METHODS AND KITS FOR TREATING PAIN
20210268066 · 2021-09-02
Assignee
Inventors
- Ru-Rong Ji (Durham, NC)
- Gang Chen (Durham, NC, US)
- Zilong Wang (Durham, NC, US)
- Changyu Jiang (Durham, NC, US)
- Kaiyuan Wang (Durham, NC, US)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K38/1774
HUMAN NECESSITIES
A61B5/4848
HUMAN NECESSITIES
C07K2317/76
CHEMISTRY; METALLURGY
A61B5/4833
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61B5/00
HUMAN NECESSITIES
Abstract
The present disclosure provides methods and kits for treating pain. More particularly, the present disclosure relates to methods of using PD-L1/PD-1-associated compounds to treat pain and/or bone destruction from bone cancer, and associated kits. The present disclosure also provides methods to assess the efficacy of compounds to suppress PD-1-associated nociceptive neuron activity.
Claims
1. A method of treating a subject suffering from pain, the method comprising administering to the subject a therapeutically effective amount of a compound capable of suppressing PD-1-associated nociceptive neuron activity such that the pain is treated, wherein the compound comprises one or more of a small molecular activator of PD-1 and a SHP-1 phosphatase activator.
2-3. (canceled)
4. The method according to claim 1, wherein the compound is administered to the subject's dorsal root ganglia, skin, muscle, joint or cerebral spinal fluid (CSF).
5. The method according to claim 1, further comprising administering to the subject a pain reliever simultaneously or serially.
6. The method according to claim 5, wherein the pain reliever is morphine.
7. A method of determining the efficacy of PD-1-associated nociceptive neuron activity suppression in a subject, the method comprising: a. administering to the subject a therapeutically effective amount of a compound capable of suppressing PD-1-associated nociceptive neuron activity, wherein the compound comprises one or more of a small molecular activator of PD-1 and a SHP-1 phosphatase activator; and b. conducting one or more quantitative sensory test(s) on the subject, wherein the one or more quantitative sensory test(s) is administered immediately after administration of the compound, and at one or more time points after administration of the compound, wherein a rapid change in mechanical pain sensitivity after administration of the compound indicates target engagement and efficacy of the therapy.
8. (canceled)
9. The method according to claim 7, wherein the one or more time points after administration of said compound is 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 6 hours and/or 12 hours after administration of said compound.
10-11. (canceled)
13. A kit for the treatment of pain in a subject, the kit comprising: a. a therapeutically effective amount of a compound capable of suppressing PD-1-associated nociceptive neuron activity, wherein the compound comprises one or more of a small molecular activator of PD-1 and a SHP-1 phosphatase activator; b. an apparatus for administering said compound; and c. instructions for use.
14. (canceled)
15. The method according to claim 1, wherein the subject is a human.
16. The method according to claim 7, wherein the subject is a human.
17. The kit according to claim 13, wherein the subject is a human.
18. The method according to claim 1, further comprising administering to the subject a PD-L1 protein.
19. The method according to claim 7, further comprising administering to the subject a PD-L1 protein.
20. The kit according to claim 13, wherein the compound further comprises a PD-L1 protein.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The following detailed description of the embodiments of the present invention can be best understood when read in conjunction with the following drawings, where like structure is indicated with like reference numerals and in which:
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
DETAILED DESCRIPTION OF THE INVENTION
[0041] Before the disclosed processes and materials are described, it is to be understood that the aspects described herein are not limited to any specific embodiment, apparatus, or configuration, and as such can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and, unless specifically defined herein, is not intended to be limiting.
[0042] It is also to be understood that unless clearly indicated otherwise by the context, embodiments disclosed for one aspect or embodiment of the invention can be used in other aspects or embodiments of the invention as well, and/or in combination with embodiments disclosed in the same or other aspects of the invention. Thus, the disclosure is intended to include, and the invention includes, such combinations, even where such combinations have not been explicitly delineated.
Definitions
[0043] Throughout this specification, unless the context requires otherwise, the word “comprise” and “include” and variations (e.g., “comprises,” “comprising,” “includes,” “including”) will be understood to imply the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other integer or step or group of integers or steps.
[0044] Articles “a” and “an” are used herein to refer to one or to more than one (i.e. at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.
[0045] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
[0046] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result.
[0047] As used herein, “treatment” refers to a clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviation of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and/or the remission of the disease, disorder or condition. In some embodiments, the treatment comprises pain. As used herein, the term “pain” refers to any type of pain (acute or chronic). Examples, include, but are not limited to, inflammatory pain, neuropathic pain, cancer pain, and the like. In some embodiments, the pain comprises neuropathic pain. In other embodiments, the pain comprises inflammatory pain. In yet other embodiments, the pain comprises cancer pain.
[0048] The term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and/or clinical results.
[0049] The term “biological sample” as used herein includes, but is not limited to, a sample containing tissues, cells, and/or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissues, cells, biopsies, blood, lymph, serum, plasma, urine, saliva, tissue, mucus and tears. In one embodiment, the biological sample is a blood sample (such as a plasma sample). A biological sample may be obtained directly from a subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary, such as a healthcare provider or lab technician).
[0050] As used herein, the term “subject” and “patient” are used interchangeably herein and refer to both human and nonhuman animals. The term “nonhuman animals” of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like. Preferably, the subject is a human patient that is suffering from pain.
[0051] The prevailing view in the field is that cancers secrete pronociceptive mediators to activate or sensitize primary afferent neurons in the cancer microenvironment. This microenvironment contains growth factors such as NGF and VEGF that cause sprouting of pain-sensing afferent fibers (Selvaraj, D, et al. 2015; Jimenez-Andrade, J M, et al. 2011). Programmed cell death ligand-1 (PD-L1) is typically produced by cancer cells and suppresses immunity through PD-1 receptor expressed on T cells. However, the role of PD-L1/PD-1 in regulating pain and neuronal function is unclear. Specifically, it is unclear whether and how the PDL1/PD-1 pathway can regulate pain sensitivity via non-immune modulation such as neuronal modulation. It is increasingly appreciated that primary nociceptive neurons (nociceptors) share similarities with immune cells and can both listen and talk to immune cells (Ji, R R, et al. 2016; Talbot, S, et al. Annu Rev Immunol, 2016, 34:421-447; McMahon, SB, et al. Nat Rev Neurosci, 2015, 16:389-402). Nociceptors not only respond to immune mediators such as cytokines and chemokines and bacterial infection (Chiu, I M, et al. Nature, 2013, 501:52-57) but also produce cytokines and chemokines and express Toll-like receptors (TLRs), key regulators of immunity (Talbot, S, et al. 2016; Ji, R R, et al. Nat Rev Drug Discov., 2014, 13:533-548; Li, Y, et al. J Pain. 2014, 15:712-725; Xu, Z Z, et al. Nat. Med., 2015). In primary sensory neurons, TLRs rapidly regulate pain sensitivity via interacting with ion channels (Ji, R R, et al. 2016; Park, C K, et al. Neuron, 2014, 82:47-54).
[0052] We have discovered that cancers also produce the anti-nociceptive mediator PD-L1 to suppress pain. In particular, we have found that PD-L1 is a previously unrecognized endogenous inhibitor of pain: PD-L1 is produced not only by melanoma but also by non-malignant tissues such as skin, DRG, and spinal cord. It was previously unclear whether nociceptive neurons express functional PD-1 receptor, an important immune regulator, in mouse and human dorsal root ganglion (DRG). The present inventors have assessed the expression and function of PD-1 in primary sensory neurons of mouse and human DRG and demonstrated that activation of PD-1 by PD-L1 potently suppresses neuronal activities in mouse and human nociceptive neurons. Moreover, PD-L1 inhibits acute baseline pain and inflammatory pain and chronic neuropathic pain after nerve injury. Both melanoma and normal neural tissues including dorsal root ganglia (DRG) produce PD-L1 that can potently inhibit acute and chronic pain. Intraplantar injection of PD-L1 evokes analgesia in naïve mice via PD-1, whereas PD-L1 neutralization or PD-1 blockade induces mechanical allodynia. Mice lacking Pd1 exhibit thermal and mechanical hypersensitivity. PD-1 activation in DRG nociceptive neurons by PD-L1 induces SHP-1 phosphorylation, inhibits sodium channels, and causes hyperpolarization through activation of TREK2 K+channels. In addition to malignant melanoma tissue, endogenous PD-L1 can be detected in normal neural tissues including spinal cord DRG nerve and skin. The inventors also discovered that PD-L1 potently suppresses spinal cord synaptic transmission in the pain circuit as a unique neuromodulator. Finally, PD-L1 masks pain in melanoma, and conversely, blocking PD-L1 or PD-1 elicits spontaneous pain and allodynia in melanoma-bearing mice. These findings within the present disclosure identify a previously unrecognized role of PD-L1 as an endogenous pain inhibitor and a neuromodulator.
[0053] In naïve mice, exogenous application of PD-L1 induced analgesia, whereas blockade of endogenous PD-L1 and PD-1 signaling via sPD-L1, PD-1 antibodies, or Pd1 deletion resulted in hyperalgesia. PD-L1 increased pain threshold via PD-1 receptor because the analgesic effect of PD-L1 was completely lost in mice lacking Pd1. In addition to physiological pain in naïve animals, PD-L1 potently suppressed formalin-induced acute inflammatory pain. Furthermore, PD-L1 effectively reduced chronic pain including nerve injury-induced neuropathic pain and bone cancer pain in rodents via both peripheral and central actions.
[0054] We have also discovered that PD-L1 modulates neuronal excitability in mouse and human DRGs of the peripheral nervous system and synaptic transmission in the spinal cord of the central nervous system through activation of PD-1 receptor. It has been generally believed that PD-1 is expressed by immune cells such as T cells (Keir, M E, et al. 2008). However, non-immune cells such as melanoma cells also express PD-1 (Kleffel, S, et al. Cell, 2015, 162:1242-1256). Our analyses using immunohistochemistry, in situ hybridization, and electrophysiology in dissociated DRG neurons clearly demonstrate the presence of anatomical and functional PD-1 receptor in mouse and human DRG neurons.
[0055] Mechanistically, our results show that activation of PD-1 by PD-L1 inhibited action potential induction and suppressed transient sodium currents in mouse and human DRG neurons. PD-L1 also regulated RMPs and caused hyperpolarization via PD-1/SHP activation and subsequent activation of two-pore K.sup.+ channel TREK2. Furthermore, PD-L1 was present in spinal cord tissue and bath application of PD-L1 suppressed excitatory synaptic transmission (sEPSC) in lamina 110 neurons in the spinal cord pain circuit. PD-L1 also inhibited bone cancer-induced hyperexcitability in spinal WDR neurons. These results strongly suggest that as a neuromodulator PD-L1 modulates pain sensitivity via both peripheral and central mechanisms. Because PD-L1 affects both the frequency and amplitude of sEPSCs in spinal cord slices (
[0056] It is noteworthy that we discovered that PD-L1 suppresses pathological pain not only in models of inflammatory, neuropathic, and bone cancer pain but also in a melanoma model, which exhibited high PD-L1 levels in circulation. We provided several lines of pharmacological and behavioral evidence to demonstrate a critical role of the PD-L1/PD-1 axis in masking pain in melanoma-bearing mice. First, inoculation of B16-melanoma cells resulted in robust melanoma growth but not spontaneous pain and mechanical allodynia. Second, intraplantar neutralization of PD-L1 with soluble PD-1 induced spontaneous pain, ongoing pain (CPP), and mechanical allodynia; and furthermore, systemic or local injection of either human anti-PD-1 antibody (Nivolumab) or mouse anti-PD-1 antibody (RMP1-14), or siRNA knockdown of PD-1 expression in DRGs each induced robust pain symptoms in melanoma-bearing hindpaw. Finally, inhibition of SHP also evoked spontaneous pain. It is of great interest to investigate whether PD-L1 can still mask pain after melanoma metastasis.
[0057] What is the biological significance of PD-L1 in suppressing the function of both immune system and nociceptive system? Because these two systems are important for host defense (Talbot, S, et al. 2016; McMahon, S B, et al. 2015), it is conceivable that tumor can shut off both defense systems via PD-L1 secretion for optimal host invasion and cancer growth. Emerging immune therapies with anti-PD1 and anti-PD-L1 antibodies have shown efficacy in treating cancers such as melanoma (Brahmer, J R, et al. 2012; Herbst, R S, et al. 2014; Topalian, S L, et al. 2012). Our findings suggest the importance of examining the pain caused by individual tumor sites in patients with melanoma and other malignancies before, after, and during immune therapies. On the other hand, it is also of great interest to identify novel pain inhibitors produced by cancer cells, which will open a new avenue to developing future pain medicine. Given the high potency of PD-L1 in suppressing activities of human nociceptive neurons, local targeting of PD-L1/PD-1 signaling in sensory neurons may lead to the development of novel analgesics.
[0058] In view of the present disclosure, the methods described herein can be configured by the person of ordinary skill in the art to meet the desired need. In general, the present disclosure provides methods of treating a subject suffering from pain comprising, consisting of, or consisting essentially of administering to the subject a therapeutically effective amount of a compound capable of suppressing PD-1-associated nociceptive neuron activity such that the pain is treated.
[0059] In some embodiments, the compound comprises one or more of PD-L1 and derivatives thereof, small molecular activators of PD-1, SHP-1 phosphatase activators, and combinations thereof. In some embodiments, the compound comprises PD-L1. “Derivatives” of PD-L1 are structural analogs of PD-L1 or compounds of which PD-L1 is a precursor that inhibit PD-1. In other embodiments, the compound comprises PD-L1.
[0060] The compound comprising one or more of PD-L1 and derivatives thereof, small molecular activators of PD-1, SHP-1 phosphatase activators, and combinations thereof may be administered to a subject by any technique known in the art, including local or systemic delivery. Routes of administration include, but are not limited to, subcutaneous, intravenous, intrathecal, intramuscular, epidural injection or implantation, or intranasal administration. In some embodiments, the compound is administered intrathecally (e.g., an administration into the spinal canal, or into the subarachnoid space, or into space under the arachnoid membrane of the brain) or intravenously (IV). In other embodiments, the compound is administered to the subject's skin, muscle, joint, cerebral spinal fluid (CSF) or dorsal root ganglia. In other embodiments, the subject is a human.
[0061] Said compound may be administered in a single dose or in multiple doses (e.g., two, three, or more single doses per treatment) over a time period (e.g., hours or days). Said compound may be present in a therapeutically effective concentration. In certain embodiments, the concentration of said compound is is about 0.1 nmol/L to about 1000 nmol/L at the time of administration; e.g., about 0.1 nmol/L to about 500 nmol/L, or about about 0.1 nmol/L to about 250 nmol/L, or about 0.1 nmol/L to about 100 nmol/L, or about 0.1 nmol/L to about 50 nmol/L, or about 0.1 nmol/L to about 10 nmol/L, or about 0.1 nmol/L to about 1 nmol/L, or about 1 nmol/L to about 500 nmol/L, or about 1 nmol/L to about 250 nmol/L, or about 1 nmol/L to about 100 nmol/L, or about 1 nmol/L to about 50 nmol/L, or about 1 nmol/L to about 10 nmol/L, or about 10 nmol/L to about 500 nmol/L, or about 10 nmol/L to about 250 nmol/L, or about 10 nmol/L to about 100 nmol/L, or about 10 nmol/L to about 50 nmol/L, or about 100 nmol/L to about 500 nmol/L, or about 100 nmol/L to about 250 nmol/L. One of skill in the art will recognize that suitable volume of the dose may be selected based on the desired route of administration.
[0062] Another aspect of the present disclosure provides a method of determining the efficacy of PD-1-associated nociceptive neuron activity suppression in a subject comprising, consisting of, or consisting essentially of administering to a subject a therapeutically effective amount of a compound capable of suppressing PD-1-associated nociceptive neuron activity, and conducting one or more quantitative sensory test(s) on the subject, wherein the one or more quantitative sensory test(s) is administered immediately after administration of the compound, and wherein a rapid change in mechanical pain sensitivity within a time period after administration of the compound indicates target engagement and efficacy of the therapy. In some embodiments, the compound comprises one or more of PD-L1 and derivatives thereof, small molecular activators of PD-1, SHP-1 phosphatase activators, and combinations thereof. In other embodiments, the time period after administration of said compound comprises 30 minutes, 45 minutes, 1 hour, 2 hours, 3 hours, 6 hours or 12 hours.
[0063] Another aspect of the present disclosure provides a kit for the treatment of pain in a subject comprising a therapeutically effective amount a compound capable of suppressing PD-1-associated nociceptive neuron activity, an apparatus for administrating said compound, and instructions for use. In some embodiments, the compound comprises, consists of, or consists essentially of one or more of PD-L1 and derivatives thereof, small molecular activators of PD-1, SHP-1 phosphatase activators, and combinations thereof. In some embodiments, the compound comprises PD-L1. In other embodiments, the subject is a human.
[0064] Another aspect of the present disclosure provides methods of treating a subject suffering from pain comprising administering to the subject PD-L1 and a pain reliever, wherein the PD-L1 potentiates the analgesic effect of said pain reliever. In some embodiments, administration of PD-L1 along with the pain reliever increases the effectiveness of said pain reliever. In some embodiments, administration of PD-L1 along with the pain reliever increases the likelihood that a subject will respond to the pain reliever. In some embodiments, the subject is a human. In other embodiments, the pain reliever is morphine.
[0065] Another aspect of the present disclosure provides methods of alleviating pain in a subject suffering from bone cancer pain comprising, consisting of, or consisting essentially of administering to the subject an effective amount of anti-PD-1 compound. In some embodiments, the anti-PD-1 compound is Nivolumab, Pembrolizumab, Pidilizumab (CT-011, Cure Tech), Atezolizumab (Tecentriq) or Durvalumab (Imfinzi). In some embodiments, the anti-PD-1 compound is Nivolumab. In some embodiments, the subject is a human.
[0066] Another aspect of the present disclosure provides methods of treating or slowing bone destruction in a subject suffering from bone cancer comprising, consisting of, or consisting essentially of administering to the subject an effective amount of anti-PD-1 compound. In some embodiments, the anti-PD-1 compound is Nivolumab, Pembrolizumab Pidilizumab (CT-011, Cure Tech), Atezolizumab (Tecentriq) or Durvalumab (Imfinzi). In some embodiments, the anti-PD-1 compound is Nivolumab. In some embodiments, the subject is a human.
[0067] The anti-PD-1 compound may be administered to a subject by any technique known in the art, including local or systemic delivery. Routes of administration include, but are not limited to, subcutaneous, intravenous, intrathecal, intramuscular, epidural injection or implantation, or intranasal administration. In some embodiments, the compound is administered intrathecally (e.g., an administration into the spinal canal, or into the subarachnoid space, or into space under the arachnoid membrane of the brain) or intravenously (IV). In other embodiments, the compound is administered to the subject's skin, muscle, joint, cerebral spinal fluid (CSF) or dorsal root ganglia
[0068] The anti-PD-1 compound may be present in a therapeutically effective concentration. In certain embodiments, the concentration of said compound is is about 0.1 nmol/L to about 100 nmol/L at the time of administration; e.g., about 0.1 nmol/L to about 75 nmol/L, or about about 0.1 nmol/L to about 50 nmol/L, or about 0.1 nmol/L to about 25 nmol/L, or about 0.1 nmol/L to about 10 nmol/L, or about 0.1 nmol/L to about 1 nmol/L, or about 1 nmol/L to about 100 nmol/L, or about 1 nmol/L to about 75 nmol/L, or about 1 nmol/L to about 50 nmol/L, or about 1 nmol/L to about 25 nmol/L, or about 1 nmol/L to about 10 nmol/L, or about 10 nmol/L to about 100 nmol/L, or about 10 nmol/L to about 75 nmol/L, or about 10 nmol/L to about 50 nmol/L, or about 10 nmol/L to about 25 nmol/L. One of skill in the art will recognize that suitable volume of the dose may be selected based on the desired route of administration.
[0069] The following examples are offered by way of illustration and not by way of limitation.
EXAMPLES
Materials And Methods
[0070] Reagents. Mouse PD-1 (Catalog: 1021-PD-100) and Rat IgG2A Isotype control (Catalog: MAB006) was obtained from R&D. Mouse PD-L1 (Catalog: ab180058) and human IgG4 (Catalog: ab90286) were purchased from Abcam. Nivolumab (OPDIVO®), a humanized anti-PD-1 antibody, was purchased from Bristol-Myers Squibb. Anti-mouse PD-1 antibody RMP1-14 (Catalog: 6E0146) was from Bio X Cell. Mouse Pd1-targeting siRNA (Catalog: L-040330-01-0005) and non-targeting siRNA (Catalog: D-0018100-01-20) were purchased from Thermo Scientific Dharmacon. RVG peptide was synthetized by Invitrogen and mixed with siRNA to increase neuronal uptake of siRNA by axons in the sciatic nerve (Berta, T, et al. J Clin Invest, 2014, 124:1173-1186). SHP-1 inhibitor sodium stibogluconate (SSG) was from Calbiochem (Catalog: 567565). PD1/PDCD1 cDNA construct (SC117011, NM_005018) and TREK2/KCNK10 cDNA construct (SC110477, NM_021161) were purchased from Origene Technologies.
[0071] Animals. Adult mice (males, 8-10 weeks) were used for behavioral and biochemical studies. Pd1 knockout mice with C57BL/6 background were purchased from the Jackson laboratory (Stock No: 021157) and maintained at Duke animal facility. Young mice (5-7 weeks of both sexes) were used for electrophysiological studies in the spinal cord and DRG neurons. All mouse procedures were approved by the Institutional Animal Care & Use Committee of Duke University.
[0072] For bone cancer pain experiments, adult Wistar rats (females, 8 weeks) were obtained from Shanghai Experimental Animal Center of Chinese Academy of Sciences and the rat experiments were approved by the Animal Care and Use Committee of Fudan University. All animals were housed under a 12-hour light/dark cycle with food and water available ad libitum. No statistical method was used to predetermine sample size. No randomization was applied to the animal experiments. Sample sizes were estimated based on our previous studies for similar types of behavioral, biochemical, and electrophysiological analyses (Xu, Z Z, et al. 2015; Berta, T, et al. 2014; Chen, G, et al. J Clin Invest, 2015, 125:3226-3240). Two to five mice or rats were housed in each cage. Animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The numbers of mice and rats used in different experiments were summarized in Table 1.
TABLE-US-00001 TABLE 1 Numbers of animals (mice and rats) used in study. No. of No. of No. of Experiment Sample size groups samples animals/donors 1. In vivo 1.1 Behavioral test (mouse) n = 4-25 mice 57 342 342 mice Behavioral test (rat) n = 5, 6 rats 5 27 27 rats 1.2 Tissue ELISA analysis n = 3, 4 mouse tissues 14 44 7 mice 1.3 Serum ELISA analysis n = 6 mice 2 12 12 mice 1.4 Western Blot analysis n = 5 mice 2 10 10 mice 1.5 In situ hybridization n = 4 mice 5 20 15 mice 1.6 Mouse tissues (IHC) n = 4 mice 10 40 24 mice 1.7 Recording in sciatic nerve n = 5 mice 2 10 10 mice 1.8 Recording in rat spinal cord n = 4, 5 rats 5 24 24 rats 2. Ex vivo 2.1 Patch-clamp recording in n = 6-18 whole-mount DRGs 9 95 47 mice whole-mount DRGs 2.2 Patch-clamp recording n = 6-22 spinal cord slices 9 122 42 mice in spinal cord slices 2.3 Human tissues (IHC) n = 4 tissues 6 4 4 donors 3. In vitro 3.1 Patch-clamp recording 3.1.1 Human DRG neurons n = 7-17 human DRG neurons 8 81 5 donors 3.1.2 Mouse DRG neurons n = 6-9 mouse DRG neurons 2 12 5 mice 3.2 Immunocytochemistry (ICC) n = 98-104 mouse DRG neurons 4 407 4 mice 3.3 Culture medium ELISA analysis n = 3 cultures 2 6 Cell line 3.4 Cell culture for implantation n = 30 cultures 1 30 Cell line 3.5 Cell transfection for recording n = 6-10 cultures 7 38 Cell line Total number of mice 528 Total number of rats 51 Total number of human donors 9
[0073] Culture of murine melanoma cells. Murine melanoma cell line B16-F10 was obtained from ATCC (ATCC®CRL-6475, Rockville, Md.). Melanoma cells were grown in Dulbecco's modified Eagle medium containing 4500 mg/I glucose, 100 mg/I penicillin, 100 mg/I streptomycin, and supplemented with 10% fetal bovine serum in 5% CO.sub.2/95% air at 37° C. Cells were collected for experiments following enzymatic digestion with trypsin.
[0074] Mouse and rat models of cancer and pain. We produced the following rodent models of pain:
[0075] Mouse model of melanoma: Murine B16-F10 melanoma cells (5×10.sup.5 cells/20 μl, suspended in PBS) were subcutaneously injected into the plantar region of a left hindpaw of mouse.
[0076] Mouse model of inflammatory pain: Acute inflammatory pain was induced by intraplantar injection of 20 μl diluted formalin (5%).
[0077] Mouse model of neuropathic pain: Chronic constriction injury (CCI) model of neuropathic pain was produced under isoflurane anesthesia (Chen, G, et al. 2015). After the left sciatic nerve was exposed, three ligatures (7-0 prolene) were placed around the nerve proximal to the trifurcation with one millimeter between each ligature. The ligatures were loosely tied until a short flick of the ipsilateral hind limb was observed. Animals in the sham group received surgery identical to those described but without nerve ligation.
[0078] Rat bone cancer pain model. Tumor cells were extracted from the ascetic fluid of rats that received Walker 256 rat mammary gland carcinoma cells, and suspension of 1×10.sup.8/m1 tumor cells in PBS was prepared. The inoculation was performed as previously described (Yang, Y, et al. J. Neurosci., 2015, 35:7950-7963). Briefly, rats were anesthetized with sodium pentobarbital (50 mg/kg, intraperitoneal). The right leg was shaved, and the skin was disinfected with iodine tincture and 75% ethanol. A 22-gauge needle was inserted at the site of the intercondylar eminence of the right tibia and was then replaced with a 10 μl microinjection syringe containing a 4 μl suspension of tumor cells (4×10.sup.5). The contents of the syringe were slowly injected into the tibia cavity. To prevent leakage of cells outside the bone, the injection site was sealed with bone wax. For the sham group (control), 4 μl of PBS was injected instead of carcinoma cells into the tibia. At the end of the experiment, radiological, postmortem, and histological evaluations were performed. Rats that showed no obvious tumor growth and bone destruction after inoculation of tumor cells were excluded from the experiments.
[0079] Drug injection. For intravenous injection, anti-PD-1 antibody (Nivolumab, 3 or 10 mg/kg or RMP1-14, 10 mg/kg in 100 μl PBS) or control antibody (human IgG4 or rat IgG2A) was administered into the tail vein of mouse. For local intraplantar injection, drugs (20 μl PBS) were injected using a Hamilton microsyringe (Hamilton) with a 30-gauge needle. For intrathecal injection, spinal cord puncture was made with a 30-G needle between the L5 and L6 level to deliver reagents (10 μl) to the cerebral spinal fluid (Chen, G, et al. 2015). For peri-sciatic injection, a mixture of 2 μg siRNA and 1.5 μg of transfection reagent (Chimeric Rabies Virus Glycoprotein Fragment, RVG-9R (Berta, T, et al. 2014)) in 6 μl D5W (5% dextrose in water) was injected with a 30-G needle under the mesoneurium of the left sciatic nerve at mid-thigh level. Care was taken to avoid solution entry into the epineurium of the sciatic nerve.
[0080] In situ hybridization. We used probes directed against mouse Pdl1 (NM_021893) and Pdcd1 (NM_008798) designed by Advanced Cell Diagnostics and the RNAscope multiplex fluorescent assay according to the manufacturer's instructions. Pre-hybridization, hybridization and washing were performed according to standard methods (Xu, Z Z, et al. 2015).
[0081] Immunohistochemistry in mouse and human tissues and quantification. After appropriate survival times, mice were deeply anesthetized with isoflurane and perfused through the ascending aorta with PBS, followed by 4% paraformaldehyde. After the perfusion, the L4-L5 spinal cord segments, L4-L5 DRGs, sciatic nerves, and melanoma tissues were removed and postfixed in the same fixative overnight. Fresh human DRGs (L4-L5) of 4 non-diseased donors from NDRI (National Disease Research Interchange) (Xu, Z Z, et al. 2015) and the attached spinal nerves were immediately fixed upon delivery in fresh 4% paraformaldehyde overnight. Spinal cord, DRG, and nerve tissue sections (10 or 14 μm) and free-floating spinal cord and skin sections (30 μm) were cut in a cryostat. The sections were blocked with 2% goat or donkey serum for 1 h at room temperature and then incubated overnight at 4° C. with the following primary antibodies: anti-PD-1 (rabbit, 1:500, Sigma, Catalog: PRS4065), anti-phosphorylated SHP-1 (pSHP-1, rabbit, 1:500, Abcam, Catalog: ab51171), anti-NeuN (mouse, 1:1000, Millipore, Catalog: MAB377), anti-NF200 (mouse, 1:1000, Sigma, Catalog: N0142), anti-TREK2 (rabbit, 1:200, Alomone labs, Catalog: APC-055), and anti-CGRP (goat, 1:500, Abcam, Catalog: ab36001) antibodies. After washing, the sections were incubated with cyanine 3(Cy3)- and/or FITC-conjugated secondary antibodies (1:400; Jackson ImmunoResearch) for 2 h at room temperature. For double immunofluorescence, sections were incubated with a mixture of polyclonal and monoclonal primary antibodies, followed by a mixture of Cy3- and FITC-conjugated secondary antibodies or FITC-conjugated 1B4 (10 μg/ml; Sigma-Aldrich, Catalog: L2895) (Xu, Z Z, et al. 2015). In some cases, DAPI (1:1000, Vector laboratories, Catalog: H-1200) or Nissl staining (1:200, ThermoFisher Scientific, Catalog: N21483) was used to stain cell nuclei or neurons in tissue sections. The stained sections were examined with a Nikon fluorescence microscope, and images were captured with a CCD Spot camera. For high resolution images, sections were also examined under a Zeiss 510 inverted confocal microscope. To confirm the specificity of PD-1 antibody, blocking experiments were conducted in DRG, nerve, spinal cord, and skin sections using a mixture of anti-PD-1 antibody (1:500=2 μg/ml) and immunizing blocking peptide (1:300=0.7 μg/ml, i.e. 10 fold of the mole concentration of the antibody, Sigma, Catalog: SBP4065), based on a protocol recommended for blocking with immunizing peptide (www.abcam.com/technical).
[0082] To determine if there is neuronal loss in Pd1 deficient mice, we conducted semi-quantification of different neuronal populations in DRGs of WT and Pd1.sup.−/− mice. All the series L4 DRG sections (14 μm) were collected and every 5th section was used for respective immunostaining (CGRP, NF200), 1B4 staining, or Nissl staining. The number of positive neurons for each staining was counted and the percentage of the labeled population was calculated based on the Nissl-stained total population in DRG sections. To quantify immunostaining in the dorsal horn, immunofluorescence intensity in spinal cord sections of WT and KO mice (3-5 spinal sections/per mouse) were included.
[0083] ELISA. Mouse PD-L1 ELISA kit was purchased from US Biological (Catalog: 027620). ELISA was performed using culture medium, serum and different normal tissues including paw skin, sciatic nerve, gastrocnemius, DRG, brain, spinal cord, lung, thymus, kidney, spleen, liver, as well as malignant skin tissue baring melanoma. Cultured cells and tissues were homogenized in a lysis buffer containing protease and phosphatase inhibitors. Serum was obtained from whole blood, collected by cardiac puncture. After 30 minutes at room temperature, the clot was removed in a refrigerated centrifuge at 2,000× g for 10 min to collect the supernatant (serum). For each ELISA assay, 50 μg proteins, 50 μl of culture medium, or 50 μl of serum were used. ELISA was conducted according to manufacturer's instructions. The standard curve was included in each experiment.
[0084] Quantitative real-time RT-PCR. Hindpaw skins of MCI-4W mice were collected 3 h after the intraplantar injection. Total RNA was extracted using Direct-zolTM RNA MiniPrep Kit (Zymo Research Corporation) and 0.5-1 μg of RNA was reverse-transcribed using the iScript cDNA Synthesise (Bio-Rad). Specific primers including GAPDH control were designed using IDT SciTools Real-Time PCR software. We performed gene-specific mRNA analyses using the MiniOpticon Real-Time PCR system (BioRad).sup.35. Quantitative PCR amplification reactions contained the same amount of Reverse transcription (RD product, ncluding 7.5 μL of 2×iQSYBR-green mix (BioRad) and 100-300 nM of forward and reverse primers in a final volume of 15 μL. The primer sequences were shown in Table 2. Primer efficiency was obtained from the standard curve and integrated for calculation of the relative gene expression, which was based on real-time PCR threshold values of different transcripts and groups.
TABLE-US-00002 TABLE 2 Primer sequences used for qPCR (FIG. 20). SEQ SEQ ID ID Genbank Gene NO Forward Primers NO Reverse Primers No. TNF 1 CCCCAAAGGGATGAGAAGTT 2 CACTTGGTGGTTTGCTACGA NM013693 IL-1B 3 TGTCTTGGCCGAGGACTAAG 4 TGGGCTGGACTGTTTCTAATG NM008361 IL-6 5 TCCATCCAGTTGCCTTCTTGG 6 CCACGATTTCCCAGAGAACATG NM031168 IFNG 7 CCTAGCTCTGAGACAATGAACG 8 TTCCACATCTATGCCACTTGAG NM008337 CCL2 9 CCCAATGAGTAGGCTGGAGA 10 AAAATGGATCCACACCTTGC NM011333 CD2 11 CACAGGTCAGGGTTGTGTTG 12 AATGGGATGACTAGGCTGGA NM013486 CD8 13 CCGTTGACCCGCTTTCTGT 14 TTCGGCGTCCATTTTCTTTGG NM009857 CD68 15 ACCGCCATGTAGTCCAGGTA 16 ATCCCCACCTGTCTCTCTCA NM001251 GAPDH 17 TCCATGACAACTTTGGCATTG 18 CAGTCTTCTGGGTGGCAGTGA NM008084
[0085] Western blot. Protein samples were prepared in the same way as for ELISA analysis, and 20-50 μg of proteins were loaded for each lane and separated by SDS-PAGE gel (4-15%; Bio-Rad). After the transfer, the blots were incubated overnight at 4° C. with polyclonal antibody against PD-1 (1:1000, rabbit; Sigma, Catalog: PRS4065). For loading control, the blots were probed with GAPDH antibody (1:20000, mouse; Sigma, Catalog: G8795). These blots were further incubated with HRP-conjugated secondary antibody and developed in ECL solution (Pierce). Specific bands were evaluated by apparent molecular sizes. The intensity of the selected bands was analyzed using NIH Image J software. Uncut gels for the represented blots in were included in
[0086] Whole-cell patch clamp recordings in dissociated mouse DRG neuron. DRGs were aseptically removed from 4-7 week-old mice and digested with collagenase (0.2 mg/ml, Roche)/dispase-II (3 mg/ml, Roche) for 120 min. Cells were placed on glass cover slips coated with poly-D-lysine and grown in a neurobasal defined medium (10% fetal bovine serum and 2% B27 supplement) at 37° C. with 5% CO.sub.2/95% air for 24 h before experiments. Whole-cell voltage clamp recordings were performed at room temperature to measure transient sodium currents and action potentials, respectively, with an EPC10 amplifier (HEKA) and an Axopatch-200B amplifier with a Digidata 1440A (Axon Instruments) (Xu, Z Z, et al. 2015). The patch pipettes were pulled from borosilicate capillaries (Chase Scientific Glass Inc.). When filled with the pipette solution, the resistance of the pipettes was 4-5 MΩ. The recording chamber (300 μl) was continuously superfused (3-4 ml/min). Series resistance was compensated for (>80%), and leak subtraction was performed. Data were low-pass-filtered at 2 KHz, sampled at 10 KHz. The pClamp10 (Axon Instruments) software was used during experiments and analysis. For sodium current recording, pipette solution contained (in mM): CsCl 130, NaCl 9, MgCl.sub.2 1, EGTA 10, HEPES 10, adjusted to pH 7.4 with CsOH. The external solution was composed of (in mM): NaCl 131, TEACI 10, CsCl 10, CaCl.sub.2 1, MgCl.sub.2 2, CdCl.sub.2 0.3, 4-aminopyridine 3, HEPES 10, glucose 10 adjusted to pH 7.4 with NaOH. In voltage-clamp experiments, the transient sodium current (I.sup.Na) was evoked by a test pulse to +0 mV from the holding potential, −70 mV.sup.25. For action potential and resting membrane potential (RMP) recordings, pipette solution contained (in mM): K-gluconate 126, NaCl 10, MgCl.sub.21, EGTA 10, NaATP 2, and MgGTP 0.1, adjusted to pH 7.3 with KOH. The external solution was composed of (in mM): NaCl 140, KCl 5, CaCl.sub.2 2, MgCl.sub.2 1, HEPES 10, glucose 10, adjusted to pH 7.4 with NaOH. In current-clamp experiments, the action potentials were evoked by current injection steps. RMP was measured without a current injection.
[0087] Whole-cell patch clamp recordings in whole mount DRGs of mice ex vivo. L4-L5 DRGs were carefully removed 4 days after sham surgery or CCI surgery and placed in cold oxygenated ACSF. The connective tissue was gently removed under a microscope and the ganglia were digested with a mixture of 0.4 mg/mL trypsin (Sigma) and 1.0 mg/ml type-A collagenase (Sigma) for 30 min at 37° C. The intact ganglia were then incubated in ACSF oxygenated with 95% O.sub.2 and 5% CO.sub.2 at 28° C. for at least 1 h before transferring them to the recording chamber. DRG neurons were visualized with a 40× water-immersion objective using a BX51WI microscope (Olympus). Whole-cell current and voltage recordings were acquired with an Axon700B amplifier. Patch pipettes (4-7 MΩ) were pulled from borosilicate glass capillaries on P-97 puller. The recording chamber (300 μl) was continuously superfused (3-4 ml/min). Series resistance was compensated for (>80%), and leak subtraction was performed. The pipette solution contained (in mM): 140 KCl, 2 MgCl.sub.2, 10 Hepes, 2 Mg-ATP, pH 7.4. Osmolarity was adjusted to 290-300 mOsm. Data was acquired with a Digidata 1322A acquisition system (molecular devices) using pCLAMP 9.0 software. Signals were low-pass filtered at 5 kHz, sampled at 10 kHz and analyzed offline.
[0088] Primary cultures and patch clam recordings in human DRG neurons. Non-diseased human DRGs were obtained from donors through NDRI with permission of exemption from Duke IRB. Postmortem L3-L5 DRGs were dissected from 5 male donors at the age of 27, 31, 43, 54, and 67 and delivered in ice-cold culture medium to the laboratory at Duke University within 24-72 hours of death. Upon the delivery, DRGs were rapidly dissected from nerve roots and minced in a calcium-free HBSS (Gibco). Human DRG cultures were prepared as previously reported (Xu, Z Z, et al. 2015). DRGs were digested at 37° C. in humidified O.sub.2 incubator for 120 min with collagenase Type 11 (Worthington, 285 units/mg, 12 mg/ml final concentration) and dispase 11 (Roche, 1 unit/mg, 20 mg/ml) in PBS with 10 mM HEPES, pH adjusted to 7.4 with NaOH. DRGs were mechanically dissociated using fire-polished pipettes, filtered through a 100 μM nylon mesh and centrifuged (500× g for 5 min). The pellet was resuspended, plated on 0.5 mg/ml poly-D-lysine-coated glass coverslips, and cells were grown in Neurobasal medium supplemented with 10% FBS, 2% B-27 supplement, 1% N-2 supplement, and 1% penicillin/streptomycin. Whole-cell patch clamp recordings in small-diameter DRG neurons (<55 μm) were conducted at room temperature using patch pipettes with resistances of 2-3 MΩ. The recording chamber was continuously superfused (3-4 ml/min). The data were acquired at a rate of 10 kHz and filtered at 3 kHz using an EPC-10 amplifier (HEKA, Germany) and an Axopatch-200B amplifier with a Digidata 1440A (Axon Instruments). For sodium current recording, pipette solution contained (in mM): CsCl 130, NaCl 9, MgCl.sub.2 1, EGTA 10, HEPES 10, adjusted to pH 7.4 with CsOH. The external solution was composed of (in mM): NaCl 131, TEACI 10, CsCl 10, CaCl2 1, MgCl.sub.2 2, CdCl.sub.2 0.3, 4-aminopyridine 3, HEPES 10, glucose 10 adjusted to pH 7.4 with NaOH. In voltage-clamp experiments, the transient sodium current (I.sub.Na) was evoked by a test pulse to 0 mV from the holding potential of -70 mV. Pre-treatment of the SHP-1 inhibitor SSG was performed 30 min prior to whole-cell patch-clamp recordings. For action potential and RMP recordings, pipette solution contained (in mM): K-gluconate 126, NaCl 10, MgCl.sub.2 1, EGTA 10, NaATP 2, and MgGTP 0.1, adjusted to pH 7.3 with KOH. The external solution was composed of (in mM): NaCl 140, KCl 5, CaCl.sub.2 2, MgCl.sub.2 1, HEPES 10, glucose 10, adjusted to pH 7.4 with NaOH. In current-clamp experiments, the action potentials were evoked by a current injection (Xu, Z Z, et al. 2015). The resting membrane potential was measured without a current injection.
[0089] CHO cell culture, transfection and electrophysiology. CHO cell line was purchased from Duke Cell Culture Facility. Cells were cultured in high glucose (4.5 g/L) Dulbecco's Modified Eagle's Medium containing 10% (v/v) fetal bovine serum (Gibco). Transfection (1 μg cDNA) was performed with Lipofectamine™ 2000 Reagent (Invitrogen) at 70% confluency and the transfected cells were cultured in the same growth medium for 48 h before electrophysiological and biochemical studies. PD1/PDCD1 cDNA construct (SC117011, NM_005018) and TREK2I KCNK10 cDNA construct (SC110477, NM_021161) were purchased from Origene Technologies.
[0090] Whole-cell patch clamp recordings in transfected CHO cells were conducted at room temperature using patch pipettes with resistances of 5-6 MΩ. The recording chamber was continuously superfused (3-4 ml/min). The data were acquired at a rate of 10 kHz and filtered at 3 kHz using an EPC-10 amplifier (HEKA, Germany). Pipette solution contained (in mM): K-gluconate 126, NaCl 10, MgCl.sub.2 1, EGTA 10, NaATP 2, and MgGTP 0.1, adjusted to pH 7.3 with KOH. The external solution was composed of (in mM): NaCl 140, KCl 5, CaCl.sub.2 2, MgCl.sub.2 1, HEPES 10, glucose 10, adjusted to pH 7.4 with NaOH. In voltage-clamp recordings, TREK2-induced currents were elicited by voltage-ramp from -120 mV to +100 mV every 10s interval. In current-clamp experiments, the resting membrane potential was measured without any membrane potential compensation.
[0091] Spinal cord slice preparation and patch clamp recordings in mice ex vivo. The L3-L5 lumbar spinal cord segment was removed from mice under urethane anesthesia (1.5-2.0 g/kg, i.p.) and kept in pre-oxygenated ice-cold artificial cerebrospinal fluid (aCSF) solution composed of (in mM): NaCl 126, KCl 3, MgCl.sub.2 1.3, CaCl.sub.2 2.5, NaHCO.sub.3 26; NaH.sub.2PO.sub.4 1.25; glucose 11. Transverse slices (300-400 μm) were cut on a vibrating microslicer. The slices were perfused with aCSF solution for at least 1 h prior to experiment. The whole cell patch-clamp recordings were made from lamina 110 neurons in voltage clamp mode (Berta, T, et al. 2014). After establishing the whole-cell configuration, neurons were held at -60 mV to record spontaneous EPSCs (sEPSCs) in the presence of 10 μM picrotoxin and 2 μM strychnine. The miniature EPSCs (mEPSCs) were recorded in some neurons in the presence of 10 μM picrotoxin, 2 μM strychnine, and 0.5 μM tetrodotoxin. The resistance of a typical patch pipette is 5-6 MΩ. Signals were filtered at 2 kHz and digitized at 10 kHz. The recording data were analyzed using Mini Analysis (Synaptosoft Inc.).
[0092] Spontaneous discharge recordings in mouse sciatic nerve in vivo. Adult male mice (25-32 g) were anaesthetized with urethane (1.5 g/kg, i.p.) and monitored for loss of hind paw pinch reflex with additional injections of urethane (0.2 g/kg). The animals were artificially ventilated with oxygen on a respirator. The left thigh was shaved and an incision made parallel to the femur. The muscle was parted by blunt forceps dissection to expose the sciatic nerve proximal to the trifurcation. A cuff electrode (Microprobes) was placed loosely around the full circumference of the sciatic nerve. Skin flaps were raised to enclose a pool of mineral oil that covered the exposed regions of nerve. The spontaneous discharges in the sciatic nerve were recorded with a microelectrode AC amplifier (1800, A-M systems), filtered (low cut-off 100 Hz and hi cut-off 20 kHz) and digitized at 20 kHz (Digidata 1440A, Molecular Devices). Data were stored with a personal computer using pCLAMP 10 software and analyzed with Offline Sorter software (Plexon, Dallas, Tex.) and Origin pro 8.0 (Origin Lab). The spikes of sciatic nerve were characterized as previously reported (Xu, Z Z, et al. 2015).
[0093] Extracellular recording in rat spinal cord in vivo. Rats were anesthetized with urethane (1.5 g/kg, i.p.), and the trachea was cannulated to allow artificial respiration. A laminectomy was performed at vertebrae T13-L1 to expose the lumbar enlargement of the spinal cord. An intrathecal catheter (PE-10) was made for drug injection. The vertebral column was rigidly fixed in the frame with clamps. The exposed spinal cord was covered by warm (37° C.) saline solution. After surgery, the animal was immobilized and artificially ventilated (Capstar-100, IITC Life Science, USA). End-tidal CO.sub.2 was maintained at 3.5 to 4.5% and the rectal temperature at 37-38° C. by a feedback controlled heating blanket. The electrocardiogram was monitored, and the heart rate was maintained at 250-300/min. As we reported previously (Yang, Y, et al. 2015), single unit extracellular recordings were made at L4-5 segments, 300-700 μm from the surface of the spinal cord with a glass micropipette filled with 0.5 M sodium acetate (impedance 8-10 MΩ at 1000 Hz). The micropipette was inserted perpendicularly to the spine into the dorsal horn from a point about mid-way between the midline and medial edge of the dorsal root entry zone. Each neuron was functionally identified as a wide dynamic range (WDR) neuron on the basis of their responses to innocuous or noxious mechanical stimulation to the receptive fields (RFs) in the plantar region of the hindpaw. WDR neurons responding to innocuous stimulation and to a greater degree, noxious stimulation of the RF were analyzed in the present study. The recorded signals were amplified with a microelectrode amplifier (1800 A-M System, USA) and fed to computer via a CED 1401 interface for off-line analysis using the Spike 2 software (Cambridge Electronic Design, Cambridge, UK). For low-intensity mechanical stimulation, graded stimuli with von Frey filaments (4, 8, 15, and 26 g) were applied for 15s at 30s intervals. High-intensity (pinch) stimulation with pinch produced by a clip (150 g) was also applied for 15 s. In pharmacological studies, only one cell was studied in each animal.
[0094] Measurement of hindpaw melanoma growth in mice. To assess tumor growth after melanoma cell implantation, paw volume was determined by water displacement plethysmometer (Ugo Basile, Italy). The Plethysmometer is a microcontrolled volume meter, specially designed for accurate measurement of the rodent paw swelling. It consists of a water filled Perspex cell into which the paw is dipped. A transducer of original design records small differences in water level, caused by volume displacement. The digital read-out shows the exact volume of the paw.
[0095] Behavioral analysis in mice. The following behavioral measurements were conducted in a blinded manner and during daytime (light cycle) normally starting at 9 AM.
[0096] Spontaneous pain in mouse melanoma model: We measured the time (seconds) mice spent on licking or flinching the melanoma-bearing hindpaws for 1 or 3 hours.
[0097] Von Frey test for mechanical pain: Animals were habituated to the testing environment daily for at least 2 days before baseline testing. The room temperature and humidity remained stable for all experiments. For testing mechanical sensitivity, we confined mice in boxes placed on an elevated metal mesh floor and stimulated their hindpaws with a series of von Frey hairs with logarithmically increasing stiffness (0.02-2.56 g, Stoelting), presented perpendicularly to the central plantar surface. We determined the 50% paw withdrawal threshold by up-down method (Chen, G, et al. 2015).
[0098] Hargreaves test for thermal pain: Thermal sensitivity was tested using Hargreaves radiant heat apparatus (IITC Life Science), the basal paw withdrawal latency was adjusted to 9-12 s, with a cutoff of 20 s to prevent tissue damage (Chen, G, et al. 2015).
[0099] Rota-rod test for motor function: A Rota-rod system (IITC Life Science Inc.) was used to assess the motor function. Mice were tested for three trails separated by 10 min intervals. During the tests, the speed of rotation was accelerated from 2 to 20 rpm in 3 min. The falling latency was recorded and averaged (Chen, G, et al. 2015).
[0100] Conditioned place preference (CPP) test for spontaneous/ongoing pain: We used a single trial conditioning protocol to measure CPP (Chen, G, et al. 2015). All mice underwent a 3-day pre-conditioning habituation and animal behavior was video-recorded. Analyses of the pre-conditioning (baseline) behavior showed no pre-existing chamber preference. On the conditioning day, mice received the vehicle (PBS, 20 μl, i.pl.) paired with a randomly chosen chamber in the morning, and PD-1 (5 μg in 20 μl PBS, i.pl.) paired with the other chamber 4 h later. Chamber pairings were counterbalanced. On the test day, 20 h following the afternoon pairing, mice were placed in the CPP test box with access to both chambers and the behavior was recorded for 15 min and analyzed by ANY-maze software for chamber preference.
[0101] Statistical analyses. All the data were expressed as mean ±s.e.m, as indicated in the figure legends. The sample size for each experiment was based on our previous studies on such experiment (Xu, Z Z, et al. 2015; Chen, G, et al. 2015). Statistical analyses were completed with Prism GraphPad 5.0. Biochemical and behavioral data were analyzed using two-tailed student's t-test (two groups) or Two-Way ANOVA followed by post-hoc Bonferroni test. Electrophysiological data were tested using one-way ANOVA (for multiple comparisons) or Two-Way ANOVA (for multiple time points) followed by post-hoc Bonferroni test or student's t-test (two groups). The criterion for statistical significance was P <0.05.
Example 1
PD-L1 Inhibits Acute Inflammatory Pain and Increases Pain Threshold in Naïve Animals
[0102] As a first step to address a role of PD-L1 in acute pain modulation, we examined the effects of PD-L1 in an acute inflammatory pain model. Intraplantar (i.pl) injection of formalin (5%) induced typical bi-phasic inflammatory pain as previously reported (Berta, T, et al. 2014), but the 2.sup.nd-phase pain (10-45 min) was substantially inhibited by PD-L1 pre-treatment (i.pl., 1-10 μg, P<0.05, One-Way ANOVA), in a dose-dependent manner (
[0103] Next, we tested if PD-L1 would also alter pain threshold in naïve mice. Von Frey test revealed a significant increase in paw withdrawal threshold after i.pl. injection of PD-L1 (5 μg=0.1 nmol, P<0.05, Two-Way ANOVA). The threshold increase was rapid and evident at 30 min and maintained for 3 h after the injection (
Example 2
PD-L1 is an Endogenous Pain Inhibitor and Alters Basal Pain Thresholds Via PD-1
[0104] PD-L1 is produced by malignant tissues and serves as a predictive biomarker in cancer immunotherapy (Patel, SP & Kurzrock, R. Mol Cancer Ther, 2015, 14:847-856). As expected, mouse B16 melanoma tissue has high expression levels of PD-L1 (≈450 ng/mg tissue,
[0105] To determine a role of endogenous PD-L1, produced by non-malignant tissues, in pain regulation, we tested mechanical pain after pharmacological blockade of either PD-L1 or PD-1 in naïve mice. Neutralization of hindpaw PD-L1 by i.pl. injection of soluble PD-1 (sPD-1, 5 μg=0.1 nmol) induced a transient mechanical allodynia for 3 h (
[0106] Nivolumab is a FDA-approved fully humanized IgG4 monoclonal antibody, which selectively targets PD-1 (Weber, J S, et al., Lancet Oncol., 2015, 16:375-384) and has shown great success in treating melanoma, lymphoma, and lung cancer (Ansell, S M, et al. 2015; Weber, J S, et al. 2015; Brahmer, J R, et al. Future Oncol, 2015, 11:1307-1326). Of note Nivolumab (10 μg=0.07 nmol, i.pl.) but not control human IgG, induced marked mechanical allodynia for 5 h (
[0107] Next we tested baseline pain and PD-L1-induced analgesia in Pd1.sup.−/− mice with and without PD-L1 treatment. Interestingly, baseline pain sensitivity increased in naive Pd1.sup.−/− mice. Compared with WT mice Pd1.sup.−/− mice displayed mechanical and thermal hypersensitivity, by showing decreased mechanical and thermal pain thresholds in von Frey test and hot plate test (
Example 3
PD-1 Receptor is Expressed by Primary Sensory Neurons in Mouse DRGs
[0108] To determine peripheral mechanisms by which PD-L1 modulates pain, we examined Pd1 mRNA and PD-1 protein expression in mouse DRG neurons. In situ hybridization showed Pd1 mRNA expression in majority of DRG neurons with various sizes (
Example 4
PD-L1 Suppresses Nociceptive Neuron Activity in Mouse DRGs via PD-1
[0109] Activation and sensitization of nociceptive sensory neurons (nociceptors) often produces pain and pain hypersensitivity (Hucho, T & Levine, J D. Neuron, 2007, 55:365-376; Reichling, D B & Levine, J D. Trends Neurosci, 2009, 32:611-618; Basbaum, Al, et al. Cell, 2009, 139:267-284). We postulated that PD-L1/PD-1 inhibits pain via direct modulation of nociceptor activity. We employed patch clamp recordings to evaluate excitability in dissociated small-diameter neurons (<25 μm, presumably nociceptors) in mouse DRGs. Notably, PD-L1, at a very low concentration (10 ng/ml=0.2 nM), evoked a potent and immediate inhibition of action potential induced by current injection and further increased rheobase, a minimum current to induce action potential (
[0110] To further assess the contribution of endogenous PD-L1 and PD-1 to neuronal excitability in WT neurons, we employed pharmacological approaches in a whole mount DRG preparation. Compared to dissociated DRG neurons, whole mount DRG preparation has advantage of retaining extracellular PD-L1. Neutralization of PD-L1 with sPD-1 (30 ng/ml ≈0.6 nM) increased the firing rate of action potentials in small-diameter DRG neurons (
Example 5
PD-L1 Inhibits Neuronal Hyperexcitability and Neuropathic Pain After Nerve Injury
[0111] Hyperexcitability of primary sensory neurons after nerve injury has been strongly implicated in chronic pain (Hucho, T & Levine, J D. 2007; Basbaum, Al, et al. 2009; Devor, M, et al. Pain, 1992, 48:261-268; Chen, G, et al. 2015). We used mount mouse DRG preparation to examine hyperexcitability in small-sized nociceptive neurons after chronic nerve constriction (CCI). As expected, nociceptive neurons fired more action potentials after CCI (
[0112] The central axons of nociceptive neurons terminate in the spinal cord dorsal horn to form first-order synapses in the pain pathway (Basbaum, Al, et al. 2009). PD-L1 in DRG neurons could be transported to central axon terminals to modulate spinal cord synaptic transmission and nociception. To test this hypothesis, we examined the effects of intrathecal (i.t.) injection of PD-L1 on CCI-induced neuropathic pain in mice. PD-L1 reduced the CCI-induced mechanical allodynia at a low dose (100 ng,
Example 6
PD-L1 Inhibits Synaptic Transmission and Injury-Induced Neuronal Hyperactivities in the Spinal Cord
[0113] Patch clamp recordings in spinal cord slices showed that superfusion of PD-L1 rapidly (within 1 min) reduced the frequency and amplitude of spontaneous EPSCs (sEPSCs) in lamina 110 neurons (
[0114] Next, we tested the central effects of PD-L1 in a bone cancer model in rats (Yang, Y, et al. 2015). PD-L1, given two weeks after tumor cell inoculation via i.t. route, reduced bone cancer-induced mechanical allodynia (P<0.05, Two-Way ANOVA,
Example 7
PD-L1 Modulates Sodium Currents and TREK2 Potassium Channels Via SHP-1
[0115] We also assessed how PD-L1 modulates neuronal excitability. Activation of PD-1 by PD-L1 recruits the tyrosine phosphatases SHP-1/SHP-2 (Src homology region 2 domain-containing phosphatase-1 and 2) to mediate PD-L1's biological actions in immune cells (Keir, M E, et al. 2008; Hebeisen, M, et al. J Clin Invest, 2013, 123:1044-1056). Immunohistochemistry shows that PD-L1 is sufficient to activate SHP-1 in vivo after i.t. injection, leading to increased phosphorylation of SHP-1 (pSHP-1) in mouse DRG neurons (
[0116] Given an important role of sodium channels in generating action potentials and pain (Bennett, D L & Woods, C G. Lancet Neurol, 2014, 13:587-599), we examined the effects of PD-L1 on transient sodium currents in mouse DRG neurons with small diameters. PD-L1 perfusion (10 ng/ml) caused a gradual and persistent inhibition of transient sodium currents (
[0117] Two-pore K.sup.+ channel TREK2 μlays a major role in regulating RMP in DRG nociceptive neurons of rats (Acosta, C, et al., J Neurosci, 2014, 34:1494-1509). TREK2 also expressed in mouse DRG neurons (
Example 8
Human DRG Neurons Express Functional PD-1
[0118] A translational gap from rodents to humans was blamed for many failures in developing pain therapeutics (Woolf, C J. Nat Med, 2010, 16:1241-1247; Mogil, J S. Nat Rev Neurosci, 2009, 10:283-294). To this end, we examined the PD-1 expression and function in human DRG neurons from non-diseased donors, as shown in our previous studies (Xu, Z Z, et al. 2015; Han, Q, et al. Neuron, 2016). PD-1 IR was observed on cell surface of human DRG neurons with small and large sizes as well as in human spinal nerve axons (
[0119] Importantly, PD-1 receptor is functional in human DRG neurons: incubation of dissociated small-diameter nociceptive neurons (30-50 μm) with PD-L1 directly altered neuronal activities. At an concentration (10 ng/ml) that is effective in suppressing mouse nociceptive neuron activity (
Example 9
PD-L1 and PD-1 Mask Spontaneous Pain and Allodynia in a Mouse Melanoma Model
[0120] Given the high expression of PD-L1 in melanoma (
[0121] Next, we tested the hypothesis that pain after melanoma could be masked by upregulated PD-L1 function. We employed several pharmacological approaches to block PD-L1/PD-1 signaling. Strikingly, local neutralization of PD-L1, by i.pl. injection of soluble PD-1 (sPD-1, 5 μg, MCI-4w), elicited marked spontaneous pain (
[0122] Given an important role of PD-L1 in regulating the function of immune system, we also investigated the effects of sPD-1 treatment on T cell and inflammatory markers in the ipsilateral hindpaw skin surrounding melanoma and control skin in the contralateral paw. To correlate the changes of these immune markers with pain, we collected skin tissues in the acute phase, 3 h after the sPD-1 treatment when robust allodynia and spontaneous pain developed. MCI resulted in increased mRNA levels of T cell markers (CD2, CD3), macrophage marker (CD68), and inflammatory cytokine markers (TNF, IL-1B, IL-6, IFNG, CCL2) in the ipsilateral skin, compared with the contralateral skin (
[0123] To further test a peripheral and neuronal role of PD-1 in regulating pain in melanoma, we employed a gene therapy method we recently established (Berta, T, et al. 2014) in which small interfering RNA (siRNA) was used to knockdown PD-1 expression specifically in DRG neurons. This method allows siRNA uptake by DRG sensory neurons via axonal retrograde transport of siRNA (Berta, T, et al. 2014). Peri-sciatic injection of PD-1-targeting siRNA at MCI-4w induced marked and persistent mechanical allodynia for >4 days (
[0124] Finally, we evaluated if anti-PD-1 antibodies would also unmask pain as sPD-1 and Pd1 siRNA in the melanoma model. Intravenous injection of Nivolumab, but not the control human IgG4 (3-10 mg/kg), caused rapid, persistent, and dose-dependent mechanical allodynia and also elicited marked spontaneous pain (
Example 10
PD-L1 Potentiates Morphine Analgesia (antinociception) in a Mouse Model
[0125] Animals. Pd1 (Pdcd1) knockout mice with a C57BL/6 background and C57BL/6 mice were purchased from the Jackson Laboratory (Stock No: 021157) and maintained at the Duke animal facility. Young mice (5-7 weeks of both sexes) were used for electrophysiological studies in the spinal cord and DRG neurons. Adult male mice (8-10 weeks), including knockout mice and corresponding wild-type control mice, as well as some CD1 mice, were used for behavioral and pharmacological studies. Mice were group-housed on a 12-hour light/12-hour dark cycle at 22±1° C. with free access to food and water. No statistical method was used to predetermine sample size. All the mice were randomized and applied to the animal experiments. All the animal procedures were approved by the Institutional Animal Care & Use Committee of Duke University. Animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.
[0126] Tail-flick test. All animals were habituated to testing environment for at least 2 days before baseline testing. Mice were gently held by a hand with a terry glove and with tails exposed. The distal 3 cm of the tail was immersed into the 50° C. hot water. The tail-flick latency was the time required for a mouse to flick or remove its tail out of the water. A maximum cut-off value of 15 seconds was set to avoid thermal injury. Tail-flick latency was determined both before and after drug injection. Data are expressed as the maximum possible effect (MPE) calculated as MPE (%)=100×[(postdrug response−baseline response)/(cutoff response −baseline response)]. The MPE (%) data from each animal were converted to area under the curve (AUC).
[0127] Hot-plate test. All animals were habituated to testing environment for at least 2 days before baseline testing. A mouse was placed on a hot plate at 53° C. and the reaction time was scored when the animal began to exhibit signs of avoidance such as jumping or paw licking. A maximum cut-off value of 40 seconds was set to avoid tissue injury. Data are expressed as the maximum possible effect (MPE) calculated as MPE (%)=100×[(postdrug response−baseline response)/(cutoff response−baseline response)]. The MPE (%) data from each animal were converted to area under the curve (AUC).
[0128] Statistical analyses. All data were expressed as mean ±s.e.m, as indicated in the figure legends. Statistical analyses were completed with Prism GraphPad 6.1. Behavioral data were analyzed using One-Way or Two-Way ANOVA followed by post-hoc Bonferroni test.
[0129] The results of both the tail-flick and hot-plate tests show that subcutaneous injection of saline does not produce any analgesic effect in either wild-type (WT) mice or mice lacking PD-1 (Pd1.sup.−/−) (
Example 11
Anti-PD-1 Monoclonal Antibody Nivolumab Protects Against Bone Destruction and Alleviates Cancer Pain in a Mouse Model of Bone Cancer
[0130] Since cancers often become painful after metastasis to bone tissue, we examined the role of PD-1 in a bone cancer pain model following inoculation of Lewis lung cancer (LLC) cells into tibia bone cavity. Intravenous injections of Nivolumab produced a rapid increase, within several hours after each injection, in mechanical and thermal pain sensitivity, due to possible activation of nociceptor terminals as we previously showed. However, Nivolumab also produced sustained beneficial effects on cancer pain relief, days after each treatment (
[0131] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be incorporated within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated herein by reference for all purposes.