HIGHLY STABLE AND SPECIFIC MOLECULAR BEACONS ENCAPSULATED IN CATIONIC LIPOPLEX NANOPARTICLES AND APPLICATION THEREOF
20210332423 · 2021-10-28
Inventors
Cpc classification
C12Q1/6818
CHEMISTRY; METALLURGY
C12Q2600/112
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a method of detecting the presence of mutated genes, mRNAs or microRNAs in a subject. The method comprises the following steps: (1) Provide a body fluid sample containing cells, circulating tumor cells (CTCs), and/or extracellular vesicles (EVs); and use an analyzer having overhang molecular beacons to measure fluorescence signals generated by interactions between the body fluid sample and the overhang molecular beacons, so as to detect the presence of the mutated genes, mRNAs or microRNA. Furthermore, a biochip comprising a gold coating substrate and tethered lipoplex nanoparticles encapsulating the overhang molecular beacons is also provided in the invention.
Claims
1. A method of detecting the presence of mutated genes, mRNAs or microRNAs in a subject, comprising: (1) Providing a body fluid sample containing cells, circulating tumor cells (CTCs), and/or extracellular vesicles (EVs); and (2) Using an analyzer having overhang molecular beacons to measure fluorescence signals generated by interactions between the body fluid sample and the overhang molecular beacons, so as to detect the presence of the mutated genes, mRNAs or microRNAs, wherein the overhang molecular beacons comprises a stem having at least 9-base pairs, a loop having at least 4 bases, an overhang section of at least 5 complementary bases to the mutated genes, mRNAs or microRNAs at the end of the stem, a fluorescence dye and a quencher at the 3′ end; and wherein the last complementary base of the overhang section or the first complementary base of the stem in the overhang molecular beacons is corresponding to a single-point mutated base of the mutated genes, mRNAs or microRNAs.
2. The method of claim 1, wherein the overhang molecular beacons are selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 12, SEQ ID No 13 and their combinations.
3. The method of claim 2, wherein the SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or their combinations is applied for detecting KRAS mutations.
4. The method of claim 2, wherein the SEQ ID No 7, SEQ ID No 9 or their combinations is applied for detecting EGFR mutations.
5. The method of claim 2, wherein the SEQ ID No 11, SEQ ID No 12 or their combinations is applied for detecting EML4-ALK fusion.
6. The method of claim 2, wherein the SEQ ID No 13 is applied for detecting miR-411 editions (EDs).
7. The method of claim 1, wherein the fluorescence dye comprises FAM, Cy3 and Cy5 at the 5′ end and an internal fluorescence dye comprises iFluorT, iCy3 and iCy5 close to the quencher position.
8. The method of claim 1, wherein the overhang molecular beacons are encapsulated within lipoplex nanoparticles which comprises cationic lipoplex nanoparticles and reacts with extracelluar vesicles and/or cells that are captured on the biochip surface by specific antibodies.
9. The method of claim 8, wherein the lipoplex nanoparticles are tethered on biochips and universal standard vesicle (SV) nanoparticles consisting of more than 100 target oligos from mRNA and miRNA targets are added as a standard for the biochips.
10. The method of claim 1, wherein the analyzer further comprises microfluidic channels, lipoplex nanoparticles for encapsulating the overhang molecular beacons, and a detector which comprises a total internal reflective fluorescence (TIRF) microscope, fluorescence microscope, plate reader or portable fluorescence detector.
11. The method of claim 1, wherein the mutated mRNA is corresponding to a cancer mutation comprises KRAS mutations in pancreactic cancer, EGFR mutations in non-small cell lung cancer, EML4-ALK fusion in non-small cell lung cancer.
12. The method of claim 1, wherein the body fluid sample is blood, serum, plasma, urine, sputum, or saliva from the subject.
13. A biochip for detecting mutated genes, mRNAs or microRNAs, comprising a gold coating substrate and lipoplex nanoparticles, wherein the lipoplex nanoparticles tether on the gold coating substrate and encapsulate a plaurity of overhang molecular beacons which comprise a stem having at least 9-base pairs, a loop having at least 4 bases, an overhang section of at least 5 complementary bases to the mutated genes, mRNAs or microRNAs at the end of the stem, a fluorescence dye and a quencher at the 3′ end; and wherein the last complementary base of the overhang section or the first complementary base of the stem in the overhang molecular beacons is corresponding to a single-point mutated base of the mutated gene, mRNAs, or microRNAs.
14. The biochip of claim 13, wherein the overhang molecular beacons are selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 12 SEQ ID No 13 and their combinations.
15. The biochip of claim 14, wherein the SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or their combinations is applied for detecting KRAS mutations.
16. The biochip of claim 14, wherein the SEQ ID No 7, SEQ ID No 9 or their combinations is applied for detecting EGFR mutations.
17. The biochip of claim 14, wherein the SEQ ID No 11, SEQ ID No 12 or their combinations is applied for detecting EML4-ALK fusion.
18. The biochip of claim 14, wherein the SEQ ID No 13 is applied for detecting miR-411 editions (EDs).
19. The biochip of claim 13, wherein the fluorescence dye comprises FAM, Cy3 and Cy5 at the 5′ end and an internal fluorescence dye comprises iFluorT, iCy3 and iCy5 close to the quencher position.
20. The biochip of claim 13, wherein the quencher at the 3′ end comprises BHQ-1 and BHQ-2.
Description
BRIEF DESCRIPTION OF THE DRAWING
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
[0026] In the following sequence listing, the symbol of [a], [c], [g], and [t] represent a modified base of locked nucleic acid (LNA) of a, c, g and t, respectively.
[0027] SEQ ID No 1 is a polynucleotide sequence of molecule beacon named Co-MB-miR21 set forth as follows:
TABLE-US-00001 (SEQ ID No 1) cgcgatctca [a]ca[t]ca[g]tc[t] ct[a]taa[g]cta gatcgcg
[0028] The SEQ ID No 1 further has a fluorophore or chromophore at the 5′ end and a quencher at the 3′ end. Preferably, the fluorophore at the 5′ end is 6FAM and the quencher at the 3′end is BHQ1.
[0029] SEQ ID No 2 is a polynucleotide sequence of the molecule beacon named Oh-MB-miR21 set forth as follows:
TABLE-US-00002 (SEQ ID No 2) [t]ca[a]ca[t]ca[g] tc[t]ga[t]aa[g]c t[a]gattatca gactga
[0030] The SEQ ID No 2 further has a fluorophore or chromophore at the 5′ end and a quencher at the 3′ end. Preferably, the fluorophore at the 5′ end is 6FAM and the quencher at the 3′ end is BHQ1.
[0031] SEQ ID No 3 is a polynucleotide sequence of molecule beacon named Oh-MB-KRAS.sup.WT set forth as follows:
TABLE-US-00003 (SEQ ID No 3) cc[t]ac[g]cc[a]c c[a]gc[t]cc[a]ac [t]aatggagct ggtgg
[0032] SEQ ID No 4 is a polynucleotide sequence of molecule beacon named Oh-MB- KRAS.sup.G12C set forth as follows:
TABLE-US-00004 (SEQ ID No 4) cg[c]ca[c]aa[g]ct[c]ca[a]ct[a]cc [a]cttagttgg agctt
[0033] SEQ ID No 5 is a oligonucleotide sequence of molecule beacon named Oh-MB- KRAS.sup.G12D set forth as follows:
TABLE-US-00005 (SEQ ID No 5) ac[g]cc[a]tc[a]g c[t]cc[a]ac[t]ac [c]acgagttgg agctga
[0034] SEQ ID No 6 is oligonucleotide sequence of molecule beacon named Oh-MB- KRAS.sup.G12V set forth as follows:
TABLE-US-00006 (SEQ ID No 6) ac[g]cc[a]ac[a]g c[t]cc[a]ac[t]ac [c]agagttgga gctgt
[0035] The SEQ ID No 3, 4, 5 or 6 further has a fluorophore at the 5′ end and a quencher at the 3′ end. Preferably, the fluorophore at the 5′ end is 6FAM and the quencher at the 3′ end is BHQ1.
[0036] SEQ ID No 7 is a polynucleotide sequence of molecule beacon named Ohi-MB-EGFR.sup.mu.sup.t (T790M) set forth as follows:
TABLE-US-00007 (SEQ ID No 7) [a]gc[t]gc/iCy3/[a]tg[a] tg[a]gc[t]gcac ggtggcagct catcat
[0037] SEQ ID No 8 is a polynucleotide sequence of molecule beacon named Ohi-MB-EGFR.sup.WT (T790M) set forth as follows:
TABLE-US-00008 (SEQ ID No 8) [a]gc[t]gc/iCy3/[g]tg[a] tg[a]gc[t]gcac ggtggcagct catcac
[0038] SEQ ID No 9 is a polynucleotide sequence of molecule beacon named Ohi-MB-EGFR.sup.Mut (L845R) set forth as follows:
TABLE-US-00009 (SEQ ID No 9) [t]tg[g]cc/iCy3/[c]gc[c] ca[a]aa[t]ctgt gattagattt tgggcg
[0039] SEQ ID No 10 is a polynucleotide sequence of molecule beacon named Ohi-MB-EGFR.sup.WT (L858R) set forth as follows:
TABLE-US-00010 (SEQ ID No 10) [t]tg[g]cc/iCy3/[a]gc[c] ca[a]aa[t]ctgt gattagattt tgggct
[0040] The SEQ ID No 7, 8. 9 or 10 further has a quencher at the 3′ end. Preferably, the quencher at the 3′ end is BHQ2.
[0041] SEQ ID No 11 is a polynucleotide sequence of molecule beacon named Ohi-MB-EML4-ALK vl set forth as follows:
TABLE-US-00011 (SEQ ID No 11) [g]ta[c]ac/iCy3/[t]tt[a] gg[t]cc[t]ttcc caggaaagga cctaaa
[0042] SEQ ID No 12 is a polynucleotide sequence of molecule beacon named Ohi-MB-EML4-ALK v3a set forth as follows:
TABLE-US-00012 (SEQ ID No 12) [g]ta[c]ac/iCy3/[t]tg[g] tt[g]at[g]atga catcatcatc aaccaa
[0043] The SEQ ID No 11 or 12 further has a quencher at the 3′ end. Preferably, the quencher at the 3′ end is BHQ2.
[0044] SEQ ID No 13 is a polynucleotide sequence of molecule beacon named Oh-MB-411.sup.ED set forth as follows:
TABLE-US-00013 (SEQ ID No 13) gaccgtatag taatgct[a]ta [c]gg[t]c[c]a[c]t[a]
[0045] SEQ ID No 14 is a polynucleotide sequence of molecule beacon named Oh-MB-411.sup.WT (L858R) set forth as follows:
TABLE-US-00014 (SEQ ID No 14) gaccgtatag taatgct[a]ta [c]gg[t]c[t]a[c]t[a]
[0046] The SEQ ID No 13 or 14 further has a fluorophore or chromophore at the 5′ end and a quencher at the 3′ end. Preferably, the fluorophore at the 5′ end is 6FAM and quencher at the 3′end is BHQ1.
[0047] The aforementioned sequences are summed in TABLE 1
TABLE-US-00015 TABLE 1 SEQ NAME ID SEQUENCE COMMENT Co-MB-miR21 1 cgcgatctca [a]ca[t]ca[g]tc[t] ct[a]taa[g]cta gatcgcg 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-miR21 2 [t]ca[a]ca[t]ca[g] tc[t]ga[t]aa[g]c t[a]gattatca gactga 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-KRAS.sup.WT 3 cc[t]ac[g]cc[a]c c[a]gc[t]cc[a]ac [t]aatggagct ggtgg 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-KRAS.sup.G12C 4 cg[c]ca[c]aa[g]c t[c]ca[a]ct[a]cc [a]cttagttgg agctt 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-KRAS.sup.G12D 5 ac[g]cc[a]tc[a]g c[t]cc[a]ac[t]ac [c]acgagttgg agctga 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-KRAS.sup.G12V 6 ac[g]cc[a]ac[a]g c[t]cc[a]ac[t]ac [c]agagttgga gctgt 6FAM at the 5′ end BHQ1 at the 3′ end Ohi-MB-EGFR.sup.Mut 7 [a]gc[t]gc/iCy3/[a]tg[a] tg[a]gc[t]gcac ggtggcagct catcat BHQ2 at the 3′ end (T790M) Ohi-MB-EGFR.sup.WT 8 [a]gc[t]gc/iCy3/[g]tg[a] tg[a]gc[t]gcac ggtggcagct catcac BHQ2 at the 3′ end (T790M) Ohi-MB-EGFR.sup.Mut 9 [t]tg[g]cc/iCy3/[c]gc[c] ca[a]aa[t]ctgt gattagattt tgggcg BHQ2 at the 3′ end (L845R) Ohi-MB-EGFR.sup.WT 10 [t]tg[g]cc/iCy3/[a]gc[c] ca[a]aa[t]ctgt gattagattt tgggct BHQ2 at the 3′ end (L858R) Ohi-MB-EML4-ALK v1 11 [g]ta[c]ac/iCy3/[t]tt[a] gg[t]cc[t]ttcc caggaaagga cctaaa BHQ2 at the 3′ end Ohi-MB-EML4-ALK v3a 12 [g]ta[c]ac/iCy3/[t]tg[g] tt[g]at[g]atga catcatcatc aaccaa BHQ2 at the 3′ end Oh-MB-411.sup.ED 13 gaccgtatag taatgct[a]ta [c]gg[t]c[c]a[c]t[a] 6FAM at the 5′ end BHQ1 at the 3′ end Oh-MB-411.sup.WT 14 gaccgtatag taatgct[a]ta [c]gg[t]c[t]a[c]t[a] 6FAM at the 5′ end BHQ1 at the 3′ end
[0048] In conclusion, the present invention relates to designs of lipoplex nanoparticles containing highly stable and specific molecular probes, such as overhang molecular beacons, for detection of RNA targets including single-point mutated and depleted/fused messenger RNAs, microRNAs, and long non-coding RNAs (lncRNA), in extracellular vesicles (EVs) and viruses using various biochips. The invented lipoplex nanoparticles can also be used to capture and identify cells.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0049] As used herein, the term “nucleic acid” is a term that generally refers to a string of at least two base-sugar phosphate combinations.
[0050] As used herein, the term “nucleic acid sequence” or “oligonucleotide” also encompasses a nucleic acid and polynucleotide as defined above. The term “DNA molecule” includes nucleic acids/polynucleotides that are artificially made DNA mimic.
[0051] As used herein, the term “locked nucleic acid (LNA) or LNA nucleosides” is a class of nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2′-O atom and the 4′-C atom in a conformation for Watson-Crick binding, which makes the pairing with a complementary nucleotide strand more rapid and more stable. The LNA has a general chemical structure described as formula (I), where the Base comprises a (i.e. A), g (i.e. G), c (i.e. C) and t (i.e. T).
##STR00001##
Embodiments
[0052] In one embodiment, the present invention discloses a method of detecting the presence of mutated genes, mRNAs or microRNAs in a subject. The method comprises the following steps. (1) Provide a body fluid sample containing cells, circulating tumor cells (CTCs), and/or extracellular vesicles (EVs); and use an analyzer having overhang molecular beacons to measure fluorescence signals generated by interactions between the body fluid sample and the overhang molecular beacons, so as to detect the presence of the mutated genes, mRNAs or microRNAs. The overhang molecular beacons comprises or consists of a stem having at least 9-base pairs, a loop having at least 4 bases, an overhang section of at least 5 complementary bases to the mutated genes or mRNAs at the end of the stem, a fluorescence dye and a quencher at the 3′ end; and the last complementary base of the overhang section or the first complementary base of the stem in the overhang molecular beacons is corresponding to a single-point mutated base of the mutated genes, mRNAs or microRNAs.
[0053] In one example of the embodiment, the overhang molecular beacons are selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 12, SEQ ID No 13 and their combinations.
[0054] In one example of the embodiment, the SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or their combinations is applied for detecting KRAS mutations.
[0055] In one example of the embodiment, the SEQ ID No 7, SEQ ID No 9 or their combinations is applied for detecting EGFR mutations.
[0056] In one example of the embodiment, the SEQ ID No 11, SEQ ID No 12 or their combinations is applied for detecting EML4-ALK fusion.
[0057] In one example of the embodiment, the SEQ ID No 13 is applied for detecting miR-411 editions (EDs).
[0058] In one example of the embodiment, the fluorescence dye comprises FAM, Cy3 and Cy5 at the 5′ end and an internal fluorescence dye comprises iFluorT, iCy3 and iCy5 close to the quencher position.
[0059] In one example of the embodiment, the overhang molecular beacons are encapsulated within lipoplex nanoparticles which comprise cationic lipoplex nanoparticles and reacts with extracelluar vesicles that are captured on the biochip surface by specific antibodies.
[0060] Typically, the lipoplex nanoparticles are made of lipid mixtures such as 1,2-di-O-octadecenyl -3 -trimethylammonium propane (DOTMA), 1,2-dioleoyl-3 -trimethylammonium-propane (DOTAP), 3B-[N-(N′,N′-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-Cholesterol), and other ionizable lipids, 1,2-di-O-octadecenyl-3-dimethylammonium propane (DODMA), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), and other non-ionizable lipids: DODMA), L-a-phosphatidylcholine (EggPC, SoyPC), Cholesterol, 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), and other saturated fatty acid, 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), and other helper lipids and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)] (DSPE-PEG), and other PEG phospholipids.
[0061] In one example of the embodiment, the lipoplex nanoparticles are tethered on biochips and universal standard vesicle (SV) nanoparticles consisting of more than 100 target oligos from mRNA and miRNA targets are added as a standard for the biochips.
[0062] In one example of the embodiment, the analyzer further comprises microfluidic channels, lipoplex nanoparticles for encapsulating the overhang molecular beacons, and a detector which comprises a total internal reflective fluorescence (TIRF) microscope, fluorescence microscope, plate reader or portable fluorescence detector.
[0063] In one example of the embodiment, wherein the mutated mRNA is corresponding to a cancer mutation comprises KRAS mutations in pancreactic cancer, EGFR mutations in non-small cell lung cancer, EML4-ALK fusion in non-small cell lung cancer.
[0064] In one example of the embodiment, wherein the body fluid sample is blood, serum, plasma, urine, sputum, or saliva from the subject.
[0065] In one example of the embodiment, the method is to detect the mutated genes, mRNAs or microRNAs in the subject with the disease or condition in a cancer which is selected from the group consisting of , but not limited to, lymphomas (Hodgkins and non-Hodgkins), B cell lymphoma, T cell lymphoma, myeloid leukemia, leukemias, mycosis fungoides, carcinomas, carcinomas of solid tissues, squamous cell carcinomas, adenocarcinomas, sarcomas, gliomas, blastomas, neuroblastomas, plasmacytomas, histiocytomas, melanomas, adenomas, hypoxic tumors, myelomas, AIDS related lymphomas or sarcomas, metastatic cancers, bladder cancer, brain cancer, nervous system cancer, squamous cell carcinoma of head and neck, neuroblastoma/glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, colon cancer, cervical cancer, cervical carcinoma, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, hematopoietic cancers, testicular cancer, colon-rectal cancers, prostatic cancer,pancreatic cancer, or cancer cachexia.
[0066] In another embodiment, the present inention provides a biochip for detecting mutated genes, mRNAs or microRNAs. The invented biochip comprises a gold coating substrate and lipoplex nanoparticles. The lipoplex nanoparticles tether on the gold coating substrate and encapsulate a plaurity of overhang molecular beacons and the overhang molecular beacons comprise or consist of a stem having at least 9-base pairs, a loop having at least 4 bases, an overhang section of at least 5 complementary bases to the mutated genes, mRNAs or microRNAs at the end of the stem, a fluorescence dye and a quencher at the 3′ end; and wherein the last complementary base of the overhang section or the first complementary base of the stem in the overhang molecular beacons is corresponding to a single-point mutated base of the mutated gene, mRNAs, or microRNAs.
[0067] In one example of the another embodiment, the overhang molecular beacons are selected from the group consisting of SEQ ID No 2, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 12 SEQ ID No 13 and their combinations.
[0068] In one example of the another embodiment, the SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or their combinations is applied for detecting KRAS mutations.
[0069] In one example of the another embodiment, the SEQ ID No 7, SEQ ID No 9 or their combinations is applied for detecting EGFR mutations.
[0070] In one example of the another embodiment, the SEQ ID No 11, SEQ ID No 12 or their combinations is applied for detecting EML4-ALK fusion.
[0071] In one example of the another embodiment, the SEQ ID No 13 is applied for detecting miR-411 editions (EDs).
[0072] In one example of the another embodiment, the fluorescence dye comprises FAM, Cy3 and Cy5 at the 5′ end and an internal fluorescence dye comprises iFluorT, iCy3 and iCy5 close to the quencher position.
[0073] In one example of the another embodiment, the quencher at the 3′ end comprises BHQ-1 and BHQ-2.
[0074] The following examples are to disclose and interpret the present invention in details.
EXAMPLE 1
CLN-TIRF Technology and MB Design
[0075]
[0076] For clinical use, CLN-MB biochips need to be mass produced with long-term storage stability in both liquid and dry form. This requires stable MBs in CLNs. As shown in
EXAMPLE 2
Comparison of CLN-Co-MB and CLN-Oh-MB Based on Standard Vesicles (SVs).
[0077] To develop a standard for chip-to-chip calibration and normalization, standard vesicles (SVs) made of anionic lipoplex nanoparticles containing miR-21_oligo DNAs were prepared to mimic the real EVs with a similar particle diameter (50˜150 nm) and a slightly negative surface charge (−8.7 mV) (Table 1). Since the target RNA in EVs has a small copy number along with other RNAs, we prepared SVs containing 1% of single strand miR-21_oligo DNA mixed with 99% of low-cost miR-54_oligo DNA (scramble DNA). Initial testing of the hybridization efficacy of CLN-MB biochips with target RNAs was carried out using SVs. The SV concentration analyzed by Nanosight™ was 3×10.sup.10/mL and the calculated average copy number of encapsulated miR-21_oligo was around 50-200 strands per SV. Results of CLN-Co-MB and CLN-Oh-MB comparison based on SVs are shown in
TABLE-US-00016 TABLE 2 Particle concen- Average Poly- Zeta For- tration size dispersity potential EE mulation (/mL) (nm) index (mV) (%) CLN- 5.3 × 10.sup.10 102.5 ± 8.2 0.146 ± 0.014 26.2 ± 1.2 80.51 ± F-ODN 0.36 SV- 3.0 × 10.sup.9 83.2 ± 11.6 0.153 ± 0.017 −8.7 ± 0.5 58.05 ± F-ODN 0.32
All values indicate mean±S.D. for n=3 independent experiments
[0078] For clinical applications, users prefer to use the pre-synthesized CLN-MB to simplify the assay. Lyophilization is a widely used method to prepare the dry form of lipoplex nanoparticles.
[0079] We have determined the concentration of target RNAs through calibration and analytical quantification curve for total fluorescence intensity of GAPDH mRNA in EVs. The concentration of GAPDH mRNA was also determined by using standard vesicles (SVs) with GAPDH fragment oligo. The SVs with GAPDH oligo target were prepared and sequentially diluted to produce SV solutions with different contents of GAPDH fragment target. The calibration curve was determined by CLN-TIRF assay. As shown in
EXAMPLE 3
Comparison of CLN-Co-MB and CLN-Oh-MB in Cancer Cells
[0080] We then compared CLN-Co-MB and CLN-Oh-MB in living cells. The miR-21, which is often overexpressed in tumor cells, was chosen as a target model. A549, which is a lung cancer cell line with overexpressed miR-21, was chosen as the test cell. HBEC, which is normal human bronchial epithelial cell line, was chosen as the negative control cell. After loading A549 or HBEC cells onto the CLN biochip, CLNs were internalized by the cells, and the subsequent release of MBs could detect the intracellular target RNAs.
EXAMPLE 4
omparison of CLN-Co-MB and CLN-Oh-MB in Cancer EVs
[0081] EVs collected from A549 or HBEC cell culture medium were directly applied to the CLN biochip containing miR-21-specific CLN-Co-MBs or CLN-Oh-MBs. The EV concentration was around 10.sup.7/mL (2×10.sup.5 EVs in 20 μL) in cell culture medium. As shown in
EXAMPLE 5
Comparison of CLN-Co-MB and CLN-Oh-MB in Single-point Mutation
[0082] The CLN-Co-MB has been studied for single-point mutation detection in surveillance of cancer therapy, but could not provide the needed specificity. Here, we first encapsulated miR-21_oligo wide-type, single mutant (1-base mismatch), bi-mutant (2-base mismatch) and tri-mutant (3-base mismatch) in SVs as a model system to compare CLN-Oh-MB and CLN-Co-MB.
[0083] Based on these results, we further verified the efficacy of CLN-Oh-MB for three important KRAS mutants (G12C, G12D, G12V), which count for >65% of pancreatic cancer patients. The locations of mutated base were marked in gray color as shown in Table 3. The Oh-MB', Oh-mBG-12c, Oh-MB.sup.G12D and Oh-MB.sup.G12V were designed to complement with KRAS.sup.WT, KRAS.sup.G12C, KRAS.sup.G12D and KRAS.sup.G12V, respectively (Table 3). Four pancreatic cancer cell lines, HUT78, PaCa-2, AsPC-1 and PANC03.27 known as a wild-type (WT), G12C, G12D and G12V mutation respectively, were used as the model systems. EVs collected from cell culture medium were directly applied to the CLN-Oh-MB tethered biochips. Compare to KRAS.sup.WT, the fluorescence signals of KRAS.sup.G12C, KRAS.sup.G12D and KRAS.sup.G12V with CLN-Oh-MB.sup.WT were reduced to 2%, 7% and 15%, respectively (
TABLE-US-00017 TABLE 3 Name DNA sequence, listed 5′ to 3′ miR-54_oligo AGGATATGAGACGACGAGAACA miR-21_oligo Target TAGCTTATCAGACTGATGTTGA miR-21_oligo 1-mismatch TAGCTTATCAGACTAATGTTGA miR-21_oligo 2-mismatch TAGCTTATCAGACTACTGTTGA miR-21_oligo 3-mismatch TAGCTTATCAGACTACCGTTGA Co-MB-miR21 /6FAM/CGCGATCTCA[+A]CA[+T]CA[+G]TC[+T]GA[+T]- AA[+G]CTAGATCGCG/BHQ1/ Oh-MB-miR21 /6FAM/(+T]CA[+A]CA[+T]CA[+G]TC[+T]GA[+T]AA[+G]C- T[+A]GATTATCAGACTGA/BHQ1/ Oh-MB-KRAS.sup.WT /6FAM/CC[+T]AC[+G]CC[+A]CC[+A]GC[+T]CC[+A]AC [+T]AATGGAGCTGGTGG/BHQ1/ Oh-MB KRAS.sup.G12C /6FAM/CG[+C]CA[+C]AA[+G]CT[+C]CA[+A]CT[+A]CC [+A]CTTAGTTGGAGCTT/BHQ1/ Oh-M8-KRAS.sup.G12D /6FAM/AC[+G]CC[+A]TC[+A]GC[+T]CC[+A]AC[+T]AC [+C]ACGAGTTGGAGCTGA/BHQ1/ Oh-MB-KRAS.sup.G12V /6FAM/AC[+G]CC[+A]AC[+A]GC[+T]CC[+A]AC[+T]AC [+C]AGAGTTGGAGCTGT/BHQ1/
EXAMPLE 6
Design of CLN-Ohi-MB for Improvement of Single-Point Mutation Detection
[0084] The CLN-Oh-MB developed for single-point mutation detection in early cancer diagnosis has a high background noise due to an external dye and quencher structure. To reduce the background noise from the external dye in the end of overhang section of Oh-MBs, internal fluorescence dye close to the quencher position was designed into the MB construct. Here, we show Ohi-MBs made of Cy3 or Cy5 dye to serve as internal fluorophores. A typical Ohi-MB includes 3′-Black Hole Quencher 2 (3BHQ-2) to serve as a quencher of fluorogenic dual-labeled probes as shown in
[0085] The superior recognition efficacy of Ohi-MB against the Oh-MB can be clearly seen in fluorescence images in
EXAMPLE 7
Design of CLN-Ohi-MB for EGFR Single-Point Mutation and EML4-ALK Fusion Detection
[0086] In order to improve EGFR single-point mutation detection, the internal Oh-MB (Ohi-MB) has been developed for EFGR L858R and EGFR T790M mutation. Representative TIRF fluorescence images and calibration curves revealed an increase of the fluorescence signal of T790M oligos in SVs in proportion to the SV concentration (5%, 10%, 15% and 20%) detected by using CLN-Ohi-MB EGFR T790M (WT) and CLN-Oh-MB EGFR T790M (Mut) as shown in
[0087] For further investigation of the CLN-Ohi-MB performance, EML4-ALK fusion detection was conducted with MB designs shown in Table 1 in EVs collected from lung cancer cell lines (H3122 with EML4-ALK fusion variant 3a, H2228 with variant v1 and Calu-1 without EML4-ALK fusion). The results demonstrated the superior fusion variant recognition.
EXAMPLE 8
Performance of CLN-Ohi-MB in CLN/ILN Biochips for Multiple Myeloma (MM) and Chronic Lymphocytic Leukemia (CLL) Diagnosis
[0088] In the ILN biochip assay, antibodies are tethered on the chip surface to capture EVs rich in specific surface receptor. Cationic lipoplex nanoparticles containing RNA-specific molecular beacons are than applied to identify specific RNA targets in the captured EVs. This unique technology allows us to sort and probe individual EVs with both RNA and membrane protein targets. In
[0089] A similar performance for chronic lymphocytic leukemia (CLL) patients is shown in
EXAMPLE 9
Design of a Universal Standard Vesicle (SV) as a Standard for Chip-to-Chip, Analyzer-to-Analyzer and Lab-to-Lab Calibration and Normalization for CLN/ILN Biochip Assays
[0090] It is essential to have SV nanoparticles that can serve as a consistent model material and standard for CLN/ILN biochips, analyzers and other EV detection technologies for different users.
[0091] We have designed lipopolyplex nanoparticles made of anionic lipids to serve as SVs. A typical phospholipids formulation includes 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) (49%), linoleic acid (LA) (49%) and 1,2-Dimyristoyl-sn-glycerol methoxypolyethylene glycol (DMG-PEG) (2%) and the formed SV reveals a structure of cubosomes consisting of numerous inter-connected small cubic bilayer structures which allow encapsulation of a large amount of biomolecules as shown in
[0092]
EXAMPLE 10
esign of CLN-Oh-MB for MicroRNA Single-Point Edition Detection
[0093] The CLN-Oh-MB can also be developed for microRNA single-point edition detection in early cancer diagnosis. The LNA nucleotides were also introduced into microRNA based CLN-Oh-MBs. The design of CLN-Oh-MBs used in this example for targeting miR-411 microRNA edition is shown in Table 1. The squared bases indicate the LNA nucleotides. The total fluorescence intensity (TFI) bar chart and representative TIRF fluorescence images confirmed an increase of the fluorescence signal of non-small cell lung carcinoma (NSCLC) patient samples (NYU-850 and NYU-984) from New York University (NYU) comparing to patients (C1 and C2) with benign nodules as shown in
[0094] It should be emphasized that the above-described examples of the present disclosure are merely possible examples of implementations, and are merely set forth for a clear understanding of the principles of the disclosure. Many variations and modifications may be made to the above-described examples and embodiments, too. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims.