NANOCHANNEL SYSTEMS AND METHODS FOR DETECTING PATHOGENS USING SAME

Abstract

A method of detecting a pathogen uses a 3D nanochannel device having top and bottom chambers, and a plurality of nanochannels. The method also includes functionalizing a nanochannel by coupling an oligonucleotide probe to an inner surface thereof. The method further includes adding a lysis buffer and patient sample to the top chamber. Moreover, the method includes extracting an oligonucleotide from the patient sample. In addition, the method includes placing top and bottom electrodes in the top and bottom chambers respectively and applying an electrophoretic bias therethrough. The method also includes applying a selection bias across first and second gating nanoelectrodes to direct flow of the oligonucleotide through the nanochannel. Moreover, the method includes applying a sensing bias through a sensing nanoelectrode. In addition, the method includes detecting an output current from the sensing nanoelectrode, and analyzing the output current from the sensing nanoelectrode to detect the oligonucleotide.

Claims

1. A method of detecting a pathogen in a patient sample, comprising: providing a 3D nanochannel device having top and bottom chambers, and a 3D nanochannel array disposed in the top and bottom chambers such that the top and bottom chambers are fluidly coupled by a plurality of nanochannels in the 3D nanochannel array; functionalizing the 3D nanochannel array by coupling an oligonucleotide probe to an inner surface of the 3D nanochannel device defining the nanochannel, wherein the oligonucleotide probe is complementary to an oligonucleotide characteristic of the pathogen; adding a lysis buffer to the top chamber; adding the patient sample to the lysis buffer; extracting an oligonucleotide from the patient sample in the lysis buffer to form a sample solution; placing top and bottom electrodes in the top and bottom chambers respectively; applying an electrophoretic bias between the top and bottom electrodes; applying a selection bias across first and second gating nanoelectrodes in the 3D nanochannel device to direct flow of the oligonucleotide through a nanochannel of the plurality of nanochannels; applying a sensing bias through a sensing nanoelectrode in the 3D nanochannel device; detecting an output current from the sensing nanoelectrode; and analyzing the output current from the sensing nanoelectrode to detect the oligonucleotide.

2. The method of claim 1, wherein functionalizing the 3D nanochannel array by coupling the oligonucleotide probe to the inner surface of the 3D nanochannel device defining the nanochannel comprises: adding a solution of the oligonucleotide probe to the 3D nanochannel array; running a current through the 3D nanochannel array; washing the 3D nanochannel array; and reading a signal from the 3D nanochannel array to confirm functionalization of same.

3. The method of claim 2, wherein washing the 3D nanochannel array comprises using a microfluidic chamber.

4. The method of claim 1, wherein analyzing the output current from the sensing nanoelectrode to detect the oligonucleotide is performed by a processor coupled to the 3D nanochannel device.

5. The method of claim 4, wherein the processor is coupled to the 3D nanochannel device via a wired connection.

6. The method of claim 4, wherein the processor is coupled to the 3D nanochannel device via a wireless connection.

7. The method of claim 1, wherein detecting the 3D nanochannel device has more than 100 nanochannels therein.

8. The method of claim 1, wherein the 3D nanochannel device comprises first, second, third, and fourth nanoelectrodes.

9. The method of claim 8, wherein the first nanoelectrode is configured for sensing, and wherein the second, third, and fourth nanoelectrodes are configured for three dimensional sensing.

10. The method of claim 1, wherein extracting the oligonucleotide from the patient sample in the lysis buffer to form the sample solution comprises heating the lysis buffer with the patient sample therein.

11. The method of claim 1, further comprising displaying a qualitative result.

12. The method of claim 1, further comprising displaying a quantitative result.

13. The method of claim 1, wherein the 3D nanochannel device comprises a battery.

14. The method of claim 1, wherein the method can be carried out in a point of care, bedside system.

15. The method of claim 1, wherein the 3D nanochannel array increases the surface area to volume ratio of the 3D nanochannel device.

16. The method of claim 1, wherein the method is configured to detect the oligonucleotide at a 10 femtomolar concentration or less.

17. The method of claim 1, wherein the method is configured to detect the oligonucleotide in about one minute.

18. The method of claim 1, further comprising functionalizing the 3D nanochannel array by coupling a second oligonucleotide probe to an inner surface of the 3D nanochannel device defining a second nanochannel, wherein the second oligonucleotide probe is different from the oligonucleotide probe, and wherein the second oligonucleotide probe is complementary to a second oligonucleotide.

19. The method of claim 18, wherein the second oligonucleotide is characteristic of the pathogen.

20. The method of claim 18, wherein the second oligonucleotide is characteristic of another pathogen.

21. The method of claim 18, further comprising displaying first and second colors corresponding to number ranges for the oligonucleotide probe and the second oligonucleotide probe respectively.

22. The method of claim 18, further comprising displaying first and second plots corresponding to number ranges for the oligonucleotide probe and the second oligonucleotide probe respectively.

23. The method of claim 1, wherein adding the patient sample to the lysis buffer comprises a swab with the patient sample thereof into the lysis buffer.

24. The method of claim 23, further comprises processing a single swab from a single patient.

25. The method of claim 23, further comprises processing a plurality of swabs from a plurality of patients using a plurality of 3D nanochannel arrays.

26. The method of claim 1, wherein extracting the oligonucleotide from the patient sample comprises heating the lysis buffer to about 98° C. to about 100° C.

27. The method of claim 26, further comprising cooling the lysis buffer before applying the electrophoretic bias between the top and bottom electrodes.

28. The method of claim 1, further comprising performing target genome sequencing using end-to-end barcode oligonucleotides or components thereof, which can be aligned on the inner surface defining the nanochannel and read.

29.-52. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The drawings described below are for illustration purposes only. The drawings are not intended to limit the scope of the present disclosure. The drawings illustrate the design and utility of various embodiments of the present disclosure. It should be noted that the figures are not drawn to scale and that elements of similar structures or functions are represented by like reference numerals throughout the figures. In order to better appreciate how to obtain the recited and other advantages and objects of various embodiments of the disclosure, a more detailed description of the present disclosure will be rendered by reference to specific embodiments thereof, which are illustrated in the accompanying drawings. Understanding that these drawings depict only typical embodiments of the disclosure and are not therefore to be considered limiting of its scope, the disclosure will be described and explained with additional specificity and detail through the use of the accompanying drawings.

[0042] FIG. 1 generally and schematically depicts a method 100 for detecting a pathogen and diagnosing a disease according to some embodiments.

[0043] FIG. 2 is a graph illustrating a data analysis method according to some embodiments.

[0044] FIG. 3 is a graph illustrating the specificity and sensitivity of a method for detecting a pathogen and diagnosing a disease according to some embodiments.

[0045] FIGS. 4 and 5 schematically depict point of care pathogen detection systems/platforms according to some embodiments.

[0046] FIGS. 6A and 6B schematically depict flow cells for use in point of care pathogen detection systems/platforms according to some embodiments.

[0047] FIGS. 7A and 7B schematically depict a cartridge for use in point of care pathogen detection systems/platforms according to some embodiments.

[0048] FIG. 8 schematically depicts a main board for use in point of care pathogen detection systems/platforms according to some embodiments.

[0049] FIGS. 9-11 schematically depict hybridization of target oligonucleotides to complementary oligonucleotide probes in 3D nanochannel arrays according to some embodiments.

[0050] In order to better appreciate how to obtain the above-recited and other advantages and objects of various embodiments, a more detailed description of embodiments is provided with reference to the accompanying drawings. It should be noted that the drawings are not drawn to scale and that elements of similar structures or functions are represented by like reference numerals throughout. It will be understood that these drawings depict only certain illustrated embodiments and are not therefore to be considered limiting of scope of embodiments.

DETAILED DESCRIPTION OF ILLUSTRATED EMBODIMENTS

[0051] Embodiments described herein are directed to nanochannel based electrically assisted point of care platforms/detection systems and methods of detecting SARS-CoV-2 using same. In particular, the embodiments are directed to various types (2D or 3D) of nanochannel based pathogen (e.g., SARS-CoV-2) detection systems, methods of using nanochannel array devices, and methods of detecting SARS-CoV-2 or other pathogens by using a nanochannel based 3D sensor system.

[0052] In some embodiments, a method of detecting a pathogen like SARS-CoV-2 (e.g., using a target oligonucleotide in the SARS-CoV-2 genome) includes providing a 3D nanochannel device having top and bottom chambers, and a 3D nanochannel array disposed in the top and bottom chambers such that the top and bottom chambers are fluidly coupled by a plurality of nanochannels in the 3D nanochannel array. Examples of such 3D nanochannel arrays are described in U.S. Provisional Patent Application Ser. Nos. 62/566,313, 62/593,840 and 62/923,396, and U.S. Utility patent application Ser. Nos. 16/147,362 and 16/524,033, the contents of which have been previously incorporated by reference herein. The method also includes functionalizing the 3D nanochannel array by coupling a target/pathogen specific oligonucleotide probe to an inner surface of the 3D nanochannel array defining the plurality of nanochannels, where the pathogen target oligonucleotide is complementary to the oligonucleotide probe.

[0053] The method further includes adding an oropharyngeal and/or nasopharyngeal swab to a buffer to form a solution including the isolated sample from the patient. The sampling method may follow the CDC approved method for oropharyngeal and/or nasopharyngeal swab sample collection. Moreover, the method includes adding the sample solution to the top chamber and gently mixing the sample solution with lysis buffer inside the top chamber. In addition, the method includes applying a current to the 3D nanochannel device for 5 minutes to bind the target oligonucleotide to the primer coupled to the walls of the plurality of nanochannels in the 3D nanochannel array.

[0054] After binding the target oligonucleotide to the primer on the walls of the nanochannels, the nanochannels are washed by replacing the sample solution with deionized (DI) water and allowing the nanochannels to equilibrate for about one minute with an applied current. After washing the nanochannels with DI water for one minute, completeness of the washing can be determined by plotting an intensity graph of the applied current (see FIG. 3 and corresponding description).

[0055] The method also includes placing top and bottom nanoelectrodes in the top and bottom chambers respectively. The method further includes applying an electrophoretic bias between the top and bottom nanoelectrodes during a running mode and a sensing step. Moreover, the method includes applying a selection bias across first and second gating nanoelectrodes in the 3D nanochannel device to direct flow of the oligonucleotide through a nanochannel of the plurality of nanochannels.

[0056] In addition, the method includes applying a sensing bias through a sensing nanoelectrode in the 3D nanochannel device. The method also includes detecting an output current from the sensing nanoelectrode and processing the output current as a delta current in software operatively coupled to the 3D nanochannel device. The method further includes analyzing the output current from the sensing nanoelectrode to detect coupling of the pathogen specific oligonucleotide (e.g., a target oligonucleotide in the SARS-CoV-2 genome) and to determine the extent thereof. Electrically addressing and sensing individual nanochannel channels within multi-channel nanochannel arrays, is described in U.S. Provisional Patent Application Ser. No. 62/612,534 and U.S. Utility patent application Ser. No. 16/237,570, the contents of which have been previously incorporated by reference herein.

[0057] In some embodiments, the method may also include functionalizing the 3D nanochannel array by coupling a second oligonucleotide probe (complementary to a second region in a pathogen specific oligonucleotide) to an inner surface of the 3D nanochannel array defining a second nanochannel, where the second oligonucleotide probe is different from the first oligonucleotide probe. Analyzing the output current from the sensing nanoelectrode to detect and measure the pathogen specific oligonucleotide may include comparing the output current and the sensing bias to corresponding values in a reference table. Analyzing the output current from the sensing nanoelectrode to detect coupling of the oligonucleotide may include using an effect of a negative charge in a phosphate backbone of the oligonucleotide. Charge carriers in the 3D nanochannel device may include DI water, H+ ions, and OH− ions.

[0058] In some embodiments, the pathogen specific oligonucleotide is an SARS-CoV-2 RNA fragment. In other embodiments, the pathogen specific oligonucleotide may be an RNA or DNA fragment from other pathogens. In some embodiments, the pathogen specific oligonucleotide may be extracted from patient samples such as cell free DNA, tissue, cell culture medium, nasal swab, nasal wash, mid-turbinate swab, sputum, bronchoalveolar lavage fluid, serum, urine, plasma, or saliva inside the top chamber of the 3D nanochannel device by disposing the patient sample in lysis buffer and heating the lysis buffer to 98° C. for several minutes.

[0059] Exemplary nucleic acid sequences for use with the 3D nanochannel devices and pathogen detection methods described herein are listed in the Table 1. The nucleic acid sequences were present in Coronavirus samples taken from COVID-19 patients in China, the United States of America (CA, MA, WI, AZ, and IL), Nepal, Sweden, Australia, Hong Kong, Taiwan, and Korea. The present sequences are designed by the inventors, from the approved sequences derived after sequencing and the region which have been confirmed by the CDC for SARS-CoV-2 detection and COVID-19 diagnosis. Note that the list below is not comprehensive, and that this invention subsumes other probes specific for COVID-19, or other viruses, that may accurately enable molecular detection.

[0060] In one embodiment a device and system for detecting pathogen includes one gene sequence as a probe to capture the target molecule, which relates to a specific pathogen. Accordingly, the device and system can have more than one type of probe to capture one gene and detect the pathogen genome which may be DNA, RNA, protein, antibody, antigen, and relate to the particular pathogen. For instance, the target fragment and or probe can detect a wide range (e.g., millions) of DNA, RNA, and/or protein targets, which derive from one or different pathogens.

[0061] In one embodiment such device and system can operate target genome sequencing by using the end to end barcode oligonucleotides or component which can be aligned after the reading and electrical scanning the sensor surface. Exemplary oligonucleotide probes for use with SARS-CoV-2 detection platforms are listed in Table 1.

TABLE-US-00001 TABLE 1 Oligonucleotide Probes for SARS-CoV-2 Detection Platforms Genes corresponding to probe Sr# Start End 40 bp probe sequence seq1 3060 3099 AAGAAGGTGATTGTGAAGAAGAAGAGTTTGAG RdRP/ORF1 CCATCAAC ab seq2 1093 1133 CTTAAATTCCATAATCAAGACTATTCAACCAAG RdRP/ORF1 GGTTGAA ab seq3 9556 9596 TTACTCATTCTTACCTGGTGTTTATTCTGTTATT RdRP/ORF1 TACTTG ab seq4 10974 11014 GTGCAGTGAAAAGAACAATCAAGGGTACACAC RdRP/ORF1 CACTGGTT ab seq5 21563 21603 ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCT RdRP/ORF1 CTAGTC ab and S seq6 22869 22909 GGAATTCTAACAATCTTGATTCTAAGGTTGGTG S GTAATTA seq7 25608 25648 ACTCTCCAAGGGTGTTCACTTTGTTTGCAACTT ORF3a GCTGTTG seq8 27851 27891 TGAACTGCAAGATCATAATGAAACTTGTCACG ORF7b CCTAAACG Seq9 26332 26372 ACACTAGCCATCCTTACTGCGCTTCGATTGTG E gene TGCGTACT Seq10 28309 28349 ACCCCGCATTACGTTTGGTGGACCCTCAGATT N gene CAACTGGC

[0062] The 3D nanochannel devices and platforms described herein can be incorporated in an automated point of care pathogen detection system leveraging microfluidics for preparation and extraction of patient samples, pathogen detection via oligonucleotide hybridization, and data analysis. Such point of care pathogen detection systems can be used to detect the SARS-CoV-2 virus and diagnose COVID-19 disease using a bedside point of care system. Alternatively, samples may be appropriately collected and forwarded, under suitable conditions and within a specified timeframe, to a CLIA certified laboratory at which testing may be conducted.

[0063] FIG. 1 depicts three general steps in a method 100 for detecting a pathogen (e.g., SARS-CoV-2) and diagnosing a disease (e.g., COVID-19) according to some embodiments. At step 102, patient samples are collected, prepared, and target oligonucleotides are extracted therefrom as described herein. At step 104, the extracted patient sample is run on a point of care system including the 3D nanochannel device to generate data relating to the target oligonucleotides as described herein. At step 106, the generated data is analyzed to detect the oligonucleotides in the patient sample for pathogen detection and disease diagnosis as described herein. Software allowing data analysis and representation has been validated and verified.

[0064] FIG. 2 is a graph 200 illustrating a data analysis method for detecting SARS-CoV-2 specific oligonucleotides and diagnosing COVID-19 disease using 3D nanochannel devices according to some embodiments. The 3D nanochannel devices detect an oligonucleotide detection signal in response to an applied delta current. The graph 200 plots a detection signal (Y axis) vs. an applied delta current (X axis) for a control sample 202 and a sample containing SARS-CoV-2 specific oligonucleotides (target) 204. The amount of applied delta current to generate the control and target curves 202, 204 and their normal distributions across respective mean values 206, 208 can be used to distinguish a positive sample 204 from a negative sample 202.

[0065] FIG. 3 is a graph 300 illustrating the specificity and sensitivity of a method for detecting SARS-CoV-2 specific oligonucleotides and diagnosing COVID-19 infection using 3D nanochannel devices according to some embodiments. In FIG. 3 test results are plotted along the X-axis while specificity and sensitivity for each test result are plotted along the Y-axis. The graph 300 shows that both the specificity and sensitivity of the method are each about 100% for test values between about 3.9 and about 7.0.

[0066] FIG. 4 schematically depicts a point of care pathogen (e.g., SARS-CoV-2) detection system/platform 400 including a 3D nanochannel device according to some embodiments. The system 400 includes a small footprint 3D nanochannel detection device 402 to analyze patient samples and generate data, and a computer 404 with a processor programmed to analyze the generated data as described herein. The input to the system may be a patient swab. The output of the system 400 may be a Graphical User Interface 406 showing a graph 408 and an indication of whether the pathogen has been detected.

[0067] FIG. 5 schematically depicts a point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection device 500 according to some embodiments. The device 500 has a small footprint for use at a point of care/bedside. The device 500 includes a 3D nanochannel cartridge 508, which includes a flow cell 510 having top and bottom chambers, and a 3D nanochannel array disposed in the top and bottom chambers such that the top and bottom chambers are fluidly coupled by a plurality of nanochannels in the 3D nanochannel array, as described herein. The cartridge 508 may be disposable and may minimize or eliminate contamination between patient samples. The cartridge 508 may also increase the throughput of the device 500 by minimizing cleaning requirements. The device 500 may be used with a swab 502 with a patient sample on a tip 504 thereof as described herein. The patient sample on the swab tip 504 may be loaded into a top chamber 506 of the flow cell 510 of the device 500 as described herein. After processing and analysis, generated results may be transmitted to a computer (see FIG. 4) via a Bluetooth connection 512.

[0068] FIGS. 6A and 6B schematically depict flow cells 600A, 600B for use in point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection devices according to some embodiments. The flow cells 600A, 600B may be used with the point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection systems and devices 400, 500 depicted in FIGS. 4 and 5. The flow cells 600A, 600B have one (600A) or more (e.g., four in 600B) sample containers 602 with lysis buffer therein. A patient sample on a tip 604 of a swab 606 may be loaded into a sample container 602 containing a sample solution (i.e., patient sample in lysis buffer) therein for solubilization of the patient sample. The sample container 602 may be fluidly coupled to a top chamber of the flow cell 600A, 600B to deliver the patient sample to the 3D nanochannel device therein (see FIG. 5). The flow cell 600A has one sample container 602, and the flow cell 600B has four sample containers. The flow cells 600A, 600B can process patient samples from one patient at a time (see FIG. 6A) or from a plurality of samples from a plurality of patients (see FIG. 6B) using a plurality of isolated 3D nanochannel arrays in one system.

[0069] FIGS. 7A and 7B schematically depict a cartridge 700 for use in point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection devices according to some embodiments. The cartridge 700 includes a cartridge/sensor board 702 and a 3D nanochannel device/sensor 704 coupled to the cartridge/sensor board 702 with an attachment/wiring harness 706. A flow cell 708 is attached to the 3D nanochannel device/sensor 704 and the cartridge/sensor board 702. During manufacturing, the cartridge/sensor board 702 can be first formed. Next, the wiring harness 706 can be attached thereto or formed thereon. Next, the 3D nanochannel device/sensor 704 can be attached to the wiring harness 706. Next, the flow cell 708 can be attached to the 3D nanochannel device/sensor 704 and cartridge/sensor board 702.

[0070] FIG. 8 schematically depicts a main board 800 for use in point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection devices according to some embodiments. The main board 800 is a part of point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection devices, such as the point of care pathogen (e.g., SARS-CoV-2) 3D nanochannel detection system and device 400, 500 depicted in FIGS. 4 and 5. The main board 800 includes a cartridge connector 802 configured to electrically and physically couple a cartridge 700 thereto. The cartridge 700 includes a cartridge/sensor board 702, a flow cell 708, a sample container 710, and a heating system 712. The heating system 712 may be used to process the patient sample as described herein.

[0071] FIGS. 9 to 11 schematically depict hybridization of target (e.g., SARS-CoV-2 specific) oligonucleotides to oligonucleotide probes designed to be complementary thereto according to some embodiments. Hybridization of target oligonucleotides to oligonucleotide probes is a part of methods for detecting and quantifying the target oligonucleotides according to some embodiments, such as those described in U.S. Utility patent application Ser. No. 16/237,570, the contents of which have been previously incorporated by reference herein.

[0072] FIG. 9 schematically depicts a portion of a functionalized nanochannel array 900 with nanoelectrodes 902, 904 embedded therein according to some embodiments. Exemplary nanochannel arrays with nanoelectrodes embedded therein are described in U.S. Provisional Patent Application Ser. Nos. 62/711,234, 62/874,766 and 62/972,415, and U.S. Utility patent application Ser. No. 16/524,033, the contents of which have been previously incorporated by reference herein. The nanochannel array 900 also includes DNA probes 906 attached to a functionalized inner surface 908 of a nanochannel. The nanochannel array 900 further includes other DNA probes 910, which can be the same as or different from DNA probes 906, attached to inner surfaces of other nanochannels. The DNA probes 908, 910 may have the same or different sequences as described herein such as oligonucleotide probes for detecting SARS-CoV-2.

[0073] FIG. 10 schematically depicts the portion of the functionalized nanochannel array 900 depicted in FIG. 9 after extracted target SARS-CoV-2 RNA and/or cDNA molecules 912 have been added to the functionalized nanochannel array 900. FIG. 10 also depicts other extracted target SARS-CoV-2 RNA and/or cDNA molecules 914, which have also been added to the functionalized nanochannel array 900 and sensed by other nanochannels. The extracted target SARS-CoV-2 RNA and/or cDNA molecules 912, 914 may have the same or different sequences as described herein.

[0074] FIG. 11 schematically depicts the portion of the functionalized nanochannel array 900 depicted in FIGS. 9 and 10 after extracted target SARS-CoV-2 RNA and/or cDNA molecules 912 have attached to the SARS-CoV-2 specific oligonucleotide probes 906 coupled to a nanochannel in the functionalized nanochannel array 900. FIG. 11 also depicts other extracted target SARS-CoV-2 RNA and/or cDNA molecules 914, which have also attached to other SARS-CoV-2 specific oligonucleotide probes coupled to other nanochannels in the functionalized nanochannel array 900. The extracted target SARS-CoV-2 RNA and/or cDNA molecules 912, 914 may have the same or different sequences as described herein. After the extracted target SARS-CoV-2 RNA and/or cDNA molecules 912, 914 have attached to the SARS-CoV-2 specific oligonucleotide probes in the nanochannel array 900, electrical signals can be sensed with nanoelectrodes 902, 904 (see FIG. 9) and analyzed to detect and quantify the SARS-CoV-2 RNA and/or cDNA molecules 912, 914 as described herein and in methods such as those described in U.S. Utility patent application Ser. No. 16/237,570, the contents of which have been previously incorporated by reference herein.

[0075] The 3D nanochannel devices described herein can be used in point of care, bedside systems/platforms for detecting target biomolecules (e.g., RNA and/or cDNA related to COVID-19). The 3D nanochannel devices include preparation and extraction chambers and nanochannel arrays for sensing the target biomolecules. The point of care, bedside systems/platforms include processors and software operatively and communicatively coupled to the 3D nanochannel devices to control same and analyze data from same to generate diagnostic results. The communication between the processors and the 3D nanochannel devices may be wireless connections using Bluetooth connections. Each of the 3D nanochannel devices may have hundreds of nanochannels with each nanochannel having a plurality (e.g., two or four) nanoelectrodes embedded therein. The plurality of nanoelectrodes in each nanochannel provides sensing therein and increases sensitivity by decreasing the Debby lenses. The array of nanochannels increases the surface area to volume ratio of the 3D nanochannel devices and allows miniaturization of same and incorporation of same into small footprint/form factor point of care, bedside systems/platforms for detecting target biomolecules.

[0076] The 3D nanochannel devices described herein can detect target biomolecules without amplification (e.g., PCR) or fluorescent or other tagging, which may be used with two dimensional or planar sensors. Accordingly, the 3D nanochannel devices described herein can be used to replace amplification and tagging steps in other biochemical methods, shortening assay time.

[0077] The 3D nanochannel devices described herein have high sensitivity and have a very low detection limit in the range of 10 femtomolar concentration of target oligonucleotides or less. The 3D nanochannel devices described herein can detect a pathogen (e.g., SARS-CoV-2) and diagnose an infection (e.g., COVID-19) in a short period of time on the order of a minute to several minutes.

[0078] The 3D nanochannel devices described herein are configured for use with oropharyngeal and/or nasopharyngeal swabs to collect and process patient samples. The oropharyngeal and/or nasopharyngeal swabs with patient samples thereon are introduced into lysis buffer in the preparation and extraction chambers as described herein. Then an isothermal or gradient heating and cooling system can be used to prepare the patient sample in a solution of lysis buffer.

[0079] After the extraction step, the sample processing and analysis method using the 3D nanochannel devices described herein includes a washing step as described herein. After the washing step, a sensing step can be carried out as described herein. During the sensing step, the signal reading and intensity determination can be carried out in about one minute. The sensed signal and intensity is there processed as described herein to output qualitative and quantitative results as described herein.

[0080] In some embodiments, the 3D nanochannel devices include a first embedded nanoelectrode for sensing and second, third, and fourth nanoelectrodes for three dimensional sensing inside each nanochannel. The 3D nanochannel devices may include integrated microfluidic chambers to facilitate a washing step after sample preparation. The 3D nanochannel devices may include rechargeable batteries and may be connected to a processor via WiFi or a cloud network.

[0081] In some embodiments, a plurality of oligonucleotide probes complementary to several oligonucleotide targets indicative of a pathogen (e.g., SARS-CoV-2) or an infection (e.g., COVID-19) can be coupled to an inner surface of each nanochannel. In some embodiments, different oligonucleotide probes complementary to several oligonucleotide targets each indicative of a different pathogen or a different infection can be coupled to inner surfaces of respective nanochannels such that different nanochannels detect different pathogens and evidence of different infections. The 3D nanochannel devices described herein can be controlled by software to handle different oligonucleotide probes with different oligonucleotide targets in different nanochannels. The software can show the electrical signals sensed in different nanochannels (by different nanoelectrodes) using different colors for different numerical ranges of sensed current. Such software can analyze various sensed signals to generate intensity plots and two and three dimensional maps for observation of signals corresponding to different oligonucleotide probes inside each nanochannel.

[0082] The 3D nanochannel devices described herein can be configured to process patient samples from one patient at a time (see FIG. 6A) or from a plurality of samples from a plurality of patients (see FIG. 6B) using a plurality of isolated 3D nanochannel arrays in one system.

[0083] The probes used in the 3D nanochannel array sensors described herein may be modified to alter their surface chemistry, allowing more system control and design options. For instance, thiol modification may be used for thiol gold binding. Avidin/biotin and EDC crosslinker/N-hydroxysuccinimide (NHS) are other probe modification and target pairs that may be used with the 3D nanochannel array sensors described herein accommodating modification of structure and chemistry of immobilizing techniques.

[0084] The corresponding structures, materials, acts and equivalents of all means or step plus function elements in the claims below are intended to include any structures, materials, acts and equivalents for performing the function in combination with other claimed elements as specifically claimed. It is to be understood that while the invention has been described in conjunction with the above embodiments, the foregoing description and claims are not to limit the scope of the invention. Other aspects, advantages and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains.

[0085] In some embodiment the device and system use CRISPR enzymes as an immobilized probe in such structure and system to detect the target oligonucleotide within the particular pathogen, for instance using dCAS 9 or other crisper enzyme families for such platforms and systems.

[0086] In some embodiment using the provided temperature gradient can be used for performing Realtime PCR for amplification of a target molecule in such systems and platforms.

[0087] In some embodiment using such system and platform for a simple PCR protocol for amplification of the target molecule before sensing it.

[0088] In some embodiment using isothermal PCR before sensing the target molecule in an all in one system and platform described herein.

[0089] In some embodiment using monoclonal antibody as a functionalized probe to detect an antigen inside the collected sample.

[0090] In some embodiment DNA probes can be addressed by plurality of nanoelectrodes into particular nanochannel. Where the first electrode is for the addressing and the second and third electrode is for sensing the target RNA, or DNA or antigen.

[0091] In some embodiments using dressed polymer for covering the surface of the nanochannel before probe functionalization and cleaning it after sensing protocol and reusing such a sensor for diagnosis again.

[0092] A Sequence Listing is filed herewith as an ASCII text file. The name of the Sequence Listing ASCII text file is “US17378167_ST25.txt”. The date of creation of the Sequence Listing ASCII text file is Oct. 5, 2021. The size of the Sequence Listing ASCII text file is 2 KB. The Sequence Listing filed herewith is fully incorporated-by-reference herein as though set forth in full.

[0093] Various exemplary embodiments of the invention are described herein. Reference is made to these examples in a non-limiting sense. They are provided to illustrate more broadly applicable aspects of the invention. Various changes may be made to the invention described and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process act(s) or step(s) to the objective(s), spirit or scope of the present invention. Further, as will be appreciated by those with skill in the art, each of the individual variations described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present inventions. All such modifications are intended to be within the scope of claims associated with this disclosure.

[0094] Any of the devices described for carrying out the subject diagnostic or interventional procedures may be provided in packaged combination for use in executing such interventions. These supply “kits” may further include instructions for use and be packaged in sterile trays or containers as commonly employed for such purposes.

[0095] The invention includes methods that may be performed using the subject devices. The methods may comprise the act of providing such a suitable device. Such provision may be performed by the end user. In other words, the “providing” act merely requires the end user obtain, access, approach, position, set-up, activate, power-up or otherwise act to provide the requisite device in the subject method. Methods recited herein may be carried out in any order of the recited events which is logically possible, as well as in the recited order of events.

[0096] Exemplary aspects of the invention, together with details regarding material selection and manufacture have been set forth above. Other details of the present invention may be appreciated in connection with the above-referenced patents and publications as well as generally known or appreciated by those with skill in the art. The same may hold true with respect to method-based aspects of the invention in terms of additional acts as commonly or logically employed.

[0097] In addition, though the invention has been described in reference to several examples optionally incorporating various features, the invention is not to be limited to that which is described or indicated as contemplated with respect to each variation of the invention. Various changes may be made to the invention described and equivalents (whether recited herein or not included for the sake of some brevity) may be substituted without departing from the true spirit and scope of the invention. In addition, where a range of values is provided, it is understood that every intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention.

[0098] Also, it is contemplated that any optional feature of the inventive variations described may be set forth and claimed independently, or in combination with any one or more of the features described herein. Reference to a singular item, includes the possibility that there are plural of the same items present. More specifically, as used herein and in claims associated hereto, the singular forms “a,” “an,” “said,” and “the” include plural referents unless specifically stated otherwise. In other words, use of the articles allow for “at least one” of the subject item in the description above as well as claims associated with this disclosure. It is further noted that such claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0099] Without the use of such exclusive terminology, the term “comprising” in claims associated with this disclosure shall allow for the inclusion of any additional element—irrespective of whether a given number of elements are enumerated in such claims, or the addition of a feature could be regarded as transforming the nature of an element set forth in such claims. Except as specifically defined herein, all technical and scientific terms used herein are to be given as broad a commonly understood meaning as possible while maintaining claim validity.

[0100] The breadth of the present invention is not to be limited to the examples provided and/or the subject specification, but rather only by the scope of claim language associated with this disclosure.