacrylated chitosan, methacrylated collagen, methacrylated polyethylene glycol, methacrylated polyvinyl alcohol, methacrylated polylysine, or a combination thereof.
3. The microneedle of claim 1, wherein the hydrogel further comprises a conductive polymer, an ionomer, or a combination thereof; or poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof.
4. The microneedle of claim 1, wherein the probe coupled to the hydrogel comprises the probe being coupled to the hydrogel by covalent bonding, intermolecular bonding, physisorption, complexation, a linker; or a combination thereof.
5. The microneedle of claim 1, wherein the probe comprises a nucleic acid, wherein the nucleic acid is an nucleic acid that binds to the target; and wherein the nucleic acid optionally comprises an aptamer, single stranded complementary probe DNA, peptide nucleic acid, nucleic acid enzyme, or combinations thereof.
6. The microneedle of claim 5, wherein the nucleic acid comprises a linker functional group for coupling the probe to the hydrogel.
7. The microneedle of claim 6, wherein the linker functional group comprises a phosphoramidite functional group; or an acrydite functional group.
8. The microneedle of claim 1, wherein the probe comprises a fluorophore; or an electroactive species, a redox active species, or a combination thereof.
9. The microneedle of claim 1, wherein the probe comprises a nucleic acid, and the nucleic acid comprises a fluorophore or is linked to a fluorophore, or the nucleic acid comprises a redox reporter or is linked to a redox reporter.
10. The microneedle of claim 1, wherein the probe further comprises a quencher, and the probe is optionally reversibly bound to a quencher, or is optionally tethered to the quencher via covalent bonding, intermolecular bonding, physical adsorption, conjugation, or a combination thereof.
11. The microneedle of claim 10, wherein the probe comprises a nucleic acid and the quencher comprises a sequence partially or fully complimentary to at least a portion of the nucleic acid sequence.
12. The microneedle of claim 10, wherein the probe comprises a nucleic acid and the quencher comprises a graphene-based material, wherein the graphene-based material optionally comprises graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof.
13. The microneedle of claim 1, wherein the measurable signal is fluorescence; or an electrochemical signal.
14. The microneedle of claim 1, wherein the target comprises a biomolecule present in interstitial fluid.
15. The microneedle of claim 14, wherein the target comprises small biomolecules, proteins, or micro ribonucleic acids; or cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNA miR21, micro-RNA miR210, uric acid (UA), serotonin, insulin, adenosine triphosphate, or glucose.
16. The microneedle of claim 1, wherein the microneedle has a length of about 300 μm to about 1000 μm, such as about 800 μm.
17. The microneedle of claim 1, further comprising a conductive material, wherein the conductive material optionally comprises a metal nanoparticle, graphene-based material, conductive polymer, or an ionomer, or a combination thereof.
18. A method of producing a microneedle, the method comprising: combining a functionalized hydrogel, a probe precursor, optionally a conductive material, and a crosslinking agent in a mold; and exposing the mixture in the mold to UV light to link at least a portion of the probe to the functionalized hydrogel and to form a crosslinked material..
19. The method of claim 18, further comprising: removing the crosslinked material from the mold; and further exposing the unmolded crosslinked material to UV light.
20. The method of claim 18, wherein combining the functionalized hydrogel, the probe precursor, optionally a conductive material, and the crosslinking agent in the mold comprises: dissolving about 50:1 to about 10:1 (wt/wt) of functionalized hydrogel:crosslinking agent in a buffer to form a functionalized hydrogel solution; optionally adding a conductive material to the functionalized hydrogel solution; optionally degassing the functionalized hydrogel solution; adding the functionalized hydrogel solution to the mold; partially drying the functionalized hydrogel solution in the mold; optionally, adding further functionalized hydrogel solution to the mold; adding the probe precursor to the mold; and optionally, drying the mixture in the mold further.
21. The method of claim 18, wherein the probe precursor comprises a solution of nucleic acid and optionally a quencher.
22. The method of claim 18, wherein exposing the mixture in the mold to UV light comprises exposing the mixture to light of about 200 nm to about 400 nm, preferably about 360 nm light; and preferably for about 1 min to about 1 hour, such as about 10 to about 20 min.
23. The method of claim 18, wherein the hydrogel comprises hyaluronic acid; and functionalizing functionalizing the hydrogel comprises reacting hyaluronic acid with methacrylic anhydride to form methacrylated hyaluronic acid.
24. The method of claim 18, wherein the optional conductive material comprises metal nanoparticles, graphene-based material, or a conductive polymer or ionomer, such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate, polyacetylene, polypyrrole, polyindole, polyaniline, or copolymers thereof.
25. The method of claim 18, wherein the mold is a negative polydimethylsiloxane mold.
26. An apparatus for detecting a target in a sample, the apparatus comprising: the microneedle according to claim 1; and a detector for detecting the measurable signal.
27. A transdermal patch comprising the microneedle according to claim 1.
28. A method for transdermal biosensing of a target in a subject, the method comprising: applying the transdermal patch according to claim 27; detecting the measurable signal; and associating the measurable signal to the concentration of the target in the subject.
29. The method of claim 28, wherein detecting the measurable signal is reagentless.
30. The method of claim 28, wherein detecting the measurable signal comprises measuring the fluorescence intensity of the probe; or measuring an electrochemical signal.
31. The method of claim 28, wherein associating the measurable signal comprises comparing a measured intensity of the measurable signal to a calibration curve of measured intensities of known concentrations of the target.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0086] Embodiments of the present disclosure will now be described, by way of example only, with reference to the attached Figures.
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
DETAILED DESCRIPTION
[0114] Analyzing interstitial fluid (ISF) via microneedle (MN) devices can enable patient health monitoring in a minimally invasive manner and at point-of-care settings. However, most MN-based diagnostic approaches require complicated fabrication processes or post-processing of the extracted ISF. Described herein is an in situ and on-needle measurement of target analytes performed by integrating hydrogel microneedles (HMN) with nucleic acid probes (e.g., aptamer probes, pDNA probes) as the target recognition elements.
[0115] In one example, fluorescently tagged aptamer probes are chemically attached to a hydrogel matrix while a crosslinked patch is formed. In another example, fluorophore-modified nucleic acid (e.g., apatmers, probe DNA) are immobilized on or tethered to a quencher (e.g., graphene-based quencher), and the probe (comprising the nucleic acid and further comprising the quencher) is coupled to a hydrogel matrix via intermolecular interactions, such as hydrogen bonding.
[0116] In another example, the HMNs described herein are capable of continuous electrochemical measurement via integration with a probe that comprises a redox reporter, and a conductive material that communicates electrochemical signals through the hydrogel. In an example, the conductive material comprises conductive polymer poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS)—which, when integrated into a hydrogel network, can boost the electrical properties of the HMN, making the HMN suitable for use as a working electrode.
[0117] This system may improve the quality of life of patients who are in need of close monitoring of biomarkers of health and disease. The HMNs described herein can enable rapid and reagentless target detection of targets such as glucose, ATP, uric acid, serotonin, insulin, cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNAs such as miR21 and miR210.
[0118] In an example, to demonstrate the effectiveness of such a system, an assay may be used for specific and sensitive quantification of glucose concentrations in an animal model of diabetes to track hypoglycemia, euglycemia, and hyperglycemia conditions. The assay may track the rising and falling concentrations of glucose and the extracted measurements closely match those from the gold standard techniques. The assay can enable rapid and reagentless target detection and can be readily modified to measure other target analytes in vivo, such as glucose, ATP, uric acid, serotonin, insulin, cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNAs such as miR21 and miR210.
[0119] In one or more embodiments, the present disclosure provides a continuous and real-time biosensor that can provide insight into the health status of patients, and their response to therapeutics, in a non- or minimally invasive manner, which may enable health care systems to provide personalized and precision medicine. In one or more embodiments example, a Microneedle Aptamer-assisted Detector was developed and is described herein for minimally Invasive and Continuous Tracking, or MADICT, to address challenges in real-time biosensing. In one or more embodiments example, the Microneedle Detector may be a nucleic acid-assisted microneedle detector. In one or more embodiments, the MADICT may form the basis for a universal platform for multiplexed, rapid and in-line measurement of any target molecules in interstitial fluid (ISF). In one or more embodiments, the MADICT may comprise three main components: 1) Hydrogel microneedles (HMNs) for ISF extraction; 2) nucleic acid probes (e.g., aptamer probes, pDNA probes) for sensitive target detection; and 3) a semiconductor integrated chip (IC) and supporting electronics for miniaturized electrochemical measurement and wireless transmission of data.
[0120] Upon insertion into skin, the HMNs can rapidly swell once in contact with ISF, which facilitates a continuous diffusion of target molecules into the patch's needles, which are functionalized with the nucleic acid probes (e.g., aptamer probe, pDNA probe) that are a main component of the real-time biosensor. In one or more embodiments, the HMNs can also act as a working electrode (WE). In one or more embodiments, the HMNs can also act as a working electrode (WE) with the integration of a conductive material and a redox reporter coupled or linked to the probe, such as a nucleic acid probe (e.g., aptamer probes, pDNA probes). In one or more embodiments, incorporation of a conductive polymer, such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS), into the hydrogel network may improve the electrical properties of the HMNs, making the MNs according to one or more embodiments suitable for use as a working electrode in a biosensor.
[0121] The nucleic acid probes (e.g., aptamer probes, pDNA probes) can switch their conformation upon specific target binding. Non-specific binding of background chemicals do not appear to cause the nucleic acid probes (e.g., aptamer probes, pDNA probes) to switch its conformation, as the probe has only been observed responding to the binding of the target even when the background concentration is many orders of magnitude higher. This feature enables the presently described sensor to operate continuously in complex mixtures without sample preparation or added reagents.
[0122] The requirements for continuous tracking are challenging and the field faces specific problems. Some challenges presently faced include: the biosensor preferably does not use any batch processing, such as wash steps or addition of reagents; the detection mechanism should be generalizable to a wide range of targets; the sensing scheme should have adequate sensitivity, specificity and dynamic range in a short time-scale; biosensors preferably use simple instrumentation for point-of-care (POC) implementation; and finally, the biosensor should remain stable even after prolonged exposure to complex biological environments.
[0123] Continuous biosensing has revolutionized diabetes care through enabling continuous glucose measurement, however, the molecular based real-time biosensors are mainly limited to the enzymatic detection of a handful of biomolecules such as glucose, oxygen, and lactate. Another generation of biosensors can continuously measure other types of biomolecules in vivo, including a platform for continuous detection of small-molecule drugs in the bloodstream of live animals using an electrochemical sensor based on structure-switching aptamer probes. Further work on real-time biosensing involved real-time enzyme-linked immunosorbent assay which combines antibody and aptamer probes for continuous measurement of insulin and glucose in live animals. These platforms may demonstrate the feasibility of continuous in vivo molecular detection for a wide range of analytes, but they tend to have complicated instrumentation suitable only for a few hours monitoring and are invasive.
[0124] Microneedle-based transdermal devices are emerging to address the challenges of non/minimally invasive wearable biosensing, and can be potentially employed for point-of-care (POC) diagnosis and tracking. Microneedles (MN) enable ready access to dermal interstitial fluid (ISF), one of the more prevalent, accessible fluids in the body that contains important biomarkers for continuous monitoring. New advances have recently been made in exploiting hollow, metallic MN-based devices for real-time monitoring of various metabolites, electrolytes, and therapeutics, and toward the simultaneous multiplexed detection of key chemical markers. However, these sensors tend to be mainly limited to enzymatic based detection, which can hinder their performance for detection of analytes for which enzymes are not available. It has been found that hydrogel microneedles (HMNs), which have been mainly used for cosmetics and drug delivery applications, have potential for diagnostics where extracted ISF has been used for off-chip detection of different analytes. Indeed, HMN arrays are considered to possess several advantages, such as increased amount of ISF (10 μL vs 2 μL in hollow MN), lower fabrication cost and higher production yield when comparing to other MNs. However, they lacked in situ sensing.
[0125] In one or more embodiments of the present disclosure, the herein described MADICT combines HMN arrays with nucleic acid probes (e.g., aptamer probes, pDNA probes), which may address unmet challenges related to real-time biosensing. In one or more embodiments, the present disclosure may address the above-noted challenges for at least the following reasons. Nucleic acid probes (e.g., aptamer probes, pDNA probes) can enable continuous and reagentless measurement of any target molecule of interest. Nucleic acid probes (e.g., aptamer probes, pDNA probes) can be also selected for high sensitivity and specificity detection. Incorporating IC and supporting electronics for miniaturized electrochemical measurement and wireless transmission of data can enable monitoring in POC setting. In one or more embodiments, HMNs can act as a support matrix which can hinder the degradation of nucleic acid probes (e.g., aptamer probes, pDNA probes) even after exposure to ISF environments.
[0126] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0127] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0128] The term “comprising” as used herein refers to the list that follows being non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) and/or ingredient(s) as appropriate.
[0129] The term “subject”, as used herein, refers to an animal, and can include, for example, domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.), mammals, non-human mammals, primates, non-human primates, rodents, birds, reptiles, amphibians, fish, and any other animal. In a specific example, the subject is a human.
[0130] The term “linker” or “linker functional group” refers to a chemical moiety or chemical functional group that connects, or is used to connect two entities. For example, a phosphoramidite functional group may be used to connect a nucleic acid to a hydrogel; or, a PEG chain may connect a nucleic acid to a quencher. A skilled person will recognize how to select an appropriate linker, or linker functional group in view of the two entities to be connected, and the intended application/desired properties of the linked product.
[0131] Generally, the present disclosure provides microneedles for detecting a target. In another aspect, the present disclosure provides methods of producing microneedles. In another aspect, the present disclosure provides methods and apparatus using the microneedles herein disclosed. In other aspects, the present disclosure provides transdermal patches and methods of biosensing using the same.
[0132] According to an embodiment, the microneedle of the present disclosure may comprise a hydrogel and a probe coupled to the hydrogel, the probe for generating a measurable signal in the presence of the target. The measurable signal may be generated in situ. In other words, the signal may be measurable without requiring other reagents (e.g., reagent-less) or processing steps.
[0133] Hydrogels
[0134] Microneedles described herein comprise a hydrogel. The hydrogel may be any suitable polymer or combinations thereof. The hydrogel preferably comprises functionalities that allow for crosslinking and/or functionalization, and it will be understood that any polymer with such functionalities may be used. The hydrogel may comprise a polymer comprising at least one C═C functionality, where the C═C functionality may allow for crosslinking and/or functionalization. The hydrogel may comprise an acrylated polymer, a methacrylated polymer, or a combination thereof. Suitable methacrylated polymers include but are not limited to methacrylated gelatin, methacrylated hyaluronic acid, methacrylated alginate, methacrylated chitosan, methacrylated collagen, methacrylated polyethylene glycol, methacrylated polyvinyl alcohol, methacrylated polylysine, and combinations thereof. The hydrogel may include a combination of polymers, and said polymers may have differing functionalities. The hydrogel may comprise functionalized hyaluronic acid, such as methacrylated hyaluronic acid. The hydrogel may comprise any suitable conductive material for communicating an electrochemical signal throughout the hydrogel, such as a conductive polymer or ionmer.
[0135] Probes
[0136] Microneedles described herein comprise a probe. The probe may be for generating a measurable signal in the presence of a target, alone or in communication with other components of the microneedle. The probe may be for generating a fluorescence signal or an electrochemical signal, in the presence of a target, alone or in communication with other components of the microneedle.
[0137] The probe may be coupled to the hydrogel by any suitable means or fashion, such as by bond, association, physisorption, intermolecular bonding, or complexation. The probe may be coupled to the hydrogel directly, or by a linker. If the probe is coupled to the hydrogel by a linker, the linker may be formed from a phosphoramidite functional group, such as an acrydite functional group. The probe may be covalently bonded to the hydrogel. The probe may be coupled to the hydrogel via hydrogen bonding, or other intermolecular interaction. The probe may be coupled to the hydrogel via physisorption, such as pi-pi stacking.
[0138] Any suitable probe may be used in the microneedles herein described. The probe may be any suitable moiety for generating a measurable signal. The probe preferably generates a measurable signal when bound to, associated with, or in proximity to the target. The probe may comprise a fluorophore, or be conjugated to a fluorophore. The probe may comprise a redox reporter, or be conjugated to a redox reporter.
[0139] The probe may comprise a nucleic acid. The nucleic acid may comprise an aptamer, single stranded complementary probe DNA, peptide nucleic acid, nucleic acid enzyme, or combinations thereof. The probe may comprise an aptamer, such as an aptamer that binds a target. The probe may comprise probe DNA (pDNA), wherein the pDNA is a pDNA that binds to the target. The pDNA may be suitable for any nucleic acid-based target, such as single stranded DNA or RNA to which the sequence of pDNA is complementary. The aptamer may comprise a linker functional group for coupling the probe to the hydrogel. The pDNA may comprise a linker functional group for coupling the probe to the hydrogel. The linker functional group may comprise a phosphoramidite functional group, such as an acrydite functional group. The aptamer may comprise, or be conjugated or linked to a fluorophore. The aptamer may comprise, or be conjugated or linked to a redox reporter. The pDNA may comprise, or be conjugated or linked to a fluorophore. The pDNA may comprise, or be conjugated or linked to a redox reporter. The aptamer may comprise any suitable sequence for binding a target of interest, such as a biomarker. Many such aptamers will be readily known by the person of skill in the art. The aptamer may comprise a sequence as listed in Table 1 or Table 2. It will be readily understood that, while a glucose aptamer, an ATP aptamer were tested herein, it is expected that aptamers for other targets can be used in their place. For example, insulin, cortisol, vancomycin, gentamicin aptamers could be used, such as those listed in Table 1. pDNA is a type of DNA probe that is single stranded, and targets single-stranded DNA or RNA. Generally, the pDNA sequence is complementary to its DNA or RNA target, such as micro-ribonucleic acids (miR). For example, see Tables 1 and 4. The pDNA may comprise any suitable sequence for binding a target of interest, such as a biomarker. Many such pDNA will be readily known by the person of skill in the art.
TABLE-US-00001 TABLE 1 Exemplary suitable aptamer sequences, and associated targets. Target Sequence Insulin 5′GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC3′ (SEQ ID NO. 1) Cortisol 5′AATGCGGGGTGGAGAATGGTTGCCGCA3′ (SEQ ID NO. 2) Vancomycin 5′CTCTCGGGACGACCGAGGGTACCGCAATAGTACTTATTGTTCGCCTATTGTGGGTCGGGTCGTCC C3′ (SEQ ID NO. 3) Gentamicin 5′GGGACTTGGTTTAGGTAATGAGTCCC3′ (SEQ ID NO. 4) Glucose ′5CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGTCCC3′ (SEQ ID NO. 5) ATP 5′CACCTGGGGGAGTATTGCGGAGGAAGG3′ (SEQ ID NO. 6) L-tyrosinamide 5′GGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC3′ (SEQ ID NO. 7) Thrombin 5′GGTTGGTGTGGTTGG3′ (SEQ ID NO. 8) Serotonin 5′ GACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTC3′ (SEQ ID NO. 9) Uric acid 5′CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCGT 3′ (SEQ ID NO. 10) MIR210 pDNA /5Cy3/TCAGCCGCTGTCACACGCACAG/3AmMO/ (SEQ ID NO. 11) MIR21 pDNA /5Cy3/TCAACATCAGTCTGATAAGCTA/3AmMO/ (SEQ ID NO. 12) Cy3-Cyanine 3 modification 5AmMC6 is 5′ Amino Modifier C6 modification 3AmMO is 3′ Amino Modifier modification
[0140] The probe may further comprise a quencher. The probe may be reversibly bound to a quencher. The probe may be tethered to the quencher via a linker at one end, and may be reversibly bound to the quencher at another end. If the probe comprises a fluorophore, for example, the quencher may be a quencher of the fluorophore. If the probe is an aptamer, the quencher may comprise a sequence complimentary to at least a portion of the aptamer sequence. If the probe is pDNA, the quencher may comprise a sequence complimentary to at least a portion of the pDNA sequence. The quencher may be any suitable quencher for reducing the signal of the probe in the absence of the target and/or enhancing the measurable signal of the probe in the presence of the target. The quencher may comprise a moiety that binds competitively to the probe, and preferably the target binds the probe more competitively, favourably, or strongly as compared to the quencher. The quencher may comprise a competitor strand of the aptamer, or the pDNA. The quencher may comprise a sequence as listed in Tables 1 to 3. The quencher may comprise a sequence partially or completely complimentary to at least a portion of a sequence listed in Tables 1 to 3, for example, if the sequence listed is an aptamer or pDNA. The quencher may comprise a moiety that conjugates competitively with the probe, and preferably the target binds the probe more competitively, favourably, or strongly as compared to the quencher.
[0141] The probe may be tethered to a quencher at one end, and may be reversibly bound to the quencher at another end. The probe may be tethered to the quencher via covalent bonding, intermolecular bonding, physical adsorption (such as pi-pi stacking, hydrophobic interactions), or conjugation. The quencher may comprise a graphene-based material, such as graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. The quencher may comprise a graphene-based material, such as graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof, tethered to the probe via covalent bond, physical adsorption, or conjugation. If the probe is tethered to a quencher, the quencher may conjugate competitively with the probe, and the probe may disassociate from, or become distanced from the quencher in the presence of a target that preferably binds the probe more competitively, favourably, or strongly as compared to the quencher.
[0142] Nevertheless, it will be understood that any suitable quencher, such as a quencher complimentary to any of the above-noted aptamer or pDNA probes, or graphene-materials (e.g., graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof) conjugated to probes, is within the scope of the present disclosure.
[0143] The probe may comprise, or may be coupled to an electroactive species, a redox active species, or a combination thereof. The probe may comprised, or be coupled a redox reporter. The redox reporter may comprise aromatic species. The probe may comprise, or may be coupled to metal nanoparticles. In one or more embodiments, when the probe comprises a nucleic acid, such as an nucleic acid that binds a target, the nucleic acid may comprise, or may be coupled to an electroactive species, a redox active species, a redox reporter, metal nanoparticles, or a combination thereof. In one or more embodiments, when the probe comprises an aptamer, such as an aptamer that binds a target, the aptamer may comprise, or may be coupled to an electroactive species, a redox active species, a redox reporter, metal nanoparticles, or a combination thereof. In one or more embodiments, when the probe comprises pDNA, such as pDNA that binds a target, the pDNA may comprise, or may be coupled to an electroactive species, a redox active species, a redox reporter, metal nanoparticles, or a combination thereof. In one or more embodiments, the electroactive species, redox active species, redox reporter, metal nanoparticles, or a combination thereof, may communicate, or assist with communicating, an electrochemical signal through the hydrogel. Many such electroactive species, redox active species, redox reporters, or metal nanoparticles will be readily known by the person of skill in the art. In an example, metal nanoparticles may comprise platinum, silver, gold, palladium, or combinations thereof. The metal nanoparticles may comprise platinum and/or silver. In another example, the redox reporter may comprise an aromatic species. The redox reporter may comprise methylene blue, ferrocene, or a combination thereof.
[0144] In embodiments where the probe may comprise, or may be coupled to an electroactive species, a redox active species, or a combination thereof, such as a redox reporter, the probe may not comprise a quencher. In embodiments where the probe may comprise, or may be coupled to an electroactive species, a redox active species, or a combination thereof, such as a redox reporter, the probe may comprise a quencher, where the quencher acts as support for the probe or as a conductive material and may not quench the measurable signal; for example, wherein the quencher comprises graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. Where the probe may comprise, or may be coupled to an electroactive species, a redox active species, or a combination thereof, the probe may bind with a target and undergo a conformational change. In undergoing this conformational change, the electroactive species, redox active species, or combination thereof of the probe may be brought closer to conductive materials in the microneedle. The conductive materials may comprise metal nanoparticles, graphene-based materials, conductive polymers, or ionomers, where the conductive polymer or ionomer may comprise poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof; and the graphene-based material may comprise ferrocene, graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. Bringing the electroactive species, redox active species, or combination thereof of the probe closer to conductive materials may generate and/or transmit an electrical signal for detection.
[0145] Other Components
[0146] The microneedles herein described may comprise other components. For example, the microneedle or the hydrogel may comprise a nanoparticle. In one or more embodiments, the probe may be coupled to the nanoparticle, and the nanoparticle coupled or associated with the hydrogel.
[0147] In one or more embodiments, the nanoparticle may be a conductive material that's integrated into the hydrogel, or a component thereof. In one or more embodiments, the nanoparticle may communicate, or assist with communicating, an electrochemical signal through the hydrogel. In one or more embodiments, the nanoparticle may enhance electrical properties of the microneedle. The nanoparticle may comprise any suitable metal, such as platinum, silver, gold, palladium, or combinations thereof. The metal nanoparticles may be platinum nanoparticles or platinum and silver nanoparticles. Graphene may be used in addition to, or in place of, metal nanoparticles in the microneedle. The microneedle may comprise any other suitable components.
[0148] Measurable Signal
[0149] The microneedles herein described are for generating a measurable signal in the presence of a target, such as a biomolecule or a biomarker. The measurable signal may be fluorescence. The measurable signal may be an electrochemical signal. The electrochemical signal may be generated in-situ by the probe. The electrochemical signal may be communicated through the hydrogel, such as with the assistance of a conductive material.
[0150] It will be understood that other measurable signals may be used without departing from the spirit of the present disclosure. For example, the measurable signal may be an electrochemical signal extracting from a redox reporter coupled to the probe. The redox reporter may be methylene blue, ferrocene, or combination thereof.
[0151] Targets
[0152] The microneedles and transdermal patches herein described may be used to detect one or more targets. The target may be any suitable molecule for detection. The target may be a biomolecule or biomarker, such as a biomolecule present in interstitial fluid. The target may comprise small biomolecules, proteins, or micro ribonucleic acids. The target may comprises glucose, ATP, uric acid, serotonin, insulin, cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNAs such as miR21 and miR210. The target may comprise small biomolecules uric acid (UA), serotonin, or glucose. The target may comprise protein insulin. The target may comprise micro ribonucleic acids miR21, or miR210. The target may be adenosine triphosphate or glucose. It will be understood that while aptamer or pDNA probes for certain targets were exemplified herein, the same principle may be used to detect other targets, such as any molecule with a known aptamer or pDNA. It will be understood that any molecule or ion suitable for generating an electrochemical signal in the presence of the probe may be detected, such as a molecule or ion that undergoes a redox reaction with the probe. Further, in embodiments where the probe may be coupled to an electroactive species, a redox active species, a redox reporter, metal nanoparticles, or a combination thereof, it will be understood that any target, such as an ion, or a molecule with a known aptamer, suitable for generating an electrochemical signal in the presence of the probe may be detected.
[0153] Conductive Materials
[0154] The microneedles herein described may comprise a conductive material. The conductive material may be any suitable material for communicating a signal from the probe through the hydrogel. For example, the conductive material may communicate an electrochemical signal of the probe through the hydrogel and to an electrical wire associated with the microneedle. The conductive material may be a nanoparticle, such as a metal nanoparticle, or graphene. The nanoparticle or graphene may be embedded within the hydrogel's 3D network. The conductive material may be a conductive polymer, such as an ionomer. Any suitable conductive polymer may be used, such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate, polyacetylene, polypyrrole, polyindole and polyaniline and their copolymers. The conductive material or polymer may be mixed with, embedded in, conjugated with or covalently linked (e.g. by crosslinking) to the hydrogel.
[0155] The conductive material may comprise metal nanoparticles, graphene-based materials, conductive polymers, or ionomers. In an embodiment, the conductive polymer or ionomer comprises poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof. In an embodiment, the graphene-based material comprises ferrocene, graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof.
[0156] Methods of producing Microneedles
[0157] In one or more aspects, there is provided a method of producing a microneedle. The method may comprise combining a functionalized hydrogel, a probe precursor, optionally a conductive material, and a crosslinking agent in a mold; and exposing the mixture in the mold to UV light to link at least a portion of the probe to the functionalized hydrogel and to form a crosslinked material. The method optionally comprises functionalizing a hydrogel to form the functionalized hydrogel, such as reacting hyaluronic acid with methacrylic anhydride to form methacrylated hyaluronic acid. The method may further comprise washing and/or purification steps. The method may comprise washing the microneedle to remove excess or unbound probe or other reagent. The method may comprise removing the crosslinked material from the mold, and/or further exposing the unmolded crosslinked material to UV light. The method optionally comprises washing the crosslinked material to remove unbound probe. The crosslinking agent may be any suitable reagent, such as N,N′-methylenebisacrylamide. The method may comprise combining functionalized hydrogel, probe precursor, and crosslinking agent with a photoinitiator in the mold. The crosslinking may occur in the presence of a photoinitiator. The photoinitiator may catalyze the crosslinking. The hydrogel may be cast in any suitable way to form a microneedle, such as by mold. The mold may be a negative polydimethylsiloxane mold. In one embodiment, combining the functionalized hydrogel, the probe precursor, and the crosslinking agent in the mold comprises: [0158] dissolving about 50:1 to about 10:1 (wt/wt) of functionalized hydrogel:crosslinking agent in buffer to form a functionalized hydrogel solution; [0159] optionally adding a conductive material to the functionalized hydrogel solution; [0160] optionally degassing the functionalized hydrogel solution; [0161] adding the functionalized hydrogel solution to the mold; [0162] partially drying the functionalized hydrogel solution in the mold; [0163] optionally, adding further functionalized hydrogel solution to the mold; [0164] adding the probe precursor to the mold; and [0165] optionally, drying the mixture in the mold further.
[0166] It will be understood that any suitable conditions may be used. The ratio of functionalized hydrogel:crosslinking agent may be about 50:1 to about 10:1, such as about 10:1, or about 20:1, or about 30:1, or about 40:1 or about 50:1. The probe precursor solution may comprise a nucleic acid. The probe precursor solution may comprise a nucleic acid and a quencher. The probe precursor solution may comprise a nucleic acid that comprises, or is coupled to an electroactive species, a redox active species, or a combination thereof, such as a redox reporter. The probe precursor solution may comprise a nucleic acid and quencher (e.g., an aptamer and a quencher, or pDNA and a quencher), for example, in a ratio of about 1:5 to about 1:20, such as about 1:5 or about 1:10 or about 1:15 or about 1:20. Degassing the functionalized hydrogel solution may be done at any suitable stage of the method or process, and degassing may comprise centrifuge, sonication and/or vacuum. Drying the functionalized hydrogel solution in the mold may occur for any suitable amount of time, and in one or more stages. For example, to the partially-dried functionalized hydrogel solution in the mold may be added additional functionalized hydrogel solution for further drying. This process may be repeated one or more times. The functionalized hydrogel solution may be exposed to any suitable conditions for curing or crosslinking, such as UV light. The mixture in the mold may be exposed to UV light, such as at a wavelength of about 360 nm for a suitable amount of time, such as about 15 minutes. For example, the mixture may be exposed to light of 200 nm to 400 nm, such as about 360 nm. For example, the mixture may be exposed to curing conditions, such as UV light, for about 1 minute to about 1 hour, such as about 10-20 minutes.
[0167] The method may comprise combining a functionalized hydrogel, a probe precursor, and a conductive material to form a mixture and forming said mixture into the microneedle. The method may comprise curing the mixture, such as by crosslinking the mixture in a mold to form a crosslinked material. The crosslinking may be induced by any suitable means, such as by exposing the mixture to UV light. In one embodiment, the method comprises combining a functionalized hydrogel, a probe precursor, and a conductive material to form a mixture; and crosslinking the mixture in a mold to form a crosslinked material. Crosslinking may involve exposing the mixture to UV light. The method may comprise one or more drying steps, such as drying the mixture in the mold before or after crosslinking. Combining the functionalized hydrogel, probe precursor, and the conductive material may be done by any suitable means or procedure. The method may further include degassing, such as degassing the mixture in the mold by any suitable means, such as by centrifuge, sonication, and or applying vacuum. The method may further comprise combining the functionalized hydrogel, the probe precursor, and the conductive material with a metal nanoparticle or metal nanoparticle precursor. The metal nanoparticle precursor may be a metal salt, such as a Pt, Pd, Au, or Ag salt. The metal nanoparticle may be a metal nitrate or metal chloride, for example, silver nitrate and/or platinum sodium chloride.
[0168] Properties of Microneedles
[0169] In one or more aspects, there is provided a microneedle obtainable or obtained by the methods herein disclosed. The microneedle may have a length of about 300 μm to about 1000 μm, such as about 800 μm. The microneedle may be produced as a plurality of microneedles. The plurality of microneedles may be in any suitable arrangement, such as a grid. The plurality of microneedles may be connected, for example, the microneedles may be cast by a mold that includes a base layer from which the microneedles extend. The plurality of microneedles may be in a grid of about 10 to about 500. The plurality of microneedles may be in a square grid, such as a grid of 3×3, or 4×4, or 5×5, etc. The plurality of microneedles may be in a rectangular grid, such as a grid of 3×4, or 3×5, or 3×6, etc. or 4×5, or 4×6, etc. The plurality of microneedles may be in an irregularly shaped grid, or any suitable shape or pattern.
[0170] The plurality of microneedles may be individually spaced apart, such as at a distance of about 100 μm to about 1000 μm, such as about 500 μm.
[0171] Apparatus
[0172] In one or more aspects, there is provided an apparatus for detecting a target in a sample. The apparatus may comprise a microneedle as disclosed herein together with a detector for detecting the measurable signal. The detector may be any suitable detector, such as a fluorimeter for detecting a fluorescent signal, etc. The detector may be a smartphone-based detector for detecting a fluorescent signal, etc. The smartphone detector may be a miniaturized optic and imager system that includes: a laser diode for exciting the fluorophore comprised by, or conjugated to a probe of a HMN as described herein or transdermal patch comprising the same, a microscopic objective for magnification, a filter such as a bandpass filter for passing frequencies within a certain range and rejecting (attenuating) frequencies outside that range, and a lens such as a camera lens for focusing emitted light. Any emitted fluorescent light from the HMN or patch can be magnified by the objective, passed through the filter to filter out background excitations, collected by the camera lens, and visualized by the smartphone. The apparatus may comprise a microneedle as disclosed herein together with a detector for detecting the electrochemical signal. The detector may be any suitable detector, such as a potentiostat.
[0173] The apparatus may further comprise a reference electrode and/or a counter electrode, or they may be provided separately.
[0174] The sample may be any suitable sample, such as a solution comprising the target, a biological sample or solution thereof. The sample may have been taken from a subject, or the apparatus may be used with a transdermal patch for biosensing, wherein the sample is the subject's interstitial fluid.
[0175] Transdermal Patch
[0176] In one or more aspects, there is provided a transdermal patch comprising a microneedle according to any one of more embodiments of the present disclosure. The transdermal patch may comprise other components, such as adhesive to attach the patch and/or a bandage.
[0177] In the transdermal patch, the microneedle as described herein may act as a working electrode. The transdermal patch may thus further comprise a reference electrode and/or a counter electrode, or these electrodes may be provided separately, such as on a separate patch. The reference electrode and/or the counter electrode may also be microneedle electrodes, or they may be any suitable electrode for use in the system. The reference electrode may be a microneedle electrode comprising Ag/AgCl. The counter electrode may be a microneedle electrode comprising Au. The transdermal patch may comprise three electrodes (a working electrode, counter electrode, and reference electrode) or a plurality of each. The transdermal patch may comprise other components, such as adhesive to attach the patch and/or a bandage. The electrodes may be localized on one area of the patch, such as in a side-by-side arrangement. Each electrode may have its own associated wiring.
[0178] Biosensing
[0179] In one or more aspects, there is provided a method for transdermal biosensing, or a use of the microneedles herein disclosed for transdermal biosensing. The method may comprise applying a transdermal patch or any suitable means of applying microneedles as herein described. The method may comprise applying the transdermal patch to any suitable location of a subject, such as arm, leg, abdomen, etc. The method or use for biosensing may include detecting the measurable signal and associating the measurable signal to the concentration of the target in the subject. Alternatively, the method or use may be for simply identifying the presence of a given level of the target in the subject, as opposed to the exact concentration. Detecting the measurable signal may be done completely in situ; in other words, the detection may be done without further processing steps. Detecting may be reagentless. Detecting may occur without requiring removal of the transdermal patch, or without further processing of the transdermal patch. Detecting may occur while the transdermal patch is applied, or in contact with the subject. Detecting the measurable signal may comprise measuring the fluorescence intensity of the probe, measuring voltammetry or amperometry, or any other suitable measurement of the microneedle system. Associating the measurable signal may comprise comparing a measured intensity of the measurable signal to a calibration curve of measured intensities of known concentrations of the target. It will be understood that any suitable means of associating the measurable signal to the presence or absence (or concentration) of the target may be used.
[0180] Herein, there is described: [0181] 1. A microneedle for detecting a target, the microneedle comprising: a hydrogel; a probe coupled to the hydrogel, the probe for generating a measurable signal in the presence of the target. [0182] 2. The microneedle of item 1, wherein the measurable signal is generated in situ. [0183] 3. The microneedle of item 1 or 2, wherein the hydrogel comprises a polymer comprising at least one C═C functionality. [0184] 4. The microneedle of any one of items 1 to 3, wherein the hydrogel comprises an acrylated polymer, a methacrylated polymer, or a combination thereof. [0185] 5. The microneedle of item 4, wherein the hydrogel comprises methacrylated gelatin, methacrylated hyaluronic acid, methacrylated alginate, methacrylated chitosan, methacrylated collagen, or a combination thereof. [0186] 6. The microneedle of any one of items 1 to 5, wherein the hydrogel comprises functionalized hyaluronic acid. [0187] 7. The microneedle of any one of items 1 to 6, wherein the hydrogel comprises methacrylated hyaluronic acid. [0188] 8. The microneedle of any one of items 1 to 7, wherein the probe coupled to the hydrogel comprises the probe being coupled to the hydrogel by a linker. [0189] 9. The microneedle of item 8, wherein the linker is formed from a phosphoramidite functional group, such as an acrydite functional group. [0190] 10. The microneedle of any one of items 1 to 9, wherein the probe coupled to the hydrogel comprises the probe being covalently bonded to the hydrogel. [0191] 11. The microneedle of any one of items 1 to 10, wherein the hydrogel further comprises a nanoparticle. [0192] 12. The microneedle of item 11, wherein the probe coupled to the hydrogel comprises the probe being coupled to the nanoparticle. [0193] 13. The microneedle of any one of items 1 to 12, wherein the probe comprises an aptamer. [0194] 14. The microneedle of item 13, wherein the aptamer is an aptamer that binds to the target. [0195] 15. The microneedle of item 13 or 14, wherein the aptamer comprises a sequence according to a SEQ ID No. herein disclosed. [0196] 16. The microneedle of any one of items 13 to 15, wherein the aptamer comprises a linker functional group for coupling the probe to the hydrogel. [0197] 17. The microneedle of item 16, wherein the linker functional group comprises a phosphoramidite functional group. [0198] 18. The microneedle of item 16 or 17, wherein the linker functional group comprises an acrydite functional group. [0199] 19. The microneedle of any one of items 1 to 18, wherein the probe comprises a fluorophore. [0200] 20. The microneedle of any one of items 1 to 19, wherein the probe comprises an aptamer, and the aptamer comprises a fluorophore or is linked to a fluorophore. [0201] 21. The microneedle of any one of items 1 to 20, wherein the probe is reversibly bound to a quencher. [0202] 22. The microneedle of item 21, wherein the probe is an aptamer and the quencher comprises a sequence partially or fully complimentary to at least a portion of the aptamer sequence. [0203] 23. The microneedle of item 21 or 22, wherein the quencher comprises a sequence according to a SEQ ID No. herein disclosed. [0204] 24. The microneedle of any one of items 1 to 23, wherein the measurable signal is fluorescence. [0205] 25. The microneedle of any one of items 1 to 24, wherein the target is a biomolecule present in interstitial fluid. [0206] 26. The microneedle of any one of items 1 to 25, wherein the target is adenosine triphosphate. [0207] 27. The microneedle of any one of items 1 to 26, wherein the target is glucose. [0208] 28. The microneedle of any one of items 1 to 27, wherein the microneedle has a length of about 300 μm to about 1000 μm, such as about 800 μm. [0209] 29. A method of producing a microneedle, the method comprising: combining a functionalized hydrogel, a probe precursor, and a crosslinking agent in a mold; and exposing the mixture in the mold to UV light to link at least a portion of the probe to the functionalized hydrogel and to form a crosslinked material. [0210] 30. The method of item 29, further comprising functionalizing a hydrogel to form the functionalized hydrogel. [0211] 31. The method of item 29 or 30, further comprising: removing the crosslinked material from the mold; and further exposing the unmolded crosslinked material to UV light. [0212] 32. The method of any one of items 29 to 31, further comprising washing the crosslinked material to remove unbound probes. [0213] 33. The method of any one of items 29 to 32, wherein combining the functionalized hydrogel, the probe precursor, and the crosslinking agent in the mold comprises: dissolving about 50:1 to about 10:1 (wt/wt) of functionalized hydrogel:crosslinking agent in a buffer to form a functionalized hydrogel solution; optionally degassing the functionalized hydrogel solution; adding the functionalized hydrogel solution to the mold; partially drying the functionalized hydrogel solution in the mold; optionally, adding further functionalized hydrogel solution to the mold; adding the probe precursor to the mold; and optionally, drying the mixture in the mold further. [0214] 34. The method of any one of items 29 to 33, wherein the probe precursor is a solution of aptamer and quencher, preferably in a ratio of about 1:5 to about 1:20, such as a 1:10 ratio. [0215] 35. The method of any one of items 29 to 34, wherein exposing the mixture in the mold to UV light comprises exposing the mixture to light of about 200 nm to about 400 nm, preferably about 360 nm light; and preferably for about 1 min to about 1 hour, such as about 10 to about 20 min. [0216] 36. The method of any one of items 29 to 35, wherein the hydrogel comprises hyaluronic acid. [0217] 37. The method of item 36, wherein functionalizing the hydrogel comprises reacting hyaluronic acid with methacrylic anhydride to form methacrylated hyaluronic acid. [0218] 38. The method of any one of items 29 to 37, wherein combining the functionalized hydrogel, the probe precursor and the crosslinking agent in the mold further comprises adding a photoinitiator to the mixture in the mold. [0219] 39. The method of any one of items 29 to 38, wherein the crosslinking agent comprises N,N′-methylenebisacrylamide. [0220] 40. The method of any one of items 29 to 39, wherein the mold is a negative polydimethylsiloxane mold. [0221] 41. A microneedle obtainable or obtained by the method according to any one of items 29 to 40. [0222] 42. An apparatus for detecting a target in a sample, the apparatus comprising: the microneedle according to any one of items 1 to 28 or 41; and a detector for detecting the measurable signal. [0223] 43. The apparatus of item 42, wherein the detector is a fluorimeter. [0224] 44. A transdermal patch comprising the microneedle according to any one of items 1 to 28 or 41. [0225] 45. A method for transdermal biosensing of a target in a subject, the method comprising: applying the transdermal patch according to item 44; detecting the measurable signal; and associating the measurable signal to the concentration of the target in the subject. [0226] 46. The method of item 45, wherein detecting the measurable signal is in situ. [0227] 47. The method of item 45 or 46, wherein detecting the measurable signal is reagentless. [0228] 48. The method of any one of items 45 to 47, wherein detecting the measurable signal occurs without requiring removal of the transdermal patch. [0229] 49. The method of any one of items 45 to 48, wherein detecting the measurable signal occurs while the transdermal patch is applied to the subject. [0230] 50. The method of any one of items 45 to 49, wherein detecting the measurable signal occurs in the absence of further processing of the transdermal patch. [0231] 51. The method of any one of items 45 to 50, wherein detecting the measurable signal comprises measuring the fluorescence intensity of the probe. [0232] 52. The method of any one of items 45 to 51, wherein associating the measurable signal comprises comparing a measured intensity of the measurable signal to a calibration curve of measured intensities of known concentrations of the target.
[0233] Herein, there is also described: [0234] 1. A microneedle for detecting a target, the microneedle comprising: a hydrogel; a probe coupled to the hydrogel, the probe for generating a measurable signal in the presence of the target. [0235] 2. The microneedle of item 1, wherein the hydrogel comprises a polymer comprising at least one C═C functionality. [0236] 3. The microneedle of item 1 or 2, wherein the hydrogel comprises a polymer comprising an acrylated polymer, a methacrylated polymer, or a combination thereof. [0237] 4. The microneedle of any one of items 1 to 3, wherein the hydrogel comprises a polymer comprising methacrylated gelatin, methacrylated hyaluronic acid, methacrylated alginate, methacrylated chitosan, methacrylated collagen, methacrylated polyethylene glycol, methacrylated polyvinyl alcohol, methacrylated polylysine, or a combination thereof. [0238] 5. The microneedle of any one of items 1 to 4, wherein the hydrogel further comprises a conductive polymer, an ionomer, or a combination thereof. [0239] 6. The microneedle of any one of items 1 to 5, wherein the conductive polymer, an ionomer, or a combination thereof comprises poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof. [0240] 7. The microneedle any one of items 1 to 6, wherein the probe coupled to the hydrogel comprises the probe being coupled to the hydrogel by covalent bonding, intermolecular bonding, physisorption, complexation, a linker; or a combination thereof. [0241] 8. The microneedle of any one of items 1 to 7, wherein the probe comprises a nucleic acid, wherein the nucleic acid is an nucleic acid that binds to the target. [0242] 9. The microneedle of item 8, wherein the nucleic acid comprises an aptamer, single stranded complementary probe DNA, peptide nucleic acid, nucleic acid enzyme, or combinations thereof. [0243] 10. The microneedle of item 8 or 9, wherein the nucleic acid comprises a linker functional group for coupling the probe to the hydrogel. [0244] 11. The microneedle of item 10, wherein the linker functional group comprises a phosphoramidite functional group; or an acrydite functional group. [0245] 12. The microneedle of any one of items 1 to 11, wherein the probe comprises a fluorophore. [0246] 13. The microneedle of item 12, wherein the probe comprises a nucleic acid, and the nucleic acid comprises a fluorophore or is linked to a fluorophore. [0247] 14. The microneedle of any one of items 1 to 13, wherein the probe further comprises a quencher. [0248] 15. The microneedle of item 14, wherein the probe is reversibly bound to a quencher. [0249] 16. The microneedle of item 14 or 15, wherein the probe is tethered to the quencher via covalent bonding, intermolecular bonding, physical adsorption, conjugation, or a combination thereof. [0250] 17. The microneedle of any one of items 14 to 16, wherein the probe comprises a nucleic acid and the quencher comprises a sequence partially or fully complimentary to at least a portion of the nucleic acid sequence. [0251] 18. The microneedle of any one of items 14 to 16, wherein the probe comprises a nucleic acid and the quencher comprises a graphene-based material. [0252] 19. The microneedle of item 18, wherein the graphene-based material comprises graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. [0253] 20. The microneedle of any one of items 12 to 19, wherein the measurable signal is fluorescence. [0254] 21. The microneedle of any one of items 1 to 11, wherein the probe comprises an electroactive species, a redox active species, or a combination thereof, such as a redox reporter. [0255] 22. The microneedle of item 21, wherein the probe comprises a nucleic acid, and the nucleic acid comprises an electroactive species, a redox active species, or a combination thereof; or is linked to an electroactive species, a redox active species, or a combination thereof. [0256] 23. The microneedle of item 21 or 22, wherein the measurable signal is an electrochemical signal. [0257] 24. The microneedle of any one of items 1 to 23, wherein the target comprises a biomolecule present in interstitial fluid. [0258] 25. The microneedle of item 24, wherein the target comprises small biomolecules, proteins, or micro ribonucleic acids. [0259] 26. The microneedle of item 24 or 25, wherein cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNA miR21, micro-RNA miR210, uric acid (UA), serotonin, insulin, adenosine triphosphate, or glucose. [0260] 27. The microneedle of any one of items 1 to 26, wherein the microneedle has a length of about 300 μm to about 1000 μm, such as about 800 μm. [0261] 28. The microneedle of any one of items 1 to 27, further comprising a conductive material. [0262] 29. The microneedle of item 28, wherein the conductive material comprises a metal nanoparticle, graphene-based material, conductive polymer, or an ionomer; or a combination thereof. [0263] 30. The microneedle of item 29, wherein the graphene-based material comprises ferrocene, graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. [0264] 31. The microneedle of item 29 or 30, wherein the conductive polymer, ionomer, or combination thereof comprises poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof. [0265] 32. A method of producing a microneedle, the method comprising: combining a functionalized hydrogel, a probe precursor, optionally a conductive material, and a crosslinking agent in a mold; and exposing the mixture in the mold to UV light to link at least a portion of the probe to the functionalized hydrogel and to form a crosslinked material. [0266] 33. The method of item 32, further comprising: removing the crosslinked material from the mold; and further exposing the unmolded crosslinked material to UV light. [0267] 34. The method of item 32 or 33, wherein combining the functionalized hydrogel, the probe precursor, optionally a conductive material, and the crosslinking agent in the mold comprises: dissolving about 50:1 to about 10:1 (wt/wt) of functionalized hydrogel:crosslinking agent in a buffer to form a functionalized hydrogel solution; optionally adding a conductive material to the functionalized hydrogel solution; optionally degassing the functionalized hydrogel solution; adding the functionalized hydrogel solution to the mold; partially drying the functionalized hydrogel solution in the mold; optionally, adding further functionalized hydrogel solution to the mold; adding the probe precursor to the mold; and optionally, drying the mixture in the mold further. [0268] 35. The method of any one of items 32 to 34, wherein the probe precursor comprises a solution of nucleic acid and optionally a quencher. [0269] 36. The method of any one of items 32 to 35, wherein exposing the mixture in the mold to UV light comprises exposing the mixture to light of about 200 nm to about 400 nm, preferably about 360 nm light; and preferably for about 1 min to about 1 hour, such as about 10 to about 20 min. [0270] 37. The method of any one of items 32 to 36, wherein the hydrogel comprises hyaluronic acid; and functionalizing functionalizing the hydrogel comprises reacting hyaluronic acid with methacrylic anhydride to form methacrylated hyaluronic acid. [0271] 38. The method of any one of items 32 to 36, wherein the optional conductive material comprises metal nanoparticles, graphene-based material, or a conductive polymer or ionomer, such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate, polyacetylene, polypyrrole, polyindole, polyaniline, or copolymers thereof. [0272] 39. The method of any one of items 32 to 38, wherein the mold is a negative polydimethylsiloxane mold. [0273] 40. An apparatus for detecting a target in a sample, the apparatus comprising: the microneedle according to any one of items 1 to 31; and a detector for detecting the measurable signal. [0274] 41. A transdermal patch comprising the microneedle according to any one of items 1 to 31. [0275] 42. A method for transdermal biosensing of a target in a subject, the method comprising: applying the transdermal patch according to item 41; detecting the measurable signal; and associating the measurable signal to the concentration of the target in the subject. [0276] 43. The method of item 42, wherein detecting the measurable signal is reagentless. [0277] 44. The method of item 42 or 43, wherein detecting the measurable signal comprises measuring the fluorescence intensity of the probe; or measuring an electrochemical signal. 45. The method of item 44, wherein associating the measurable signal comprises comparing a measured intensity of the measurable signal to a calibration curve of measured intensities of known concentrations of the target.
[0278] Herein, there is also described: [0279] 1. A microneedle for detecting a target, the microneedle comprising: a hydrogel; a probe coupled to the hydrogel, the probe for generating a measurable signal in the presence of the target. [0280] 2. The microneedle of item 1, wherein the hydrogel comprises a polymer comprising at least one C═C functionality; an acrylated polymer, a methacrylated polymer, or a combination thereof; and/or methacrylated gelatin, methacrylated hyaluronic acid, methacrylated alginate, methacrylated chitosan, methacrylated collagen, methacrylated polyethylene glycol, methacrylated polyvinyl alcohol, methacrylated polylysine, or a combination thereof. [0281] 3. The microneedle of item 1 or 2, wherein the hydrogel further comprises a conductive polymer, an ionomer, or a combination thereof. [0282] 4. The microneedle of any one of items 1 to 3, wherein the conductive polymer, an ionomer, or a combination thereof comprises poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof. [0283] 5. The microneedle any one of items 1 to 4, wherein the probe coupled to the hydrogel comprises the probe being coupled to the hydrogel by intermolecular bonding, physisorption, complexation, or a combination thereof. [0284] 6. The microneedle of any one of items 1 to 5, wherein the probe comprises a nucleic acid, wherein the nucleic acid is an nucleic acid that binds to the target. [0285] 7. The microneedle of item 6, wherein the nucleic acid comprises an aptamer, single stranded complementary probe DNA, peptide nucleic acid, nucleic acid enzyme, or combinations thereof. [0286] 8. The microneedle of any one of items 1 to 7, wherein the probe comprises a fluorophore. [0287] 9. The microneedle of item 8, wherein the probe comprises a nucleic acid, and the nucleic acid comprises a fluorophore or is linked to a fluorophore. [0288] 10. The microneedle of any one of items 1 to 9, wherein the probe further comprises a quencher. [0289] 11. The microneedle of item 10, wherein the probe is tethered to the quencher via covalent bonding, intermolecular bonding, physical adsorption, conjugation, or a combination thereof. [0290] 12. The microneedle of any one of items 1 to 11, wherein the probe comprises a nucleic acid and the quencher comprises a graphene-based material. [0291] 13. The microneedle of item 12, wherein the graphene-based material comprises graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. [0292] 14. The microneedle of any one of items 1 to 13, wherein the measurable signal is fluorescence. [0293] 15. The microneedle of any one of items 1 to 13, wherein the probe comprises an electroactive species, a redox active species, or a combination thereof, such as a redox reporter. [0294] 16. The microneedle of item 15, wherein the probe comprises a nucleic acid, and the nucleic acid comprises an electroactive species, a redox active species, or a combination thereof or is linked to an electroactive species, a redox active species, or a combination thereof. [0295] 17. The microneedle of item 15 or 16, wherein the measurable signal is an electrochemical signal. [0296] 18. The microneedle of any one of items 1 to 17, wherein the target comprises a biomolecule present in interstitial fluid. [0297] 19. The microneedle of item 18, wherein the target comprises small biomolecules, proteins, or micro ribonucleic acids. [0298] 20. The microneedle of item 18 or 19, wherein the target comprises cortisol, vanomycin, gentamicin, tyrosinamide, thrombin, micro-RNA miR21, micro-RNA miR210, uric acid (UA), serotonin, insulin, adenosine triphosphate, or glucose. [0299] 21. The microneedle of any one of items 1 to 20, wherein the microneedle has a length of about 300 μm to about 1000 μm, such as about 800 μm. [0300] 22. The microneedle of any one of items 1 to 21, further comprising a conductive material. [0301] 23. The microneedle of item 25, wherein the conductive material comprises a metal nanoparticle, graphene-based material, conductive polymer, or an ionomer, or a combination thereof. [0302] 24. The microneedle of item 23, wherein the graphene-based material comprises ferrocene, graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof. [0303] 25. The microneedle of item 23 or 24, wherein the conductive polymer, ionomer, or combination thereof comprises poly(3,4-ethylenedioxythiophene) polystyrene sulfonate; polyacetylene; polypyrrole; polyindole; polyaniline; a copolymer thereof; or a combination thereof. [0304] 26. A method of producing a microneedle, the method comprising: combining a functionalized hydrogel, a probe precursor, optionally a conductive material, and a crosslinking agent in a mold; and exposing the mixture in the mold to UV light to link at least a portion of the probe to the functionalized hydrogel and to form a crosslinked material. [0305] 27. The method of item 26, further comprising: removing the crosslinked material from the mold; and further exposing the unmolded crosslinked material to UV light. [0306] 28. The method of item 26 or 27, wherein combining the functionalized hydrogel, the probe precursor, optionally a conductive material, and the crosslinking agent in the mold comprises: dissolving about 50:1 to about 10:1 (wt/wt) of functionalized hydrogel:crosslinking agent in a buffer to form a functionalized hydrogel solution; optionally adding a conductive material to the functionalized hydrogel solution; optionally degassing the functionalized hydrogel solution; adding the functionalized hydrogel solution to the mold; partially drying the functionalized hydrogel solution in the mold; optionally, adding further functionalized hydrogel solution to the mold; adding the probe precursor to the mold; and optionally, drying the mixture in the mold further. [0307] 29. The method of any one of items 26 to 28, wherein the probe precursor comprises a solution of nucleic acid and a quencher. [0308] 30. The method of any one of items 26 to 29, wherein exposing the mixture in the mold to UV light comprises exposing the mixture to light of about 200 nm to about 400 nm, preferably about 360 nm light; and preferably for about 1 min to about 1 hour, such as about 10 to about 20 min. [0309] 31. The method of any one of items 26 to 30, wherein the hydrogel comprises hyaluronic acid; and functionalizing functionalizing the hydrogel comprises reacting hyaluronic acid with methacrylic anhydride to form methacrylated hyaluronic acid. [0310] 32. The method of any one of items 26 to 31, wherein the optional conductive material comprises metal nanoparticles, graphene-based material, such as ferrocene, graphene-oxide (GO) nanosheets, graphene-oxide (GO) nanoparticles, graphene-oxide (GO) nanocomposites, or a combination thereof; or a conductive polymer or ionomer, such as poly(3,4-ethylenedioxythiophene) polystyrene sulfonate, polyacetylene, polypyrrole, polyindole, polyaniline, or copolymers thereof. [0311] 33. The method of any one of items 26 to 32, wherein the mold is a negative polydimethylsiloxane mold. [0312] 34. An apparatus for detecting a target in a sample, the apparatus comprising: the microneedle according to any one of items 1 to 25; and a detector for detecting the measurable signal. [0313] 35. A transdermal patch comprising the microneedle according to any one of items 1 to 25. [0314] 36. A method for transdermal biosensing of a target in a subject, the method comprising: applying the transdermal patch according to item 35; detecting the measurable signal; and associating the measurable signal to the concentration of the target in the subject. [0315] 37. The method of item 36, wherein detecting the measurable signal is reagentless. [0316] 38. The method of item 36 or 37, wherein detecting the measurable signal comprises measuring the fluorescence intensity of the probe; or measuring an electrochemical signal. [0317] 39. The method of any one of items 36 to 38, wherein associating the measurable signal comprises comparing a measured intensity of the measurable signal to a calibration curve of measured intensities of known concentrations of the target.
[0318] To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in anyway
EXAMPLES
Example 1
A Hydrogel Microneedle-assisted Biosensor Integrating Aptamer Probes and Fluorescence Detection for Reagentless Biomarker Quantification
[0319] 1.1 Introduction
[0320] Herein, a fluorescent HMN biosensor based on methacrylated hyaluronic acid (MeHA) for on-needle and reagentless capture and detection of any biomarkers of interest is disclosed. This reagentless fluorescence assay for minimally invasive detection (RFMID) integrates a rapid and simple approach to link aptamer probes—short single-stranded DNA capable of specific binding to a target molecule—to the MeHA matrix. The application of this biosensor is demonstrated for ex vivo detection of adenosine triphosphate (ATP) and glucose, where HMN arrays functionalized with aptamer probes can detect the analyte concentrations with high sensitivity and specificity. It is also shown that the RFMID can be employed for tracking rising and falling levels of glucose in an animal model of diabetes. Specifically, the RFMID can accurately track severe hypoglycemia range, which cannot be detected using the commercially available glucose monitoring devices. The proposed RFMID technique is expected to pave the way for the next generation of real-time, continuous biosensors.
[0321] 1.2 Results and Discussion
[0322] RFMID Detection Strategy
[0323] The RFMID integrates HMNs with aptamer probes as biorecognition elements to selectively capture the target analyte in a minimally invasive manner. HMNs are fabricated using MeHA, a highly swellable and biocompatible polymer that has been previously employed for enhanced ISF extraction and off-site target detection.sup.4. MeHA was synthesized by modifying HA with methacrylic anhydride.sup.4,21. The degree of methacrylation was determined to be 20% by integration of methacrylate proton signals at 6.1, 5.7, and 1.8 ppm to the peak at 1.9 ppm related to the N-acetyl glucosamine of HA.sup.22 (see 1.5 Supplementary Information). An approach was employed to link aptamer probes into MeHA-HMNs by introducing an acrydite group to the proximal end of the aptamer. In the presence of a photoinitiator (PI) and under UV exposure, the acrydite group forms a covalent linkage with MeHA, enabling the attachment of aptamer probes to the HA network (
[0324] For reagentless target detection, aptamer probes and a strand displacement strategy was used. Briefly, Cy3 fluorophore-conjugated aptamers were hybridzed with a DNA competitor strand that has been conjugated to a quencher (Dabcyl) molecule, called the quencher strand, and coupled the complex to MeHA through covalent linkage. The aptamer-quencher complex retains the fluorophore and quencher in proximity, producing no signal in the absence of a specific target. When the aptamer binds to the target, the quencher competitor strand dissociates and alleviates quenching of the fluorophore, producing a signal without requiring for any post-processing steps such as washing or adding a detection reagent. Despite that fact that the displacement-based analyses often suffer from low sensitivities, this is not the case in the presently described assay because the binding of an aptamer to its target molecule is more thermodynamically stable than the binding to its complementary stand.
[0325]
[0326] RFMID Fabrication and Testing
[0327] The RFMID was fabricated using a negative polydimethylsiloxane (PDMS) mold (
[0328]
[0329] Before complete drying, the hybridized aptamer-quencher complex was added to the mold and the patches were left to dry. The patches were then exposed to UV for both aptamer linking and patch crosslinking. To remove the unbound aptamer probes, the patches were washed twice inside the mold to avoid the deformation of patch needles. The HMN patches were then removed from the mold and exposed to UV for another 5 min through the needle side to ensure formation of a crosslinked patch (not shown in
[0330] First, the chemical structure of hydrogel biosensor and efficiency of linking the aptamer probes to MeHA were investigated using Fourier-transform infrared spectroscopy (FTIR) (
[0331] Next, the effect of aptamer probes on the swelling capability and mechanical strength of the RFMID patches was investigated. The swelling capability of the RFMID patches were tested by measuring the patch's weight before and after application through an agarose hydrogel for 10 mins. It was observed that the presence of aptamer probes does not have any significant effect on the swelling ability of MeHA hydrogel network (
[0332] This experiment ultimately indicates that the analytes diffuse into the patch needles and are captured by aptamer probes for subsequent detection. To visualize the target recovery capability, HMN patches were pressed through an agarose hydrogel loaded with Rhodamine B (RhoB) then the diffused dye was recovered (
[0333]
[0334] In Vitro and Ex Vivo Detection of ATP and Glucose
[0335] To investigate the sensor's capability for biomolecule detection, a series of experiments were conducted to measure varying concentrations of glucose (
[0336] Upon successful detection of target analytes in agarose hydrogel, the sensor capability for in situ biomarker measurement was tested using an ex vivo skin model. First, the degradation of both ATP and glucose aptamer probes via nucleases present in the skin was examined. To this end, functionalized HMN patches with only aptamer probes were applied through a blank porcine skin or agarose hydrogel (with no nucleases present). It was observed that the fluorescence intensity of the patches did not change after insertion. After penetration, the quencher strand was added to the HMN patches and a reduction in fluorescence signal was observed. The reduction of fluorescence signal intensity of the patches applied to skin or agarose were then measured and compared. The fluorescence signal reduction in HMNs penetrated through skin was 98% and 29% of the ones inserted into blank agarose hydrogel for glucose and ATP aptamer probes, respectively, (
[0337] The RFMID was then employed for glucose (
[0338] To determine the shortest timescale for effective capture of target analytes, glucose-RFMID patches were applied on the porcine skin equilibrated with various concentrations of glucose for different durations. 2 min of microneedle patch administration was found to be sufficient to capture glucose (
[0339]
[0340] In Vivo Glucose Detection in Animal Models of Diabetes
[0341] Having demonstrated the platform's ability to detect glucose in vitro and ex vivo sensitively and accurately, its performance in vivo was evaluated using a streptozotocin-induced rat model of diabetes. Prior to the animal experiment, the cytotoxicity of the composite materials was evaluated in NIH-3T3 fibroblast cells using MTT assay (see 1.5 Supplementary Information). Results showed that NIH-3T3 fibroblast viability was not significantly influenced, suggesting that the RFMID materials were biocompatible. RFMID patches were inserted on the rat's dorsal skin side (
[0342] The RFMID patches for glucose detection were applied at different time points and kept on the skin for 5 min (
[0343]
[0344] 1.3 Conclusions
[0345] Herein is demonstrated the first technology to combine HMN arrays with aptamer probes to summon their merits for reagentless and minimally invasive target detection. A comprehensive characterization has been shown for HMN patches functionalized with aptamer probes where addition of the aptamer probes did not have a significant effect on the swelling ability or mechanical strength of the patches. Experiments in skin specimens equilibrated with varying concentrations of glucose or ATP indicate that the sensor has high sensitivity and specificity to detect clinically relevant concentrations of both analytes, with a LOD of 1.1 mM for glucose and 0.1 mM for ATP. In vivo experiments in awake diabetic rats confirmed the RFMID ability to measure changes in glucose with no need for adding any reagents and highlighted the RFMID platform's capacity to detect inter-individual variations in glucose response between animals—a critical feature for clinical implementation. Importantly, RFMID measurements closely matched those obtained with standard clinical glucose sensors.
[0346] Based on the above experimental results, it was considered that RFMID device can be fabricated using any other polymer with C═C for probe binding. The probe can be either aptamer or antibody with appropriate functional group to bind to the hydrogel network.
[0347] It is contemplated that this system could be modified for continuous, real-time measurement in a minimally invasive manner. Aptamer probes have been employed to the continuously measure biomolecules in vivo using electrochemical sensors where the structure switching characteristics of aptamers were integrated with a redox reporter to produce a concurrent electrochemical signal. The aptamer-based electrochemical detection has been applied for continuous measurement of different metabolites and drugs, however, the complicated and invasive design (i.e., insertion into the vein that requires surgery) and/or the short monitoring capacity (a few hours) are key shortcomings. The presently disclosed microneedles can be deployed as an integrated technology to continuously collect individual patient molecular profiles in a minimally invasive manner, allowing continuous and prolonged measurement of any targets of interest, such as drugs with narrow therapeutic range.
[0348] Finally, it is to be emphasized that the RFMID system is a platform that could be readily modified to measure other circulating analytes in vivo, for which aptamers pairs are available, thus making it potentially a versatile tool for diverse biomedical applications.
[0349] 1.4 Methods
[0350] Materials
[0351] The Pharma-grade sodium Hyaluronic acid (HA, MW 300 KDA) was purchased from Bloomage Co., Ltd (China). 1×PBS, Dimethyl sulfoxide (DMSO, 25-950-CQC), was purchased from Corning, USA. Irgacure 2959 (photo initiator, PI), N′-methylenebisacrylamide (MBA), methacrylic anhydride (MA), glucose and ATP solution and other chemicals were purchased from Sigma Aldrich (Canada). 100 mM ATP solution (R0441) was purchased from Thermo Fisher. The porcine ear skin was obtained from a local supermarket. All the aptamer and displacement strand were purchased from Integrated DNA technologies. Sequence of ATP.sup.29 and glucose.sup.28 aptamer and competitor strands were obtained from literature. Sequence and modification of all aptamer and competitor strands are indicated in Table 2.
TABLE-US-00002 TABLE 2 Sequence and modification of aptamer and competitor strands Internal Name 5′ mod mod 3′ mod Sequence Glucose aptamer 5ACryd iCy3 CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCA TTGTCGTCCC; SEQ ID NO. 13 (Acrydite-Cy3-CTCTCGGGACGACCGTGTGTGTTGCTC TGTAACAGTGTCCATTGTCGTCCC; SEQ ID NO. 13) Glucose competitor 3DAb GGTCGTCCCGAGAG; SEQ ID NO. 14 (GGTCGTCCCGAGAG-Dabcyl; SEQ ID NO. 14) ATP aptamer 5ACryd iCy3 CACCTGGGGGAGTATTGCGGAGGAAGG; SEQ ID NO. 15 (Acrydite-Cy3-CACCTGGGGGAGTATTGCGGAGGAAG G; SEQ ID NO. 15) ATP competitor 3DAb TTTTCCAGGTG; SEQ ID NO. 16 (TTTTCCAGGTG-Dabcyl; SEQ ID NO. 16) Acryd-acrydite modification Cy3-Cyanine 3 modification Dab-Dabcyl modification
[0352] Synthesis and Characterization of MeHA
[0353] MeHA was synthesized based on the modified protocol established by Poldervaart et al.sup.21. 2.0 g HA was dissolved in 100 mL Millipore water and stirred overnight under 4 degree for complete dissolving. Subsequently, 1.6 mL MA was added into HA solution and 3.6 mL of 5N NaOH solution was added to adjust the solution to pH 8-9. The mixture was stirred overnight under 4 degree to complete the reaction. Next, MeHA was precipitated by acetone and washed three times with ethanol. Subsequently, precipitated MeHA was redissolved in Millipore water and was dialyzed for 2 days to remove the impurity. The purified MeHA was lyophilized for 3 days. Eventually, 2 -5 mg of MeHA was dissolved in 1 mL Deuterium oxide (D.sub.2O) (Sigma Aldrich, 151882) and then tested with 300 MHz .sup.1HNMR with 10 ms time scale. The degree of methacrylate modification was determined by integration of methacrylate proton signals at 6.1, 5.7, and 1.8 ppm to the peak at 1.9 ppm related to the N-acetyl glucosamine of HA.sup.22.
[0354] Fabrication of RMFID
[0355] For each RMFID patch, 50 mg MeHA, 1 mg PI and 1 mg of MBA were dissolved in 1.25 mL of glucose or ATP aptamer binding buffer. The MeHA solution was then sonicated for 5 min to remove the bubbles. Subsequently, 0.5mL of MeHA solution was deposited on a negative polydimethylsiloxane (PDMS) mold (Micropoint, Singapore), and degassed for 90 s.
[0356] After drying at room temperature for 5 hours, another 0.75 mL of MeHA solution was casted on the mold followed by drying at room temperature for 10 hours. Next, 10 μL of aptamer-quencher strand solution composed of 1 μM aptamer and 10 μM corresponding quencher strand with 15 min pre-hybridization was loaded on the HMN followed by drying at 45 degrees for 30 min. Dry HMN patches were then crosslinked by UV light with 360 nm wavelength for 15 min. The RMFID patches were washed twice with 10 μM of glucose or ATP aptamer binding buffer and dried under 45 degrees. Last, MN patches were carefully separated from PDMS molds and further crosslinked for 5 mins. After being trimmed, the RMFID patches were observed under a fluorescence microscope (Nikon, Ti2). The fabricated needles of the RMFID patch were 850 μm in height, 250 μm in base width and 500 in internal spacing.
[0357] Chemical Characterization
[0358] The Fourier-transform infrared spectroscopy (FTIR, Bruker Hyperion 3000 FTIR Microscope) was conducted to study the crosslinked degree of HMNs and aptamer functionalization efficiency. The following four samples were made in 1 mL DI water: two samples of 50 mg/mL MeHA solution containing 1 mg/mL photo initiator (MeHA); one sample of 50 mg/mL MeHA solution containing 1 mg/mL photo initiator and 1 mg/mL MBA (MeHA+MBA); and one sample of 50 mg/mL MeHA solution containing 1 mg/mL photo initiator and 1 μM aptamer (MeHA+APT). One sample of MeHA, MeHA+MBA and MeHA+APT were crosslinked under UV exposure for 20 min, and then their FTIR spectrum is recorded from 4000 to 400 cm.sup.−1 and were compared with not-crosslinked MeHA sample.
[0359] Mechanical Test and Skin Penetration Efficiency
[0360] The RMFID patches were applied on rat dorsal skin or on the porcine skin for 15 min. Subsequently, the trace on skin was recorded by digital camera every 5 min for 15 mins. The mechanical strength of MN patches was measured using Instron 5548 micro tester equipped with 500N compression loading cell. For each test, the HMN patch was placed flat on its backside (tips facing upwards) on a compression platen. The distance between two platens was set to 1.5 mm. A vertical force was applied (at a constant speed of 0.5 mm/min) by the other platen. The compression loading cell capacity was set to 70 N. The load (force; N) and displacement (distance; mm) was recorded by the testing machine every 0.1 s to create the load-displacement curve.
[0361] In Vitro Cytotoxicity Assay (Evaluation of Biocompatibility)
[0362] The biocompatibility of RMFID was investigated using mouse fibroblast cells (NIH-3T3). Cells were seeded at a density of 50,000 cells per well in a 96-well plate with a final volume of 100 μL. Subsequently, cells were exposed to 10μL of sample solution for 24 hours. The 5mL sample solution contains 50 mg MeHA, 1 mg MBA, 1 mg photo initiator and 10 μL of 1 μM ATP or glucose aptamer solution. 10 μL of DMEM medium solution was used as control. After sample exposure, 10 A of the 5 mg/ml Methylthiazolyldiphenyl-tetrazolium bromide (MTT) (Sigma Aldrich, M5655) solution was added to all wells. Next, the plate was incubated in the absence of light for 3 hours. 150 μI of DMSO was added and gently pipetted to all wells to break up cells and release the formazan crystals. The absorbance of the samples was then obtained at 540 nm using a spectrophotometer.
[0363] Swelling Studies
[0364] A 1.4 wt % agarose (Sigma Aldrich, A0169) hydrogel was prepared in DI water. The dry mass (W.sub.0) of HMNs were measured before applying through agarose. Then the HMNs were penetrated to the agarose through a layer of parafilm and swelled for 10 min. Next, wet mass (W.sub.t) of the swelled HMN patches was measured. The swelling ratio of HMNs was calculated based on the below formula:
[0365] Assessing Rhodamine B Recovery Rate
[0366] A 1.4wt % agarose hydrogel containing 100 mg/mL (Co) Rhodamine B (Rho B) (Sigma Aldrich, R6626) was prepared. HMN patches with crosslink time of 5, 10, 15, 20 min were weighted, and their dry mass (W.sub.0) was recorded. Next, HMNs were punched into RhoB agarose through parafilm for 10 min. After measuring the wet mass (W.sub.t), the swelled HMN was mixed with 300 μL (V) Millipore water in a centrifuge tube followed by a 5 min centrifugation at 10 K rpm.sup.4. Subsequently, 80 μL of recovered solution was transferred into a 96-well plate to measure the absorbance at 552 nm. The Rho B recovery rate were calculated based on the following formula.
[0367] In the equation, C.sub.0 refers to the initial RhoB concentration (100 mg/mL), C.sub.t is the detected RhoB concentration recovered from MN, V is the volume of recovered solution (300 μL), and (W.sub.t−W.sub.0)÷ρ is the volume of solution absorbed by MN.
[0368] Assessing Glucose Recovery Rate
[0369] To evaluate the capability of the RFMID for glucose recovery, three groups of samples were prepared: a group of blank HMN patches without aptamer probe functionalization and two groups of HMN patches functionalized with glucose aptamer probes (Glu apt HMN). After measuring the dry mass (W.sub.0), HMNs were penetrated to 1.4 wt % agarose containing varying glucose concentration of 3.5, 5, 10, 20 mM for 10 min. After measuring the wet mass (W.sub.t), one group of HMN patches functionalized with aptamer probes was sonicated for 10 min and named as Glu apt-US HMN. Subsequently, all the HMN were mixed with 300 μL (V) Millipore water in a centrifuge tube followed by 5 min centrifugation at 2,100 rcf. Subsequently, 250 μL of recovered solution was transferred into a 96-well plate and the recovered glucose concentration was measured using a glucose (GO) assay kit purchased from Sigma (GAGO20). Glucose recovery rate was defined by the following formula.
[0370] C.sub.0 refers to the initial glucose concentrations (3.5, 5, 10, 20 mM), C.sub.t is the detected glucose concentration recovered from MN, V is the volume of recovered solution (300 μL), (W.sub.t−W.sub.0)÷ρ is the volume of solution absorbed by HMN.
[0371] In Vitro Glucose and ATP Measurement
[0372] The Fluorescence intensity (FI) of the RFMID was recorded by the fluorescent microscope from the base side. The RFMID patches with ATP or glucose aptamer probe were applied on 1.4 wt % agarose hydrogels containing various concentrations of ATP (0, 0.25, 0.5, 1, 2, 4 mM) or glucose (0, 3.5, 5, 10, 20, 32 mM) for 10 min, respectively. Next, the fluorescent 5 intensity of the RFMID after target detection was recorded. Finally, the corresponding needles were identified and the fluorescence intensity difference before and after target capturing were measured and calculated by subtracting FI before target capture from the FI after target capture.
[0373] Assessing Specificity of RMFID
[0374] The RMFID functionalized with glucose or ATP aptamer probe was punched into the 1.4 wt % agarose containing 10 mM glucose and 0, 1, 2, 4 mM ATP, or 1 mM ATP and 0, 5, 10, 20 mM glucose for 10 min, respectively. The fluorescence intensity of RMFID before and after being applied on agarose was recorded by fluorescent microscope.
[0375] Ex Vivo Glucose and ATP Measurement
[0376] After being rinsed with DI water and trimmed to 1 cm by 1 cm square, porcine ear skins were equilibrated in 1×PBS with various concentrations of ATP (0, 0.25, 0.5, 1, 2, 4 mM) or glucose (0, 3.5, 5, 10, 20, 32 mM) overnight. Subsequently, fluorescent intensity RFMID patches were recorded with the fluorescence microscope from the base side. Next, ATP or glucose RFMID patches were applied on porcine skin equilibrated with ATP or glucose for 5 min, respectively. Tegaderm tape (3M) was used to fix RFMID patches on the skin. After drying under room temperature, the RFMID patches were observed under the fluorescence microscope and their fluorescent intensity was recorded. Similar to the in vitro experiment, the fluorescent intensity difference of RFMID before and after target capturing was calculated.
[0377] In Vivo Glucose Measurement in Diabetic Rats
[0378] Animal studies were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals and the Animal Welfare Act Regulations; all protocols were approved by the University of Toronto Institutional Animal Care and Use Committee. An established model of T1D, the streptozotocin (STZ)-induced diabetic rat, was used to explore the in vivo performance of RFMID. Male Sprague Dawley rats (Charles River, 100-150 gr) were injected with STZ (65 mg/kg i.p.) that destroys the host's pancreatic beta-cells secreting insulin.sup.35. After the STZ injection, the rats were monitored for 1 week and their blood glucose was measured every 2 days using a glucose meter (OneTouch® Ultra®, LifeScan, Inc., USA). Diabetic rats with blood sugar stabilized above 17 mM were selected for this study. Before starting experiments, the rats were fasted for 5 hours. Rat skin was then shaven, treated with hair removal cream, and dried prior to MN patch application. RFMID patches for ISF glucose detection were prepared and their fluorescence intensity was measured. The baseline blood and ISF glucose level of rats were measured by glucometer and RFMID, respectively. Subsequently, 4 units of insulin were injected to the rats subcutaneously and blood glucose levels were tracked by glucometer every 5 min. The RFMID patches were applied on rats' skin and fixed with Tegaderm tape for 5 min, when blood glucose level decreased to certain ranges (5 ranges in total): T0: 25-35 mM, T1: 15-25 mM, T2: 10-15 mM, T3: 5-10 mM, T4: 3-5 mM. After reaching to hypoglycemia regime, 0.5 mL of 30% glucose solution was intraperitoneally injected into the rats, followed by another two time-point ISF glucose measurements by RFMID. After drying at room temperature, RFMID patches were observed under the microscope and their fluorescence intensity was recorded. Rats' ISF glucose levels were calculated by interpolating the fluorescence intensity difference before and after detection into the ex vivo RFMID glucose detection calibration curve.
[0379] Statistical Analysis
[0380] All the statistical analysis was conducted using GraphPad Prism 9. The statistical difference between groups in biocompatibility test, RFMID specificity test and swelling experiment was analyzed using ordinary one-way ANOVA with Tukey's multiple comparison test. In glucose recovery experiment, the statistical difference between different HMN groups and various glucose concentrations were analyzed using two-way ANOVA with Geisser-Greenhouse correction. The significance of statical difference was calculated with 95% confidence interval (P<0.05) and shown in GP style (0.1234 (ns), 0.0332 (*), 0.0021 (**), 25 0.0002 (***), <0.0001 (****)) in graphs. Each experiment contains three parallel replicates. All data is expressed as mean±s.d. For in vitro and ex vivo glucose and ATP measurement, fluorescence signal raw data after subtracting the background signal was used to calculate the calibration curves using the sigmoidal 4PL nonlinear regression model. The LOD is defined as the minimum target concentration that can be detected by the presently described RFMID 30 device and calculated by interpolating the mean fluorescence signal of control group plus three times of s.d. into the corresponding calibration curve.
[0381] 1.5 Supplementary Information
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389] 1.5.1 Further Supplementary Information
[0390] Materials
[0391] The Pharma-grade sodium Hyaluronic acid (HA, MW 300 KDA) was purchased from Bloomage Co., Ltd (China). 1×PBS, Dimethyl sulfoxide (DMSO, 25-950-CQC), was purchased from Corning, USA. Irgacure 2959 (photo initiator, PI), N′-methylenebisacrylamide (MBA), methacrylic anhydride (MA), glucose, L-tyrosinamide (T3879), and ATP solution and other chemicals were purchased from Sigma Aldrich (Canada). 100 mM ATP solution (R0441) and 5.7 mg/mL human alpha-thrombin native protein (RP-43100) were purchased from Thermo Fisher (Canada). The porcine ear skin was obtained from a local supermarket. All the aptamer and displacement strand were purchased from Integrated DNA technologies (IDT). Sequence of ATP[29] and glucose[40] aptamer and competitor strands were obtained from literature. Sequence and modification of all aptamer and competitor strands are indicated in Table 3.
[0392] Fabrication of RMFID
[0393] For each RMFID patch, 50 mg MeHA, 1 mg PI and 1 mg of MBA were dissolved in 1.25 mL of glucose or ATP aptamer binding buffer. The MeHA solution was then sonicated for 5 min to remove the bubbles. Subsequently, 0.5mL of MeHA solution was deposited on a negative polydimethylsiloxane (PDMS) mold (Micropoint, Singapore), and degassed for 90 s. After drying at room temperature for 5 hours, another 0.75 mL of MeHA solution was casted on the mold followed by drying at room temperature for 10 hrs. Next, 10 μL of aptamer-quencher strand solution composed of 1 μM glucose or ATP aptamer and 10 μM corresponding quencher strand, 2 μM L-tyrosinamide aptamer and 2.5 μM quencher strand or 1 uM of thrombin aptamer-quencher complex with 15 min pre-hybridization was loaded on each HMN followed by drying at 45 degrees for 30 min. This follows by adding another layer of MeHA on top to form the base of the patch. Consecutive adding of MeHA solution and aptamer-quencher complex solution rather than adding a mixture of MeHA and aptamer solution at once reduces the background signal since the aptamer-quencher complex is added only to the needle area, i.e., the base of the patch does not fluoresce. Dry HMN patches were then crosslinked by UV light with 360 nm wavelength for 15 min. The RMFID patches were washed twice with 10 μM of glucose, ATP, L-tyrosinamide or thrombin aptamer binding buffer and further dried under 45 degrees. Last, MN patches were carefully separated from PDMS molds and further crosslinked for 5 mins. After being trimmed and taped on a clean glass slide, the RMFID patches were observed under a fluorescence microscope (Nikon, Ti2). The fabricated needles of the RMFID patch were 850 μm in height, 250 μm in base width and 500 in internal spacing.
[0394] In Vitro and Ex Vivo Characterization of RFMID
[0395] To investigate the sensor's capability for biomolecule detection, a series of experiments were conducted to measure varying concentrations of glucose (
[0396] Upon successful detection of target analytes in agarose hydrogel, the sensor capability for in situ biomarker measurement was tested using an ex vivo skin model. First, the stability of aptamer probes in the skin environment against nucleases present in the skin was examined. To this end, functionalized HMN patches with only aptamer probes were applied through a blank porcine skin or agarose hydrogel (with no nucleases present). It was observed that the fluorescence intensity of the patches did not change after insertion. After penetration, the quencher strand was added to the HMN patches and a reduction in fluorescence signal was observed. The reduction of fluorescence signal intensity of the patches applied to skin or agarose were then measured and compared. The fluorescence signal reduction in HMNs penetrated through skin was 98%, 29%, 97%, and 91% of the ones inserted into blank agarose hydrogel for glucose, ATP, L-tyrosinamide, and thrombin aptamer probes, respectively, (
[0397] The RFMID was then employed for glucose (
[0398] To determine the shortest timescale for effective capture of target analytes, glucose-RFMID patches were applied on porcine skin equilibrated with various concentrations of glucose for different durations. 2 min of microneedle patch administration was found to be sufficient to capture and detect glucose (
TABLE-US-00003 TABLE 3 Sequence and modification of aptamer and competitor strands Name 5′ mod Internal mod 3′ mod Sequence (5′ to 3′) Glucose aptamer 5Acryd iCy3 CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGT CCATTGTCGTCCC (SEQ ID NO. 13) Glucose competitor 3Dab GGTCGTCCCGAGAG (SEQ ID NO. 14) ATP aptamer 5Acryd iCy3 CACCTGGGGGAGTATTGCGGAGGAAGG (SEQ ID NO. 15) ATP competitor 3Dab TTTTCCAGGTG (SEQ ID NO. 16) L-tyrosinamide 5Acryd iCy3 GGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC; aptamer SEQ ID NO. 17; (Acrydite-Cy3-GGAGCTTGGATTGATGTGGTGTGT GAGTGCGGTGCCC; SEQ ID NO. 17) L-tyrosinamide 3Dab TCACATCAAT; SEQ ID NO. 18 competitor (TCACATCAAT-Dabcyl; SEQ ID NO. 18) Thrombin 5Acryd iCy3 3Dab CCAAC(CH.sub.2CH.sub.2O).sub.30GGTTGGTGTGGTTGG; aptamer- isp18 SEQ ID NO. 19 competitor (Acrydite-Cy3-CCAAC-(CH.sub.2CH.sub.2O).sub.30-GGTTGGT complex GTGGTTGG-Dabcyl; SEQ ID NO. 19) Thrombin 5Acryd iCy3 GGTTGGTGTGGTTGG; SEQ ID NO. 20 aptamer (Acrydite-Cy3-GGTTGGTGTGGTTGG; SEQ ID NO. 20) Thrombin 3Dab TTTTTCAACC; SEQ ID NO. 21 competitor (TTTTTCAACC-Dabcyl-SEQ ID NO. 21) Acryd-acrydite modification Cy3-Cyanine 3 modification Dab-Dabcyl modification Isp 18-internal Spacer 18 modification
TABLE-US-00004 TABLE S1 Comparison of RFMID's response time with similar MN-based sensors Capture Washing Blocking Detection Washing Total time FLISA.sup.1 30 s-20 min 10 min 30 min 120 min incubation with 10 min 200 min-220 min Ab + 30 min incubation with plasmonic fluor Aptamer 60 min 10 min — 60 min incubation with 10 min 140 min decorated MN FAM labeled aptamer array.sup.2 Encoded 40 min 10 min — 120 min incubation with 10 min 180 min MNs.sup.3 detection Ab RFMID 2 min — — — — 2 min
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405] 1.6 Background, Example 1 References [0406] 2. Samant, P. P. et al. Sampling interstitial fluid from human skin using a microneedle patch. Sci. Transl. Med. 12, 571-606 (2020). [0407] 4. Chang, H. et al. A Swellable Microneedle Patch to Rapidly Extract Skin Interstitial Fluid for Timely Metabolic Analysis. Adv. Mater. 29, 83-122 (2017). [0408] 16. Zheng, M. et al. Osmosis-Powered Hydrogel Microneedles for Microliters of Skin Interstitial Fluid Extraction within Minutes. Adv. Healthc. Mater. 9, 1-11 (2020). [0409] 18. Zhu, J. et al. Gelatin Methacryloyl Microneedle Patches for Minimally Invasive Extraction of Skin Interstitial Fluid. Small 16, 1-9 (2020). [0410] 20. Wang, Z. et al. Microneedle patch for the ultrasensitive quantification of protein biomarkers in interstitial fluid. Nat. Biomed. Eng. 5, 64-76 (2021). [0411] 21. Poldervaart, M. T. et al. 3D bioprinting of methacrylated hyaluronic acid (MeHA) hydrogel with intrinsic osteogenicity. PLoS One 12, 1-15 (2017). [0412] 22. Bencherif, S. A. et al. Influence of the degree of methacrylation on hyaluronic acid hydrogels properties. Biomaterials 29, 1739-1749 (2008). [0413] 26. Il'icheva, I. A., Nechipurenko, D. Y. & Grokhovsky, S. L. Ultrasonic cleavage of nicked DNA. J. Biomol. Struct. Dyn. 27, 391-398 (2009). [0414] 27. Nakatsuka, N. et al. Aptamer-field-effect transistors overcome Debye length limitations for small-molecule sensing. Science. 362,319-324 (2019). [0415] 28. Poudineh, M. et al. A fluorescence sandwich immunoassay for the real-time continuous detection of glucose and insulin in live animals. Nat. Biomed. Eng. 5,53-63 (2021). [0416] 29. Wilson, B. D., Hariri, A. A., Thompson, I. A. P. & Eisenstein, M. Independent Control of the Thermodynamic and Kinetic Properties of Aptamer Switches. Nat. Commun. 10, 1-22 (2019). [0417] 31. Boyne, M. S. et al. Timing of Changes in Interstitial and Venous Blood Glucose Measured with a Continuous Subcutaneous Glucose Sensor. Diabetes 52,2790-2794 (2003). [0418] 35. GhavamiNejad, A. et al. Glucose-Responsive Composite Microneedle Patch for Hypoglycemia-Triggered Delivery of Native Glucagon. Adv. Mater. 31,1-7 (2019). [0419] 37. Yi, K. et al. Aptamer-decorated porous microneedles arrays for extraction and detection of skin interstitial fluid biomarkers. Biosens. Bioelectron. 190, (2021). [0420] 38. Zhang, X., Chen, G., Bian, F., Cai, L. & Zhao, Y. Encoded Microneedle Arrays for Detection of Skin Interstitial Fluid Biomarkers. Adv. Mater. 31, 1-8 (2019). [0421] 39. Nakatsuka, N.; Yang, K.; Abendroth, J. M.; Cheung, K.; Yang, H.; Zhao, C.; Zhu, B.; Rim, Y. S.; Yang, Y.; Weiss, P. S.; Andrews, A. M.; Angeles, L.; Angeles, L.; States, U.; Angeles, L.; Angeles, L.; States, U.; Approaches, T.; States, U.; Science, B.; Behavior, H.; Angeles, L.; States, U.; Angeles, L.; States, U.; States, U. Aptamer-Field-Effect Transistors Overcome Debye Length Limitations for Small-Molecule Sensing. Science (80-.). 2019, 362 (504901225), 319-324. https://doi.org/10.1126/science.aao6750.Aptamer-field-effect. [0422] 40. Poudineh, M.; Maikawa, C. L.; Ma, E. Y.; Pan, J.; Mamerow, D.; Hang, Y.; Baker, S. W.; Beirami, A.; Yoshikawa, A.; Eisenstein, M.; Kim, S.; Vuĉković, J.; Appel, E. A.; Soh, H. T. A Fluorescence Sandwich Immunoassay for the Real-Time Continuous Detection of Glucose and Insulin in Live Animals. Nat. Biomed. Eng. 2021, 5 (1), 53-63. https://doi.org/10.1038/s41551-020-00661-1. [0423] 41. Wilson, B. D.; Hariri, A. A.; Thompson, I. A. P.; Eisenstein, M.; Soh, H. T. Independent Control of the Thermodynamic and Kinetic Properties of Aptamer Switches. Nat. Commun. 2019, 10 (1), 1-9. https://doi.org/10.1038/s41467-019-13137-x. [0424] 42. Feagin, T. A.; Olsen, D. P. V.; Headman, Z. C.; Heemstra, J. M. High-Throughput Enantiopurity Analysis Using Enantiomeric DNA-Based Sensors. J. Am. Chem. Soc. 2015, 137 (12), 4198-4206. https://doi.org/10.1021/jacs.5b00923. [0425] 43. Tang, Z.; Mallikaratchy, P.; Yang, R.; Kim, Y.; Zhu, Z.; Wang, H.; Tan, W. Aptamer Switch Probe Based on Intramolecular Displacement. J. Am. Chem. Soc. 2008, 130 (34), 11268-11269. https://doi.org/10.1021/ja804119s. [0426] 44. Laffel, L. Ketone Bodies: A Review of Physiology, Pathophysiology and Application of Monitoring to Diabetes. Diabetes. Metab. Res. Rev. 1999, 15 (6), 412-426. https://doi.org/10.1002/(SICI)1520-7560(199911/12)15:6<412::AID-DMRR72<3.0.CO;2-8. [0427] 45. Dungan, K.; Verma, N. Monitoring Technologies—Continuous Glucose Monitoring, Mobile Technology, Biomarkers of Glycemic Control. Endotext. 2000. [0428] 46. Wang, Z.; Luan, J.; Seth, A.; Liu, L.; You, M.; Gupta, P.; Rathi, P.; Wang, Y.; Cao, S.; Jiang, Q.; Zhang, X.; Gupta, R.; Zhou, Q.; Morrissey, J. J.; Scheller, E. L.; Rudra, J. S.; Singamaneni, S. Microneedle Patch for the Ultrasensitive Quantification of Protein Biomarkers in Interstitial Fluid. Nat. Biomed. Eng. 2021, 5 (1), 64-76. https://doi.org/10.1038/s41551-020-00672-y. Also Reference (1) in Table 51. [0429] 47. Yi, K.; Wang, Y.; Shi, K.; Chi, J.; Lyu, J.; Zhao, Y. Aptamer-Decorated Porous Microneedles Arrays for Extraction and Detection of Skin Interstitial Fluid Biomarkers. Biosens. Bioelectron. 2021, 190 (March). https://doi.org/10.1016/j.bios.2021.113404. Also Reference (2) in Table S1. [0430] 48. Zhang, X.; Chen, G.; Bian, F.; Cai, L.; Zhao, Y. Encoded Microneedle Arrays for Detection of Skin Interstitial Fluid Biomarkers. Adv. Mater. 2019, 31 (37), 1-8. https://doi.org/10.1002/adma.201902825. Also Reference (3) in Table 51.
Example 2
A hydrogel Microneedle Assay Combined with Nucleic Acid Probes for On-Site Detection of Small Molecules, Proteins, and Ribonucleic Acids
[0431] A Versatile Microneedle Biosensor.
[0432] Point of care testing (POCT) of clinical biomarkers is important to health monitoring and timely treatment, yet biosensing assays capable of detecting biomarkers without the need for costly external equipment and reagents are limited. Blood-based assays are, specifically, challenging as blood collection can be invasive while pre-processing is required. Herein described is a versatile assay that employs hydrogel microneedles (HMNs) to extract interstitial fluid (ISF), the fluid underneath of skin, in a minimally invasive manner and graphene oxide-nucleic acid (GO.NA)-based fluorescence biosensor to sense the biomarkers of interest in situ. The HMN-GO.NA assay may be supplemented with a portable detector, enabling a complete POCT procedure. The herein described system may successfully measure six clinically important biomarkers (glucose, uric acid, insulin, and serotonin as well as microribonucleic acid 210 and 21) ex-vivo, in addition to accurately detecting glucose and uric acid in-vivo.
[0433] Herein described is a sample-in answer-out biosensing platform for detection of various biomarkers applicable to point-of-care-testing.
[0434] Introduction
[0435] Point-of-care testing (POCT) is generally conducted close to the site of patient care and enables rapid turn-around of results, fast clinical actions, and patient-centered care. POCT is growing rapidly, and its global market could be worth $68.6 billion USD by 2030. To date, blood has been used as the main source of biomarkers; however, blood processing can be labor-intensive, time-consuming, and requires sophisticated clinical equipment, making its use for POCT less favorable. Blood sampling can also be painful and can be challenging for some patients (children, critically ill, and elderly). A promising alternative to blood is interstitial fluid (ISF) which is originated from blood and fills the extracellular space; thus, it has common biomarkers with plasma/serum while also containing biomarkers unique to the local cells. A wide range of metabolites, including amino acids, lipids, and nucleotides as well as protein biomarkers can be detected in ISF, emphasizing the potential of ISF for health monitoring 9.
[0436] Microneedle (MN)-based biosensors have emerged as a promising approach for ISF monitoring. They enable minimally invasive penetration through the skin for ISF access and sensing. Off-MN and on-MN biosensors have been reported for analysis of biomarkers of clinical relevance. In the off-MN format, the collected ISF is recovered and used for subsequent analysis. The on-MN refers to the assays in which the recognition elements are integrated, thus enabling on-needle analysis. On-MN assays potentially eliminate the need for sample processing and can be employed for POCT. For instance, solid MNs coated with specific enzymes have been developed to electrochemically detect glucose and ketone bodies—the cause of diabetic ketoacidosis. A flexible MN coated with enzymes has been also reported to simultaneously detect glucose, uric acid, and cholesterol, but has not been tested for in-vivo application.sup.18. Solid MNs integrated with miniaturized electronics have been used to enzymatically detect glucose, alcohol, and lactate in human subjects. Despite these significant achievements, enzyme-based biomarker detection is limited to a narrow range of biomarkers for which an enzyme is available. Non-enzymatic MNs immobilized with antibodies or aptamers have also been reported, but their detection strategy relies on the addition of extra reagents, complicating their POCT application.
[0437] Herein described is an HMN assay that incorporates graphene oxide-nucleic acid (GO.NA) optical sensors for POCT and sensing. The GO.NA optical sensor consists of GO nanosheets conjugated to fluorophore-modified nucleic acid (NA), in which GO acts as a quencher. Single-stranded NA has high affinity for binding to GO, therefore, in the absence of biomarker of interest the NAs are tightly bound to GO; in turn, their fluorophore tag is quenched. However, in the presence of a specific biomarker, the NAs bind to their target, inducing a conformational change that distances the fluorophore tag from GO, leading to fluorescence recovery and generation of an optical signal. GO also acts as a substrate for NA immobilization; therefore, protects the NA from degradation and inhibits potential NA release from HMN-GO.NA. Further, GO quenches the fluorophores, eliminating the need for a quencher-modified displacement strand. To enable microscope-free patch visualization and optical measurements for POCT, further developed was a miniaturized smartphone-based system that captures fluorescence images of the HMN-GO.NA patches (A and B of
[0438]
[0439] Versatility of the HMN-GO.NA was investigated by employing two different types of NAs as the recognition element, aptamer and a probe deoxynucleic acid (pDNA), and detecting a range of different analytes including small molecules, proteins, and micro ribonucleic acids (miR). Aptamers were employed to detect glucose, uric acid (UA), serotonin, and insulin while pDNAs were used to detect miR21 and miR210. Table 4 below outlines the nucleic acid sequences used with their modification. The four biomarkers detected were considered to be of clinical importance for health monitoring. Continuous monitoring and POCT of glucose and insulin levels have long been considered important for diabetic management and mitigation of insulin over/under dose. Changes in UA levels are generally recognized as an important diagnosis and prognosis factor in many multifactorial disorders like obesity, metabolic syndrome, and hypertension UA monitoring can be particularly important in cancer patients who undergo chemo and radiotherapy. Serotonin can be important in regulating certain body functions such as mood, sleep, digestion, nausea, wound healing, bone health, and blood clotting. miRes, a class of small non-coding NAes, are generally considered to act as diagnostic and prognostic biomarkers for various cancers, including breast, colon and lung cancer. More specifically, the levels of miR21 and miR 210 are considered to be associated with tumor size, degree of invasion, and cancer stage. Micro ribonucleic acids (also abbreviated as miRNA) may be used also be used for tracking disease treatment effectiveness. For example, the ratio of biomarker miR210 to miR21 may be used as an indicator for drug treatment success. The HMN-GO.NA described herein showed precise analyte detection both in-vitro and ex-vivo. Further, the assay performance was examined for detection of glucose and uric acid in-vivo, in diabetic rat models. The herein described HMN-GO.NA biosensor along with the miniaturized imager provide a practical solution for disease diagnosis and health monitoring in POCT.
[0440] Results
[0441] HMN-GO.NA Sensing Strategy
[0442] To make HMN-GO.NA assay, a mixture of hydrogel and GO.NA was prepared followed by MN fabrication using the micromolding technique. The fabricated HMNs consisted of an array of 10×10 needles with a height of 850 μm and are capable of penetrating the skin, reaching the epidermis, and extracting ISF in a minimally invasive manner. In the GO.NA complex, the NA was conjugated to a fluorophore tag (Cy3) and acted as the biorecognition element; recognizing its specific biomarker and binding to it, while GO acted as the quencher element, quenching the fluorophore tag in the absence of the biomarker. GO was linked to two different types of NAs: aptamers for small molecule, metabolite, as well as protein detection, and probe DNA (pDNA) for miR detection. As illustrated in of
[0443] HMN-GO.NA Fabrication and Characterization
[0444] To fabricate the HMN-GO.NA patches, hyaluronic acid (HA), a highly biocompatible polymer, was modified with methacrylic anhydride to form the methacrylated HA (MeHA) as the hydrogel backbone. MeHA has been previously used for the fabrication of HMN arrays and has displayed a high degree of swelling, allowing increased ISF extraction and improved sensing.sup.21,37. HMN-GO.NA was then fabricated using a two-layer micro-molding technique. The first layer or the needle region is composed of a mixture of a hydrogel and GO.NA which was injected to the mold (
[0445] Investigated were two approaches to make the GO.NA complex: covalent bonding and physical adsorption (physisorption). In the covalent bonding approach, a covalent bond was formed between the carboxyl groups of GO and the amine groups on the amine-modified NA strands, resulting in the covalent complex of GO.NA. In the physisorption approach, pi-pi stacking and hydrophobic interactions between the NA rings and the hexagonally shaped carbons in GO produced the strongly conjugated GO.NA complex. To assess the fluorescence quenching capability of GO, HMN-GO.NA was fabricated where NA was linked to GO either covalently or physically, and the HMN patches were imaged using a microscope. In the absence of GO or a quencher-conjugated displacement strand, a strong fluorescence signal was observed (
[0446] Next characterized was the interaction of GO with the MeHA hydrogel network. GO contains carboxyl groups which can act as the hydrogen acceptor and form hydrogen bonds with the amine and/or hydroxyl groups present in the MeHA hydrogel. To show the formation of such hydrogen bonds between GO and MeHA, Fourier Transform Infrared (FTIR) spectroscopy was performed on hydrogel and hydrogel-GO films. The N-H stretching vibration peak at 3300 in the hydrogel-only spectrum shifted to 3305 in the hydrogel-GO spectrum, indicating the formation of hydrogen bonds. The N—H bending peak at 1610 also shifted to 1600 in the hydrogel-GO spectrum, further suggesting hydrogen bond formation between GO and the MeHA hydrogel.sup.44,46. Even though GO is highly biocompatible, the formation of hydrogen bonds between GO and MeHA hydrogel ensured effective GO entrapment inside the microneedles and relieved any concern regarding potential GO release. Also studied was the release of NA from HMN-GO.NA patches (
[0447]
[0448] Ex-Vivo Validation of HMN-GO.NA Assay for Biomarker Detection
[0449] After studying the characteristics of HMN-GO.NA assay, its performance was tested for detection of a diverse range of biomarkers, including small molecules (UA, glucose, and serotonin), proteins (insulin), and ribonucleic acids (miR21 and miR210). The fabricated HMN-GO.NA patches were tested using agarose hydrogel (
[0450] Next studied was the detection of insulin, a small protein hormone secreted from the pancreas with a physiological range of 0.1-3 nM, using the assay . Insulin regulates glucose levels in the blood and its monitoring is needed for diabetes management 26. The response of the HMN-GO.Insulin.aptamer patches linearly correlated with insulin concentration showing a LOD of 1.3 μM (
[0451] To detect miR210 and miR21, HMN-GO.pDNA patches were prepared and applied on skins containing different concentrations of the target miR. The observed fluorescent response from HMN-GO-pDNA patches increased as higher concentrations of miR 210 and miR 21 were present (
[0452]
[0453] Next studied was the selectivity of the HMN assay for the detection of specific biomarkers in the presence of other interfering biomarkers. Porcine skins containing certain concentrations of all the tested biomarkers (UA, glucose, insulin, and serotonin for non-NA targets and miR210, and miR21 for NA targets) were prepared and HMN-GO.NA patches specific to each target were applied on them. The patch response was then compared with the ones calculated from the experiments with no interferences. The percentage accuracies of 64, 123, 85, 103, 86, 93 were acquired for glucose, insulin, UA, serotonin, miR210, and miR21, respectively. Unlike other patches with accuracy percentages near 100%, HMN-GO.glucose.aptamer patch showed 64% accuracy, which may be due to using physisorbed GO.glucose aptamer conjugate. Physisorption is a physical form of linkage and may be more prone to nonspecific detachment.
[0454] These results demonstrated that HMN-GO.NA assay can be applied for rapid, accurate, and specific identification of a range of different analytes including small molecules, proteins, and miRs, highlighting the universality of the assay.
[0455] A Portable, Smartphone-Based Detector for POCT Setting
[0456] Although fluorescence-based biosensors provide high sensitivity, an obstacle is their need for sophisticated and bulky microscope imagers that can trigger the fluorophores, capture the emitted signal, and visualize the images. To address this challenge and enable the HMN-GO.NA assay for on-site, POCT biomarker detection, a miniaturized optic system and fluorescence imagers was developed, consisting of a laser diode, microscopic objective, and filter as shown in
[0457] HMN-GO.NA patches for UA and glucose detection were prepared, applied on porcine skins containing different concentrations of the targets, and visualized using the developed miniaturized optic system, and the images were analyzed using the freely available software. An increased fluorescence response was observed when higher concentrations of UA and glucose were present in the porcine skin (
[0458]
[0459] In-Vivo UA and Glucose Detection in an Animal Model of Diabetes
[0460] The levels of serum uric acid (SUA) are generally found to be elevated in diabetic patients. The elevated SUA level acts as a key risk factor predicting diabetic-associated complications like stroke, kidney deterioration, and fatty liver disease necessitating SUA monitoring in diabetic patients in addition to glucose. The available at-home UA test kits like HumaSens.sup.plus and UASure require fingertip punctures, which can hinderfrequent UA measurement and discomforts patients—specifically children and elderly patients—raising the need for a painless and convenient UA test. Further, the at-home UA test kits like UASure, cannot detect UA concentrations lower than 170 μM limiting their application for diagnosis of certain diseases associated with low UA level.sup.60,62. Importantly, 100% of the SUA can also be found in ISF, qualifying a MN-based UA detection method. Thus, employed was the HMN-GO.NA patches to identify levels of UA and glucose in diabetic rats, considering the importance of UA and glucose measurement. To confirm that the patches would not evoke any inflammatory response, hematoxylin and eosin (H&E) staining was performed on the parts of skin that were inserted with HMN patches (
[0461]
[0462] Discussion
[0463] In the presented work, an GO.NA optical sensor was integrated with HMN arrays; thereby, leveraging from the competitive advantages that HMN offers (such as biocompatibility, simpler fabrication process, and higher ISF extraction) as well as the versatility of the GO.NA sensors. In the GO.NA conjugate, the NA component was tagged with a fluorophore and acted as the recognition element; while the GO component quenched the fluorophore tag when the biomarkers of interest were not present. It was demonstrated that the GO could successfully quench fluorophore tags; thus, providing a versatile quenching mechanism that fits different types of NA probes (including but not limited to single stranded complementary probe DNA, aptamer, peptide nucleic acid, nucleic acid enzyme, or combinations thereof). Incorporating GO in HMN did not impose a significant change on the swelling ratio of HMN patches, but increased the mechanical strength of patches. The GO was entrapped in the hydrogel matrix by forming hydrogen bonds, preventing GO as well as NA releases.
[0464] Employed were two different types of single-stranded NAs namely, aptamer and pDNA (single-stranded NA complementary to miR) in the HMN-GO.NA patches to detect a wide range of biomarkers considered to be clinically important ,as well as miRs presented in ISF. HMN-GO.NA assay was tested for six clinically important biomarkers: UA, glucose, serotonin, insulin, miR210, and miR 21. Additionally, the HMN-GO.NA design was compatible with both covalent (all the GO.NAs except GO.glucose.aptamer) and physiosorbed GO.NA (GO-glucose.aptamer) conjugates, further advancing the versatility of the technique. Moreover, a smartphone-based detector was designed and assembled which allows the HMN-GO.NA implementation at POCT setting. The developed HMN-GO.NA assay was also used to identify the ISF UA and ISF glucose levels in diabetic rats, results of which were compared to a benchmark assay and further validated the accurate performance of HMN-GO.NA assay.
[0465] The developed HMN-GO.NA assay may be useful for POCT testing and adaptable for the simultaneous detection of multiple biomarkers. For example, simultaneous detection of glucose and insulin, which is needed for high-quality diabetic management. To enable the HMN-GO.insulin.aptamer for detecting insulin at the physiological ranges (0.05-3 nM), the obtained LOD for insulin could be decreased by 1000 fold, which can be achieved by employing strategies like utilizing an insulin aptamer with higher affinity to insulin, amplifying the fluorescence signal by using a stronger fluorophore like quantum dots, and retaining the insulin target in the detection cycle for several rounds by degrading the insulin-bound aptamer. HMN-GO.serotonin.aptamer assay also demonstrated a great capacity for accurately detecting serotonin at biological and pathological ranges. The prototyped smartphone-based detector could effectively detect and visualize fluorescence responses from HMN patches. Use of the smartphone-based detector may be further enabled by preserving consistent parameters for each component by fixing them in a black box, and using an internal image analyzer.
[0466] Method
[0467] Synthesize of MeHA
[0468] MeHA was synthesized based on the modified protocol established above. Briefly, 2.0g HA was dissolved in 100 mL Millipore water and stirred overnight under 4 degrees for complete dissolving. Subsequently, 1.6 mL MA was added to the HA solution followed by stepwise addition of 3.6 mL of 5N NaOH solution was added to adjust the solution to pH 8 9. The mixture was stirred overnight under 4 degrees to complete the reaction. Next, MeHA was precipitated by acetone and washed three times with ethanol. Subsequently, precipitated MeHA was redissolved in Millipore water and was dialyzed for 5 days to remove the impurity. The purified MeHA was lyophilized for 3 days.
[0469] Synthesize of GO. NA Conjugates
[0470] Amine-modified NAs were covalently linked to GO using a modified protocol from [24]. Briefly, 100 μg/mL GO was mixed with freshly prepared 10 mM N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride EDC-HCl, 25 mM NaCl, 25 mM 2-(N-morpholino)ethanesulfonic acid MES, and 2 μM amine-modified NA in a medium of water. The mixture was stirred at room temperature for 3 hours, and the GO.NA complex was purified by 20 minutes of centrifugation at 14000 rpm followed by 2 times washing with nuclease-free water. After the last centrifugation, the GO.NA pellet was dispersed in buffer A (100 mM NaCl, 25 mM HEPES, pH 7.6, 1 mM MgCl.sub.2) and stored at 4° C. refrigerator which is stable up to one month.
[0471] The physisorbed GO.glucose.aptamer was prepared following a previously reported method [36]. Briefly, 400 μg/mL GO and 8 μM aptamer, were mixed and incubated overnight in a medium of 150 mM Buffer A (150 mM NaCl, 25 mM HEPES, pH 7.5, 1 mM MgCl.sub.2). The following day, the mixture was washed 3 times with 150 mM Buffer A and 6 minutes of centrifugation at 8000 rpm. After the final wash, the GO-aptamer conjugate was redispersed in 150 mM Buffer A and stored at 4° up to one month.
[0472] HMN-GO. NA Fabrication
[0473] To fabricate the HMN-GO.NA patches, first 50 mg of MeHA, 1 mg of photoinitiator (2-hydroxy-4-2-hydroxy-2methylpropiophenome, refered to herein as PI), and 1 mg and N,N′-Methylenebisacrylamide (MBA) per patch were mixed. Then 10 mM Buffer A (10 mM NaCl, 25 mM HEPES, pH 7.6, 1 mM MgCl.sub.2 in nuclease-free water) was added to achieve a concentration of 100 mg/mL MeHA. The solution was sonicated and mixed occasionally until the MeHA, PI, and MBA were completely dissolved, and a clear mixture was obtained.
[0474] To cast the first layer (needle layer) of HMN-GO.NA, 150 μL of the prepared 100 mg/ml MeHA with an equivalent volume of the desired GO.NA solutions were mixed and de-bubbled by being left covered for 15-20 minutes in the dark at an ambient condition. 300 μL of the MeHA-GO.NA mixture was deposited on a negative polydimethylsiloxane (PDMS) mold (Mioint, Singapore), and vacuumed for 90 seconds. The MeHA-GO.NA was dried for 5 hours at room temperature, followed by the addition of the second layer (base layer) containing 700 μL of 50 mg/mL MeHA. The patches were dried overnight in the dark at room temperature. The patches were removed from the molds and cured under UV light for 40 minutes with the needles facing up.
[0475] Chemical Characterization
[0476] The Fourier-transform infrared spectroscopy (FTIR, Bruker Hyperion 3000 FTIR Microscope) was conducted to study the chemical bonds for MeHA hydrogel and MeHA hydrogel-GO films. To prepare the MeHA hydrogel films, MeHA hydrogel mixture (containing 50 mg/mL MeHA +1 mg/mL of MBA and photoinitiator) was made, dried overnight, and crosslinked under UV for 40 minutes. The MeHA-GO hydrogel film was prepared by mixing 300 A of the MeHA mixture with an equal volume of 100 μg/mL GO followed by similar steps as making MeHA hydrogel film. The FTIR spectrum is recorded from 400-4000 cm.sup.−1 and the peaks at 1600-1610 and 3300-3305 have been assigned to N-H bending and stretching, respectively.
[0477] Electron Microscopy Imaging
[0478] To visualize the HMN-GO.NA array, an HMN-GO.NA patch was prepared, coated with a 2 nm thick layer of gold and imaged using a Hitachi SU5000 FESEM. To visualize and analyze MeHA, MeHA-GO, and MeHA-GO.NA pore sizes, thin films were prepared and allowed to swell in water for 20 minutes. The films were then snap-frozen with liquid nitrogen and freeze-dried for 48 hours followed by being coated with a 2 nm thick layer of gold and imaged using a Hitachi SU5000 FESEM.
[0479] Swelling Studies
[0480] The prepared HMN, HMN-GO, and HMN-GO.NA patches were prepared and weighed (W.sub.0). A 1.4 wt % agar gel was prepared and covered with a thin layer of parafilm. The patches were inserted into the agar through the parafilm for and incubated for 10 minutes. The patches were then removed and immediately weighed (W.sub.T). To calculate the swelling ratio, the following formula was used:
[0481] Mechanical Test
[0482] The mechanical strength of HMN, HMN-GO, and HMN-GO.NA patches were measured using Instron 5548 micro tester equipped with a 500N compression loading cell. For each test, the HMN patch was placed flat on its backside (tips facing upwards) on a compression platen. The distance between two platens was set to 1.5 mm. A vertical force was applied (at a constant speed of 0.5 mm/min) by the other platen. The compression loading cell capacity was set to 70 N. The load (force; N) and displacement (distance; mm) was recorded by the testing machine every 0.1 s to create the load-displacement curve.
[0483] NA Release Experiments
[0484] The following patches were prepared as mentioned above: HMN only, HMN mixed with 2 μM Cy3 ATP aptamer solution, HMN-GO.ATP.aptamer (the covalent form), and HMN-GO.ATP.aptamer (the physisorbed form). The release experiment was performed for three soaking times: 5 minutes, 10 minutes, and 30 minutes. Each patch was soaked in a solution consisting of 100 μL of 1× PBS with 4 mM ATP. After the soaking time, the patches were removed from their solutions. The solutions were diluted 1:10 using 1× PBS. 50 μL of the 1:10 solutions were aliquoted per well in a 96-well plate and fluorescence readings were performed. To account for any possible change in the fluorescent intensity caused by the HMN es, the fluorescent intensity obtained from all the conditioned was normalized to the fluorescent intensity obtained from HMN-only patches.
[0485] In-Vitro Testing
[0486] The HMN-GO.NA patches were prepared and imaged under the fluorescence microscope (Nikon, Ti2) with 10 ms exposure. 1.4 wt % agar gels containing the desired concentrations of the biomarkers of interest were prepared and covered with parafilm. The patches were applied on agar through the thin parafilm for 10 minutes, removed from the gel, and dried for 10 minutes under ambient conditions and at dark. Their fluorescence images were taken and the corresponding fluorescence response for each patch was calculated. The following buffers were used to prepare agar gels containing each biomarker of interest: Ringer's Buffer (147 mM NaCl, 4 mM KCl, 2.25 mM CaCl2, pH=7) for glucose, uric acid buffer (120 mM NaCl, 1 mM MgCl2, 20 mM Tris-HCl, 5 mM KCl, pH=7.4) for UA, serotonin buffer (1× PBS with 2 mM MgCl2, pH=7.4.) for serotonin, and insulin buffer (10 mM Buffer A (10 mM NaCl, 25 mM HEPES, pH 7.6, 1 mM MgCl2 in nuclease-free water) for insulin.
[0487] Ex-Vivo Testing
[0488] For the ex-vivo experiments, porcine skins (pig skin ears) were trimmed to 1 cm by 1 cm squares, rinsed with DI water, and equilibrated with different concentrations of the biomarkers of interest in their specific buffers. The skin-biomarker equilibration time for glucose, UA, and miR was 16 hours, but this equilibration time was 8 hours for serotonin and insulin due to their less stable nature. HMN-GO.NA patches were then prepared, and their baseline fluorescence intensity was recorded by the fluorescence microscope. The patches were then inserted into dried and biomarker-equilibrated porcine skin and fixed using Tegaderm tape. After 5 minutes, the patches were removed from the skin and left in dark under the ambient conditions to completely dry. The fluorescent intensity of patches after skin application was recorded based and patch responses were calculated based on which the associated calibration curves were drawn.
[0489] Specificity Test
[0490] For the biomarker specificity experiment, trimmed and washed porcine skins were equilibrated with a buffer (1× PBS, 2 mM KCl, 20 mM Tris-HCl, 2 mM MgCl.sub.2 at pH 7.4) containing 10 mM glucose, 200 μM UA, 5 μM insulin, and 2 μM serotonin. For miR specificity experiments, the prepared porcine skins were equilibrated in buffer A containing 200 nM miR210 and miR21. HMN-GO.NA patches specific to each biomarker were fabricated as outlined before and their baseline fluorescence intensity was recorded by a fluorescence microscope. The patches were then applied to the porcine skins containing a mixture of different biomarkers, removed after 5 minutes, left to dry, and imaged with the fluorescence microscope. The obtained patch fluorescent responses were interpolated in the established ex-vivo calibration curves based on which the concentrations of captured biomarkers were calculated. The patch's percentage accuracies are defined as “[1−(calculated concentration of biomarker/actual concentration of biomarker present in skin)]*100%”.
[0491] H&E Staining
[0492] HMN-GO.NA patches were applied on the shaved dorsal rat skin for 5 minutes. The rat was euthanized 5 minutes (for cavity visualization) and 1 hour (for inflammatory marker visualization) after removing the HMN-GO.NA patches and the skin sections were cut and washed with 0.9% NaCl solution. The samples were fixed with neutral buffered 10% formalin for 24 hours, then stored in 70% ethanol and refrigerated. Fixed skin samples were cryopreserved in 15% sucrose/PBS solution at 4C overnight. Following cryopreservation, samples were briefly rinsed in PBS to remove residual sucrose. Samples were mounted on cork using OCT (TissueTek), frozen in isopentane cooled by liquid nitrogen, and stored at −80C. 10-micron sections were cut using a cryostat maintained at −20C and mounted on microscope slides. Hematoxylin and eosin (H&E) stains were used to identify the basic morphology of skin samples. Slides were stained with Harris-modified hematoxylin (Sigma, HHS32) for 30-seconds, washed in distilled water, and counterstained with 1% Eosin Y (Sigma, E4009) for 2 minutes. Slides were washed in distilled water, dehydrated in 75% and 95% ethanol, and cleared in Xylene prior to mounting with Permount mounting medium (Fisher Scientific, SF15). Images were acquired using a Cytation-5 multimode imager (Agilent). Images were obtained at 20× magnification and stitched together using the Gen5 software (Agilent).
[0493] In-Vivo Measurement of Glucose and Uric Acid
[0494] In-vivo experiments were done following the Guidelines for the Care and Use of Laboratory Animals and the Animal Welfare Act Regulations; all protocols were approved by the University of Waterloo Institutional Animal Care and Use Committee. To examine the performance of HMN-GO.glucose.aptamer and HMN-GO.UA.aptamer, an established model of streptozotocin (STZ)-induced diabetic rat was used. Male Sprague Dawley rats (Charles River, 100-150 gr) were injected with STZ (65 mg/kg) which destroys the host's pancreatic beta-cells secreting insulin. The STZ-injected rats were monitored for 1 week and their blood glucose was measured every 2 days using a glucose meter (OneTouchR UltraR, LifeScan, Inc., USA). Diabetic rats with blood sugar stabilized above 17 mM were selected for this study. Before applying the HMN-GO.glucose.aptamer patches, the rats fasted for 5 hours. The fasting blood and ISF glucose levels were measured by a glucometer and HMN-GO.glucose.aptamer, respectively. Subsequently, 4 units of insulin were injected into the rats and blood glucose levels were tracked by glucometer every 5 min. The HMN-GO.glucose.aptamer patches were applied to rat's skin and fixed with Tegaderm tape, when blood glucose levels reached certain ranges of >30 mM, 20-30 mM, 10-20 mM, and <10 mM. For two of the rats, subsequent to the final decrease in blood glucose, the rats were fed to increase blood glucose to about 20 mM, when another round of HMN-GO.glucopse.aptamer patches were applied (T4: 15-20 mM).
[0495] Totally, the blood and ISF glucose levels were tested at five-time points in each rat. The removed patches were dried at room temperature and used for post-insertion imaging.
[0496] HMN-GO.UA.aptamer patches were applied to ten individual male Sprague Dawley rats; three diabetic and seven healthy rats. The prepared HMN-GO.UA.aptamer patches were applied to the dorsal skin of rats for five minutes during which their blood was also collected from the tail vein using a blood collection system (Microvette® CB 300, Kent Scientific Corporation). The collected blood was then clotted by being left undisturbed at room temperature for 30 minutes, followed by centrifugation at 2000 g and at 4 degrees for 10 minutes. The resultant blood serum was collected and tested for uric acid concentration using the fluorometric uric acid assay kit (abcam, ab65344) following the product's instructions.
[0497] Rat skin was shaved, treated with hair removal cream, and cleaned prior to all HMN applications and the HMN was applied on rats for a total of five minutes. After the five minutes application, the removed patches were dried at room temperature and used for post-insertion imaging. To calculate the fluorescent response of patches, the HMN-GO.glucose.aptamer and HMN-GO.UA.aptamer patches were once imaged before skin application and once post-skin application. Rats' ISF UA and glucose levels were calculated by interpolating the fluorescent response into the ex vivo detection calibration curves.
[0498] Smartphone-Based Fluorescence Imaging Setup
[0499] The smartphone-based fluorescence imaging system was enclosed by a custom-made Blackbox with a provision to change the sample. The HMN-GO.NA was taped to the microscopic glass slide that was illuminated/excited by a 532 nm diode laser (10 mW) driven by a 3V battery. The fluorescence signal was collected through a 4× objective lens (Olympus, NA=0.10, WD=18.5 mm) and bandpass filter (Ø25 mm, CWL=570 nm, FWHM=10 nm). A 3D printed laser holder was used to maintain a low incident angle (˜10°) of the laser beam to the sample. The fluorescence image of the MN patch was taken by a Smartphone (Model-iPhone 13) and analyzed by ImageJ software.
[0500] Statistical Analysis
[0501] The statistical analysis was conducted using GraphPad Prism 9. The statistical difference between the swelling ratio of HMN, HMN-GO, and HMN-GO.NA was examined using the student T-test. Each experiment was performed in three replicates unless otherwise stated. All data are expressed as mean and the error bars represent the SEM. The calibration curves for both ex-vivo and in-vitro experiments were drawn based on patch fluorescent response. The response is defined as [F (fluorescent intensity after patch application)−F.sub.0 (fluorescent intensity before patch application)]/F.sub.0 (fluorescent intensity before patch application). The concentration of biomarkers for in-vivo experiments was determined by interpolating the obtained response in the ex-vivo calibration curves. The LOD is defined as the minimum target concentration that can be reliably detected by our HMN-GO.NA assay and is calculated using the method introduced by Armbruster et al.sup.70.
TABLE-US-00005 TABLE 4 Nucleic acid sequences used in Example 2 with their modification, selected from the literature references and ordered from IDT-Integrated DNA Technologies. Literature Nucleic acid sequences Biomarkers Reference /5Cy3/CTCTCGACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCGT/ Uric Acid (3) 3AmMO/ (SEQ ID NO. 22) (UA) /5Cy3/CTCTCGGGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCG Glucose (4) TCCC (SEQ ID NO. 23) /5AmMC6/GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC/3Cy3/ Insulin (5, 6) (SEQ ID NO. 24) /5AmMC6/GACTGGTAGGCAGATAGGGGAAGCTGAT/iCy3/TCGATGCGTGG Serotonin (4) GTC (SEQ ID NO. 25) /5Cy3/CACCTGGGGGAGTATTGCGGAGGAAGG/3AmMO/ Adenosine (2) (SEQ ID NO. 26) three phosphates (ATP) pDNA Biomarkers /5Cy3/TCAGCCGCTGTCACACGCACAG/3AmMO/ (SEQ ID NO. 27) miR210 /5Cy3/TCAACATCAGTCTGATAAGCTA/3AmMO/ (SEQ ID NO. 28) miR21 Cy3-Cyanine 3 modification 5AmMC6 is 5′ Amino Modifier C6 modification 3AmMO is 3′ Amino Modifier modification
Example 2
Supplementary Information
[0502] Demonstrating Proof of Concept for HMN-GO.NA Using ATP Aptamer
[0503] Since ATP aptamer repetitively demonstrated desired binding affinity to its biomarker (adenosine three phosphates abbreviated as ATP) it was decided to first demonstrate the concept using this aptamer. Therefore, HMN-GO.ATP.aptamers were fabricated and applied on agarose gels containing different concentrations of ATP (
[0504]
[0505]
[0506]
Example 2
References
[0507] 2. B. D. Wilson, A. A. Hariri, I. A. P. Thompson, M. Eisenstein, H. T. Soh, Independent control of the thermodynamic and kinetic properties of aptamer switches. Nat Commun. 10, 1-9 (2019). [0508] 3. Y. Liu, J. Liu, Selection of DNA Aptamers for Sensing Uric Acid in Simulated Tears. Analysis & Sensing (2022), doi:10.1002/anse.202200010. [0509] 4. N. Nakatsuka, K. A. Yang, J. M. Abendroth, K. M. Cheung, X. Xu, H. Yang, C. Zhao, B. Zhu, Y. S. Rim, Y. Yang, P. S. Weiss, M. N. Stojanović, A. M. Andrews, Aptamer-field-effect transistors overcome Debye length limitations for small-molecule sensing. Science (1979). 362, 319-324 (2018). [0510] 5. W. Yoshida, E. Mochizuki, M. Takase, H. Hasegawa, Y. Morita, H. Yamazaki, K. Sode, K. Ikebukuro, Selection of DNA aptamers against insulin and construction of an aptameric enzyme subunit for insulin sensing. Biosens Bioelectron. 24, 1116-1120 (2009). [0511] 6. Y. Wu, B. Midinov, R. J. White, Electrochemical aptamer-based sensor for real-Time monitoring of insulin. ACS Sens. 4, 498-503 (2019). [0512] 9. Yang, J. et al. Recent Progress in Microneedles-Mediated Diagnosis, Therapy, and Theranostic Systems. Adv Healthc Mater (2022) doi:10.1002/adhm.202102547. [0513] 18. Gao, J., Huang, W., Chen, Z., Yi, C. & Jiang, L. Simultaneous detection of glucose, uric acid and cholesterol using flexible microneedle electrode array-based biosensor and multi-channel portable electrochemical analyzer. Sens Actuators B Chem 287, 102-110 (2019). [0514] 24. Liu, Z. et al. Intracellular detection of ATP using an aptamer beacon covalently linked to graphene oxide resisting nonspecific probe displacement. Anal Chem 86, 12229-12235 (2014). [0515] 36. Wu, M., Kempaiah, R., Huang, P. J. J., Maheshwari, V. & Liu, J. Adsorption and desorption of DNA on graphene oxide studied by fluorescently labeled oligonucleotides. Langmuir 27, 2731-2738 (2011).60. Kuo, C. S. et al. Portable electrochemical blood uric acid meter. J Clin Lab Anal 16, 109-114 (2002). [0516] 62. Cho, S. K., Chang, Y., Kim, I. & Ryu, S. U-Shaped Association Between Serum Uric Acid Level and Risk of Mortality: A Cohort Study. Arthritis and Rheumatology 70, 1122-1132 (2018). [0517] 70. Armbruster, D. A. & Pry, T. Limit of blank, limit of detection and limit of quantitation. Clin Biochem Rev 29 Suppl 1, S49-52 (2008).
[0518] The embodiments described herein are intended to be examples only. Alterations, modifications and variations can be effected to the particular embodiments by those of skill in the art. The scope of the claims should not be limited by the particular embodiments set forth herein, but should be construed in a manner consistent with the specification as a whole.
[0519] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0520] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modification as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.