miRNA as biomarker for Parkinson's disease and diagnostic kit using same

11447772 · 2022-09-20

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for providing information on the diagnosis of Parkinson's disease. The present invention also relates to a composition for preventing, ameliorating or treating Parkinson's disease. The present invention uses at least one miRNA whose expression is specifically down- or up-regulated in a Parkinson's disease model. Therefore, the use of the miRNA is effective in diagnosing and treating Parkinson's disease.

Claims

1. A method for providing information on the diagnosis of Parkinson's disease by determination of up-regulation of expression level of at least one miRNA in a blood, serum, or plasma sample taken from a subject comprising (a) comparing the expression level of at least one miRNA selected from the group consisting of miR-1226-5p and miR-3064-5p in the blood, serum, or plasma sample taken from the subject with that of the selected miRNA in a normal sample, and (b) diagnosing the subject with Parkinson's disease when the expression level of the selected miRNA is higher than that of the selected miRNA in the normal sample.

2. The method of claim 1, wherein the miRNA is miR-1226-5p.

3. The method of claim 1, wherein the miRNA is miR-3064-5p.

4. The method of claim 1, wherein the miRNA is miR-1226-5p and miR-3064-5p.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows miRNAs whose expression was down-regulated during apoptosis of cells in Parkinson's disease models.

(2) FIG. 2 shows miRNAs whose expression was up-regulated during apoptosis of cells in Parkinson's disease models.

(3) FIG. 3 shows images of an internal control injected with 6-OHDA. The substantia nigra of the left hemisphere of the brain whose tissue was untreated was left intact (A) and neurons of the substantia nigra of the right hemisphere injected with 6-hydroxydopamine were dead and their tissue was deformed, resulting in excessive shrinkage (B).

(4) FIG. 4 shows living neurons in the substantia nigra under the influence of miR-494-3p co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

(5) FIG. 5 shows living neurons in the substantia nigra under the influence of miR-1244 co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

(6) FIG. 6 shows living neurons in the substantia nigra under the influence of miR-4324 co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

(7) FIG. 7 shows living neurons in the substantia nigra under the influence of miR-4726-5p co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

(8) FIG. 8 shows living neurons in the substantia nigra under the influence of miR-6768-5p co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

(9) FIG. 9 shows living neurons in the substantia nigra under the influence of miR-501-5p co-injected with 6-OHDA. Lesions in A (normal) and B (injected) in the same individual were confirmed by H&E staining.

BEST MODE FOR CARRYING OUT THE INVENTION

(10) The present invention will be explained in more detail with reference to the following examples. It will be evident to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.

EXAMPLES

(11) Materials and Methods

(12) 1. SH-SY5Y Cell Culture

(13) C57BL/6 SH-SY5Y neuroblast cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen, MD, USA) supplemented with 10% heat-inactivated fetal bovine serum (GIBCO, MD, USA) in a humidified 5% CO.sub.2 chamber at 37° C. (Jang, S.-W., Oh, M.-S., Yang, S. I. & Cho, E.-M. Gene expression profiles of human neuroblastoma cells exposed to CuO nanoparticles and Cu ions. BioChip Journal 10, 140-149 (2016)). 6-Hydroxydopamine (Sigma-Aldrich, St. Louis, Mo., USA) was dissolved in phosphate buffered saline (PBS) and stored at −80° C. before use. Whenever necessary, the solution was plated and used as a batch reagent. Special care was taken because the solution was sensitive to light.

(14) 2. Cell Viability Test

(15) Cell viability was observed using stable tetrazolium salt (WST-1 assay, Sigma-Aldrich, St. Louis, Mo., USA). SH-SY5Y cells were plated in each well of a 96-well plate at a density of 5000 cells/well and treated with 6-hydroxydopamine (6OHDA, 25 μM, 24 h). The test group was compared with a control group treated with PBS only. 2 h before completion of the experiment, WST-1 solution was added in an amount of 10 μl/well and cells were cultured in a chamber at 37° C. After completion of the experiment, a color change at 450 nm was observed.

(16) 3. RNA Isolation

(17) Total RNA of the SH-SY5Y cell line treated with 6OHDA (25 μM, 24 h) was isolated using Trizol reagent. This procedure was performed according to the method recommended by the manufacturer (Invitrogen, California, USA). The quantity and purity of the isolated total RNA were monitored using a NanoDrop ND-2000 spectrophotometer (Nano Drop, Delaware, USA) at 260/280 nm (ratio 1.8-2.0) ratio (Kim, G. W. e. a. Integrative analyses of differential gene expression and DNA methylation of ethylbenzene-exposed workers. BioChip Journal 9, 259-267 (2015)).

(18) 4. miRNA Expression Profiling

(19) Affymetrix miRNA 4.0 array (Lee, S. E. e. a. Identification and characterization of MicroRNAs in acrolein-stimulated endothelial cells: Implications for vascular disease. BioChip Journal 9, 144-155 (2015)) was used for miRNA expression profiling assay. The microarray data were analyzed using the Gene Expression Omnibus (GEO) database.

(20) 5. Target Prediction and Gene Ontology Analysis

(21) Target miRNA genes were predicted utilizing TargetScan6.2 DB based on the miRNA expression profiles according to the miRanda algorithm (Kim, G. W. et al. Integrative analyses of differential gene expression and DNA methylation of ethylbenzene-exposed workers. BioChip Journal 9, 259-267 (2015)). The most frequent target miRNAs whose expression levels were high were reconfirmed using Gene Ontology (GO) categories (www.geneontology.org/) (Cho, H. et al. A relationship between miRNA and gene expression in the mouse Sertoli cell line after exposure to bisphenol A. BioChip Journal 4, 75-81 (2010); Jeong, S. I. et al. MicroRNA microarray analysis of human umbilical vein endothelial cells exposed to benzo(a)pyrene. BioChip Journal 6, 191-196 (2012); Park, H. R., Lee, S. E., Yang, H., Son, G. W. & Park, Y. S. Functional screening of altered microRNA expression in 3-methylcholanthrene-treated human umbilical vein endothelial cells. BioChip Journal 8, 260-268 (2014); Park, J. H. et al. Expression profiles of miRNAs during ethanol-induced differentiation of neural stem cells. BioChip Journal 6, 73-83 (2012)). The miRs were sorted in the order of increasing or decreasing expression level based on the log.sub.2 fold change.

(22) 6. Construction of Parkinson's Disease Animal Models

(23) 30 min before injection of 6-OHDA (Sigma, St. Louis, USA), desipramine (12.5 mg/kg; Sigma, St. Louis, USA), a noradrenalin transporter blocker, was injected intraperitoneally into experimental animals such that the toxicity of 6-OHDA affected dopaminergic neurons only. After each experimental animal was deeply anesthetized with intraperitoneal injection of a mixture of ketamine (40 mg/kg) and xylazine (5 mg/kg). Thereafter, the animal was fixed to a brain stereotactic apparatus (David KOPF instrument, CA, USA) under inhalation anesthesia and the scalp was excised to expose the skull. After the bregma was identified, small holes were formed at spots located 1.1 mm posterior and 1.2 mm lateral (right) to this landmark by using a dental drill. A 26-gauge needle was inserted to reach a point located 5.0 mm on the back through the hole such that it was placed on the medial forebrain bundle (MFB). 2 μL of a solution of 6-OHDA in 0.1% ascorbic acid (2.5 μg/μL) was injected at a rate of 0.5 μL/min through a 5 μL Hamilton syringe using an infusion pump (Harvard Apparatus., USA). 5 μL of the test miRNA was injected at a rate of 0.5 μL/min through another 5 μL Hamilton syringe. 5 min after completion of the injection, the Hamilton syringes were removed and the skin was sutured. The left hemisphere was not injected with the test substance (“internal control”). After the experimental animal was anesthetized with a mixture of ketamine (70 mg/kg) and xylazine (8 mg/kg), the animal was perfused with 4% paraformaldehyde (in 0.1 M phosphate buffer, pH 7.4) through the heart, followed by fixing. The brain tissue was excised.

(24) Results

(25) 1. miRs Whose Expression was Down-Regulated During Apoptosis of Cells in the PD Models

(26) FIG. 1 shows miRNAs whose expression was most highly down-regulated during apoptosis of cells in the PD models. Particularly, it has not been reported that miR494-3p is associated with Parkinson's disease. A significant decrease in the expression level of miR494-3p was repeatedly observed in every experiment. miRs whose expression was down-regulated by ≤−2.0 (by ≥30%) based on the log ratio are also listed in FIG. 1. Particularly, bioinformatic data analysis revealed that miR-1244 targets the protein ‘TBC1 domain family member 2B’. Importantly, the miRNA acts as a fundamental regulator that targets one of the genes specifically expressed during apoptosis of neurons in Parkinson's disease (A Network View on Parkinson's Disease, Comput Struct Biotechnol J. 2013; 7: e201304004).

(27) 2. miRs Whose Expression was Up-Regulated During Apoptosis of Cells in the PD Models

(28) FIG. 2 shows miRNAs whose expression was most highly up-regulated during apoptosis of cells in the PD models.

(29) 3. miR SEQ

(30) The sequences of the miRNAs whose expression was highly up- or down-regulated are as follows:

(31) The miRNAs whose expression was most highly down-regulated during apoptosis of cells in the PD models are hsa-miR-494-3p (SEQ ID NO. 1: UGAAACAUACACGGGAAACCUC), hsa-miR-1244 (SEQ ID NO. 2: AAGUAGUUGGUUUGUAUGAGAUGGUU), hsa-miR-6768-5p (SEQ ID NO. 3: CACACAGGAAAAGCGGGGCCCUG), hsa-miR-4324 (SEQ ID NO. 4: CCCUGAGACCCUAACCUUAA), hsa-miR-4726-5p (SEQ ID NO. 5: AGGGCCAGAGGAGCCUGGAGUGG), and hsa-miR-501-5p (SEQ ID NO. 6: AAUCCUUUGUCCCUGGGUGAGA).

(32) The miRNAs whose expression was most highly up-regulated during apoptosis of cells in the PD models are hsa-miR-1226-5p (SEQ ID NO. 7: GUGAGGGCAUGCAGGCCUGGAUGGGG), hsa-miR-4767 (SEQ ID NO. 8: CGCGGGCGCUCCUGGCCGCCGCC), and hsa-miR-3064-5p (SEQ ID NO. 9: UCUGGCUGUUGUGGUGUGCAA).

(33) 4. H&E Staining

(34) Cell viabilities in the Substantia nigra pars compacta, where major lesions of Parkinson's disease arise, were confirmed by H&E staining and compared to evaluate the efficacy of the miRNAs against Parkinson's disease.

(35) 1) Tissue fixing: Cellular enzymes were inactivated and ingredients in the tissue were converted to insoluble states by coagulation or precipitation. The tissue was fixed by immersion in a fixing solution at 4° C. for at least one day such that the cellular structure was well preserved.

(36) 2) Dehydration and cleaning: Water was removed and solvents used for water removal were removed for easy penetration of paraffin into the sub-tissue.

(37) 3) Construction of paraffin block: The inner and outer portions of the tissue were shaped with paraffin without causing any deformation of the tissue and cellular structure.

(38) 4) Slide preparation: The paraffin block was sliced with a microtome knife into 10 μm thick continuous coronal sections to prepare silane coating slides.

(39) 5) Staining: After the treatment, the paraffin was removed for tissue preservation, the cell nuclei were stained with Harris hematoxylin. Eosin Y was used for contrast staining.

(40) 6) Cells were colored indigo blue and contrast-stained sections were colored pink.

(41) 5. Inhibitory Effect of the miRNAs on Neuronal Apoptosis

(42) As can be seen from FIGS. 3 to 9, excessive shrinkage of the tissue was observed due to tissue deformation as well as neuronal apoptosis and in the internal control injected with 6-OHDA only (FIG. 3), whereas neurons were alive in the experimental groups received miR-494-3p (FIG. 4), miR-1244 (FIG. 5), miR-4324 (FIG. 6), miR-4726-5p (FIG. 7), miR-6768-5p (FIG. 8), and miR-501-5p (FIG. 9). These results demonstrated that the miRNAs are very effective in protecting neurons from apoptosis.

(43) Although the particulars of the present invention have been described in detail, it will be obvious to those skilled in the art that such particulars are merely preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.