FLUORESCENT DYE, PREPARATION METHOD AND USES THEREOF

Abstract

A fluorescent dye, as well as a preparation method and uses thereof, wherein the fluorescent dye is sensitive and specific to viscosity and has low background fluorescence; it can also be used as a fluorescent activated and lighted probe used for fluorescent labeling, quantification or monitoring of protein, enzymes or nucleic acid.

Claims

1. A fluorescent dye, the structural formula of which is shown as Formula (I), ##STR00068## wherein: D- is HO— or N(X.sub.1)(X.sub.2)—, X.sub.1 and X.sub.2 are respectively and independently selected from hydrogen, alkyl and modified alkyl; and X.sub.1 and X.sub.2 are optionally interconnected, and form a lipid heterocyclic ring with N atoms; R is selected from cyano group, carboxy, amide group, ester group, sulfoxide group, sulphone group, sulfonic ester group or sulfonamido group; Ar.sub.1 and Ar.sub.2 are respectively and independently selected from arylene and sub-heteroaryle; wherein hydrogen atoms in Ar.sub.1 and Ar.sub.2 being optionally, respectively and independently substituted by halogen atoms, hydroxyl group, aldehyde group, carboxyl group, ester group, amide group, cyano group, sulfonic acid group, phosphoric acid group, amino group, primary amino group, secondary amino group, alkyl or modified alkyl; X.sub.1 and X.sub.2 optionally and independently form a lipid heterocyclic ring with Ar.sub.1; wherein: the “alkyl” is respectively and independently C.sub.1-C.sub.10 straight or branched alkyl; optionally, the “alkyl group” is C.sub.1-C.sub.7 straight or branched alkyl; optionally, the “alkyl group” is C.sub.1-C.sub.5 straight or branched alkyl; optionally, the “alkyl group” is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tertiary butyl, sec-butyl, n-amyl, 1-methyl butyl, 2-methyl butyl, 3-methyl butyl, isoamyl, 1-ethyl propyl, neoamyl, n-hexyl, 1-methyl amyl, 2-methyl amyl, 3-methyl amyl, isohesyl, 1,1-dimethyl butyl, 2,2-dimethyl butyl, 3,3-dimethyl butyl, 1,2-dimethyl butyl, 1,3-dimethyl butyl, 2,3-dimethyl butyl, 2-ethyl butyl, n-heptyl, 2-methyl hexyl, 3-methyl hexyl, 2,2-dimethyl amyl, 3,3 dimethyl amyl, 2,3-dimethyl amyl, 2,4-dimethyl amyl, 3-ethyl amyl or 2,2,3-methyl butyl; the “modified alkyl” is respectively and independently a group obtained by replacing any carbon atom in alkyl with one or more groups of halogen atom, —OH, —CO—, —O—, —CN, —S—, —SO.sub.2—, —(S═O)—, azido, primary amino group, secondary amino group, tertiary amino group, and quaternary ammonium base, and the modified alkyl has 1-10 carbon atoms, wherein the carbon-carbon single bond is optionally and independently replaced by a carbon-carbon double bond or a carbon-carbon triple bond; the replacement of carbon atoms refers to that carbon atoms or the carbon atoms and hydrogen atoms thereon together are replaced by a corresponding group; the “halogen atom” is respectively and independently F, Cl, Br or I; the “lipid heterocyclic ring” is a saturated or unsaturated 4- to 15-membered monocyclic or polycyclic lipid heterocyclic ring containing one or more heteroatoms of N, O, S or Si on the ring, and the lipid heterocyclic ring is —S—, —SO— or —SO.sub.2— when there are S atoms on the ring; the lipid heterocyclic ring is optionally substituted by a halogen atom, an alkyl, an aryl or a modified alkyl; the “arylene” is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic subaromatic group; the “sub-heteroaryle” is a 5- to 13-membered monocyclic or dicyclic or fused dicyclic or fused polycyclic sub-heteroaromatic group containing one or more heteroatoms of N, O, S or Si on the ring; the “ester group” is R′(C═O)OR″ group; the “amide group” is R′CONR″R′″ group; the “sulfonic acid group” is R′SO.sub.3H group; the “sulfonic ester group” is R′SO.sub.2OR″ group; the “sulfonamido group” is R′SO.sub.2NR″R′″ group; the “phosphoric acid group” is R′OP(═O)(OH).sub.2 group; the “sulphone group” is R′SO.sub.2R″ group; the “sulfoxide group” is R′SOR″ group; the “primary amino group” is R′NH.sub.2 group; the “secondary amino group” is R′NHR″ group; the “tertiary amino group” is R′NR″R′″ group; the “quaternary ammonium base” is R′R″R′″ R″″N.sup.+ group; each R′, R″, R′″, R″″ respectively and independently being single bond, hydrogen, alkyl, alkylene, modified alkyl or modified alkylene; the “alkylene” is C.sub.1-C.sub.10 straight or branched alkylene; optionally, it is C.sub.1-C.sub.7 straight or branched alkylene; optionally, it is C.sub.1-C.sub.5 straight or branched alkylene; and the “modified alkylene” is a group obtained by replacing any carbon atom in C.sub.1-C.sub.10 (preferably C.sub.1-C.sub.6) alkylene with a group selected from —O—, —OH, —CO—, —CS—, and —(S═O)—.

2. The fluorescent dye according to claim 1, wherein the “modified alkylene” is a group containing one or more groups selected from —OH, —O—, ethylene glycol unit, monosaccharide unit, —O—CO—, —NH—CO—, —SO.sub.2—O—, —SO—, Me.sub.2N—, Et.sub.2N—, —S—S—, —CH═CH—, F, Cl, Br, I, and cyano group.

3. The fluorescent dye according to claim 1, wherein Ar.sub.1 and Ar.sub.2 respectively and independently are structures selected from the following Formulae (II-1) to (II-22): ##STR00069## ##STR00070## ##STR00071## ##STR00072##

4. The fluorescent dye according to claim 1, wherein the compound represented by Formula (I) is selected from the compounds below: ##STR00073## ##STR00074## ##STR00075## ##STR00076## ##STR00077## ##STR00078##

5. A method of preparing the fluorescent dye according to claim 1, including a step of aldol condensation reaction between a compound of Formula (a) and a compound of Formula (b), ##STR00079##

6. Uses of the fluorescent dye according to claim 1 in viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

7. Uses of the fluorescent dye according to claim 1 in preparing reagents for viscosity testing, protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

8. A fluorescent activated and lighted probe, comprising the fluorescent dye according to claim 1.

9. Uses of the fluorescent activated and lighted probe according to claim 8 in protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection, wherein the uses are those other than for diagnostic methods of diseases.

10. Uses of the fluorescent activated and lighted probe according to claim 8 in preparing reagents for protein fluorescent labeling, nucleic acid fluorescent labeling, protein quantification or detection, or nucleic acid quantification or detection.

Description

DESCRIPTION OF DRAWINGS

[0045] FIG. 1 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-3 (1×10.sup.−5 M);

[0046] FIG. 2 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-3 (1×10.sup.−5 M);

[0047] FIG. 3 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-4 (1×10.sup.−5 M);

[0048] FIG. 4 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-4 (1×10.sup.−5 M);

[0049] FIG. 5 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-28 (1×10.sup.−5 M);

[0050] FIG. 6 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-28 (1×10.sup.−5 M);

[0051] FIG. 7 is a diagram showing the fluorescence emission intensity at different viscosity conditions of the molecular rotor III-34 (1×10.sup.5 M);

[0052] FIG. 8 is a diagram showing the linear relationship between viscosity conditions and fluorescence intensity of the molecular rotor III-34 (1×10.sup.−5 M);

[0053] FIG. 9 is a diagram showing the fluorescence background contrast of molecular rotors III-11 and III-36 (1×10.sup.−6 M) in PBS;

[0054] FIG. 10 is a diagram showing the fluorescence background contrast of molecular rotors III-34 and III-37 (1×10.sup.−6 M) in PBS;

[0055] FIG. 11 is a diagram showing the fluorescence background contrast of molecular rotors III-31, III-32, III-33 and III-38 (1×10.sup.−6 M) in PBS;

[0056] FIG. 12 is a diagram showing the fluorescence background contrast of molecular rotors III-3 and III-39 (1×10.sup.−6 M) in PBS;

[0057] FIG. 13 is a diagram showing the fluorescence background contrast of molecular rotors II-21 and III-40 (1×10.sup.−6 M) in PBS;

[0058] FIG. 14 is a diagram showing the fluorescence background contrast of molecular rotors III-28, III-29, I1-30 and I1-41 (1×10.sup.−6 M) in PBS;

[0059] FIG. 15 is a diagram showing the fluorescence background contrast of molecular rotors I1-3 and I1-42 (1×10.sup.−6 M) in PBS;

[0060] FIG. 16 is a diagram showing the fluorescence background contrast of molecular rotors I1-3 and I1-43 (1×10.sup.−6 M) in PBS;

[0061] FIGS. 17A and 17B are the application of molecular rotors III-3, III-4, III-6, III-7, III-8, III-18, III-21 in labeling intracellular RNA aptamers, wherein A are cells expressing the target RNA aptamers, and B are cells not expressing the target RNA aptamers;

[0062] FIGS. 18A and 18B are the application of molecular rotors III-3, I1-43 in labeling intracellular mRNA.

SPECIFIC IMPLEMENTATION

Compound III-1

[0063] ##STR00012##

[0064] To a stirring solution of p-dimethylaminobenzaldehyde (0.35 g, 2.3 mmol) and 4-cyano-benzeneacetonitrile (0.4 g, 2.8 mmol) in 20 mL methanol, 2 drops of piperidine were added. After stirring at ambient temperature for 2 h, the mixture was cool to room temperature. A large amount of precipitate was appeared. Then the precipitate was obtained by filtration and washed with cold EtOH three times. The orange solid was obtained after dried under vacuum (0.60 g, yield 95%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=3.05 (s, 6H), 6.83 (d, J=9.2 Hz, 2H), 7.84-7.94 (m, 6H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.16O.sub.3 [M+H].sup.+: 274.1344. Found: 274.1345.

Example 2

Compound III-2

[0065] ##STR00013##

[0066] With reference to the synthetic method of compound III-1 (0.34, yield 89%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=1.23 (t, J=7.60 Hz, 6H), 3.05 (t, J=7.60 Hz, 4H), 6.84 (d, J=9.2 Hz, 2H), 7.84-7.95 (m, 6H), 8.09 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.20H.sub.20O.sub.3 [M+H].sup.+: 302.1657. Found: 302.1658.

Example 3

Compound III-3

[0067] ##STR00014##

[0068] With reference to the synthetic method of compound III-1 (0.33 g, yield 95%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=7.96 (s, 1H), 7.85 (d, J=16.0 Hz, 6H), 6.81 (d, J=8.0 Hz, 2H), 4.77 (s, 1H), 3.55 (d, J=28.0 Hz, 4H), 3.04 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.18N.sub.3O [M+H].sup.+: 304.1450. Found: 304.1451.

Example 4

Compound III-4

[0069] ##STR00015##

[0070] To stirring solution of compound III-3 (0.61 g, 2.0 mmol) and TEA (0.25 g, 2.2 mmol) in 40 mL dried DCM, 4-tosyl chloride (0.38 g, 2.0 mmol) in 10 mL DCM was added slowly under 0° C. The resulting mixture was stirred under Ar.sub.1 atomo and was permitted to warm to room temperature. After complete the reaction, the mixture was quenched by 2 mL of water. The reaction mixture was extracted three times and the organic phase was dried with anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was used in the next step without purified.

[0071] To a stirring solution of the residue in 20 mL CH.sub.3CN, 1 ml MeNH2 was added under Ar atmosphere. The mixture was heated to refluxed overnight. Upon completing the reaction, the reaction mixture was cooled to room temperature and the organic liquid was removed under reduce pressure. Then the residue was dissolved in 50 mL DCM and the organic phase was washed with water and brine (2×100 ml). Upon drying over anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford orangered solid. (0.54 g, 82%). .sup.1H NMR (400 MHz, CDCl.sub.3): δ=7.88 (d, J=9.0 Hz, 2H), 7.74-7.65 (m, 4H), 7.48 (s, 1H), 6.73 (d, J=9.1 Hz, 2H), 3.60-3.55 (m, 2H), 3.08 (s, 3H), 2.57-2.52 (m, 2H), 2.34 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.21H.sub.23N.sub.4 [M+H].sup.+: 331.1923. Found: 331.1925.

Example 5

Compound III-5

[0072] ##STR00016##

[0073] To a stirring solution of 3,5-difluoro-4-hydroxybenzaldehyde (0.32 g, 2.0 mmol) and 4-cyano-benzeneacetonitrile (0.35 g, 2.4 mmol) in 40 mL anhydrous EtOH, 2 drops of piperidine were added. After stirring at ambient temperature for 2 h, the mixture was cool to room temperature. A large amount of precipitate was appeared. Then the precipitate was obtained by filtration and washed with cold EtOH three times. The orange solid was obtained after dried under vacuum. .sup.1H NMR (400 MHz, CDCl.sub.3): δ=7.80 (d, J=9.0 Hz, 2H), 7.74-7.66 (m, 4H), 7.48 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.16H.sub.9F.sub.2N.sub.2O [M+H].sup.+: 283.0683. Found: 283.0684.

Example 6

Compound 5-(N-methyl-N-(2-hydroxyethyl)amino) pyrazine-2-carbaldehyde

[0074] ##STR00017##

[0075] To a stirring solution of N-methyl-N-(2-hydroxyethyl)amino (2.6 g, 35 mmol) and 5-chloro-pyrazine-2-carbaldehyde (0.50 g, 3.5 mmol) in 20 mL dry CH.sub.3CN, K.sub.2CO.sub.3 (0.71 g, 5.3 mmol) was added in one portion. The mixture was heated to reflux under Ar atmosphere. The mixture was heated to refluxed for 24 h. Upon completing the reaction, the reaction mixture was cooled to room temperature and the organic liquid was removed under reduce pressure. Then the residue was dissolved in 100 mL DCM and the organic phase was washed with water and brine (2×100 ml). Upon drying over anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound. (0.48 g, 76%). .sup.1H NMR (400 MHz, CDCl.sub.3): δ 9.88 (s, 1H), 8.62 (d, J=1.2 Hz, 1H), 8.14 (d, J=1.1 Hz, 1H), 3.92 (m, 2H), 3.88-3.83 (m, 2H), 3.28 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.8H.sub.12N.sub.3O.sub.2 [M+H].sup.+: 182.1. Found: 182.1.

Compound III-6

[0076] ##STR00018##

[0077] With reference to the synthetic method of compound III-1 (0.36 g, 96%). .sup.1H NMR (400 MHz, CDCl.sub.3): δ 8.39 (s, 1H), 8.30 (s, 1H), 7.80 (d, J=8.5 Hz, 2H), 7.72 (d, J=8.4 Hz, 2H), 7.51 (s, 1H), 3.93 (t, J=4.9 Hz, 2H), 3.88-3.83 (m, 2H), 3.29 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.17H.sub.16N.sub.5O [M+H].sup.+: 306.1355. Found: 306.1357.

Example 7

Compound III-7

[0078] ##STR00019##

[0079] With reference to the synthetic method of compound III-4, (0.21 g, 67%) o .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 8.37 (d, J=5.2 Hz, 2H), 8.06 (s, 1H), 8.00-7.85 (m, 4H), 3.77 (t, J=6.5 Hz, 2H), 3.20 (s, 3H), 2.56 (m, 2H), 2.23 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.21N.sub.6 [M+H].sup.+: 333.1828. Found: 333.1829.

Example 8

Compound 6-(N-methyl-N-(2-hydroxyethyl)amino) pyridine-2-carbaldehyde

[0080] ##STR00020##

With reference to the synthetic method of Compound 5-(N-methyl-N-(2-hydroxyethyl)amino) pyrazine-2-carbaldehyde: (0.45 g, 68%). .sup.1H NMR (400 MHz, CDCl.sub.3): δ=9.69 (s, 1H), 8.43 (d, J=2.1 Hz, 1H), 7.86 (dd, J=9.0, 2.3 Hz, 1H), 6.56 (d, J=9.1 Hz, 1H), 3.86-3.79 (m, 4H), 3.15 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.9H.sub.13O.sub.2N.sub.2 [M+H].sup.+: 181.1. Found: 181.1.

Compound III-8

[0081] ##STR00021##

[0082] With reference to the synthetic method of compound III-1, (0.39 g, 89%) o .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.54 (d, J=4.0 Hz, 1H), 8.30 (dd, J=9.3, 2.5 Hz, 1H), 8.03 (s, 1H), 7.92 (d, J=8.0 Hz, 2H), 7.85 (d, J=8.0 Hz, 2H), 6.84 (d, J=8.0 Hz, 1H), 4.77 (t, J=5.4 Hz, 1H), 3.67 (t, J=5.3 Hz, 2H), 3.60 (q, J=5.4 Hz, 2H), 3.15 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.27N.sub.4O [M+H].sup.+: 305.1402. Found: 305.1401.

Example 9

Compound III-9

[0083] ##STR00022##

[0084] With reference to the synthetic method of compound III-4, (0.31 g, 92%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.55 (d, J=4.0 Hz, 1H), 8.31 (dd, J=9.3, 2.5 Hz, 1H), 8.05 (s, 1H), 7.93 (d, J=8.0 Hz, 2H), 7.84 (d, J=8.0 Hz, 2H), 6.85 (d, J=8.0 Hz, 1H), 4.78 (t, J=5.4 Hz, 1H), 3.67 (t, J=5.3 Hz, 2H), 3.60 (q, J=5.4 Hz, 2H), 3.17 (t, J=8.0 Hz, 4H), 1.17 (t, J=8.0 Hz, 6H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.26N.sub.5 [M+H]+: 360.2188. Found: 360.2187.

Example 10

4-(N,N-dimethylamino)-pyrazine-6-carbaldehyde

[0085] ##STR00023##

[0086] With reference to the synthetic method of compound III-4, (0.31 g, 49%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.86 (d, J=0.6 Hz, 1H), 8.17 (d, J=2.9 Hz, 1H), 7.83 (d, J=8.9 Hz, 1H), 6.94 (dd, J=8.8, 2.9 Hz, 1H), 3.10 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.8H.sub.11N.sub.2O [M+H].sup.+: 151.1. Found: 151.1.

Compound III-10

[0087] ##STR00024##

[0088] With reference to the synthetic method of compound III-1, (0.36 g, 96%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.86 (d, J=0.6 Hz, 1H), 8.26 (s, 1H), 8.17 (d, J=2.9 Hz, 1H), 7.83 (d, J=8.9 Hz, 1H), 7.46 (m, 4H), 6.94 (dd, J=8.8, 2.9 Hz, 1H), 3.10 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.17H.sub.15N.sub.4 [M+H].sup.+: 275.1297. Found: 275.1298.

Example 11

Compound 2-(N-methyl-N-(2-hydroxyethyl)amino) pyrimidine-5-carbaldehyde

[0089] ##STR00025##

[0090] With reference to the synthetic method of compound III-4, (0.42 g, 72%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.89 (s, 1H), 8.73 (s, 2H), 3.64 (t, J=8.9 Hz, 2H), 3.45 (t, J=8.8 Hz, 2H), 3.10 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.8H.sub.12N.sub.3O [M+H].sup.+: 182.1. Found: 182.1.

Compound III-11

[0091] ##STR00026##

[0092] With reference to the synthetic method of compound III-1, (0.36 g, 96%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.26 (s, 1H), 8.73 (s, 2H), 7.64 (m, 4H), 3.64 (t, J=8.9 Hz, 2H), 3.44 (t, J=8.8 Hz, 2H), 3.11 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.17H.sub.16N.sub.5O [M+H].sup.+: 306.1355. Found: 306.1356.

Example 12

Compound 5-(N-methyl-N-(2-hydroxyethyl)amino) pyrimidine-2-carbaldehyde

[0093] ##STR00027##

[0094] With reference to the synthetic method of compound III-4, (0.42 g, 72%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.98 (s, 1H), 8.21 (s, 2H), 3.64 (t, J=8.9 Hz, 2H), 3.44 (t, J=8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.8H.sub.12N.sub.3O.sub.2 [M+H].sup.+: 182.1. Found: 182.1.

4-(1-cyano-2-(5-((2-hydroxyethyl)(methyl)amino)pyrimidin-2-yl)vinyl)benzonitrile1

[0095] ##STR00028##

[0096] With reference to the synthetic method of compound III-1, (0.56 g, 89%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4H), 3.64 (t, J=8.9 Hz, 2H), 3.44 (t, J=8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.17H.sub.16N.sub.5O [M+H].sup.+: 306.1. Found: 306.1.

Compound III-12

[0097] ##STR00029##

[0098] With reference to the synthetic method of compound III-4, (0.36 g, 96%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4H), 3.77 (t, J=6.5 Hz, 2H), 3.20 (s, 3H), 2.56 (m, 2H), 2.23 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.21N.sub.6 [M+H].sup.+: 333.1828. Found: 333.1829.

Example 13

5-cyano-2-acetonitrile-pyridine

[0099] ##STR00030##

[0100] To a stirring solution of 2-(bromomethyl)-benzonitrile (0.50 g, 2.5 mmol) in 50 mL THF, 10 ml NaCN aqueous solution (2 M) was added. The mixture was reflexed for 12 h under Ar atmosphere. Upon cooling to room temperature, the reaction mixture was extracted with DCM (3×100 ml). The organic phase was washed with water and brine (2×100 ml). Upon drying over anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound. (0.19 g, 56%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.78 (s, 1H), 7.95 (m, 1H), 7.56 (m, 1H), 4.01 (s, 2H). HRMS (ESI-TOF): Calcd. For C.sub.8H.sub.6N.sub.3 [M+H].sup.+: 144.1. Found: 144.1.

Compound III-13

[0101] ##STR00031##

[0102] With reference to the synthetic method of compound III-1, (0.45 g, 95%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.78 (s, 1H), 8.21 (s, 1H), 7.94 (m, 1H), 7.86 (d, J=8.0 Hz, 2H), 7.57 (m, 1H), 6.80 (d, J=8.0 Hz, 2H), 3.64 (t, J=8.9 Hz, 2H), 3.44 (t, J=8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.17 N.sub.4O [M+H].sup.+: 305.1402. Found: 305.1403.

Example 14

5-cyano-2-acetonitrile-pyrazine

[0103] ##STR00032##

[0104] To a stirring solution of 2-(5-chloropyrazin-2-yl)acetonitrile (0.32 g, 2.0 mmol) in dry 30 mL DMSO, CuCN (0.93 g, 10.0 mmol) was added in one portation. The mixture was heated for 12 h under Ar atmosphere. Upon cooling to room temperature, the reaction mixture was poured into 100 mL water, then extracted with DCM (4×50 ml). The organic phase was washed with water and brine (2×100 ml). Upon drying over anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound (0.20 g, 69%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.60 (s, 1H), 8.48 (s, 1H), 3.92 (s, 2H). HRMS (ESI-TOF): Calcd. For C.sub.7H.sub.5N.sub.4 [M+H].sup.+: 145.1. Found: 145.1.

Compound III-14

[0105] ##STR00033##

[0106] With reference to the synthetic method of compound III-1, (0.25 g, 91%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.60 (s, 1H), 8.48 (s, 1H), 8.11 (s, 1H), 7.81 (d, J=8.2 Hz, 2H), 6.84 (d, J=8.2 Hz, 2H), 3.60 (t, J=9.2 Hz, 2H), 3.46 (t, J=9.2 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.17H.sub.16N.sub.5O [M+H].sup.+: 306.1355. Found: 306.1354.

Example 15

Compound III-15

[0107] ##STR00034##

[0108] With reference to the synthetic method of compound III-1, (0.25 g, 91%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.00 (d, J=9.1 Hz, 1H), 7.77-7.69 (m, 1H), 7.43-7.34 (m, 1H), 6.88 (d, J=9.1 Hz, 1H), 4.81 (t, J=5.2 Hz, 1H), 3.31-3.25 (m, 4H), 2.66-2.63 (m, 4H), 1.89-1.81 (m, 4H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.20N.sub.3 [M+H].sup.+: 326.1657. Found: 326.1658.

Example 16

Compound III-16

[0109] ##STR00035##

[0110] With reference to the synthetic method of compound III-1, (0.29 g, 94%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.11 (2H, d, J=10.4 Hz), 7.99 (3H, dd, J=8.6, 3.0 Hz), 7.54 (1H, dd, J=8.0, 8.0 Hz), 7.44 (1H, dd, J=8.0, 8.0 Hz), 6.88 (2H, d, J=9.2 Hz), 4.82 (1H, bt, t, J=5.2 Hz), 3.01-3.08 (m, 2H), 3.53-3.60 (m, 2H), 2.89 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.16N.sub.3 [M+H].sup.+: 286.1344. Found: 286.1345.

Compound 17

6-(methylamino)benzo[b]thiophene-2-carbaldehyde

[0111] ##STR00036##

[0112] 6-(methylamino)benzo[b]thiophene-2-carbaldehyde (0.42 g, 1.7 mmol), 40% aqueous N,N-Dimethylethylamin solution (1 g, 8.9 mmol), CuI (13.9 mg, 0.073 mmol), K.sub.3PO.sub.4.H.sub.2O (155.4 mg, 0.73 mmol), 1 mL 33% aqueous methylamine solution and stirring bar was sealed in a screwed tube and stirred at 60° C. for 12 h. upon cooling to room temperature, the mixture was poured into 50 mL water. The organic layer was separated and the aqueous layer was extracted with DCM (3×100 ml). Combined the organic phase and dried over anhydrous Na.sub.2SO.sub.4 and evaporation under reduced pressure, the residue was purified by column chromatography on silica gel to afford target compound (0.23 g, 68%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.92 (1H, s), 8.14 (1H, s), 7.82 (1H, d, J=9.1 Hz), 7.18 (1H, d, J=2.1 Hz), 7.01 (1H, dd, J=9.1, 2.3 Hz), 3.05 (3H, s). HRMS (ESI-TOF): Calcd. For C.sub.10H.sub.10NOS [M+H].sup.+: 192.0. Found: 192.0.

Compound III-17

[0113] ##STR00037##

[0114] With reference to the synthetic method of compound III-1, (0.29 g, 94%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.45 (s, 1H), 7.92 (d, J=8.6 Hz, 2H), 7.85 (d, J=8.3 Hz, 3H), 7.73 (dd, J=8.6, 3.9 Hz, 1H), 7.21 (d, J=1.9 Hz, 1H), 7.21 (d, J=1.9 Hz, 1H), 6.96 (dd, J=9.1, 2.3 Hz, 1H), 3.05 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.14N.sub.3S [M+H].sup.+: 360.1171. Found: 360.1173.

Example 18

6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2-carbaldehyde

[0115] ##STR00038##

[0116] With reference to the synthetic method of compound 6-(methylamino)benzo[b]thiophene-2-carbaldehyde, (0.54 g, 79%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.91 (s, 1H), 8.14 (s, 1H), 7.81 (d, J=5.2 Hz, 1H), 7.17 (d, J=2.0 Hz, 1H), 7.01 (dd, J=2.0, 8.8 Hz, 1H), 4.76 (t, J=5.6 Hz, 1H), 3.58 (t, J=4.2 Hz, 2H), 3.52 (t, J=4.2 Hz, 2H), 3.04 (s, 3H). HRMS (ESI-TOF): m/z Calcd. For C.sub.12H.sub.14NO.sub.2S, [M+H].sup.+: 235.1. Found 236.1.

Compound III-18

[0117] ##STR00039##

[0118] With reference to the synthetic method of compound III-1, (0.21 g, 95%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.45 (s, 1H), 7.92 (d, J=8.6 Hz, 2H), 7.85 (d, J=8.3 Hz, 3H), 7.73 (dd, J=8.6, 3.9 Hz, 1H), 7.21 (d, J=1.9 Hz, 1H), 7.21 (d, J=1.9 Hz, 1H), 6.96 (dd, J=9.1, 2.3 Hz, 1H), 3.63-3.57 (m, 2H), 3.52 (t, J=5.7 Hz, 2H), 3.05 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.21H.sub.19N.sub.3OS [M+H].sup.+: 360.1171. Found: 360.1173.

Example 19

5-(N,N-dimethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde

[0119] ##STR00040##

[0120] With reference to the synthetic method of compound 6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2-carbaldehyde, (0.54 g, 79%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.66 (s, 1H), 8.05 (s, 1H), 6.30 (s, 1H), 4.88 (bt, 1H), 3.07 (s, 6H). HRMS (ESI-TOF): m/z Calcd. For C.sub.9H.sub.12NOS.sub.2 [M+H].sup.+: 214.0; found 214.0.

Compound III-19

[0121] ##STR00041##

[0122] With reference to the synthetic method of compound III-1, (0.31 g, 90%) o .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.34 (s, 1H), 7.86 (d, J=8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J=8.0 Hz, 2H), 6.32 (s, 1H), 4.88 (t, J=4.0 Hz, 1H), 3.08 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.14N.sub.3S.sub.2 [M+H].sup.+: 336.0629. Found: 336.0630.

Example 20

5-(N,N-diethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde

[0123] ##STR00042##

[0124] With reference to the synthetic method of compound 5-(N,N-dimethylamino)-thieno[3,2-b]thiophene-2-carbaldehyde, (0.44 g, 75%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.78 (s, 1H), 8.09 (s, 1H), 6.30 (s, 1H), 4.87 (bt, 1H), 3.27 (t, J=8.4 Hz, 4H), 1.26 (t, J=8.4 Hz, 4H). HRMS (ESI-TOF): m/z Calcd. For C.sub.9H.sub.12NOS.sub.2 [M+H].sup.+: 214.0; found 214.0.

Compound III-20

[0125] ##STR00043##

[0126] With reference to the synthetic method of compound III-1, (0.31 g, 90%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.34 (s, 1H), 7.86 (d, J=8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J=8.0 Hz, 2H), 6.32 (s, 1H), 4.88 (t, J=4.0 Hz, 1H), 3.27 (t, J=8.4 Hz, 4H), 1.26 (t, J=8.4 Hz, 4H). HRMS (ESI-TOF): Calcd. For C.sub.20H.sub.18N.sub.3S.sub.2 [M+H].sup.+: 364.0942. Found: 364.0943.

Example 21

5-((2-hydroxyethyl)(methyl)amino)-thieno[3,2-b]thiophene-2-carbaldehyde

[0127] ##STR00044##

[0128] With reference to the synthetic method of compound 6-((2-hydroxyethyl)(methyl)amino)benzo[b]thiophene-2-carbaldehyde, (0.44 g, 75%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=9.66 (s, 1H), 8.05 (s, 1H), 6.30 (s, 1H), 4.88 (bt, 1H), 3.64 (t, J=5.6 Hz, 2H), 3.44 (t, J=5.6 Hz, 2H), 3.07 (s, 3H). HRMS (ESI-TOF): m/z Calcd. For C.sub.10H.sub.12NO.sub.2S.sub.2 [M+H].sup.+: 241.0; found 242.0.

Compound III-21

[0129] ##STR00045##

[0130] With reference to the synthetic method of compound III-1, (0.31 g, 90%) .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ 8.34 (s, 1H), 7.86 (d, J=8.0 Hz, 2H), 7.81 (s, 1H), 7.77 (d, J=8.0 Hz, 2H), 6.32 (s, 1H), 4.88 (t, J=4.0 Hz, 1H), 3.65 (q, J=5.5 Hz, 2H), 3.44 (t, J=5.5 Hz, 2H), 3.34 (s, 1H), 3.08 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.16N.sub.3OS.sub.2 [M+H].sup.+: 366.0735. Found: 366.0736.

Example 22

Compound III-22

[0131] ##STR00046##

[0132] With reference to the synthetic method of compound III-1, (0.31 g, 90%).sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=3.04 (s, 6H), 6.82 (d, J=9.2 Hz, 2H), 7.59 (d, J=9.1 Hz, 2H), 7.84-7.94 (m, 6H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.24H.sub.19O.sub.3 [M+H].sup.+: 350.1657. Found: 350.1656.

Example 23

Compound III-23

[0133] ##STR00047##

[0134] With reference to the synthetic method of compound III-1: .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=3.02 (s, 6H), 6.72 (d, J=8.0 Hz, 2H), 7.24 (d, J=4.0 Hz, 1H), 7.49 (d, J=8.8 Hz, 2H), 7.55 (d, J=8.0 Hz, 1H), 7.69 (d, J=8.8 Hz, 2H), 8.02 ppm (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.18N.sub.3S [M+H].sup.+: 356.1221. Found: 356.1220.

Example 24

Compound III-24

[0135] ##STR00048##

[0136] With reference to the synthetic method of compound III-1, and compound 1 (With reference to the synthetic method of Chem. Commun. 2011, 47, 985-987): .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=3.63 (m, 16H), 3.77 (m, 4H), 6.76 (d, J=8.8 Hz, 2H), 7.38 (d, J=4.0 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.59 (d, J=8.8 Hz, 2H), 7.72 (m, 4H), 8.28 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.30H.sub.32O.sub.3N.sub.4S [M+H].sup.+: 530.2114. Found: 530.2115.

Example 25

Compound III-25

[0137] ##STR00049##

[0138] With reference to the synthetic method of compound III-1, and compound 2 (With reference to the synthetic method of J. Org. Chem. 2008, 73, 6587-6594): .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=1.23 (t, J=7.2 Hz, 6H), 3.35 (m, J=7.2 Hz, 4H), 5.78 (d, J=4.0 Hz, 1H), 6.92 (d, J=4.0 Hz, 1H), 7.12 (d, J=4.0 Hz, 1H), 7.49 (d, J=8.8 Hz, 2H), 7.56 (d, J=4.0 Hz, 1H), 7.69 (d, J=8.8 Hz, 2H), 8.28 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.30H.sub.32O.sub.3N.sub.4S [M+H].sup.+: 390.1099. Found: 390.1097.

Example 26

Compound III-26

[0139] ##STR00050##

[0140] With reference to the synthetic method of compound III-1, .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=3.30 (s, 6H), 5.71 (d, J=4.0 Hz, 1H), 6.93 (d, J=4.0 Hz, 1H), 7.15 (d, J=4.0 Hz, 1H), 7.47 (d, J=8.8 Hz, 2H), 7.56 (d, J=4.0 Hz, 1H), 7.64 (d, J=8.8 Hz, 2H), 8.28 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.20H.sub.17O.sub.2N.sub.2S.sub.2 [M+H].sup.+: 381.0731. Found: 381.0730.

Example 27

Compound III-27

[0141] ##STR00051##

[0142] With reference to the synthetic method of compound III-1, and compound 4 (With reference to the synthetic method of Heterocycles, 1997, 46, 489-501.) .sup.1H NMR (400 MHz, CDCl.sub.3): δ 2.07 (m, 4H), 3.33 (t, J=6.6 Hz, 4H), 4.2 (s, 3H), 5.70 (d, J=4.4 Hz, 1H), 6.92 (d, J=4.0 Hz, 1H), 7.15 (d, J=4.0 Hz, 1H), 7.43 (d, J=8.2 Hz, 2H), 7.51 (d, J=8.2 Hz, 2H), 7.57 (d, J=4.0 Hz, 1H), 8.10 (s, 1H). HRMS (ESI-TOF): Calcd. For C.sub.23H.sub.21O.sub.2N.sub.2S.sub.2 [M+H].sup.+: 421.1044. Found: 521.1042.

Example 28

Compound III-28

[0143] ##STR00052##

[0144] With reference to the synthetic method of compound III-1, and compound 5 (With reference to the synthetic method of WO2018014821). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.02 (s, 3H).sub.o HRMS (ESI-TOF): Calcd. For C.sub.21H.sub.16ON.sub.3S.sub.3. [M+H].sup.+: 422.0455. Found: 422.0456.

Example 29

Compound III-29

[0145] ##STR00053##

[0146] With reference to the synthetic method of compound III-1, and compound 6 (With reference to the synthetic method of WO2018014821).sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H) 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.56 (q, J=4.0 Hz, 2H), 3.01 (s, 6H), 1.21 (t, J=4.0 Hz, 3H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.19O.sub.2N.sub.2S.sub.3. [M+H].sup.+: 439.0609. Found: 439.0610.

Example 30

Compound III-30

[0147] ##STR00054##

[0148] With reference to the synthetic method of compound III-1, and compound 7 (With reference to the synthetic method of WO 2014048547). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.10 (s, 3H), 3.01 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.21H.sub.17O.sub.1N.sub.2S.sub.4. [M+H].sup.+: 429.0024. Found: 429.0026.

Example 31

Compound III-31

[0149] ##STR00055##

[0150] With reference to the synthetic method of compound III-1, and compound 9 (With reference to the synthetic method of J. Chem. Pharm. Res., 2012, 4, 1661-1669). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.14 (s, 3H), 3.01 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.23O.sub.2N.sub.2S.sub.3Si. [M+H].sup.+: 471.0691. Found: 471.0690.

Example 32

Compound III-32

[0151] ##STR00056##

[0152] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.77 (t, 2H, J=4.80 Hz), 3.41 (t, 2H, J=4.80 Hz), 3.00 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.24O.sub.3N.sub.3S.sub.3Si. [M+H].sup.+: 502.0749. Found: 502.0752.

Example 33

Compound III-33

[0153] ##STR00057##

[0154] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 0.46 (s, 6H). Calcd. For C.sub.23H.sub.22ON.sub.3S.sub.2Si. [M+H].sup.+: 448.0974. Found: 448.0972.

Example 34

Compound III-34

[0155] ##STR00058##

[0156] With reference to the synthetic method of compound III-1. H-NMR (400 MHz, CDCl.sub.3): δ=7.83 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.11 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.06 (s, 3H), 1.46 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.24H.sub.24O.sub.2N.sub.3S.sub.2 [M+H].sup.+:450.1310. Found: 450.1311.

Example 35

[0157] ##STR00059##

[0158] With reference to the synthetic method of (K. T. Arun et. al. J. Phys. Chem. A. 2005, 109, 5571-5578.) .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=10.01 (s, 1H), 7.89 (s, 1H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.52-3.65 (m, 20H), 3.37 (s, 3H), 2.97 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.24H.sub.22ON.sub.3S.sub.2Si. [M+H].sup.+:432.1204. Found: 432.1203. Calcd. For C.sub.24H.sub.36O.sub.6N.sub.1S.sub.2. [M+H].sup.+: 497.3. Found: 497.3.

Compound III-35

[0159] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, CDCl.sub.3): δ=7.89 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.18 (s, 1H), 6.96 (d, 2H, J=5.6 Hz), 3.52-3.65 (m, 20H), 3.37 (s, 3H), 2.97 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.33H.sub.39O.sub.5N.sub.3S.sub.2. [M+H].sup.+: 622.2409. Found: 622.2409.

Control Example 1

Compound III-36

[0160] ##STR00060##

[0161] With reference to the synthetic method of compound III-1, (0.25 g, 91%) o. H NMR (400 MHz, DMSO-d.sub.6): δ=8.21 (s, 2H), 7.99 (s, 1H), 7.64 (s, 4H), 3.64 (t, J=8.9 Hz, 2H), 3.44 (t, J=8.8 Hz, 2H), 3.12 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.16H.sub.17N.sub.4O.sub.4S [M+H].sup.+: 361.0971. Found: 361.0970

Control Example 2

Compound III-37

[0162] ##STR00061##

[0163] With reference to the synthetic method of compound III-1, (0.39 g, 910%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=7.83 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.11 (s, 1H), 3.85 (t, 2H, J=4.80 Hz), 3.46 (t, 2H, J=4.80 Hz), 3.05 (s, 3H), 1.46 (s, 6H). HRMS (ESI-TOF): Calcd. For C.sub.23H.sub.23N.sub.2O.sub.4S.sub.3 [M+H].sup.+: 487.0820. Found: 487.0821.

Control Example 3

Compound III-38

[0164] ##STR00062##

[0165] With reference to the synthetic method of compound III-1, and compound 11 (With reference to the synthetic method of CN 106349105). .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.01 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.22H.sub.23O.sub.4N.sub.2S.sub.3Si. [M+H].sup.+: 503.0589. Found: 203.0588.

Control Example 4

Compound III-39

[0166] ##STR00063##

[0167] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.84 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.49 (d, J=8.8 Hz, 2H), 3.78 (t, 2H, J=4.80 Hz), 3.44 (t, 2H, J=4.80 Hz), 3.01 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.19O.sub.4N.sub.2S.[M+H].sup.+: 359.1066. Found: 359.1065.

Control Example 5

Compound III-40

[0168] ##STR00064##

[0169] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=8.34 (s, 1H), 7.59 (d, J=8.0 Hz, 2H), 7.81 (s, 1H), 7.49 (d, J=8.0 Hz, 2H), 6.32 (s, 1H), 4.88 (t, J=4.0 Hz, 1H), 3.65 (q, J=5.5 Hz, 2H), 3.44 (t, J=5.5 Hz, 2H), 3.34 (s, 1H), 3.08 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.18H.sub.17O.sub.4N.sub.2S.sub.3. [M+H].sup.+: 421.0350. Found: 421.0351.

Control Example 6

Compound III-41

[0170] ##STR00065##

[0171] With reference to the synthetic method of compound III-1. .sup.1H-NMR (400 MHz, DMSO-d.sub.6): δ=7.85 (s, 1H), 7.59 (d, J=8.8 Hz, 2H), 7.47 (d, J=8.8 Hz, 2H), 7.24 (s, 1H), 3.79 (t, 2H, J=4.80 Hz), 3.43 (t, 2H, J=4.80 Hz), 3.01 (s, 3H). HRMS (ESI-TOF): Calcd. For C.sub.20H.sub.17O.sub.4N.sub.2S.sub.4. [M+H].sup.+: 477.0071. Found: 477.0070.

Control Example 7

Compound III-42

[0172] ##STR00066##

[0173] With reference to the synthetic method of compound III-1, (0.25 g, 91%). .sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.22 (s, 1H), 8.00 (d, J=9.1 Hz, 1H), 7.77-7.69 (m, 1H), 7.43-7.34 (m, 1H), 6.88 (d, J=9.1 Hz, 1H), 4.81 (t, J=5.2 Hz, 1H), 3.64-3.52 (m, 3H), 3.09 (s, 1H). LR-HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.18N.sub.3O.sub.2 [M+H].sup.+: 320.1399. Found: 320.1397.

Control Example 8

Compound III-43

[0174] ##STR00067##

[0175] With reference to the synthetic method of compound III-1, (0.29 g, 94%).sup.1H NMR (400 MHz, DMSO-d.sub.6): δ=8.11 (2H, d, J=10.4 Hz), 7.99 (3H, dd, J=8.6, 3.0 Hz), 7.54 (1H, dd, J=8.0, 8.0 Hz), 7.44 (1H, dd, J=8.0, 8.0 Hz), 6.88 (2H, d, J=9.2 Hz), 4.82 (1H, bt, t, J=5.2 Hz), 3.60 (2H, t, J=5.2 Hz), 3.56 (2H, t, J=5.2 Hz), 3.09 (3H, s). LR-HRMS (ESI-TOF): Calcd. For C.sub.19H.sub.18N.sub.3OS [M+H].sup.+: 336.1171. Found: 336.1170.

Test Example 1

[0176] The fluorescent dyes (molecular rotors) prepared in Examples 1-35 were dissolved in DMSO with a concentration of 1×10.sup.−2 M each, and each master batch was added to glycerol and methanol respectively, mixed well, and a solution with a final concentration of 1×10.sup.−5 M each was prepared. According to the different fluorescent dyes, the fluorescence emission pattern of each fluorescent dye was detected under the same conditions using the maximum excitation wavelength of each fluorescent dye in turn, and the results are shown in Table 1, indicating that the fluorescent dyes of the present invention are sensitive to changes in viscosity.

TABLE-US-00001 TABLE 1 Glycerol/methanol Emission fluorescence Compound (nm) intensity ratio III-1  530 990 III-2  530 870 III-3  530 1025 III-4  521 892 III-5  525 1028 III-6  490 1148 III-7  485 977 III-8  495 1168 III-9  490 920 III-10 520 1620 III-11 470 869 III-12 542 855 III-13 545 752 III-14 550 785 III-15 561 1011 III-16 555 491 III-17 587 828 III-18 595 978 III-19 620 991 III-20 620 836 III-21 620 544 III-22 650 989 III-23 661 687 III-24 662 596 III-25 678 783 III-26 676 368 III-27 678 486 III-28 662 559 III-29 665 684 III-30 660 756 III-31 687 624 III-32 690 817 III-33 705 691 III-34 689 489 III-35 690 710

Test Example 2

[0177] Add molecular rotors III-3, III-4, III-28 and III-34 to a diethanol-glycerol mixed solution to prepare a solution with a final concentration of 1×10.sup.−5 M, conduct excitation at 480 nm, and the fluorescence emission spectra at different viscosity conditions are shown as FIGS. 1, 3, 5 and 7, wherein molecular rotors of the same concentration have gradually increasing fluorescence intensity at different viscosity conditions, which indicates that the fluorescence intensity of molecular rotors increases following the increasing fluorescence of environmental viscosity, and that the relationship between the fluorescence intensity log and the solvent intensity log satisfies the Huffman equation and has a fine linear relation as shown in FIGS. 2, 4, 6, 8, proving that that molecular rotors are sensitive to viscosity and can be used for viscosity tests of unknown samples.

Test Example 3

[0178] Add molecular rotors III-11 and III-36; III-34 and III-37; III-31, III-32, III-33 and III-38; 11-3 and III-39; III-21 and III-40; III-28, III-29, III-30 and III-41; III-3 and III-42; III-3 and III-43 to a PBS solution to prepare a solution with a final concentration of 1×10.sup.−6 M, conduct excitation respectively at the maximum excitation of each compound so as to detect their fluorescence intensities in PBS, and normalize each sample with the strongest fluorescence in each group as 100, as shown respectively in FIG. 9, FIG. 10, FIG. 11, FIG. 12, FIG. 13, FIG. 14, FIG. 15 and FIG. 16. According to the results, compared with the molecular rotors with sulfonic acid group substitution and the rotors without substitution on the aromatic ring of the electron withdrawing group, the molecular rotors with cyano group, ester group, sulfoxide, sulphone, sulfonamido substitutions on the aromatic ring of the electron withdrawing group in the present application have lower background fluorescence.

Test Example 4

[0179] Compounds III-3, III-4, III-6, III-7, III-8, III-18, III-21 and RNA aptamer (Sequence 10: F30-8Pepper-5 RNA aptamer sequence UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUGAUGAUCCCCAAUC GUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCG UGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGU GGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAUCGUG GCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCUUCGGAGAGG CACUGGCGCCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGAGA GGCACUGGCGCCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGA GAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGGAUCAUUCAUGGCAA) are specifically bound, and the compound fluorescence after binding is noticeably activated and emits bright fluorescence when being excited by excitation light with an appropriate wavelength, see Table 2 for the optical properties after binding; the compounds can also bind to this aptamer in cells, and cells transcribing the RNA aptamer have bright fluorescence, as shown in FIG. 17A, and cells not expressing the RNA aptamer has no fluorescence, as shown in FIG. 17B, indicating that dyes of this series can be used for nucleic acid labeling.

TABLE-US-00002 TABLE 2 ε (M.sup.−1 QY Activation K.sub.d Name Ex/nm Em/nm cm.sup.−1) (−) Multiple (nM) III-7 443 485 49100 0.42 691 8.0 III-6 435 497 54700 0.57 16601 6.7 III-8 458 508 42500 0.30 9091 27.0 III-4 458 514 44100 0.45 4748 12.0 III-3 485 530 65300 0.66 3595 3.5 III-18 515 599 54400 0.43 708 18.0 III-21 577 620 10000 0.58 12600 6.1 Note: the fluorescence quantum yield was measured by the relative method with Rhodamine 6G as the standard (QY = 0.94).

Test Example 5

[0180] A stable cell line (293T/17 cell line) was constructed by fusing the skeleton protein mRNA with the aptamer (ACTB-4Pepper RNA aptamer sequence AUGGAUGAUGAUAUCGCCGCGCUCGUCGUCGACAACGGCUCCGGCAUG UGCAAGGCCGGCUUCGCGGGCGACGAUGCCCCCCGGGCCGUCUUCCCCU CCAUCGUGGGGCGCCCCAGGCACCAGGGCGUGAUGGUGGGCAUGGGUC AGAAGGAUUCCUAUGUGGGCGACGAGGCCCAGAGCAAGAGAGGCAUCC UCACCCUGAAGUACCCCAUCGAGCACGGCAUCGUCACCAACUGGGACGA CAUGGAGAAAAUCUGGCACCACACCUUCUACAAUGAGCUGCGUGUGGC UCCCGAGGAGCACCCCGUGCUGCUGACCGAGGCCCCCCUGAACCCCAAG GCCAACCGCGAGAAGAUGACCCAGAUCAUGUUUGAGACCUUCAACACCC CAGCCAUGUACGUUGCUAUCCAGGCUGUGCUAUCCCUGUACGCCUCUGG CCGUACCACUGGCAUCGUGAUGGACUCCGGUGACGGGGUCACCCACACU GUGCCCAUCUACGAGGGGUAUGCCCUCCCCCAUGCCAUCCUGCGUCUGG ACCUGGCUGGCCGGGACCUGACUGACUACCUCAUGAAGAUCCUCACCGA GCGCGGCUACAGCUUCACCACCACGGCCGAGCGGGAAAUCGUGCGUGAC AUUAAGGAGAAGCUGUGCUACGUCGCCCUGGACUUCGAGCAAGAGAUG GCCACGGCUGCUUCCAGCUCCUCCCUGGAGAAGAGCUACGAGCUGCCUG ACGGCCAGGUCAUCACCAUUGGCAAUGAGCGGUUCCGCUGCCCUGAGGC ACUCUUCCAGCCUUCCUUCCUGGGCAUGGAGUCCUGUGGCAUCCACGAA ACUACCUUCAACUCCAUCAUGAAGUGUGACGUGGACAUCCGCAAAGACC UGUACGCCAACACAGUGCUGUCUGGCGGCACCACCAUGUACCCUGGCAU UGCCGACAGGAUGCAGAAGGAGAUCACUGCCCUGGCACCCAGCACAAUG AAGAUCAAGAUCAUUGCUCCUCCUGAGCGCAAGUACUCCGUGUGGAUC GGCGGCUCCAUCCUGGCCUCGCUGUCCACCUUCCAGCAGAUGUGGAUCA GCAAGCAGGAGUAUGACGAGUCCGGCCCCUCCAUCGUCCACCGCAAAUG CUUCUAGCACUCGCUAGAGCAUGGUUAAGCUUCCCACGGAGGAUCCCCA AUCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAA UCGUGGCGUGUCGGCCUCUCCCAAUCGUGGCGUGUCGGCCUCUCCCAAU CGUGGCGUGUCGGCCUCUCUUCGGAGAGGCACUGGCGCCGGAGAGGCAC UGGCGCCGGAGAGGCACUGGCGCCGGAGAGGCACUGGCGCCGGGAUCCU CCGUGGG), and, under the conditions of conventional mammalian cell culture (37° C., 5% carbon dioxide, 100% relative humidity), the cells were digested after the cell line and control cells (293T/17) grew to a cell confluence of 90%, and were centrifuged at 800 rpm, and then the cells were re-suspended with PBS containing 0.2 μM of III-3 and 0.2 μM of III-43 molecules, and were incubated for 5 minutes before flow detection, see FIGS. 18A and 18B for the detection results; the III-3 molecular rotors could specifically mark the mRNA of skeleton protein in cell lines expressing target RNA, and there was no obvious background fluorescence (as shown in FIG. 18A), while the background fluorescence of III-43 molecules was higher than III-3, and it was unclear whether ACTB was expressed (see FIG. 18B).