PROBE-INDUCED HETERODUPLEX MOBILITY ASSAY

Abstract

The present invention relates to a method for distinguishing a first nucleic acid sequence from a second nucleic acid sequence by electrophoresis. The first nucleic acid comprises a first common sequence tract, a variable sequence tract and a second common sequence tract and the second nucleic acid comprises a first common sequence tract, optionally an variable sequence tract and a second common sequence tract. The first and the second nucleic acid sequence is contacted with a probe sequence that is reverse complementary to the first and second common sequence tract under conditions allowing the hybridization of the probe sequence to the first and second nucleic acid sequence, thereby forming a first probe hybrid and a second probe hybrid. Subsequently, the first and second probe hybrids are submitted to electrophoresis to detect the electrophoretic mobility of the first and second probe hybrid.

Claims

1. A method for distinguishing a first nucleic acid sequence from a second nucleic acid sequence by electrophoresis, wherein the first nucleic acid sequence S1 comprises a first 5′ common sequence tract C1, and a first variable sequence tract V1 of 1 to 10 nucleotides, immediately adjacent in 3′ direction to C1; and a first 3′ common sequence tract C2 positioned in 3′ direction of C1; the second nucleic acid sequence S2 comprises a second 5′ common sequence tract C1′, and a second, optional, variable sequence tract V2 of 1 to 10 nucleotides, immediately adjacent in 3′ direction to C1′; and a second 3′ common sequence tract C2′ positioned in 3′ direction of C1′; and wherein the first 5′ common sequence tract C1 is identical to the second 5′ common sequence tract C1′, or C1′ is 1 to 9 nucleotides shorter at the 3′ end than C1 and C1′ is identical to C1 from the 5′ end of C1/C1′; and the first 3′ common sequence tract C2 is identical to the second 3′ common sequence tract C2′, or C2′ is 1 to 9 nucleotides shorter at the 5′ end than the first 3′ common sequence tract C2 and C2′ is identical to C2 from the 3′ end of C2/C2′; and with the proviso that S1 and S2 with respect to their sequence tracts C1-V1-C2 and C1′-V2-C2′ differ from each other in length by ≤10 nucleotides; said method comprising: contacting the first nucleic acid sequence and the second nucleic acid sequence with a probe sequence P, said probe sequence consisting, in 5′ to 3′ orientation, of a sequence RC2 that is reverse complementary to the 3′ common sequence tract C2 and a sequence RC1 that is reverse complementary to the 5′ common sequence tract C1, under conditions allowing the hybridization of the probe sequence to the first and second nucleic acid sequence, thereby forming a first probe hybrid and a second probe hybrid, and subsequently submitting the first and second probe hybrids to electrophoresis and detecting the electrophoretic mobility of the first and second probe hybrid.

2. The method according to claim 1, wherein the length of the first nucleic acid sequence S1 and the length of the second nucleic acid sequence S2 is between 40 nucleotides and 3500 nucleotides, particularly between 150 and 250 nucleotides, more particularly between 180 and 220 nucleotides.

3. The method according to claim 1, wherein the first nucleic acid sequence S1 comprises at least (≥) 5, particularly ≥35, more particularly ≥47 nucleotides immediately adjacent in 5′ direction to the first 5′ common sequence tract C1 and at least 5, particularly ≥35, more particularly ≥47 nucleotides immediately adjacent in 3′ direction to the first 3′ common sequence tract C2 and the second nucleic acid sequence S2 comprises at least 5, particularly ≥35, more particularly ≥47 nucleotides immediately adjacent in 5′ direction to second 5′ common sequence tract C1′ and at least 5, particularly ≥35, more particularly ≥47 nucleotides immediately adjacent in 3′ direction to the second 3′ common sequence tract C2′.

4. The method according to claim 1, wherein the total length of the sum of the first 5′ common sequence tract C1 and the first 3′ common sequence tract C2 is between 18 and 3500 nucleotides, particularly between 18 and 80 nucleotides.

5. The method according to claim 1, wherein the ratio between the length of the first 5′ common sequence tract C1 and the length of the first 3′ common sequence tract C2 is between 1:7 to 7:1, particularly between 3:5 and 5:3, more particularly 1:1, wherein the minimum length of the first 5′ common sequence tract C1 and of the first 3′ common sequence tract C2 is 5 nucleotides.

6. The method according to claim 1, wherein the first variable sequence tract V1 and the second variable sequence tract V2 have independently from each other a length between 4 and 10 nucleotides, particularly between 4 and 6 nucleotides.

7. The method according to claim 1, wherein the first variable sequence tract V1 differs from the second variable sequence tract V2 in length and/or the base sequence and/or composition of the first variable sequence tract V1 differs from the base sequence and/or composition of the second variable sequence tract V2 in at least one position.

8. The method according to claim 1, wherein the length of the first variable sequence V1 tract differs from the length of the second variable sequence tract V2 in ≤10 nucleotides, particularly in ≤2 nucleotides, more particularly in one nucleotide.

9. The method according to claim 1, wherein the composition of the first variable sequence tract V1 differs from the composition of the second variable sequence tract V2 in two positions, particularly in one position.

10. The method according to claim 1, wherein the first nucleic acid sequence S1 is hybridized to its reverse complementary sequence, and/or the second nucleic acid sequence S2 is hybridized to its reverse complementary sequence.

11. The method according to claim 1, wherein the probe sequence P is hybridized to its reverse complementary sequence.

12. The method according to claim 1, wherein the first probe hybrid and the second probe hybrid are obtained by applying a temperature above the melting point of the first and second nucleic acid sequence followed by applying a temperature below the melting point of the probe sequence.

Description

DESCRIPTION OF THE FIGURES

[0131] Sequences shown in the Figures are referenced separately immediately after the Figure description.

[0132] FIG. 1 shows an overview of HMA (A), prePRIMA (B) and PRIMA (C). HMA is difficult to produce detectable peak with heteroduplex mobility shift caused by 1 bp deference (a). On the other hand, prePRIMA (b) and PRIMA (c) are able to produce heteroduplex peaks from wild type and 1 bp indel sequences. WT; wild type, mt; mutant, Homo; Homozygous, Hetero; Heterozygous, sss; short single strand. Red lines of PCR fragment represent 1 bp insertion mutation. Green and red arrowheads indicate heteroduplex peak from wild type and mutant, respectively. Black circle above the electropherogram indicates mixture of homoduplex peak and undistinguishable heteroduplex peaks. Star indicates homoduplex peak.

[0133] FIG. 2 shows an exemplary sequence and probe design. Alignment of a first sequence (51), a second sequence (S2) and a probe (P). The first variable sequence tract V1 has a length of 5 nucleotides, the second variable sequence tract has a length of 4 nucleotides. X: no nucleotide (deletion with regard to V1); C1: first 5′ common sequence tract; C1′: second 5′ common sequence tract (identical to C1); C2: first 3′ common sequence tract; C2′ second 3′ common sequence tract (identical to C2); RC1: sequence reverse complementary to C1; RC2: sequence reverse complementary to C2; black lines: first and second sequence.

[0134] FIG. 3 shows an exemplary sequence and probe design. Alignment of a first sequence (S1), a second sequence (S2) and a probe (P). The first variable sequence tract V1 has a length of 5 nucleotides. X and Y: no nucleotide (deletion with regard to V1); C1: first 5′ common sequence tract; C1′: second 5′ common sequence tract (3 nucleotides shorter than C1); C2: first 3′ common sequence tract; C2′ second 3′ common sequence tract (identical to C2); RC1: sequence reverse complementary to C1; RC2: sequence reverse complementary to C2; black lines: first and second sequence.

[0135] FIG. 4 shows heteroduplex peaks from wild type and 1 bp insertion/deletion mutant in plant (a, b and c), bacteria (d) and human (c) DNA fragments detected by prePIRMA. Arrow heads indicate. Star indicates homoduplex peak.

[0136] FIG. 5 shows the detection of 0 to 7 bp gap sequences of RDP1 with HMA by using 130 bp (b) and 300 bp (c) of PCR fragments.

[0137] FIG. 6 shows the detection of 0 to 7 bp gap sequences of DML1 with HMA by using 153 bp (b) and 300 bp (c) of PCR fragments.

[0138] FIG. 7 shows Detection of 0 to 7 bp gap sequences with HMA. (a) RDP1, (b) DML1. Red arrowheads indicate heteroduplex peaks. Star indicates homoduplex peak.

[0139] FIG. 8 shows that a probe of PRIMA does not work when the mutation position is close to edge of the DNA fragment (a,b,c) and probe length was not affected to heteroduplex peak (c). No heteroduplex peak was formed using primer pair (red arrows) close to mutation position (a and b). On the other hand, heteroduplex peaks were produced when mutation position is close to middle of DNA fragment. (green arrows, a and c) Note that no big difference was detected by using 40 mer probe and 80 mer probe (c). Star indicates homoduplex peak.

[0140] FIG. 9 shows the electrophoresis patterns from 10 bp deletion to 10 bp insertion sequences with PRIMA. A. RDP1 sequences. 225 bp sequence of RDP1 was used this analysis. Red arrows indicate primer regions and blue arrow indicates probe region. Used 10 bp deletion to 10 bp insertion sequences are shown below. B and C. Poly acrylamide gel images with PRIMA. Red stars indicate homoduplex peaks. Red and blue arrowheads indicate heteroduplex from wild type and mutant sequences, respectively. Electrophoresis patterns from 10 bp deletion (del) to wildtype are shown in B and from wild type to 10 bp insertion (ins) are shown in C. D and E. MultiNA images with PRIMA. Red stars indicate homoduplex peaks. Red and blue arrowheads indicate heteroduplex from wild type and mutant sequences, respectively. Electrophoresis patterns from 10 bp deletion (del) to wildtype are shown in D and from wild type to 10 bp insertion (ins) are shown in E.

[0141] FIG. 10 shows genotyping by using HMA, prePRIMA and PRIMA. (a) Workflow of HMA for genotyping. HMA needs 2 times of analysis. 1.sup.st analysis; sample is re-annealed only with sample itself. When heteroduplex peaks are formed, this sample is heterozygous. No heteroduplex peak indicate this sample is wild type or mutant homozygous. 2.sup.nd analysis; sample is re-annealed with wild type sample. When heteroduplex peaks are produced, this sample is mutant homozygous and if not, this is wild type homozygous. (b) Workflow of PRIMA and prePRIMA for genotyping. Only single analysis needs to detect genotype. Examples for genotyping are shown in (c) for prePRIMA and (d) for PRIMA. Star indicates homoduplex peak.

[0142] FIG. 11 shows genotyping with PRIMA using a 225 bp PCR product of the RDP1 gene and a 40mer probe with a deletion of 5 nucleotides.

[0143] FIG. 12 shows the detection of 1 bp difference from plants (A, B, E, F), human (C and G) and bacteria (D and H) many sequences with PRIMA. Electropherogram patterns were obtained by MultiNA (A-D) and gel images were obtained by polyacrylamide gel electrophoresis (E-H).

[0144] FIG. 13 shows that PRIMA is possible to distinguish type of base (A,T,G and C). To test whether PRIMA is further usable for SNP typing, PRIMA was performed with base-edited sequences (Fig. A) using 2 different probes (Fig. A, B and C). In Fig. B, nucleotide NG and T/C is distinguishable because they produce different heteroduplex peaks. In Fig. C, NG, T and C could be distinguished. These results suggest that PRIMA has the possibility to expand its usage for SNP typing. Fig. A; red arrows indicate primers, green and blue arrows indicate probes using Fig. B (green) and Fig. C (blue). Base-editing point is shown in black arrow. Fig. B, C SNP typing with PRIMA using 5531 probe (B) and 5428 probe(C). Black, green, red and blue arrowheads indicate heteroduplex peaks from A, T, G and C, respectively.

[0145] FIG. 14 shows the detection 1 bp difference with PRIMA. A. Gene construction of RDP1. Red arrows indicate primer regions and blue arrow indicates probe region. Red square shows mutation position. B. Detection of heteroduplex peak using MultiNA, Red star indicates homoduplex peaks and blue arrowheads indicate heteroduplex peaks. C. Detection of heteroduplex peak using poly acrylamide gel. Red star indicates homoduplex peaks and blue arrowheads indicate heteroduplex peaks. Marker (M) sizes are shown at left side. Different size of heteroduplex peaks were detected from 1 ins, wild type and 1del sequence with MultiNA and PAGE.

[0146] FIG. 15 shows the protocol for PRIMA.

[0147] FIG. 16 shows an alternative approach for describing the variable sequence tract V.

[0148] FIG. 17 shows a comparison of deletion or insertion probe with 1-bp indel mutants. Expected bulge structures showed that a deletion probe is simpler and has a more distinguishable bulge than the insertion probe, even though the mutation position is shifted by a few-bp (FIG. 17). Therefore, rather than using a 5-bp insertion probe, preferably a 5-bp deletion probe may be used so that the bulge size would be different from the WT, even when the 1-bp indel position is a few-bp away because exact indel positions induced by a single CRISPR experiment are known to be variable within the range of a few-bp (Nishida et al. Science 353, (2016)). Expected bulge structures are shown in wild type and 1-bp indel mutants which have 5-bp position-shifted mutation (−2 to +3). Deletion probe produces simple and distinguishable bulge structure from all insertion (a) and deletion (b) mutants. On the other hand, insertion probe produces simple bulge structure only “+1” and “+2” from deletion series (a) and “+1” from insertion series (b). Upper strand of heteroduplex figure comes from sample DNA. Lower strand of heteroduplex figure comes from probe DNA. Arrowheads indicate +1 position. Grey line indicates null nucleotide. Purple line indicates 5-bp insertion nucleotide in insertion probe. Red line indicates 1-bp insertion nucleotide in insertion series. Red squares indicate when a different bulge structure compared to the wild type is expected.

SEQUENCES

[0149] The following sequences appear in the Figures:

TABLE-US-00001 FIG. 5a RDP1_ (SEQ ID NO: 001) CTGCAGAAGATGAACTCCGTTCTGGTATCTACAAAGTCTCCAAGGTTT Wild type (SEQ ID NO: 002) GAACTCCGTTCTGGTATCTAC 1 del (SEQ ID NO: 003) GAACTCC TTCTGGTATCTAC 2 del (SEQ ID NO: 004) GAACTCC --TCTGGTATCTAC 3 del (SEQ ID NO: 005) GAACTCC- CTGGTATCTAC 4 del (SEQ ID NO: 006) GAACTCC- TGGTATCTAC 5 del (SEQ ID NO: 007) GAACTCC- GGTATCTAC 6 del (SEQ ID NO: 008) GAACTCC- GTATCTAC 7 del (SEQ ID NO: 009) GAACTCC- TATCTAC FIG. 6a DML1_ (SEQ ID NO: 010) AGCAGCTTTCAACAACCTCCATGGATTCCTCAGAGACCCATGAAGCCAT Wild type (SEQ ID NO: 011) AACAACCTCCATGGATTCCTCA 1 del (SEQ ID NO: 012) AACAACC-CCATGGATTCCTCA 2 del (SEQ ID NO: 013) AACAACC CATGGATTCCTCA 3 del (SEQ ID NO: 014) AACAACC ATGGATTCCTCA 4 del (SEQ ID NO: 015) AACAACC TGGATTCCTCA 5 del (SEQ ID NO: 016) AACAACC -GGATTCCTCA 6 del (SEQ ID NO: 017) AACAACC GATTCCTCA 7 del (SEQ ID NO: 018) AACAACC---ATTCCTCA FIG. 7a RDP1_ Wild type (SEQ ID NO: 019) ACTCCGTTCTGGTATCTA 1 bp del (SEQ ID NO: 020) ACTCC-TTCTGGTATCTA 2 bp del (SEQ ID NO: 021) ACTCC--TCTGGTATCTA 3 bp del (SEQ ID NO: 021) ACTCC---CTGGTATCTA 4 bp del (SEQ ID NO: 022) ACTCC----TGGTATCTA 5 bp del (SEQ ID NO: 023) ACTCC-----GGTATCTA 6 bp del (SEQ ID NO: 024) ACTCC------GTATCTA 7 bp del (SEQ ID NO: 025) ACTCC-------TATCTA FIG. 7b DML1_ Wild type (SEQ ID NO: 026) CAACCTCCATGGATTCC 1 by del : (SEQ ID NO: 027) CAACC  CCATGGATTCC 2 bp del : (SEQ ID NO: 028) CAACC CATGGATTCC 3 bp del : (SEQ ID NO: 029) CAACC ATGGATTCC 4 bp del : (SEQ ID NO: 030) CAACC TGGATTCC 5 bp del : (SEQ ID NO: 031) CAACC GGATTCC 6 bp del (SEQ ID NO: 032) CAACC GATTCC 7 bp del (SEQ ID NO: 033) CAACC ATTCC FIG. 8a Not_ 2 del (SEQ ID NO: 034) TTTCAACAACC--CATGG 1 del (SEQ ID NO: 035) TTTCAACAACC-CCATGG Wildtype (SEQ ID NO: 036) TTTCAACAACCTCCATGG T ins (SEQ ID NO: 037) TTTCAACAACCTCCATGG FIG. 9a DNA fragment with deletion (SEQ ID NO: 038) ...AGAAGATGAACTCC----------CTACAAAGT... (SEQ ID NO: 039) ...AGAAGATGAACTCC---------TCTACAAAGT... (SEQ ID NO: 040) ...AGAAGATGAACTCC--------ATCTACAAAGT... (SEQ ID NO: 041) ...AGAAGATGAACTCC-------TATCTACAAAGT... (SEQ ID NO: 042) ...AGAAGATGAACTCC------GTATCTACAAAGT... (SEQ ID NO: 043) ...AGAAGATGAACTCC-----GGTATCTACAAAGT... (SEQ ID NO: 044) ...AGAAGATGAACTCC----TGGTATCTACAAAGT... (SEQ ID NO: 045) ...AGAAGATGAACTCC---CTGGTATCTACAAAGT... (SEQ ID NO: 046) ...AGAAGATGAACTCC--TCTGGTATCTACAAAGT... (SEQ ID NO: 047) ...AGAAGATGAACTCC-TTCTGGTATCTACAAAGT... wildtype (SEQ ID NO: 048) ...AGAAGATGAACTCCGTTCTGGTATCTACAAAGT... DNA fragment with insertion (SEQ ID NO: 049) (SEQ ID NO: 001)...AGAAGATGAACTCCGATTCTGGTATCTACAA AGT... (SEQ ID NO: 050) ...AGAAGATGAACTCCGAATTCTGGTATCTACAAAGT... (SEQ ID NO: 051) ...AGAAGATGAACTCCGAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 052) ...AGAAGATGAACTCCGAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 053) ...AGAAGATGAACTCCGAAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 054) ...AGAAGATGAACTCCGAAAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 055) ..AGAAGATGAACTCCGAAAAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 056) ...AGAAGATGAACTCCGAAAAAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 057) ...AGAAGATGAACTCCGAAAAAAAAATTCTGGTATCTACAAAGT... (SEQ ID NO: 058) ...AGAAGATGAACTCCGAAAAAAAAAATTCTGGTATCTACAAAGT.. FIG. 13 (SEQ ID NO: 059) CTCTTGGTCGTTCTGCAGAAGATGAACTCCGATTCTGGTATCTACAAAGT CTCCAAGGTTT FIG. 14 1insertion (1ins) (SEQ ID NO: 060) GGTCGTTCTGCAGAAGATGAACTCCGATTCTGGTATCTACAAAGTCTCCA AGGTTTGTGTA Wild type (WT) (SEQ ID NO: 061) GGTCGTTCTGCAGAAGATGAACTCCG_TTCTGGTATCTACAAAGTCTCCA AGGTTTGTGTA 1bpdeletion (idel) (SEQ ID NO: 062) GGTCGTTCTGCAGAAGATGAACTCCTTCTGGTATCTACAAAGTCTCCAAG GTTTGTGTA FIG. 15 Targetseq (SEQ ID NO: 063) GCAGAAGATGAACTCCGTTCTGG 5BP DEL (SEQ ID NO: 064) GTTCTGCAGAAGATGAACTC (SEQ ID NO: 065) TGGTATCTACAAAGTCTCAA

EXAMPLES

Example 1: The Pattern and the Resolution of Heteroduplex Mobility Assay (HMA)

[0150] The inventors tested the band patterns of traditional HMA with MultiNA, Microchip Electrophoresis System from SHIMADZU. A wild type sequence and mutant sequences carrying different lengths of deletions, i.e. 0 bp (wild type) to 7 bp deleted sequences were amplified separately by PCR. Then the PCR product from the wild type was mixed with the PCR product from mutant sequences, respectively. These mixtures are denatured and re-annealed to introduce the heteroduplex complex. If the gap is enough long, the mismatched DNA sequences can arise a bulge caused by looped out bases, resulting in mobility shift (Bhattacharyya and Lilley, 1989 NAR). Similar to the previously shown results, the inventors could not detect 1 bp difference with any heteroduplex peaks (Bhattacharyya and Lilley, 1989 NAR). The heteroduplex peak with 2 bp gap was not clear neither (Ota et al., 2013 Genes Cells, Ansai et al., 2014 Dev Growth Differ).

Example 2: HMA with 5 bp Deletion Probe (prePRIMA)

[0151] The inventors proceeded with the objective of detecting a 1 bp length difference. They tested whether it was possible to distinguish 4 bp (=1 bp deletion), 5 bp (=wild type) and 6 bp (=1 bp insertion) using 5 genes which are either from A. thaliana, bacteria or human. Indeed, the inventors clearly identified the 1 bp insertion and deletion in all cases (FIG. 4). The inventors refer to this technique as prePRIMA (precursive method of Probe-Induced HMA).

[0152] The inventors further examined the effect of PCR fragment sizes and/or different sequences (FIGS. 5 and 6). Fragment with about 200 bp size worked well to detect different heteroduplex peaks among 3 to 7 bp gap fragments (FIG. 7). While shorter fragment (i.e. 130 bp of RDP1 and 153 bp of DML1 in FIG. 5b and FIG. 6a) was not adequate to obtain clear differences. Heteroduplex peaks derived from 300 bp fragments sometimes overlapped with upper marker in our system and cannot be analyzed by using MultiNA chip 500 (FIG. 5c and FIG. 6c).

[0153] The inventors further aimed to optimize the probe design. A probe worked better when it has the gap region overlapped with the mutated site at the middle of the PCR fragment than at the edge of the PCR fragment (FIG. 8).

Example 3: PRIMA with Short Single-Strand DNA (sssDNA) Probe

[0154] It is time-consuming to make a probe with 5 bp deletion in the middle of 200 bp PCR fragment, because it needs 2 step PCR or Cloning (Braman 2004, Springer protocols/Methods in Mol Bio1634). Otherwise, it is possible to order longer oligos but the cost becomes relatively expensive.

[0155] To overcome these obstacles, the inventors examined if a single-strand DNA (ssDNA) may enough to produce a heteroduplex with looped out bases. The results are shown in FIG. 8c. The ssDNA (80mer) was enough to discriminate the 1 bp different sequences. It was also possible to shorten this ssDNA probe to decrease the cost of oligonucleotide synthesis. The inventors found that short ssDNA (sssDNA) such as 40mer would be enough (FIG. 8c). From these findings, the inventors named this method as PRIMA (Probe-Induced Heteroduplex Mobility Assay) with sssDNA. It is also important that the sssDNA prefer to set around middle of the DNA fragment (FIG. 8).

Example 4: Screening by PRIMA

[0156] The inventors tested PRIMA with 10 deletion to 10 insertion mutated sequences of RDP1 (FIG. 9). There are heteroduplex peaks with different sizes of deletion to insertion sequences (FIG. 9). These results suggest that PRIMA can work in mutant screening. This can be a great help to reduce the cost of time and money in the broad range of biological researchers.

Example 5: Genotyping by PRIMA

[0157] Traditional HMA has been used for genotyping, (Ansai et al., 2014 Dev Growth Differ), although, the resolution of HMA is low as we also showed above (FIG. 1). Because of this low resolution, 1 bp different heterozygous genotype cannot be distinguished. Even when a few bp difference can be detected from the mobility shift of the heteroduplex, it is often not possible to distinguish the 2 homozygous genotype (i.e. wild type and mutant) with the small difference (a few bp). Researchers run another sample set of HMA to distinguish these homozygous wild type and mutant (FIG. 10a).

[0158] It is possible to conduct the two types of runs at the same time to save time, but the researchers need to analyse twice as many as the sample number.

[0159] On the other hand, prePRIMA and PRIMA is able to distinguish the genotypes with a single run (FIG. 11 and FIG. 10). When using 5 bp deletion sequence as a probe, heteroduplex peaks derived from wild type homozygous or mutant homozygous were observed with different mobility shifts. The heterozygous sample showed both peaks (FIG. 10c and FIG. 10d). Taken together, prePRIMA and PRIMA save the costs, labor work and/or time for genotyping compared with HMA. PRIMA does not require synthesizing a long probe compared to prePRIMA and is therefore recommend as the best method for genotyping.

Example 6: PRIMA is Applicable to Many Sequences

[0160] The inventors tested whether PRIMA is available for several sequences from plants, bacteria and human. They successfully detected heteroduplex peaks with different sizes from each genotype and materials with PRIMA (and prePRIMA). (FIG. 13).

[0161] When the inventors encountered a case that a peak pattern with a short single-stranded DNA (sssDNA) probe (forward probe) was not very clearly distinguishable, they tried another strand of sssDNA (reverse probe). The same PCR fragment and the same probe region was tested with a complementary sequence as a probe. Different mobility of heteroduplex peak was detected by using a forward or reverse probe (FIG. 13). This result is compatible with the case of HMA in Bhattacharyya and Lilley, 1989 NAR. Different peaks were detected by complementary probe. Normally, at least one of these two probes showed a clear difference with different genotype (FIG. 13). If both strands did not work, a slight shift of the probe position was performed.

Example 7: PRIMA is Possible to Distinguish Type of Base (A, T, G and C)

[0162] Recent development of CRISPR system enabled to ‘base-editing’ using nuclease-inactive version of SpCas9 (Kumor et al., Nature 2016, Nishida et al., Science 2016, Nishimasu et al., 2018). To test whether PRIMA is usable to distinguish type of base, the inventors performed PRIMA (FIG. 13). They could distinguish A or T at the same position (FIG. 13b). This result even broadens the possibility of application of PRIMA for single nucleotide polymorphism (SNP) typing besides indel detection. SNP typing can be also useful for the chemically mutagenized genotype (such as EMS-mutagenized lines in plant). Homeologs might be distinguished by PRIMA.

Methods

Protocol for PRIMA Using MultiNA DNA-500 Kit (FIG. 15)

[0163] 1. Set up a PCR condition based on the target site of genome editing. [0164] Design primers which satisfy the criteria below. [0165] Forward primer position: about 100 bp upstream of the (putative) mutation position. [0166] Reverse primer position: about 100 bp downstream of the (putative) mutation position. [0167] It is recommended to design these primers with the product size ranged between 180-220 bp. [0168] 2. Design a probe containing 5 bp deletion around the (putative) mutation position PRIMA is working with short single-stranded DNA (sssDNA). We confirmed 40mer sssDNA is long enough to introduce the conformational change after the re-annealing process in step4. We recommended probe position 5 bp deletion starting from −6 to −2 from of PAM sequence; see FIG. 15) [0169] 3. PCR [0170] Prepare PCR fragment with normal PCR protocol using the primers in step1. [0171] 4. Preparation of the mixture of PCR product and probe and re-annealing [0172] Mix the 9 μl of PCR product and 1 μl of 10 μM probe you prepared in step2. [0173] Then, preform denaturation and re-annealing reaction as follows; 5 min. at 95° C., cooling to 25° C. at 0.1° C. per second. [0174] 5. Detect heteroduplex peak [0175] Heteroduplex peak(s) can be detected by MultiNA, Microchip Electrophoresis System from SHIMADZU. This detection step can be achieved by polyacrylamide gel electrophoresis (Ota et al., 2013 Genes Cells, Ansai et al., 2014 Dev Growth Differ, Delwart et al., 1993 Science) or other high resolution electrophoresis machine (i.e. QIAxcel by Qiagen).