Transgenic silkworms expressing spider silk
11089767 · 2021-08-17
Assignee
Inventors
- Randolph V. Lewis (Nibley, UT, US)
- Lijin Xia (North Logan, UT, US)
- Xiaoli Zhang (North Logan, UT, US)
- Justin A. JONES (Nibley, UT, US)
Cpc classification
A01K2267/01
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
A01K2227/706
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
A01K67/033
HUMAN NECESSITIES
C12N15/90
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
Abstract
Transgenic silkworms stably expressing synthetic spider silk genes or composite silkworm/spider silk genes are disclosed. The exogenous spider silk genes are stably intergrated into a defined site of the fibroin heavy chain intron or a fibroin light chain intron of silkworms. Synthetic spider silk proteins and composite spider silk-silkworm genes and proteins are provided. The expression of exogenous spider silk genes is driven by the endogenous fibroin heavy chain promoter, improving the genetic stability of transgenic silkworms. The composite silkworm/spider silk fibers exhibit exceptional mechanical performance, compared to normal silkworm silk fibers and other transgenic silkworm fibers.
Claims
1. A transgenic silkworm comprising a stably-integrated exogenous synthetic spider silk gene operably linked to an endogenous silkworm promoter, wherein the exogenous spider silk gene is greater than three kilobases (3 kb) in length, is stably integrated in a sixth intron of a fibroin light chain gene, FibL, wherein the endogenous silkworm promoter is a silkworm-specific U6 promoter and the transgenic silkworm stably expresses the spider silk gene.
2. The transgenic silkworm of claim 1, wherein the exogenous synthetic spider silk gene is operably linked to an endogenous silkworm promoter in the silkworm gland.
3. The transgenic silkworm of claim 1, wherein the exogenous spider silk gene is greater than four kilobases (4 kb) in length.
4. The transgenic silkworm of claim 1, wherein the exogenous spider silk gene is greater than five kilobases (5 kb) in length.
5. The transgenic silkworm of claim 1, wherein the exogenous spider silk gene is ten kilobases (10 kb) in length.
6. The transgenic silkworm of claim 1, wherein the exogenous spider silk gene comprises SEQ ID NO. 25 or SEQ ID NO:26 or a fragment of either thereof.
7. The transgenic silkworm of claim 1, wherein the transgenic silkworm stably expresses the spider silk gene.
8. The transgenic silkworm of claim 1, wherein the exogenous synthetic spider silk gene is stably integrated in an intron of a fibroin heavy chain gene, FibH.
9. The transgenic silkworm of claim 1, wherein the exogenous spider silk gene comprises the MaSp1 gene, MaSp2 gene, Ac1 gene, Flag gene, Piri gene or the MiSp1 gene of Nephila clavipes.
10. The transgenic silkworm of claim 1, wherein the silkworm is Bombyx sp.
11. The transgenic silkworm of claim 10, wherein the silkworm is Bombyx mori.
12. A progeny silkworm of the transgenic silkworm claim 1, wherein the exogenous synthetic spider silk gene is stably integrated.
13. A transgenic Bombyx silkworm, the silkworm comprising: a stably-integrated MaSp1 gene or the MiSp1 gene of Nephila clavipes synthetic spider silk gene in the intron of the fibroin heavy chain gene FibH and operably linked to the silkworm-specific U6 promoter, wherein the exogenous spider silk gene is greater than three kilobases (3 kb) in length, wherein the transgenic silkworm stably expresses the spider silk gene.
14. The transgenic silkworm of claim 13, wherein the exogenous spider silk gene comprises SEQ ID NO. 25 or SEQ ID NO:26, or a fragment of either thereof.
15. A transgenic silkworm comprising a stably-integrated exogenous synthetic spider silk gene operably linked to an endogenous silkworm promoter, wherein the exogenous spider silk gene is greater than three kilobases (3 kb) in length, wherein the exogenous synthetic spider silk gene is stably integrated in a sixth intron of a fibroin light chain gene, FibL.
16. The transgenic silkworm of claim 15, wherein the endogenous silkworm promoter is a silkworm-specific U6 promoter.
17. The transgenic silkworm of claim 15, wherein the exogenous spider silk gene comprises the MaSp1 gene, MaSp2 gene, Ac1 gene, Flag gene, Piri gene or the MiSp1 gene of Nephila clavipes.
18. The transgenic silkworm of claim 15, wherein the silkworm is Bombyx sp.
19. A transgenic Bombyx silkworm, the silkworm comprising: a stably-integrated MaSp1 gene or the MiSp1 gene of Nephila clavipes synthetic spider silk gene in a sixth intron of a fibroin light chain gene, wherein the exogenous spider silk gene is greater than three kilobases (3 kb) in length, wherein the transgenic silkworm stably expresses the spider silk gene.
20. The transgenic silkworm of claim 19, wherein the exogenous spider silk gene comprises SEQ ID NO: 25 or SEQ ID NO: 26, or a fragment of either thereof.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2) A detailed description of the invention is hereafter provided with specific reference being made to the drawings in which:
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION
(21) Various aspects are described below with reference to the drawings. The relationship and functioning of the various elements of the aspects may better be understood by reference to the following detailed description. However, aspects are not limited to those illustrated in the drawings or explicitly described below. It should be understood that the drawings are not necessarily to scale, and in certain instances details may have been omitted that are not necessary for an understanding of aspects disclosed herein, such as conventional fabrication and assembly. Headings are provided for the convenience of the reader and to assist organization of the disclosure and should not be construed to limit or otherwise define the scope of the invention.
(22) In one aspect, the disclosure provides transgenic silkworms stably expressing synthetic spider silk genes or composite spider silk-silkworm genes.
(23) As used herein, the term “synthetic” is understood to include a gene sequence or resulting gene expression product (e.g., protein) that encompasses some or all of the native gene sequence or gene expression product, but is removed or otherwise isolated from its native host. As such, a “synthetic spider silk gene” is understood to include a DNA sequence that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the native spider silk gene over at least a 20 base pair (bp) contiguous segment of the gene or that produces a gene expression product having at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% protein sequence identity with the native spider silk protein over at least a 20 amino acid contiguous segment of the protein. The term “synthetic” may be used herein interchangeably with the terms “exogenous” or “transgenic,” particularly when describing a synthetic gene sequence that is derived from an organism different from its current host.
(24) Similarly, the term “synthetic spider silk gene” is understood to include a DNA sequence that may be less than the full length of the native spider silk gene.
(25) In some embodiments, transgenically-produced spider silk or composite spider silk-silkworm silk reflects about 10-15% of the total silk production by the silkworm. In other embodiments, transgenically-produced spider silk or composite spider silk-silkworm silk reflects over 15%, over 20%, over 25%, over 30%, over 35%, over 40%, over 45%, over 50%, over 55%, over 60%, over 65%, over 70%, over 75%, over 80%, over 85%, over 90%, over 95%, over 99%, or about 100% of the total silk production by the silkworm.
(26) In this respect, the engineered spider silk may substantially replace endogenous production of one or more of the silkworm's own silk-associated proteins, such as the silkworm fibroin protein.
(27) It is understood that the protein fibroin, including the fibroin heavy chain and fibroin light chain, is the core protein component of silk in spiders and silkworms. Thus, the terms “fibroin,” “silk protein,” or “spider silk protein” may in some cases be used interchangeably herein with reference to “silk” or “spider silk,” as appropriate.
(28) The limitations of prior technology have made it difficult to produce transgenic silkworms that stably integrate a transgene larger than about 3 kb in length in silkworms. In a specific embodiment, a transgenic silkworm is disclosed, the transgenic silkworm having a stably-integrated synthetic spider silk gene greater than about three kilobases (3 kb) in length. In certain embodiments, the stably-integrated synthetic spider silk gene is greater than about 4 kb in length; greater than about 5 kb in length; greater than about 6 kb in length; greater than about 7 kb in length; greater than about 8 kb in length; greater than about 9 kb in length; or greater than about 10 kb in length. In some embodiments, the synthetic silk gene is about 10 kb in length.
(29) As used herein, the term “stably integrated” means that the introduced transgenic material is capable of successfully passing through cell division to daughter cells and/or offspring, for example, into the second generation, third generation, etc., without substantial change in sequence or the transgenic material being lost. Thus, in some embodiments, a stably integrated transgene is present in the first generation, second generation, third generation, etc. of a transgenic silkworm (i.e., in progeny). In certain embodiments, the stably integrated transgene is expressed in the first generation, second generation, third generation, etc. of a transgenic silkworm (i.e., in progeny).
(30) It is also understood that stable integration of an exogenous nucleotide sequence into a host gene, such as through a CRISPR/Cas9 mediated knock-in system, may produce a composite (i.e., hybrid) gene including both exogenous and endogenous nucleic material. Thus, in some embodiments, a transgenic silkworm is disclosed, the transgenic silkworm having a composite spider silk-silkworm gene.
(31) It is further understood that expression of such a composite gene sequence may produce a composite (i.e., hybrid or fusion) protein or proteins. Thus, in some embodiments, a transgenic silkworm is disclosed that stably expresses a synthetic spider silk gene or a composite/hybrid spider silk-silkworm gene.
(32) In embodiments, integrated genes are expressed under control (i.e., operably linked) of an endogenous promoter in the silkworms. In some embodiments, a spider silk gene is operably linked to an endogenous promoter. For example, exogenous spider silk genetic material may be introduced into the single intron of the silkworm fibroin heavy chain gene, FibH, with stable expression of the integrated transgene driven by an endogenous promoter. In another example, exogenous spider silk genetic material may be introduced into any of the six introns of the silkworm fibroin light chain gene, FibL, with stable expression of the integrated transgene driven by an endogenous promoter. Expression of MaSp1 or MiSp1 in silkworm, driven by an endogenous fibroin promoter, appears to improve genetic stability in transgenic silkworms. In specific embodiments, the endogenous silkworm promoter is the silkworm-specific U6 promoter. The disclosed strategies thus overcome the limitations of CRISPR/Cas9 using homologous recombination, random integrations presented by the transposon-based piggyBac system, and other systems.
(33) In some embodiments, the exogenous spider silk gene may comprise the major ampullate spider silk gene MaSp1 gene, major ampullate spider silk gene MaSp2, Aciniform gene Ac1, Flagelliform gene Flag, Piriform gene Piri, or minor ampullate gene MiSp1, or synthetic variants thereof. See Teule 2007.
(34) Thus, in a specific embodiment, a transgenic silkworm is disclosed, the transgenic silkworm having a stably-integrated synthetic spider silk gene operably linked to an endogenous silkworm promoter, where the exogenous spider silk gene is greater than about three kilobases (3 kb) in length.
(35) In one aspect, transgenic spider silk proteins, composite spider silk-silkworm proteins, transgenic spider silk, composite spider silk-silkworm silk, and the nucleic acid sequences used to express them are disclosed.
(36) The sequential order and number of protein motifs are different in different spider silk proteins. These characteristics are responsible for the secondary structures and mechanical properties of spider silks. Accordingly, in various embodiments, different synthetic spider silk genes have been designed to integrate these motifs with various mechanical properties.
(37) In some embodiments, the introduced spider silk gene is the major ampullate spider silk gene MaSp1 (˜10 kb) or minor ampullate spider silk gene MiSp1 (˜10 kb) of N. Clavipes. In embodiments, transgenic silkworms express composite silkworm/spider silk proteins.
(38) The disclosed hybrid proteins may be larger and more stable than previous transgenic silk proteins. In embodiments, the transgenic spider silk proteins, composite spider silk-silkworm silk proteins, and/or composite spider silk-silkworm silk have mechanical properties comparable to or superior to natural spider silk proteins and/or natural spider silk, as well as other transgenic silkworm fibers described in the literature.
(39) In certain embodiments, these improved properties are present in the G.sub.0 and the G.sub.1 generation of transgenic silkworms. In certain embodiments, these improved properties are present in successive generations of transgenic silkworms.
(40) In one aspect, methods are disclosed for producing transgenic silkworms.
(41) Current genome editing technologies facilitate introducing site-specific modifications in the genomes of cells and organisms and provide a means to deliver exogenous genes at precise target sites in silkworms. Preliminary applications of the latest genomic editing technologies such as zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and the clustered regularly interspaced short palindromic repeat (CRISPR) system in silkworms have mostly focused on the silkworm phenotype gene (BmBLOS2) or the non-phenotype gene (Bmku70) (Wang et al. 2013). For example, researchers disrupted the fibroin heavy chain (FibH) gene of silkworm glands using a customized ZFN (Ma et al. 2014). Applications of these genome editing techniques in silkworms are generally limited to the knockout phase, however (Wei 2014).
(42) Thus, in some embodiments, a synthetic spider silk gene and/or composite spider silk-silkworm silk gene is expressed in the silk gland of a silkworm. In other embodiments, a synthetic spider silk gene and/or composite spider silk-silkworm silk gene is expressed in other tissues or organs of a silkworm.
(43) Researchers have successfully knocked-in a red fluorescence gene at a defined locus of silkworms using homologous recombination (Takasu et al. 2016). Using these techniques to stably knock-in a large (e.g., greater than 3 kb) transgene at a defined silkworm site and express the transgene under an endogenous promoter has not been demonstrated.
(44) The CRISPR/Cas9 system has been used in different research models, including insect cells, plants and human cells (Mao et al. 2016; Cho et al. 2013). The advantages of this system are the relatively easy production and design of constructs, time-saving production of transgenic organisms, and binding stability to the genomic DNA.
(45) CRISPR has two components: a “guide” RNA (gRNA) and a non-specific CRISPR-associated endonuclease (Cas9). CRISPR creates DNA double strand breaks (DSBs) at a defined position in a chromosome. The Cas9-mediated DSBs can be spontaneously repaired via the independent pathway of homology-directed repair (HDR) or nonhomologous end-joining (NHEJ).
(46) The homologous recombination-mediated knock-in system has been the preferred technology to introduce foreign genes into desired hosts. For example, using the CRISPR/Cas9 system, an exogenous DNA fragment has been added through precise and controlled homologous recombination (HR) repair systems in Caenorhabditis elegans (Dickinson et al. 2013). One limitation of this approach is that it is difficult to incorporate large DNA fragments into the target organism.
(47) Nonhomologous end-joining (NHEJ), which acts independently of the HR pathway(s), is highly efficient. For example, a 15 kb inducible gene expression cassette has been introduced at a defined locus in human cell lines using NHEJ (Yang et al. 2013). But NHEJ is associated with potentially damaging nucleotide insertions and deletions (indels) and/or substitutions in the DSB region, which can reduce transgene stability and expression.
(48) Thus, in some embodiments, the CRISPR/Cas9 system employs non-homologous recombination (end-joining) to facilitate introduction of large exogenous nuclear material, while targeting an integration site that is not affected by adjacent mutations.
(49) In some embodiments, an optimized CRISPR/Cas9 system is utilized to introduce relatively large spider silk genes into silkworm. This strategy overcomes the limitations of random integrations of transposon-based piggyBac system and other systems known in the art, including other applications of CRISPR itself. The disclosed methods facilitate insertion of large exogenous DNA fragments at defined sites within the silkworm genome. In some embodiments, fragments of the disclosed synthetic spider silk genes is introduced into a silkworm.
(50) In a specific embodiment, a method is disclosed for producing a transgenic silkworm, the method comprising: introducing an exogenous synthetic spider silk gene operably linked to an endogenous silkworm promoter, wherein the exogenous spider silk gene is greater than about three kilobases (3 kb) in length.
(51) In a specific embodiment, a method is disclosed for producing a transgenic silkworm, the method comprising: introducing an isolated nucleic acid having SEQ ID NO. 25 or SEQ ID NO:26, or a fragment of either thereof, into a defined site of the silkworm genome using a CRISPR/Cas9 system, such that the isolated nucleic acid is operably linked to an endogenous silkworm promoter, wherein the exogenous nucleic acid is stably integrated into the silkworm genome.
(52) In certain embodiments, the disclosed methods do not require use of exogenous promoters in the HC-NHEJ donors.
(53) For example, using the methods disclosed herein, two large spider silk genes may be successfully integrated at the defined locus of the fibroin heavy chain gene using optimized CRISPR/Cas9 initiated non-homologous end joining. The incorporated spider silk genes may be fully expressed under the endogenous FibH promoter of silkworm.
(54) An optimized CRISPR/Cas9 system, as used herein, may be specifically designed for efficient and stable integration and expression of a transgenic sequence in silkworm. In some embodiments, the CRISPR/Cas9 system is optimized for silkworms using the silkworm-specific U6 promoter. The CRISPR/Cas9 system may be further optimized by targeting silkworm genomic sequences (e.g., introns) that are not disrupted by introduction of exogenous nucleic acid material.
(55) In certain embodiments, relatively large synthetic spider silk protein genes (e.g., MaSp1 and MiSp1) are thus successfully integrated into the intron of the FibH gene and/or into an intron of the FibL gene. These genes are each approximately 9-10 kb, larger than any comparable successful gene knock-in previously reported in silkworms.
(56) The disclosed methods provide efficient methods for creating transgenic silkworms transformed with a synthetic spider gene, which are superior to the transposon-based piggyBac system. The disclosed methods make possible, for example, expression of a large exogenous synthetic spider gene (˜10 kb) driven by an endogenous FibH promoter through nonhomologous end-joining (NHEJ). The mechanical properties of the composite silkworm/spider fibers in these transgenic silkworms are also significantly improved, compared to non-transgenic fibers. The genetic stability of these transgenes and the superior mechanical characteristics of the expression products persists in transgenic offspring. The strategy developed in this study may be extended to other exogenous synthetic silk proteins for commercial production of biomolecules by using silkworm as an expression system.
(57) The following examples are provided to illustrate certain features and/or aspects of the disclosure. The examples should not be construed to limit the disclosure to the particular features or aspects described therein.
EXAMPLES
Example 1. Spider Silk Transgenes in FibH Intron
(58) Using the silkworm-specific CRIPSR/Cas9 system, two relatively large synthetic spider silk genes, the major ampullate spider silk gene (MaSp1, ˜10 kb) and the minor ampullate spider silk gene (MiSp1, ˜10 kb) of N. Clavipes were separately introduced into the only intron of the silkworm FibH gene. An optimized silkworm-specific CRISPR/Cas9 system was used with NHEJ. Expression was driven by the endogenous FibH promoter in the transgenic silkworm glands to improve yields and ensure genetic stability.
(59) Construction of Cas9 and sU6 gRNA Expression Vectors for Silkworm.
(60) To ensure the CRISPR/Cas9 system was well expressed in BmN cells and/or silkworms, the coding region of cas9 was constructed into a pIE-1 vector under the hr5 enhancer and IE1 promoter.
(61) To construct the expression vector of Cas9 in silkworms, the coding region of Cas9 was excised from Px330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230) with AgeI and NotI (NEB, R3552S and R3189S), gel-purified (Qiagen, No. 28704), recovered and sub-cloned into the corresponding sites downstream of the hr5 enhancer and IE1 promoter in pIEx™-1 (Novagen, No. 71241-3) to form pIEx™-1-Cas9. To facilitate the tracking of Cas9 expression and presence inside cells, eGFP was added on the C-terminal of Cas9 to form the plasmid pIEx™-1-eGFP-Cas9. To construct the sgRNA-expressing vector for silkworms, an 467 bp gBlock DNA fragment including the silkworm-specific U6 promoter and terminator as well as part of essential sgRNA frame was synthesized by Integrated DNA Technologies (Coralville, Iowa) [SEQ ID NO:22]. This gBlock DNA fragment was PCR-amplified (primer 1: AGGTTATGTAGTACACATTG [SEQ ID NO: 14] and primer 2: TTAATGCCAACTTTGTACA [SEQ ID NO: 15]) and then sub-cloned into the pGEM®-T easy vector system (Promega, A3600) to form pGEM®-T-sU6 (silkwormU6). Oligo gRNAs (gRNA_sU6_FibH_1, 2, 3) having 20 nucleotides, the target site sequence which starts with G in the sgRNA-1 and ends with C in the sgRNA2 were made. See Table 1, below, which shows the gRNAs Design of the CRISPR/Cas9 system. Sequences listed in Table 1 are SEQ ID NOS: 16-21, as listed from first to last in the table.
(62) TABLE-US-00001 TABLE 1 Name Sequence (5′-3′) Genome Location gRNA_sU6_FibH_1_F TTTTTTTAGGTATATATACAAAATATCGTGCTCTACAAGT AF226688.1:63141-63159 GGTTTTCCCTACCTATTAGC gRNA_sU6_FibH_1_R TATTAATGCCAACTTTGTACAAGAAAGCTGGGTCTAGAA AF226688.1:63141-63159 AAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATA ACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAA AACGCTAATAGGTAGGGAAAACC gRNA_sU6_FibH_2_F TTTTTTTAGGTATATATACAAAATATCGTGCTCTACAAGT AF226688.1:63194-63212 GATGTGACCATAAAATCTCG gRNA_sU6_FibH_2_R TATTAATGCCAACTTTGTACAAGAAAGCTGGGTCTAGAA AF226688.1:63194-63212 AAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATA ACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAA AACCGAGATTTTATGGTCACATC gRNA_sU6_FibH_3_F TTTTTTTAGGTATATATACAAAATATCGTGCTCTACAAGT AF226688.1:63341-63360 GCGCTGATCTGGAACGAGTT gRNA_sU6_FibH_3_R TATTAATGCCAACTTTGTACAAGAAAGCTGGGTCTAGAA AF226688.1:63341-63360 AAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATA ACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAA AACAACTCGTTCCAGATCAGCGC
(63) The oligos, including sgRNA targeting sites and part of sgRNA frame, were also ordered from Integrated DNA Technologies and were annealed and extended to form double strand DNAs. These double strand DNAs were gel-purified (Qiagen, No. 28704) and sub-cloned into the MfeI-digested pGEM®-T-sU6 using Gibson Assembly® Master Mix (NEB, E2611S) to form final sgRNA expression vector pGEM®-T-sU6-sgRNA. A codon-optimized U6 promoter (sU6) (SEQ ID NO:71) was used to construct silkworm-specific gRNA (sgRNA) expression vectors.
(64) As noted, NHEJ repair systems are associated with random nucleotide insertions and/or deletions, leading to potential loss of function of a protein if it occurs in the exons of a gene. Three different sgRNAs were designed to target the only intron of the silkworm fibroin heavy chain (FibH) to eliminate negative effects due to error-prone splicing and/or modifications via NHEJ repair. The three gRNAs (gRNA_sU6_FibH_1, 2, 3) that specifically target the intron of heavy chain AF226688.1: 63138-63159; 63196-63215; 63318-63337 were tested. See Table 1.
(65) CRISPR/Cas9 Evaluation in BmN Cells.
(66) The fully constructed plasmids pIEx™-1-eGFP-Cas9 and pGEM®-T-sU6-sgRNA were transfected to BmN cells using X-tremeGENE™ HP DNA Transfection Reagent (Roche, No. 06 366 244 001) with a ratio of 1 μg total plasmids to 2 μl transfection reagent for each well. The control group was transfected with the same volume of ddH.sub.2O in which the plasmids were suspended without the DNA plasmids. After 72-96 h transfections, the cells were washed with 1×PBS buffer (pH 7.4), the genomic DNA of transfected BmN cells were harvested by using QuickExtract™ DNA Extraction Solution (Epicentre, QE09050) and then subjected to PCR amplification by Taq PCR Master Mix Kit (Qiagen, No. 201443) using the following primers: HC-lacZdisr-Forward: ATATCTAGATTCTCAGTGGGTCGCGTTAC [SEQ ID NO:23], and HC-lacZdisr-Reverse: ATAGGTACCTCGATAACTGCCCCAGATGC [SEQ ID NO:24]. The PCR products (˜250 bp) were cloned into the pGEM®-T easy vector system (Promega, A3600). After transformation into high efficiency 5-alpha competent E. coli (NEB, C2987P) colonies were sequenced. Colonies determined to contain the mutation were determined by comparing the sequences of the PCR products to the reference sequence of the fibroin heavy chain gene (AF226688.1:63001-63601). The CRISPR/Cas9 efficiencies were evaluated based on the ratio of the mutated sequences to the unmutated sequences.
(67) The introduction of indels in the FibH intron does not affect the subsequent transcription and protein expression of FibH genes. The transgenic silkworms were thus created by optimized silkworm-specific CRISPR/Cas9 system triggered NHEJ. This strategy was also expected to have no effect on subsequent alternative splicing and/or nucleotide modifications, even allowing for NHEJ repair mutations (30). Three different gRNAs of the CRISPR/Cas9 system, with three different target sites (HC-1, -2, -3), were transformed separately into BmN cells to evaluate their on-target efficiencies.
(68) Genomic DNA was extracted and NHEJ repair regions were PCR amplified. HC-3 gRNA was introduced into silkworm eggs to generate transformed embryos because it had the highest repair rate (30% determined by sequencing) at a defined site in FibH genome.
(69)
(70) HC-NHEJ Donor Design.
(71) In previous research, the transposon-based piggyBac system was used to incorporate the fibroin heavy chain (FibH) promoter to drive temporary expression of the foreign spider silk protein gene in the posterior silk glands of transgenic silkworms. Here, a donor vector pBluescript II SK (+), was used as a backbone to construct HC-NHEJ vectors with synthetic spider silk expression motif's MaSp1-8 repeats (˜10 kb) or MiSp1-8 repeats (˜10 kb) with protein molecular weights of 214 kDa and 229 kDa, respectively.
(72) The major ampullate spider silk protein MaSp1 gene is enriched with [GGX]n and poly (A) motifs. The minor ampullate spider silk protein MiSp1 gene is enriched with the GGXGGY (X=Q or A) motifs alternating with (GA)y(A)z motifs (y=3-6 and z=2-5). Accordingly, the synthesized spider silk protein DNA of [MaSp1]8 and [MiSp1]8 synthesized by Life Technologies and connected with 8 repeats using the enzymes AgeI and BspEI (NEB, R3552S and R0540S). Table 2 below shows the DNA sequence of the MaSp1 [SEQ ID NO: 25, top] and MiSp1 [SEQ ID NO. 26, bottom] synthetic spider silk genes.
(73) TABLE-US-00002 TABLE 2 Name Sequence (5′-3′) MaSp1(8) (GGTGGTGCAGGTCAGGGTGGTTATGGTGGTCTGGGTAGCCAGGGTGCCGGTCGTGGTGGACTGGGTGGTCAAGGT GCTGGTGCAGCAGCAGCTGCCGCAGCAGCAGGCGGTGCAGGCCAAGGCGGATATGGCGGACTGGGTTCACAGGG TGCAGGCCGTGGCGGTTTAGGTGGTCAAGGCGCAGGCGCTGCTGCAGCCGCAGCGGCAGCAGCTGGCCAAGGTGG CTATGGTGGCTTAGGCTCACAGGGTGGCGGTGCTGGACAGGGTGGATACGGTGGCCTTGGCAGTCAAGGTGCGGG TCGCGGTGGTTTAGGCGGTCAGGGTGCGGGTGCGGCTGCTGCAGCTGCGGCAGCGGGTGGTGCTGGGCAAGGCGG TTACGGTGGATTAGGTAGCCAAGGTGCAGGACGCGGAGGTCTTGGTGGACAGGGTGCTGGCGCTGCTGCGGCAGC AGCAGCCGCTGGGGGTGCTGGTCAAGGGGGTTATGGCGGTTTAGGATCTCAGGGTGCGGGACGGGGTGGTCTGGG AGGGCAAGGGGCAGGCGCAGCAGCAGCGGCAGCTGCAGCCGGTGGTGCCGGACAAGGGGGATATGGGGGTCTTG GCTCCCAAGGCGCTGGTCGTGGCGGTCTTGGAGGCCAAGGTGCCGGTGCCGCTGCAGCGGCTGCTGCTGCAGCGG GTCAAGGGGGATACGGTGGTCTGGGATCACAAGGTGGTGGCGCAGGGCAAGGTGGGTATGGGGGTTTAGGTTCGC AAGGTGCTGGCCGTGGGGGACTGGGAGGACAGGGTGCCGGTGCGGCAGCCGCTGCAGCTGCTGCGGGTGGCGCT GGTCAGGGTGGCTATGGCGGATTGGGCTCTCAAGGGGCAGGTCGGGGTGGCTTGGGAGGACAAGGTGCGGGTGCA GCCGCTGCGGCAGCTGCCGCTGGCGGAGCAGGCCAGGGTGGCTACGGTGGACTGGGTTCCCAAGGTGCGGGAAG AGGTGGCTTGGGTGGCCAGGGTGCAGGGGCAGCGGCTGCAGCGGCAGCAGCC)8 MiSp1(8) (GGTGGTGCCGGTGGTTATGGTCGTGGTGCTGGTGCGGGTGCCGGTGCAGCAGCTGGTGCCGGTGCTGGCGCAGGC GGTTATGGTGGTCAGGGTGGCTACGGTGCCGGTGCCGGTGCTGGTGCCGCAGCCGCAGCGGGTGCGGGTGCAGGC GGTGCTGGCGGTTATGGCAGAGGTGCTGGGGCTGGTGCAGGCGCTGCAGCCGGTGCGGGTGCTGGTGCGGGTGGA TATGGTGGCCAGGGTGGTTATGGCGCTGGCGCAGGGGCAGGCGCAGCAGCAGCAGCTGGGGCAGGCGCAGGCGG TGCCGGTGGCTATGGACGCGGAGCCGGTGCCGGTGCAGGGGCAGCAGCGGGTGCTGGTGCCGGTGCAGGGGGTTA TGGTGGCCAAGGCGGATATGGTGCGGGTGCAGGCGCTGGTGCAGCAGCAGCCGCTGGTGCCGGTGCCGGTGGTGC GGGTGGCTACGGAAGAGGTGCGGGTGCCGGTGCCGGTGCTGCAGCGGGTGCGGGTGCGGGTGCCGGTGGTTATGG CGGTCAGGGTGGGTATGGTGCGGGTGCTGGTGCAGGCGCAGCTGCAGCCGCTGGTGCTGGTGCAGGCGGAGCCGG TGGATATGGCCGAGGTGCTGGCGCAGGCGCTGGCGCTGCTGCTGGTGCCGGTGCGGGTGCTGGGGGATACGGTGG TCAAGGGGGTTATGGTGCGGGTGCCGGTGCGGGTGCAGCCGCAGCAGCTGGTGCGGGTGCGGGTGGTGCAGGGGG ATATGGCCGTGGTGCCGGTGCTGGTGCGGGTGCTGCAGCCGGTGCTGGGGCAGGGGCTGGCGGTTATGGGGGTCA AGGCGGTTATGGCGCTGGTGCTGGTGCTGGGGCTGCCGCAGCAGCCGGTGCTGGTGCTGGCGGTGCGGGTGGTTA CGGTCGGGGAGCTGGCGCTGGTGCTGGCGCAGCAGCGGGTGCCGGTGCTGGTGCCGGTGGCTACGGTGGACAAGG TGGCTATGGTGCCGGTGCAGGCGCAGGGGCTGCAGCCGCAGCCGGTGCCGGTGCCGGTGGCGCTGGGGGTTATGG TCGCGGAGCGGGTGCAGGCGCAGGCGCAGCCGCTGGCGCTGGTGCGGGTGCTGGCGGTTATGGTGGACAAGGGG GTTATGGGGCTGGTGCTGGCGCAGGGGCAGCTGCTGCAGCGGGTGCTGGCGCT)8
(74) The entire encoding fragment was cloned into a pBluescript II SK (+) vector with HindIII and BamHI (NEB, R3104S and R3136S) to produce pSK-MaSp1/MiSp (8). The 3′ coding sequence and poly (A) signal (CTD) of the silkworm heavy chain genome was inserted into pSK-MaSp1/MiSp (8) with SacII and SacI (NEB, R0157S and R3156S) to produce pSK-MaSp1/MiSp1 (8)-CTD. The DsRed gene fragment was amplified from piggyBac1379 by PCR with gene-specific primers and then sub-cloned into pSK-MaSp1/MiSp1(8)-CTD to produce pSK-MaSp1/MiSp1(8)-DsRed-CTD. The 5′ key regulatory elements and protein sequences included the N-terminal domain (intron1/exon2) and eGFP. This was produced by PCR with the piggyBac1379 plasmid DNA and was cloned into pSK-MaSp1/MiSp1(8)-DsRed-CTD to produce the full pSK-NTD-MaSp1/MiSp1(8)-DsRed-CTD vector. PCR primers for the constructions of pSK-NTD-MaSp1/MiSp1(8)-DsRed-CTD vector are shown in Table 3, below (SEQ ID NOS: 27-32, as listed in order from first to last in the table).
(75) TABLE-US-00003 TABLE 3 Restriction Name Sequence (5′-3′) Sites Added Original from NCBI NTD-F2 ATAGGTACCAGCCCTAACAAGAGCTCACGTGATAGATTCTATGAAGC 5′ KpnI AF226688.1:63026-63862 ACTTCGGTAACGCGACCCAGTGTTAGCAAATTCTTTCAGGTTG with eGFP NTD(eGFP)-R TAACTCGAGAGCTTGTACAGCTCGTCCATGCCGAGAG 3′ XholI DsRed-F ATAGGATCCCGCCTCCTCCGAGAACGTCAT 5′ BamHI DsRed-R TAATCTAGACAGGAACAGGTGGTGGCGG 3′ XbaI CTD-F CAACCGCGGAAGCGTCAGTTACGGAGCTGGCAG 5′ SacII AF226688.1:79021-79500 CTD-R TAAGAGCTCTATAGTATTCTTAGTTGAGAAGGCATAC 3′ SacI
(76) Because exogenous promoters and enhancers were not used in HC-NHEJ vector construction (see Table 3, above), expression of synthetic spider silk protein MaSp1 or MiSp1 relied only on the endogenous FibH promoter in the posterior silk gland cells, which means that the expression of fhc proteins should be directly replaced by expression of synthetic spider silk proteins. See
(77) The CTD of the gene cassette includes a stop code from the original FibH genome. Genomic insertion of HC-NHEJ donor in G.sub.0 HCA transgenic silkworms, as revealed by nested PCR and sequencing. The horizontal arrow bars indicate the primers for the genome: junction testing. Left genome:junction testing sequence, as shown, is SEQ ID NO: 33; right genome:junction testing sequence is SEQ ID NO:34. Table 4 below shows additional primers used for the genome: junction testing of transgenic silkworm moths. Sequences listed in Table 4 are SEQ ID NOS: 35-42, as listed in order from first to last in the table.
(78) TABLE-US-00004 TABLE 4 Primer No. Name Sequence (5′-3′) Primer combination for PCRs 1 FibH62454-F TTGTGATCTTGTGCTGCGCT 1 and 2 for 5'-junction first time PCR 2 H1-R CAGGGTCAGCTTGCCGTAG 3 FibH62737-F CACCGGTAAATCAGCATTGC 3 and 4 for 5'-junction secondary time PCR 4 FibH-donor-R CGACTGCAGCACTAGTGCTG 5 PSK-F GGGCGATCGGTGCGGGCCTC 5 and 6 for 3'-junction first time PCR 6 FibH63746-R TGAGCAACAGTACCATCGGA 7 PSK-F2 TACGACTCACTATAGGGCGA 7 and 8 for 3'-junction secondary time PCR 8 FibH63575-R TCGATAACTGCCCCAGATGC
(79) The 5′ genome: junction was precisely identified (Left genome: junction testing) while at the 3′ junction: genome performed non-precision end repair resulting in some sequence heterogeneity which would be of no consequence since it will be excised out (Right genome: junction). These results indicated the HC-NHEJ donor was successfully integrated at the defined locus of FibH in transgenic silkworms. A relatively large synthetic spider silk protein gene (MaSp1 or MiSp1, ˜10 kb) was thus integrated into the genome of silkworm FibH at specific sites, which is not possible with the random integration of the transposon-based piggyBac system.
(80) The original promoter of pBluescript II SK (+) vector can only be used to run plasmid amplification in E. coli and cannot be used for gene expression in transgenic silkworms. The MaSp1 or MiSp1 genes were flanked by 5′ and 3′ regulatory elements and protein sequences (hereinafter as 5′ and 3′ terminal). The 5′ terminal region includes a portion of the intron 1/exon 2 of the FibH gene and an enhanced green fluorescence protein eGFP gene for detection. The 3′ terminal region contains a portion of the 3′ end and the stop codon of exon 2 of the FibH gene. A red fluorescence DsRed gene was added immediately after the MaSp1 and MiSp1 gene to track the expression of the full length synthetic spider silk gene. As long as the optimized CRISPR/Cas9 generated DSBs both at the intron of FibH and in the HC-NHEJ vector, the linearized vector could be ligated into the same DSB site of FibH through NHEJ, leading to the insertion of the entire HC-NHEJ vector. The error-prone mechanism of NHEJ repaired the DSBs of the optimized silkworm specific CRISPR/Cas9 system, therefore, the gRNAs cannot recognize their target sites in the FibH genome of transgenic silkworms. The transgenic silkworms transformed with the donor vectors containing the MaSp1 gene were designated as the HCA group, while the transgenic silkworms transformed with the donor vectors containing the MiSp1 gene as the HCl group.
(81) Unlike the mechanism of homologous recombination where only the target exogenous gene can be bound to specific sites by homologous arms, the whole plasmid of HC-NHEJ donor including the backbone of pBluescript II SK (+) can be inserted into fibroin heavy chain through NHEJ. The inserted backbone cannot be expressed due to the incorporated 3′ stop codon in the construction of HC-NHEJ donor. The gene cassette, including part of the FibH N-terminal, eGFP, spider silk gene, DsRed, and the C-terminal of FibH, expressed its entirety under the endogenous FibH promoter.
(82) Transgenic Silkworm Isolation.
(83) A purebred silkworm strain (diapause strain, Haoyue) was used for transformations as it has a white cocoon and high silk production, which facilitates detection of the eGFP-tagged and DsRed-tagged spider silk protein in transgenic cocoons. Microinjection has traditionally been used as a standard method for transformation of B. mori embryos. This method has flaws that are difficult to overcome, such as high cost, low survival rate, time and labor consuming as well as technically demanding operations. Additionally, microinjection can only be applied to non-diapause silkworm eggs. As an alternative, electroporation was used to reduce the time and labor needed, due to its convenience and high efficiency. Electroporation has some disadvantages, such as low transformation rate and the need to establish the appropriate electrical pulse parameters (voltage, time, frequency, time interval, and the media composition) for different species. However, once these parameters are optimized and established, exogenous DNA can be easily delivered into B. mori embryos.
(84) The electroporation equipment, CUY21EDIT in vivo square wave electroporator and CUY495P10 chamber and were purchased from Sonidel® Limited. Fresh eggs were collected within 1-2 h after being laid by purebred moths (Haoyue). The electroporation procedure is as follows. a) Prepare electroporation buffer (EP buffer) by adding ddH.sub.2O (385 μl), 2% PVP (polyvinylpyrrolidone) solution (250 μl), 10% Tween 20 (15 μl), 0.1M spermidine solution (50 μl), DNA plasmid(s) solution (100 μl, 1.0 μg/μl) to a 1.5 ml Eppendorf tube and mixed together well; then adding 100 ul 2.5 M CaCl.sub.2, mixed well again; b) collect and briefly wash the silkworm eggs spawned within 2-3 h; c) place the eggs (500-1000 eggs) into EP buffer in a 9 cm petri-dish; d) treat the silkworm eggs with pressure reduction by placing the dish with eggs on ice in a vacuum chamber for 10-20 min; e) run electroporation for the eggs on ice by placing them into the electroporation chamber, adding 1 ml EP buffer into electroporation chamber (eggs were cooled prior to electroporation by allowing them to sit in the chamber, on ice, for 2 minutes), and running the electroporation under 15 V, 50 ms (pulse), 75 ms (interval), 10-20 repeats, then leaving eggs in the chamber 10-20 min on ice to allow the eggs to cool; f) place the eggs on ice and leave them for at least 1 h; g) eggs are then placed in a 9 cm petri-dish with 7 cm diameter paper; and h) they are left in the dark at 25° C. for hatching.
(85) Electroporated B. mori embryos were raised under the same conditions as the non-transgenic group until cocoons were spun. The composite silkworm/spider fibers of transgenic cocoons emitted both green and red fluorescence, indicating the entire gene construct was inserted due to the presence of both the eGFP and the DsRed proteins.
(86)
(87) Inverse PCR and Junction Sequences.
(88) When silkworms reached the moth stage, the genomes of the G.sub.0 transgenic moths were extracted after oviposition.
(89) Genomic DNA was extracted from G.sub.0/G.sub.1 transgenic moths using the E.Z.N.A™ Insect DNA Isolation Kit (Omega Bio-Tek, C0926-01). DNA was digested with Sau3AI (NEB, R0169S) and circularized by ligation for 30 min at 16° C. The 3′- and 5′-end genome: transgene junction sequences were amplified using the designed primers reported in Table S4. The first-round of PCR amplification was performed with NEBNext® High-Fidelity 2×PCR Master Mix (NEB, M0541S) and second-round PCRs were performed using Taq PCR Master Mix Kit (Qiagen, No. 201443) on the PCR products, purified by gel extraction, from the first round of amplifications. Amplified fragments were gel-purified (Qiagen, No. 28704) and cloned into the pGEM®-T easy vector system (Promega, A3600) for sequencing. The sequencing data was analyzed using Blast at National Center for Biotechnology Information (NCBI).
(90) Sequencing data showed that the NHEJ allele in the 5′ junction is precisely repaired. See
(91) Analysis of the Composite Silk Protein.
(92) G.sub.0 and the G.sub.1 adult silkworms were dissected at the 3rd of 5 larval-stages. The glands were removed, treated with 1×PBS and then subjected to −80° C. storage. The middle gland proteins were homogenized in 2×SDS lysis buffer (3% SDS, 6M urea, 40 mM Dithiothreitol, 10% w/v Glycerol, 0.01% Bromophenol blue, and 62.5 mM Tris-HCl pH 6.8), boiled at 100° C. for 15-20 min, loaded onto 4-20% gradient gels (Thermo, Scientific), and run at 100V for 1.5 h. After gel separation (Bio-Rad), proteins were transferred to Immobilon®-P Transfer Membrane (Emd Millipore, IPVH00010) by using Tris-Glycine-Methanol buffer (3.0 g Tris, 14.4 Glycine and 200 ml methanol for 1 L buffer), 45V, overnight. Primary antibodies were commercial eGFP-specific antibody (Thermo scientific, MA1-952), and dsRed2 antibody (Santa Cruz® Biotechnology, sc-101529). Secondary antibody was Anti-Mouse IgG (H+L), HRP Conjugate (Promega, W4021). All antibodies were diluted in blocking buffer (1×TBST with 5% nonfat dry milk). Antibody-antigen reactions were performed using one-step ultra TMB blotting solution (Pierce, Thermo scientific). Transgenic confirmation of the G.sub.1 HCl group was performed in the same way as the HCA group using PCR and Western blot analyses.
(93) Proteins extracted from the middle silk glands of non-transgenic or both transgenic groups (the G.sub.0 HCA and the G.sub.1 HCl) was subjected to immunoblotting to detect eGFP and DsRed proteins using an anti-eGFP or anti-DsRed antibody to determine the presence of the spider silk protein MaSp1 and MiSp1.
(94) Coomassie blue staining of SDS-PAGE gels demonstrated the presence of MiSp1 (˜350 kDa) in the transgenic silk gland of the G.sub.1 HCl group. MaSp1 or MiSp1 were tagged with both eGFP and DsRed. The positive bands indicated that both proteins were present in the G.sub.0 HCA and the G.sub.1 HCl groups. See
(95) These results showed that the HC-NHEJ donor in the G.sub.1 HCl group were inserted at the same target site as that of the G.sub.0 HCA group. See
(96) DsRed Detection in cDna of Transgenic Silkworms mRna.
(97) The transgenic silkworms were dissected at the 3rd larval stage. The glands were removed and washed with 1×PBS (pH 7.4). Glands were stored at −80° C. after absorbing excess moisture using filter paper. The mRNA of the transgenic glands was extracted following the manufacturer's instructions of RNA/DNA/Protein Isolation Reagent (TRI Reagent, No. TR 118/50) and then reverse transcribed into its complementary DNA (cDNA) by using Transcriptor high fidelity cDNA synthesis kit (Roche, No. 05081955001). By using the cDNA as templates, the primary and secondary PCRs were performed with the designed primers (Table S5) using 2×PCR Master Mix (Qiagen, No. 201443). After gel purification (Qiagen, No. 28704), the PCR products were cloned into pGEM®-T easy vector (Promega, A3600) for sequencing. The sequencing data was analyzed using NCBI Blast. All experiments were performed with control (non-transgenic) samples of silkworm glands.
(98) Reverse transcription PCR (RT-PCR) results also showed that the DsRed gene was present in the complementary DNA (cDNA) of the transgenic silkworm glands. See Table 5, illustrating primers for DsRed detection in the genome of transgenic moths. Sequences listed in Table 5 are SEQ ID NOS: 43-48, as listed in order from first to last in the table.
(99) TABLE-US-00005 TABLE 5 Primer Primer No Name Sequence(5′-3′) Combinations for PCRs Template DNA 1 Dsred-BamHI ATAGGATCCCGCCTCCTCCGAGAACGTCAT Primer 1 and 2 used for cDNA of Transgenic 2 Dsred-XbaI TAATCTAGACAGGAACAGGTGGTGGCGG the first time PCR silk glands mRNA 3 HC_DsRed_1_F CACGAGTTCGAGATCGAGGG Primer 3 and 4 used for PCR products from 4 HC_DsRed_1_R GCGTCCACGTAGTAGTAGCC the secondary PCR the 1st PCR 5 HC_DsRed_2_F CCGACATCCCCGACTACAAG Primer 5 and 6 used for PCR products from 6 HC_DsRed_2_R ACGCCGATGAACTTCACCTT the secondary PCR the 1st PCR
(100) These results show that the synthetic spider silk protein MaSp1 and MiSp1 were fully expressed under the endogenous FibH promoter. In addition, the data indicates that the genes were inherited by the next generation of transgenic silkworms.
(101) Mechanical properties of the composite silk fibers.
(102) To further investigate the mechanical properties of composite silkworm/spider fibers, the G.sub.1 HCl offspring of the transgenic moths were raised under the same environmental and diet conditions as their parents to produce silk. The mechanical properties of non-transgenic and composite silkworm/spider fibers were tested under the same environmental conditions (22-25° C. and 40% relative humidity).
(103) The transgenic and control (non-transgenic) cocoon fibers were degummed (0.05% sodium bicarbonate, 0.05% SDS, and 0.01% sodium carbonate solution) at 85° C. for 30-45 min (wt./vol=1:50) until the silk became transparent. Then the degummed fibers were rinsed twice with warm water (50-60° C.) using the same material: solvent ratio. The degummed fibers were dried overnight under room temperature. Individual fibers were gently separated to avoid stretching and deformation and then attached to “C” shaped cards. The gauge length was 19.1 mm and diameters for each fiber were determined by taking an average of nine measurements with a Motic Optical 5A310 light microscope and Motic Images Plus 2.0 software. Each “C” card with the attached fiber was then loaded into a MTS Synergie 100 (MTS Systems) equipped with both a 50N load cell and a custom-made 10 g load cell (Transducer Techniques) for mechanical testing. Using TestWorks® 4 software, the attached fiber was uniaxially tested by pulling the fiber at a speed of 5 mm/min with a data acquisition rate of 120 Hz until the fiber broke. All tests were performed in ambient conditions (20-22° C. and 20-26% humidity). Data were then exported and further analyzed using Microsoft Excel.
(104)
(105) Table 6 illustrates the mechanical properties of the transgenic fibers in both G.sub.0 HCA and G.sub.1 HCl group compared to the G.sub.0 control group.
(106) TABLE-US-00006 TABLE 6 G.sub.0 HCA Group G.sub.0 Control Group HCA-2 HCA-3 G.sub.1 HCI Group n = 57 n = 35 n = 35 n = 17 Average SD Average SD Average SD Average SD Diameter (μL) 9.39 1.15 10.15 0.64 10.18 0.82 9.49 1.25 Maximum stress (MPa) 510.99 160.51 650.4 115.49 627.85 125.83 667.46 139.95 Maximum strain (%) 20.5 8.1 25.7 5.4 23.6 5.8 13.51 6.35 Elastic Modulus (GPa) 8.73 2.45 7.92 2.06 7.60 2.29 15.24 4.23 Energy to Break (MJ/m.sup.3) 77.29 38.99 107.93 31.06 102.92 38.66 59.77 31.38
(107) Table 7 is a comparative table of mechanical properties of the transgenic fibers using a standard two tailed T-test.
(108) TABLE-US-00007 TABLE 7 Compared Materials Max Stress Max Strain Diameter Elastic Modulus Energy to Break Control, HCA-2 0.000027** 0.0013** 0.00067** 0.11 0.00018** Control, HCA-3 0.00041** 0.055 0.00064** 0.03* 0.0028** Control, HCI 0.00053** 0.0016** 0.75 1.43E−11** 0.095 HCA-2, HCA-3 0.44 0.12 0.86 0.54 0.56 HCA-2, HCI 0.65 3.82E−09** 0.017* 5.46E−11** 3.85E−06** HCA-3, HCI 0.31 6.22E−07** 0.022* 2.99E−11** 0.00021** *P < 0.05 considered significant, **P < 0.01
(109) These results demonstrated that the composite silkworm/spider silk fibers in the G.sub.0 HCA group (the G.sub.0 HCA2 and the G.sub.0 HCA3 lines) were tougher than the non-transgenic fibers. See
(110) The values of average maximum stress in the G.sub.0 HCA2 and the G.sub.0 HCA3 were 650 and 628 MPa (27.3% and 22.9% increases respectively), higher than the non-transgenic group value of 511 Mpa. See
(111) The toughness (energy to break) of the composite silkworm/spider fibers in the G.sub.0 HCA2 (107.93 MJ/m.sup.3) and the G.sub.0 HCA3 (102.92 MJ/m.sup.3) was higher than that in the non-transgenic group (77.29 MJ/m.sup.3), while it decreased in the G.sub.1 HCl group (59.77 MJ/m.sup.3). See
(112) Both the G.sub.0 HCA and the G.sub.1 HCl groups had composite silkworm/spider fibers with maximum stress values over 900 MPa (
(113) FTIR-ATR Spectroscopic Characterization of Gland Contents.
(114) Fourier transformed infrared spectroscopy analysis of secondary protein structures on the silks in the glands was performed. A Varian 660-IR instrument with a horizontal single reflection Pike Technologies MIRacle attenuated total reflectance (ATR) module containing a ZnSe crystal was used for all measurements. Prior to producing any spectra, an appropriate background spectrum was obtained. Fresh middle glands of both control and transgenic groups were analyzed immediately after being excised from the silkworm bodies. Each gland was cut into sections beginning at the posterior end of the middle gland (posterior division (MP)) continuing to the anterior end of the middle gland (anterior division (MA)). These sections were then subjected to FTIR-ATR measurements at positions normal to the lumen of the glands. Each sample was gently clamped down prior to performing any readings and residual moisture completely wiped away and cleaned before the next section. A method developed with Resolution Pro Version 5.1.0.822 was used for all measurements that averaged the results for 20 scans over the range of 1000 cm.sup.−1 to 2000 cm.sup.−1 with a resolution of 1 cm.sup.−1 and an aperture setting of 4 cm.sup.−1 at 4000 cm.sup.−1.
(115) Spectroscopic analysis of the middle glands of silkworm from both non-transgenic and the G.sub.0 HCA transgenic groups revealed both similar and contrasting trends, as shown in
(116) When the secondary structural arrangement of the transgenic glandular material was compared to that of non-transgenic silkworms, the arrangements were highly similar. Both contained amorphous and helical-structures as well as beta-sheets, which are defining hallmarks of all silk proteins. Although the secondary structures present were fairly similar, there were also minor differences between the non-transgenic and the G.sub.0 HCA groups. Compared to the non-transgenic group, the most notable difference was that the transgenic glands had increased signal levels around the Amide II region and had an increased shift to beta-sheet rich structures or conformations as shown in
(117) Finally, the organization of silk proteins and more ordered structures are also preserved from non-transgenic to transgenic specimens. FTIR-ATR spectra of protein samples taken from the posterior glands of both groups appear fairly similar and lack any predominant order or structure. At points further along the lumen of the duct, more ordered structures can be seen in the protein structures and the formation of beta-structures is increased, as shown in
(118)
(119) The disclosed methods have several advantages over existing technology. First, the disclosed methods are the first successful use of an endogenous FibH promoter to drive expression of large (e.g., greater than 3 kb, greater than 5 kb, etc) exogenous synthetic spider silk genes, which differs significantly from other design approaches based on constructing an expression cassette with an exogenous promoter.
(120) Second, the disclosed methods demonstrate the first time a large synthetic spider silk gene (˜10 kb), which is similar to the natural characterized spidroin genes (>9 kb), has been incorporated into the FibH genome of silkworms. A relatively large gene cassette including the synthetic spider silk protein gene (protein size ˜300 kDa) has been successfully expressed in its entirety in the silk gland of transgenic silkworms. Previous workers have successfully expressed smaller synthetic spider silk proteins of approximately 120 kDa in piggyBac-based transgenic silkworms.
(121) Third, the composite silkworm/spider silk fibers emit both green and red fluorescence in both the G.sub.0 and the G.sub.1 generations of transgenic silkworms, indicating the hereditary of transgenic silkworms is stable and reliable. Genome junction testing results show that the synthetic spider silk gene has been integrated into the expected sites of FibH in the genome by the optimized silkworm-specific CRISPR/Cas9 system triggered NHEJ in both G.sub.0 and G.sub.1 generations of transgenic silkworms.
(122) Fourth, the composite silkworm/spider silk fibers demonstrate improved mechanical properties in both the G.sub.0 HCA group and the G.sub.1 HCl group, as compared to control silkworm silk fibers. The incorporation of synthetic spider silk protein MaSp1 and MiSp1 enriched both the β-sheets ((GA).sub.n, A.sub.n) and 3.sub.10-helixes (GGX) in the composite silkworm/spider silk fibers (
Example 2. Spider Silk Transgenes in FibL Intron
(123) To improve the mechanical properties of transgenic silkworm/spider fibers, a synthetic spider silk MaSp1 (172 kDa) gene was incorporated at the genetic locus of the fibroin light chain (FibL) in silkworms by CRIPSR/Cas9 initiated non-homologous end joining (NHEJ). Double strand breaks (DSBs) were created at the sixth intron of the fibroin light chain gene using an optimized CRISPR/Cas9 system. An exogenous spider silk protein MaSp1 was fully expressed under control of the endogenous FibL enhancer and promoter. The resulting transgenic silkworm/spider fibers demonstrated superior mechanical properties in both the first and second generations (G.sub.1), indicating genetic stability of the transgenic silkworms.
(124) Design of the CRISPR/Cas9 System.
(125) Two gRNAs (g5 and g6) were designed to target the 6.sup.th intron of fibroin light chain (FibL) of silkworm gland (Table 8), showing gRNA target sites in the LC-NHEJ project. The gRNAs were sub-cloned into the pGEM®-T easy vector under control of a silkworm specific U6 (sU6) promoter via Gibson Assembly. Expression vectors of the CRISPR/Cas9system (pGEM®-T-sU6-sgRNA and pIEx™-1-eGFP-cas9) were generated. Synthesized sequences of g5 (SEQ ID NO:52) and g6 (SEQ ID NO:53) are shown in Table 8.
(126) TABLE-US-00008 TABLE 8 Name Target Sequence Genome Location g5 AGAACTTTAAATTATATCT M76430.1:13857-13875 g6 TCACTATGAGACTTAAGCT M76430.1:13880-13898
(127) Light Chain Non-Homologous End Joining Donor (LC-NHEJ Donor).
(128)
(129)
(130) Table 9 below shows the primers used to construct the LC-NHEJ donors. The primers in Table 9 have SEQ ID NOs: 54-59, as listed from top to bottom in the table.
(131) TABLE-US-00009 TABLE 9 Name Sequence(5′-3′) KpnI-13461- ATAGGTACCCCGGTTGCTCAAGTGTTCCACC L-F SalI-14090- ATTGTCGACGTCATTACCGTTGCCAACGCCTC L-R eGFP-SalI-F ATAGTCGACGTGAGCAAGGGCGAGGAGCTGTTCACC eGFP-HindIII- GCAAGCTTCTTGTACAGCTCGTCCATGCCGAGAG R BamHI-14091- ATAGGATCCTGCGACCGGCTTAGTTGCTAATGCTC R-F SacI-14600- ATAGAGCTCGTACCCACTGTCCAATCCACCGTC R-R
(132)
(133) Gene fragments of MaSp1-6 (with six repeats), were cloned into pBluescript SK (+) with HindIII and BamHI (NEB) to produce pSK-MASP1 (6). The N-terminal region of silkworm FibL from part of the FibL 6.sup.th intron/7.sup.th exon (NTD) was sub-cloned into pSK-MASP1 (6) (using KpnI and SalI sites) to form the pSK-NTD-MASP1 (6) vector. The enhanced green fluorescence protein gene (eGFP) was cloned adjacent to the NTD using SalI and HindIII sites to produce pSK-NTD-eGFP-MASP1 (6). The C-terminal region of silkworm FibL (CTD) includes part of the 7.sup.th exon and almost all of the C-terminal non-coding region. This was subcloned into the CTD at BamHI and SacI sites to produce the final LC-NHEJ-Donor, pSK-NTD-eGFP-MASP1 (6)-CTD.
(134) The coding region of cas9 was driven by the hr5 enhancer and IE1 promoter in the pIE-1 vector to make sure that cas9 was expressed well in BmN cells and silkworms. The U6 promoter specific for silkworm (sU6) was used to drive the expression of FibL gRNAs, g5 and g6. To preclude the effects of error-prone repairs by NHEJ, the sixth intron of FibL was chosen as the gRNA specific target site (
(135) The linearized shuttle vector, the LC-NHEJ construct, can be inserted into FibL at the DSBs through NHEJ (
(136) Identification of Transgenic Silkworms.
(137) The mature silkworm-specific CRISPR/Cas9 system and LC-NHEJ donors were delivered into fresh silkworm eggs (1-2 h after spawning) through electroporation, as described in Example 1 herein. (silkworm strain: Haoyue). The vectors of the optimized CRISPR/Cas9 system and LC-NHEJ donor were prepared by midi/maxi-preps (QIAGEN).
(138) The G.sub.0 (first generation) transgenic worms were fed with cooked mulberry chow till the last day of the fifth larval-stage. The transgenic G.sub.0 cocoons with pupae inside emitted green fluorescence under the excitation of UV light. These G.sub.0 transgenic moths from the transgenic cocoons were raised in order to lay G.sub.1 (second generation) transgenic eggs. The hatched G.sub.1 transgenic worms were raised to spin G.sub.1 transgenic cocoons under the same conditions as parents in a room with specific light (12-hour light vs. 12-hour dark) and humidity (60-80%) conditions.
(139) Genome: Junction Testing in Transgenic Silkworm Moths.
(140) Table 10 below shows the primers used for genome: junction testing. The primers in Table 10 have SEQ ID NOs: 61-68, as listed in order from top to bottom in the table.
(141) TABLE-US-00010 TABLE 10 Name Sequence(5′-3′) Primer Combinations for PCRs LC-NHEJ-LJ13201-F AAGATGGATCAAACTGCACACGGTGTGC First-time Forward Primer LC-NHEJ-LJ13389-F AAGAGATTGTACAACTCTCGCAACAGCC Secondaiy-time Forward Primer LJ-R1 GTAAACGGCCACAAGTTCAGC Secondaiy-time Reverse Primer LS-R TACGGCAAGCTGACCCTGAA First-time Reverse Primer PSK-F GGGCGATCGGTGCGGGCCTC First-time Forward Primer PSK-F2 TACGACTCACTATAGGGCGA Secondaiy-time Forward Primer LC-NHEJ-RJ14589-R CCAATCCACCGTCTTTGGGT Secondary-time Reverse Primer Sac1-14600-R-R GACGGTGGATTGGACAGTGGGTAC First-time Reverse Primer
(142) Genomic DNA was extracted from G.sub.1 (second generation) transgenic moths using the E.Z.N.A™ Insect DNA Isolation Kit (Omega Bio-Tek, C0926-01). The 3′- and 5′-end genome: transgene junction sequences were amplified using the designed primers. The first PCRs were performed with NEBNext® High-Fidelity 2×PCR Master Mix (NEB) and the second PCRs were performed using Taq PCR Master Mix Kit (Qiagen) after purification of the first-time PCR products by gel extraction (Qiagen). Amplified fragments were gel-purified (Qiagen) and cloned into pGEM®-T easy vector system for sequencing (Promega). Sequencing data was analyzed using the NCBI Blast program.
(143)
(144) PCR investigation of the left and right genome: junction showed that the LC-NHEJ construct had been successfully inserted at the expected FibL locus in the genome of transgenic moths. (
(145) Qualitative Detection of Transgenic Silkworm/Spider Protein.
(146) Adult silkworms were dissected on the third day of the fifth larval-stage to remove their silk glands. The glands were treated with 1×PBS and then stored at −80° C. The middle gland proteins were homogenized with 2×SDS lysis buffer (3% SDS, 6 M urea, 40 mM Dithiothreitol, 10% w/v Glycerol, 0.01% Bromophenol blue, 62.5 mM Tris-HCl pH 6.8), boiled at 95° C. for 15-20 min and loaded onto 4-20% gradient gels (Thermo) at 100 V for 1.5 h. Proteins were transferred to a PVDF membrane after gel separation (Bio-Rad). Primary antibodies were commercial the eGFP-specific antibody (Thermo Scientific, cat #: MA1-952), and dsRed2 antibody (Santa Cruz® Biotechnology, sc-101529). The secondary antibody was Anti-Mouse IgG (H+L), HRP Conjugate (Promega, W4021). All antibodies were diluted in blocking buffer (1×TBST with 5% nonfat dry milk) according to the manufacturer's instructions. Antibody-antigen reactions were performed with the one-step ultra TMB blotting solution (Pierce, Thermo Scientific).
(147)
(148) The synthetic spider silk protein MaSp1 tagged with eGFP showed indistinct bands in the Coomassie blue stained SDS-PAGE (
(149) Mechanical Testing and Analysis of Silk Fibers.
(150) The mechanical properties of the transgenic silkworm/spider silk fibers were tested in a similar manner to Example 1, herein.
(151) Transgenic silkworm/spider silk fibers (in the G.sub.1 LCA6 group) were analyzed by mechanical testing after degumming under the same testing conditions as the control, non-transgenic group (22-25° C. and 40% humidity).
(152) Table 11 below reports data showing the mechanical performance of the transgenic silkworm/spider fibers in LC-A6 groups.
(153) TABLE-US-00011 TABLE 11 Control Non-Transgenic LCA6 Transgenic Native Dragline n = 57 n = 26 n = 24 Average SD Average SD Average SD Diameter (μL) 9.39 1.15 7.90 1.07 2.41 0.48 Maximum stress (MPa) 510.99 160.51 781.45 134.97 1432.99 336.42 Maximum strain (%) 20.5 8.1 20.09 7.93 11.06 3.73 Elastic Modulus (GPa) 8.73 2.45 15.95 7.02 12.56 8.21 Energy to Break (MJ/m.sup.3) 77.29 38.99 105.97 55.88 77.45 34.85
(154) The stress vs. strain results showed that the transgenic silkworm/spider silk fiber had better mechanical properties than fibers in the control group (
(155)
(156) The highest maximum stress values of the transgenic silkworm/spider silk fibers were 1204 and 1475 MPa. These mechanical properties are close to or better than values for native spider dragline silk (N. clavipes), with maximum stress of 1375 MPa (data collected under the same testing conditions as the transgenic silkworm/spider silk fibers) (
(157)
(158) Transgenic silkworm/spider fibers showed superior mechanical performance in stress strain testing. Due to integration of the spider silk protein MaSp1 in the FibL of transgenic silkworm/spider fibers, the average maximum stress in LCA6 group is about 50% higher than the control group. The best transgenic silkworm/spider fibers have mechanical properties similar to native spider dragline silk fibers. The spider silk protein MaSp1 is enriched in β-sheets, which leads to an increase in the maximum stress and elastic modulus of transgenic silkworm/spider fibers. MaSp1 also has the secondary structure Gly-II-helixes which might improve the strain. It was thus surprising that the average maximum strain of the transgenic silkworm/spider fibers was similar to that of the control group. Without wishing to be bound to any particular theory, the reason might be because the strain of the silkworm silk fibers is mainly dependent on the conformation of fibroin heavy chain, the predominant protein. This is supported by the mechanical properties of transgenic silkworm/spider fibers in the heavy chain non-homologous end joining (HC-NHEJ) (Example 1), which show a similar pattern. A portion of the original heavy chain was replaced by the synthetic spider silk protein MaSp1 or MiSp1 in the transgenic silkworm/spider fibers. Both maximum stress and strain increased in the transgenic silkworm/spider fibers in the HC-NHEJ (Example 1) due to the combination of the secondary structure β-sheets and 3.sub.10-helixes in MaSp1 or MiSp1.
(159) Compared to MiSp1, MaSp1 combines longer 3.sub.10-helixes that increase the maximum strain in the HCA group compared to that in the HCl group. The arrangement of amino acids in the spider silk proteins MaSp1 and MiSp1 are similar to that of the native fibroin heavy chain of silkworm silks, which allows them to be integrated in to the silk fibers without major disruptions.
(160) In the light chain non-homologous end joining (LC-NHEJ) experiments (Example 2), more β-sheets of spider silk protein MaSp1 were integrated into the fibroin light chain, with no change of fibroin heavy chain in the transgenic silkworms. In addition, 3.sub.10-helixes of MaSp1 were incorporated into the transgenic silkworm/spider fibers in the LCA6 group where there are no 3.sub.10-helixes in the original silkworm silks. In the HC-NHEJ experiments (Example 1), the β-sheets of the original heavy chain were replaced by spider silk protein with the secondary structure β-sheets and 3.sub.10-helixes of the spider silk protein MaSp1 and MiSp1. Overall, the mechanical properties of the transgenic silkworm/spider fibers in LCA6 group are better than that in the HCA or HCl group. The average maximum stress in the G1 LCA6 group is about 800 MPa, a 20% improvement over the G.sub.0 HCA and G.sub.1 HCl groups (650 and 667 MPa, respectively). That suggests the mechanical properties of transgenic silkworm/spider protein fibers can be improved by the increased β-sheets and 3.sub.10-helixes provided by the spider silk proteins.
(161) Alternative splicing in the FibL gene could also lead to various expression patterns of the integrated spider silk gene MaSp1. It also can change the protein conformation of transgenic silkworm/spider fibers that affects their mechanical properties. As mentioned before, the fibroin light chain has seven exons while the fibroin heavy chain only has two exons in the silkworm genome. In the LC-NHEJ project, the spider silk gene MaSp1 was integrated at the seventh exon of FibL gene that makes an MaSp1 fusion on the C-terminal end of the FibL gene. The C-terminal exon with the fusion to MaSp1 should be always expressed no matter which kind of alternative splicing happened in the FibL gene of the transgenic silkworm genome. However, in the HC-NHEJ project, the non-homologous insertion of the gene cassette with MaSp1 or MiSp1 generated a new FibH C-terminal without destroying the original FibH C-terminal in the transgenic silkworm genome. During alternative splicing, either the new or the original FibH C-terminal has a chance to be expressed while only expression of the FibH C-terminal with spider silk protein will improve the mechanical properties of transgenic silkworm/spider fibers. This may explain the increased mechanical properties of the LC-NHEJ fibers.