FUSION MOIETIES AND MICROBIAL HOSTS FOR PROTEIN PRODUCTION
20210130865 · 2021-05-06
Inventors
Cpc classification
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to fusion proteins comprising (i) a fusion moiety based on SEQ ID NO:1 and (ii) a protein. Also provided are nucleic acids encoding such fusion proteins and compositions comprising such fusion proteins. The invention also provides a method for increasing the expression level of a protein in a host cell or increasing the level of secretion of a protein from a host cell, said methods employing a fusion moiety in accordance with the invention. The invention further provides a method of producing a protein, said method comprising culturing an Aliivibrio wodanis host cell comprising a heterologous nucleic acid molecule encoding a protein under conditions suitable for the expression of the encoded protein. Certain deposited strains of Aliivibrio wodanis are also provided.
Claims
1. A fusion protein comprising (i) a fusion moiety comprising an amino acid sequence of SEQ ID NO:1 or an amino acid sequence that is at least 80% identical to SEQ ID NO:1; and (ii) a protein.
2. The fusion protein of claim 1, wherein said fusion moiety of (i) further comprises at its C-terminal end an amino acid sequence comprising GNAFA (SEQ ID NO:51) or comprising an amino acid sequence having 1 or 2 amino acid insertions, deletions or substitutions as compared to the amino acid sequence GNAFA (SEQ ID NO:51).
3. The fusion protein of claim 1 or claim 2, wherein said fusion moiety of (i) comprises an amino acid sequence of SEQ ID NO:4.
4. The fusion protein of claim 1, wherein said fusion moiety of (i) consists of an amino acid sequence of SEQ ID NO:1.
5. The fusion protein of any one of claims 1 to 3, wherein said fusion moiety of (i) consists of an amino acid sequence of SEQ ID NO:4.
6. The fusion protein of any one of claims 1 to 5, wherein said protein of (ii) is an enzyme.
7. The fusion protein of any one of claims 1 to 6, wherein said protein of (ii) is from an organism that can grow at 510° C.
8. The fusion protein of of claim 7, wherein said organism is a bacterium.
9. The fusion protein of claim 7 or claim 8, wherein said organism is a marine bacterium.
10. The fusion protein of any one of claims 1 to 9, wherein said protein of (ii) is a psychrophilic protein.
11. The fusion protein of any one of claims 7 to 10, wherein the protein of (ii) has a level of activity that is higher than the level of activity of a mesophilic homologue of said protein at a temperature of 510° C.
12. The fusion protein of any one of claims 7 to 11, wherein the protein of (ii) is a protein that is substantially inactivated at a temperature at which a mesophilic homologue of said protein is not substantially inactivated.
13. The fusion protein of any one of claims 1 to 12, wherein the protein of (ii) is a nuclease, a polymerase, a protease, a ligase, a reverse transcriptase, a phosphatase, a kinase, a methylase, a topoisomerase, a lipase, a carbohydrase, an amylase, a cellulose or a dehydrogenase.
14. The fusion protein of any one of claims 1 to 5, wherein said protein of (ii) is a protein of the Immunoglobulin superfamily.
15. The fusion protein of any one of claims 1 to 14, wherein said fusion moiety is positioned at the N-terminus of the protein of (ii).
16. A fusion protein comprising (i) a fusion moiety comprising an amino acid sequence of SEQ ID NO:4 or an amino acid sequence that is at least 80% identical to SEQ ID NO:4; and (ii) a protein.
17. The fusion protein of claim 16, wherein said fusion moiety of (i) consists of an amino acid sequence of SEQ ID NO:4.
18. The fusion protein of claim 16 or claim 17, wherein the protein of (ii) is as defined in any one of claims 6 to 14.
19. The fusion protein of any one of claims 16 to 18, wherein said fusion moiety of (i) is positioned at the N-terminus of the protein of (ii).
20. A nucleic acid molecule encoding a fusion protein of any one of claims 1 to 19.
21. A nucleic acid molecule encoding a fusion protein, said nucleic acid molecule comprising (i) a polynucleotide comprising a polynucleotide sequence of SEQ ID NO:2 or SEQ ID NO:5, or a polynucleotide sequence that is at least 80% identical to SEQ ID NO:2 or SEQ ID NO:5; and (ii) a polynucleotide encoding a protein.
22. The nucleic acid molecule of claim 21, wherein said fusion protein is as defined in any one of claims 1 to 19.
23. A composition comprising (i) a fusion protein as defined in any of claims 1 to 19 or a nucleic acid molecule as defined in any one of claims 20 to 22, and (ii) a buffer or carrier or diluent.
24. A method of producing a protein, said method comprising culturing a host cell comprising a heterologous nucleic acid molecule encoding said protein under conditions suitable for the expression of the encoded protein, wherein said protein is a fusion protein comprising (i) a fusion moiety comprising an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:4 or an amino acid sequence that is at least 80% identical to SEQ ID NO:1 or SEQ ID NO:4, and (ii) a protein.
25. The method of claim 24, said method further comprising, subsequent to culturing the host cell, a step of isolating the protein from the host cell or from the growth medium or supernatant and optionally formulating the protein into a composition including at least one additional component.
26. The method of claim 24 or claim 25, wherein said fusion protein is as defined in any one of claims 1 to 19.
27. A method for increasing the expression level of a protein in a host cell, said method comprising incorporating into said protein a fusion moiety as defined in any one of the preceding claims.
28. A method for increasing the level of secretion of a protein from a host cell, said method comprising incorporating into said protein a fusion moiety as defined in any one of the preceding claims.
29. The method of any one of claims 24 to 28, wherein said host cell is an Aliivibrio wodanis host cell.
30. A method of producing a protein, said method comprising culturing an Aliivibrio wodanis host cell comprising a heterologous nucleic acid molecule encoding said protein under conditions suitable for the expression of the encoded protein.
31. The method of claim 30, wherein said protein is a protein as defined in part (ii) of any one of the preceding claims.
32. The method of claim 30 or claim 31, wherein said protein is a fusion protein as defined in any one of the preceding claims.
33. The method of any one of claims 30 to 32, wherein said Aliivibrio wodanis is an Aliivibrio wodanis strain selected from the group consisting of: (i) the Aliivibrio wodanis strain deposited under accession number ECACC 18050101; (ii) the Aliivibrio wodanis strain deposited under accession number ECACC 18050102; and (iii) an Aliivibrio wodanis strain having all the identifying characteristics of one or both of strains (i) and (ii).
34. The method of any one of claims 30 to 33, wherein the culturing is done at a temperature of 4° C. to 18° C.
35. The method of any one of claims 30 to 34, said method further comprising, prior to culturing the Aliivibrio wodanis, a step of introducing said heterologous nucleic acid molecule encoding said protein into the Aliivibrio wodanis host cell.
36. The method of any one of claims 30 to 35, said method further comprising, subsequent to culturing the Aliivibrio wodanis, a step of isolating the protein from the Aliivibrio wodanis or from the growth medium or supernatant, and optionally formulating the protein into a composition including at least one additional component.
37. An Aliivibrio wodanis strain selected from the group consisting of: (i) the Aliivibrio wodanis strain deposited under accession number ECACC 18050101; (ii) the Aliivibrio wodanis strain deposited under accession number ECACC 18050102; and (iii) an Aliivibrio wodanis strain having all the identifying characteristics of one or both of strains (i) and (ii).
Description
[0251] The invention will now be further described in the following non-limiting Examples with reference to the following drawings:
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
[0262]
[0263] The SDS-PAGE gel shows protein bands from E. coli whole cell extracts when containing no plasmid (control), or pTM214_MvExoI (MvExoI), pTM214_5′1781_MvExoI (5′1781_MvExoI) or pTM214_P1781_MvExoI (P1781_MvExoI). 5′1781_MvExoI expressed from plasmid pTM214_5′1781_MvExoI (5′1781_MvExoI) encodes M. viscosa exonuclease I (MvExoI) having an N-terminal fusion moiety having the amino acid sequence of MSKQMKFGLLPAAIAGALLS (SEQ ID NO:1). Plasmids pTM214_MvExoI (MvExoI) and pTM214_P1781_MvExoI (P1781_MvExoI) encode M. viscosa exonuclease I that does not have an N-terminal fusion moiety. pTM214_P1781_MvExoI (P1781_MvExoI) has a 300 nucleotide fragment (SEQ ID NO:3) of the promoter of the A. wodanis gene Awod_I1781 upstream of the MvExoI coding sequence. Overnight cultures of E. coli with or without plasmid were diluted 1:100 in LB medium and grown to OD.sub.600 nm=0.7-1 at 37° C. Cultures were then transferred to 15° C. for expression overnight. Arrow is pointing to the expected size of MvExoI (55.0 kDa), and an asterisk indicates the protein band verified by mass spectrometry as MvExoI.
[0264]
EXAMPLE
Introduction
[0265] Heterologous expression of certain proteins, e.g. cold-adapted proteins, represents today one of the biggest bottlenecks in the ongoing bioprospecting efforts to find new enzymes, e.g. from cold environments (for example the cold oceans that represents a largely untapped resource in this respect). In mesophilic expression hosts such as Escherichia coli, certain proteins such as cold-adapted enzymes typically form inactive aggregates. There is therefore a need to develop new cold-temperature expression systems, including identifying new host organisms and genetic tools. In this work we explored the use of the sub-Arctic bacterium Aliivibrio wodanis as a potential host for heterologous expression of cold-active enzymes. We have tested twelve bacterial strains (Aliivibrio wodanis strains), available vectors and promoters, reporter systems, used RNA-sequencing to identify the most highly expressed genes in A. wodanis (and thus their intrinsic promoters), explored a novel 5′-fusion to stimulate protein expression and solubility, and finally tested expression of a set of “difficult-to-express” enzymes originating from various bacteria and one Archaea. Our results show that cold-adapted enzymes can be expressed in soluble and active form in A. wodanis, also when expression fails in E. coli due to formation of inclusion bodies. Moreover, we identified a 60-bp/20-aa fragment from the 5′-end of the Awod_I1781 gene of A. wodanis that stimulates expression of the Green Fluorescent Protein and improves expression of cold-active enzymes when used as a 5′-fusion. These results support that A. wodanis and associated genetic tools are well suited for low-temperature expression and represents a useful host cell for the expression of proteins, for example cold-adapted proteins that can be difficult to express in mesophiles.
Results and Discussion
Selection of Strains and Genetic Tools
[0266] Table 1 shows the twelve A. wodanis strains that were selected from our in-house strain collection for further characterization to identify promising expression host candidates. Strains were tested for growth rate, resistance against some commonly used antibiotics (in biotechnological applications), and conjugation efficiency (uptake and stability of plasmids).
[0267] Preliminary tests showed that A. wodanis does not grow at temperatures above 20° C., and has an optimal growth rate from approximately 12-18° C., and all tested strains showed very similar growth profiles.
[0268] Next, we tested for resistance to antibiotics, four of which are commonly used in biotechnological applications, namely carbenicillin, kanamycin, tetracycline and chloramphenicol. Resistance of A. wodanis strains to ampicillin, nitrofurantoin, tetracyclines, cefoxitin and sulfamethoxazole have been reported. The twelve strains used in this study were sensitive to chlorampenichol and tetracycline, of intermediate sensitivity to kanamycin and showed resistance to carbenicillin (see Table 1).
[0269] To test the ability of A. wodanis to take up plasmids, each strain was conjugated with the plasmid pTM214 (Miyashiro et al., 2011). In E. coli the mCherry fluorescent protein is constitutively expressed from pTM214, but in A. wodanis mCherry expression from pTM214 requires the addition of IPTG to the growth medium. It is straightforward to discriminate between E. coli and A. wodanis cells after conjugation. This is because only A. wodanis grows well under the culture conditions used (12° C. for 3 days in LB agar with 2.5% NaCl and 2 μg/ml chloramphenicol). E. coli does not grow under these conditions. Thus, only A. wodanis colonies carrying the pTM214 plasmid grow under these conditions. Also, as the growth medium (agar plates) does not contain IPTG, A. wodanis colonies are identifiable by their lack of mCherry expression. As mentioned above, in A. wodanis mCherry expression from pTM214 requires the addition of IPTG to the growth medium (unlike E. coli which express mCherry from from pTM214 constitutively).
[0270] Next, we used the plasmid pVSV208 to determine the capacity of strains to express a reporter protein, i.e., the red fluorescent protein (RFP), under antibiotic (chloramphenicol) pressure. Only strains that received the pTM214 plasmid was tested (see above). First, expression was monitored by examining the morphology (color) of colonies using a fluorescent microscope. Bright red colonies of strains 01/09/401 and 03/09/160 indicated strong RFP expression. For strain 88/09/441, we observed great variation, from bright red to white color, thus indicating uneven expression levels between individual colonies. Colonies of strains 02/09/382, 04/60/17347 and K7F1 150913 were less bright. Second, RFP expression was monitored in liquid cultures by measuring fluorescence (588 nm) in the supernatant of lysed cell cultures.
[0271] In summary, based on the results described above strains 01/09/401 and 03/09/160 were selected as candidate expression hosts for cold-temperature protein expression. Both of these strains grow well at low temperature to relatively high optical densities, they can receive plasmids via conjugation, and they can stably express the RFP reporter system. Strain 03/09/160 has additionally been shown to be capable of integrating plasmids efficiently into the genome.
Expression of Green Fluorescent Protein Reporter System at Low Temperature
[0272] Two A. wodanis strains (01/09/401 and 03/09/160) were next tested for their ability to support expression of a His-tagged green fluorescent protein (GFP) from a strong lac promoter (P.sub.lac). To do this we constructed the plasmid pPSY001, which was based on a His-ZZ-GFP fragment amplified from a pETZZ1a vector (Merck), and cloned into a pVSV105 (Dunn et al., 2006) backbone (
[0273] Strains 01/09/401 and 03/09/160 carrying the pPSY001 plasmid were grown in 15 mL cultures in 50 ml Falcon tubes at 4° C. and 12° C. at 200 rpm, and left for six (4° C.) and two (12° C.) days. GFP expression was first confirmed by collecting 1 mL samples and by measuring fluorescence (485-538 nm) in the supernatant of lysed and pelleted cells. His-tagged GFP from the remaining culture was affinity purified, and separated on a SDS-PAGE.
Expression, Purification and Activity of Cold-Adapted Enzymes from the Aliivibrio Genus
[0274] Having shown expression of three reporter systems (mCherry, RFP and GFP) we next wanted to test “difficult-to-express” cold-adapted enzymes in A. wodanis. Test-cases were selected from terminated projects (due to unsuccessful or poor expression in E. coli) at the Norwegian Structure Biology Center (NorStruct). As test-cases we first selected two enzymes, i.e., Exonuclease I (AsExoI) and DNA Polymerase 11 (AsPoIII), both from Aliivibrio salmonicida (in the present study the AsExoI and AsPoIII enzymes are His-tagged). The rational was that expression had previously failed in E. coli due to formation of inclusion bodies, and that they originate from a close relative of A. wodanis (which improves chances of successful expression).
[0275] The pTM214 vector with a weaker, but inducible (by IPTG) promoter (P.sub.trc), was chosen for this experiment to reduce chances of cell toxicity due to strong constitutive expression from pPSY001. Insertion of the two enzyme genes into the vector was done using Fast cloning (Li et al., 2011) (see materials and methods for details). The final plasmid constructs were named pTM214_AsExoI and pTM214_AsPoIII (Table 4), and transferred into A. wodanis by conjugation. Expression was done in strains K7F1 150913, 02/09/382, 01/09/401, 88/09/441, 04/60/17347 and 03/09/160 to verify that strains expressing highest amounts of RFP expression (
[0276]
[0277] Next, we directly compared the performance of A. wodanis to that of E. coli, when expressing the cold-active enzyme AsExoI. pTM214_AsExoI was expressed (i) as described above in A. wodanis 03/09/160 at 12° C. for 3 days, and (ii) in E. coli at 37° C. overnight.
[0278] In summary, based on expression of the exonuclease AsExoI, originating from A. salmonicida, we selected strain 03/09/160 as our standard A. wodanis strain for expression. The two enzymes AsExoI and AsPoIII are readily expressed in A. wodanis 03/09/160 in active form. AsExoI is expressed as inclusion bodies in E. coli at 37° C.
A 60 bp/20-Aa Fragment Originating from a Highly Expressed Gene (Awod_I1781) Elevates Expression of a Gfp Fusion
[0279] In an attempt to increase the protein production in A. wodanis we adapted a strategy, in which the 5′-end of a highly expressed gene is used as a fusion partner, and added to the 5′-coding region of the target gene. Another strategy that we took into consideration was that the addition of a strong RNA stem-loop to the mRNA 5′-end can enhance expression. To find the most highly expressed genes, we cultivated A. wodanis 03/09/160 under our standard growth conditions, harvested cells at OD.sub.600 nm=2 (exponential phase), and used RNA-sequencing. After cultivation, total RNA was extracted, rRNA-depleted, quantified and quality controlled, and finally subjected to cDNA library preparation and sequencing using the Illumina MiSeq technology (v3 chemistry, 2×75-bp, 25 mill reads, 3.75 Gb total output). A Galaxy analysis pipeline of EDGE-pro v1.0.1 and DESeq was used to align reads onto a complete A. wodanis 03/09/160 genome (derived from PacBio sequencing in this work), and estimate mean expression levels across biological replicates.
[0280] Table 2 shows a list of the top ten most highly expressed genes in A. wodanis 03/09/160. Interestingly, the level of expression of gene Awod_I1781 is 2.2× higher than that of the second most highly expressed gene (Awod_I1528), and 3.1× higher than that of number three on the list (Awod_I1596). A 300-bp region upstream of Awod_I1781 (i.e., the promoter) was cloned into the pTM214 vector in front of gfp (the plasmid was named pTM214_P1781_GFP) to verify that the promoter can support strong expression in A. wodanis (
[0281] The above-mentioned 300 bp region upstream of Awod_I1781 has the following nucleotide sequence (SEQ ID NO:3) (5′ to 3′):
TABLE-US-00009 tttactgataaaatggtcatttattgtgtgaaatcactttttttgtggca cagacccctttttttaaataaaagcccctaagtttaattgactttcatct gacaatagtatgaaattcacactgctatcactacttgaataacattgttc tgacatagcgtttatggcatgaaatgttggacggtggttaagtttgtttt gttatatgttaaggtttcttacatagacagactacgtgaagttggctaca agtcgatttgtataaaagattttataaatatatatttggagataaaaata
[0282] Further analysis of Awod_I1781 (the most highly expressed gene) revealed that the first 60-bp of the 5′-coding region can potentially form a strong RNA secondary structure consisting of three base-paired regions, and two terminal loops (
[0283] In summary, we used RNA-sequencing to find the most highly expressed genes in A. wodanis 03/09/160. A 60-bp sequence from the 5′-coding region of Awod_I1781 (by far the most highly expressed gene) was used as a 5′-fusion to stimulate expression of GFP. There was a stimulating effect on expression, which proved particularly effective when coupled to cold-adapted enzymes during low-temperature expression (see below).
Expression of Cold-Adapted Enzymes from Non-Aliivibrio Microbial Sources
[0284] The following four (non-Aliivibrio) enzymes were next selected for test-expression: (i) Exonuclease I (MvExoI) from Moritella viscosa (Gammaproteobacteria; Alteromonadales; Moritellaceae), (ii) ligase 1 (CsLig1) from Cenarchaeum symbiosum (Archaea; TACK group; Thaumarchaeota; Cenarchaeales; Cenarchaeaceae), (iii) ligase 6 (CpLig6) from Colwellia psychrerythraea (Gammaproteobacteria; Alteromonadales; Colwelliaceae) and (iv) alkoholdehydrogenase (AdhStrep) from Streptomyces (Actinobacteria; Streptomycetales; Streptomycetaceae).
[0285] The respective four genes were first cloned into the pTM214 vector, but downstream protein expression experiments did not produce any detectable bands after SDS-PAGE (Data not shown). Therefore, the same enzyme genes were next cloned into pTM214 behind the 60-nt/20-aa fusion from gene Awod_I1781, and conjugated into A. wodanis 03/09/160. Expression was performed as described earlier.
[0286] To test if the 60-nt/20-aa fusion can enhance expression in E. coli at low temperature (i.e., 15° C.), the 20-aa tag-MvExoI fusion (in pTM214) was expressed in E. coli strain DH5αλpir. Cultures of E. coli carrying the MvExoI fusion plasmid (or control plasmids) were grown in LB (w/34 μg/ml chloramphenicol) to OD.sub.600 nm=0.7-1 at 37° C. Cultures were next transferred to 15° C. for expression over night.
[0287] To summarize, four enzymes originating from non-A. wodanis organisms, including organisms very distantly related to A. wodanis (i.e., CsLig1 from Archaea) were expressed and purified. The activity of Exonuclease I from M. viscosa was tested and found to be active. Interestingly, the addition of a 60-nt/20-aa fusion, significantly increased the expression from not visible on gels to readily visible, both in A. wodanis and in E. coll. Adapting to a stronger promoter system like T7 may increase expression/protein production. So far, the biggest benefit with the A. wodanis system is apparently the increase in successful protein folding of cold-adapted enzymes by expressing proteins at low temperature.
A 25-Aa Peptide Originating from Awodl11781 Enhances Export of sfGFP
[0288]
[0289] To test if the Awodl11781 signal sequence (signal peptide) can be used to translocate recombinantly expressed proteins into the periplasm, or growth medium, a plasmid was constructed such that the 25-aa peptide (SEQ ID NO:4) was placed in front of the super folder GFP (sfGFP). This plasmid thus encoded a fusion protein, with the 25-aa peptide (SEQ ID NO:4) located N-terminally with respect to the sfGFP. When translocated to the periplasmic space, sfGFP is fluorescent (Aronson et al., 2011). The resulting construct (named pTM214_174 ss_sfGFP) was conjugated into A. wodanis 03/09/160. A control construct (pTM214_sfGFP), which encodes sfGFP without the N-terminal 25-aa peptide was used in parallel experiments as a control. After 48 hours of growth the fluorescence was determined in i) growth media with cells (also referred to herein as “Whole Culture”) (
[0290] In summary, the first 25-aa originating from Awodl11781 enhance translocation of sfGFP into its surroundings, when used as an N-terminal fusion peptide. Secretion of recombinantly expressed proteins can have huge advantages, such as improved folding and post-translational modifications, easier downstream purification and processing, and compatibility with continuous culturing.
Concluding Remarks
[0291] We have in this work used the sub-Arctic bacterium A. wodanis as an expression host for “difficult-to-express” enzymes. Basic characterization of twelve strains suggests that several strains are useful and that strain 03/09/160 is particularly suitable for expression, and by using RNA-sequencing we revealed that a 60-nt/20-aa sequence of the most highly expressed gene can be used as a 5′-fusion to enhance expression of the downstream fusion partner. Three reporter systems and six enzymes were expressed at low temperature, the activity of two of the enzymes was confirmed by molecular beacon-based assays.
[0292] We have also found that a 60-nt/20-aa sequence of the most highly expressed gene in A. wodanis can be used as a 5′-fusion to enhance expression of the downstream fusion partner in a non-Aliivibrio species, E. coli.
[0293] We have also found that a 75 nucleotide (nt)/25 amino acid (aa) sequence of the most highly expressed gene in A. wodanis can be used as a 5′-fusion to enhance expression and secretion of a protein from bacterial cells.
[0294] The global market for specialty enzymes is continuously growing, driven e.g., by the demand in the pharmaceutical industry, development of novel high-value enzymes, advancements in the biotechnology industry, the continued need for cost-efficient manufacturing process, and calls for greener technologies. One major driver is an increasing demand for new enzymes that work efficiently at low temperatures, due to the growing need for cleaner and greener technology to preserve the environment. This work contributes to the development of useful biotechnology tools to unlock further potential in developments in protein expression systems, e.g. for the expression of cold-adapted enzymes, and possibly other unstable products, e.g., immunoglobulin fragments.
Materials and Methods
Bacterial Strains and Growth Conditions
[0295] Twelve A. wodanis strains used in this study are listed in Table 1. Bacteria were revived from −80° C. by transferring frozen cells onto Blood agar or Marine agar plates, and placing them at 12° C. for 24-48 hours. After reviving, the cells were grown in LB (Lysogeny Broth) supplemented with 2.5% NaCl liquid cultures (LB +2.5% NaCl) for one week at 12° C., or two weeks at 4° C. Growth temperature was 12° C. (standard), except for one experiment where expression of AsExoI was tested at 4 and 12° C., and during conjugative transfer of plasmids from E. coli cc118 λpir to A. wodanis where bacteria were grown in standard LB at 37° C. Plasmid-carrying A. wodanis strains were always freshly made by conjugation before experiments (not revived from −80° C.).
Antibiotic Resistance Test
[0296] Antibiotic susceptibility testing was done by streaking A. wodanis cells onto LB plates supplemented with 2.5% NaCl and one of the following antibiotics: Chloramphenicol (2 μg/mL, Tetracycline (10 μg/mL), Carbenicillin (100 or 200 μg/mL) or Kanamycin (50 or 100 μg/mL). A. wodanis was regarded as susceptible (score=0) if no growth was detected, as intermediate susceptible (score=0.5) if poor growth was detected, or as resistant (score=1) if good growth was detected. The tested concentrations of antibiotics were similar to the recommended working concentrations for E. co/i, except Chloramphenicol that was tested at 2 μg/mL (instead of 25 μg/mL). If the test scored as “resistant”, then the test was redone using 2× of the recommended concentration. All A. wodanis strains were streaked onto same agar plate and grown at 12° C. for 2 days.
Conjugation and Plasmid Uptake Test
[0297] The capacity of A. wodanis to receive conjugative plasmids was tested using a tri-parental mating approach. E. coli CC118 λpir (pEVS104) (Stabb and Ruby, 2002) as helper strain and E. coli CC118 λpir (pTM214) (Miyashiro et al., 2011) was used as donor. E. coli strains were grown to OD.sub.600 0.5-0.7 in LB medium with kanamycin (50 μg/mL) and chloramphenicol (20 μg/mL), respectively, at 37° C. “The recipient” A. wodanis was grown to OD.sub.600=1-2 in 3 mL LB supplemented with 2.5% NaCl at 12° C. One mL of each bacteria were next pelleted and resuspended in LB medium to original volume. After a second centrifugation and resuspension, 500 μL of donor, helper and recipient bacteria were mixed and pelleted by centrifugation. The supernatant was removed and the pellet was resuspended in a small volume of residual LB medium (approx. 20 μL). The bacterial mix was spotted on an LB agar plate with 1% NaCl and incubated at 16° C. Conjugates with replicating vectors (in this case pTM214) were incubated for 24 hours, whereas those with integrating vectors (pNQ705) were incubated for 48 hours. The plasmids pTM214 and pNQ705 each carry a chloramphenicol resistance gene. After incubation, bacteria were resuspended in LB with 2.5% NaCl, spread on LB agar with 2.5% NaCl, containing 2 μg/mL chloramphenicol and incubated at 12° C. for 3 days. E. coli do not grow under these conditions. The number of colonies on agar plates were finally counted to assess the efficiency of DNA uptake. Plasmids were routinely transferred into A. wodanis as described above for pTM214 or pNQ705.
Cloning
[0298] The pPSY001 plasmid was constructed by first PCR-amplifying a region from the pETZZ-1A vector containing the promoter and His-ZZ-GFP using the oligonucleotides 1F_T7term (ATTAGGTACCCGCCGCGCTTAAT (SEQ ID NO: 43)) and 2R T7LacO (TAATGCATGCGAAATTAATACGACT (SEQ ID NO:44)). The PCR product was treated with restriction enzymes KpnI and SphI, and ligated into pVSV105 pretreated with KpnI and SphI. The ligation mix was incubated at RT for 1 hour and transformed into E. coli CC118 λpir.
[0299] For test expression, genes of interest were PCR-amplified using primer pairs and a gateway plasmid (pET151/TEV/D-TOPO or pENTR/TEV/TOPO) containing the target gene as the template. Amplified DNA was inserted into vector (pTM214) using Fast cloning technique, according to protocol (Li et al., 2011). Primers and the resulting plasmids are shown in Table 3 and Table 4. Table 4 indicates that pTM214 contains a mCherry gene. When pTM214 was used as a vector for other genes, the mCherry gene was not present (i.e. it was replaced by the other gene). Non-Aliivibrio test cases were expressed with or without a 5′ fusion partner (DNA sequence: 5′-ATGAGTAAGC AAATGAAGTT TGGACTTCTT CCAGCAGCGA TCGCTGGTGC ATTACTGAGC-3′ (SEQ ID NO:2)) originating from A. wodanis 03/09/160 gene Awod_I1781. The polynucleotide sequence of SEQ ID NO:2 encodes the amino acid sequence of SEQ ID NO:1.
Super Folder GFP (sfGFP) Constructs
[0300] Superfolder GFP (sfGFP) (Pedelacq et al., 2006) was ordered as a synthetic construct including N-terminal TEV-site (for later fusion-proteins) and C-terminal His-tag (GeneArt Strings from Thermo Fisher), and cloned into vector pTM214 using FastCloning. The resultant plasmid is named pTM214_sfGFP.
[0301] Another plasmid (pTM214_174 ss_sfGFP) was also constructed which is analogous to pTM214_sfGFP, but has a 25 amino acid peptide (SEQ ID NO:4) fused N-terminally with respect to the sfGFP (i.e. the sfGFP is encoded as a fusion protein, with the 25 amino acid peptide of SEQ ID NO:4 located at the N-terminal end of the sfGFP). The 25 amino acid peptide of SEQ ID NO:4 is encoded by the nucleotide sequence of SEQ ID NO:5. Plasmid pTM214_174 ss_sfGFP was also generated using FastCloning.
Recombinant Expression and Purification of his-GFP
[0302] A. wodanis 03/09/160, containing pPSY001, was grown in 15 ml cultures (LB with 2.5% NaCl and 2 μg/mL chloramphenicol) at 4° C. and 12° C. GFP was expressed for six days at 4° C. and two days at 12° C. One mL of culture was pelleted and lysed in 100 μL BugBuster (MerckMillipore) according to the manufacturer's protocol, incubated at room temperature for 30 minutes and finally pelleted. 50 μL of supernatant was used to measure GFP fluorescence in a Spectramax Gemini (Molecular Devices) spectrophotometer at wavelength 485-538 nm.
[0303] Similarly, GFP was expressed from the pTM214-His-GFP vector by adding different concentrations of IPTG in range from 0.05-0.5 mM. Culture was grown in LB+2.5% NaCl, for 6 days at 12° C.
Recombinant Expression and Purification of Test Cases
[0304] Test-case proteins were expressed in A. wodanis from their respective plasmids (see Table 4) by growing the bacterium in 1 L LB supplemented with 2.5% NaCl, 2 μg/ml chloramphenicol and 100 mM IPTG for 3 days at 12° C. Cells were then spun down (6,000 rpm, 30 min, 12° C.) and lysed in 30 mL lysis buffer (50 mM Tris pH 8.0, 750 mM NaCl, and 5% (v/v) glycerol) supplemented with 1× Complete protease inhibitor cocktail (Roche) and 1 U/μL HL/SAN DNase (ArcticZymes). The cells were disrupted using a cell disruptor (Constant Systems, Ltd.) at 1.38 kbar in four cycles. The lysate was cleared by centrifugation at 20,000×g for 30 min at 4° C. Affinity purification of test proteins was carried out on a 5 mL HisTrap HP column (GE Healthcare) equilibrated with buffer A (50 mM Tris pH 8.0, 750 mM NaCl, 5% (v/v) glycerol and 10 mM imidazole) using an ÅKTA purifier (GE Healthcare). The bound protein was eluted across a gradient of 0-100% buffer B (50 mM Tris pH 8.0, 750 mM NaCl, 5% (v/v) glycerol and 500 mM imidazole). The purity of the protein was evaluated by SDS-PAGE and the identity of proteins was verified using a Tandem mass spectrometry (MS-MS) service at the Tromso University Proteomics Platform (TUPP).
[0305] Moritella viscosa exonucleasel (MvExoI) was expressed in E. coli strain DH5αλpir. Briefly, overnight cultures of E. coli harboring vector were diluted 1:100 in LB medium containing 34 μg/ml chloramphenicol and grown to an OD600 of 0.7-1 at 37° C. Cultures were then transferred to 15° C. and further incubated over-night. Cultures were pelleted, followed by sonication. Soluble proteins were analyzed on SDS-PAGE. The presence of MvExoI was verified by mass spectrometry.
Enzyme Activity Assays
[0306] The two enzyme activity assays used in this work are both based on so-called “molecular beacons”. Each “molecular beacon” consists of a hairpin shaped DNA oligonucleotide with an internally quenched fluorophore (in this case FAM). TAMRA was used as the FAM quencher. Enzyme activity of affinity purified AsExoI and MvExoI were tested in 50 μL reactions containing the following: 0.2 μM ssDNA “molecular beacon” substrate (5′-FAM-CGCCATCGGAGGTTC-TAMRA-3′ (SEQ ID NO:45)), 50 mM Tris pH 8.5, 30 mM MgCl.sub.2, 1 mM DTT, 0.2 mg/ml BSA, 2% glycerol and 8.5 nM enzyme (Exonuclease I). The reaction was carried out in a black 96-well fluorescence assay plate (Cornine), and increase in FAM fluorescence (excitation at 485 nm, emission at 518 nm) was measured as relative fluorescence units (RFU) at appropriate time intervals for 40 min.
[0307] Activity assay for AsPoIII is based on a molecular beacon probe (5″-GGCCCGT.sup.DabcylAGGAGGAAAGGACATCTTCTAGCAT.sup.FAMACGGGCCGTCAAGTT CATG GCCAGTCAAGTCGTCAGAAATTTCGCACCAC-3′ (SEQ ID NO:46)) (modified from Summerer, 2008). The molecular beacon probe consists of a 23mer loop that is connected by a GC-rich 8mer stem region (the 8-mer stem region consists of two 8 nucleotide sequences-sequences are indicated in italics) and a 43mer extension. The fluorophores Dabcyl and FAM are attached to the indicated “T” nucleotides. Due to the loop formation the fluorophores Dabcyl and FAM are in close proximity and thus quenched. Upon extension by the DNA polymerase I of the primer (5″-GTGGTGCGAAATTTCTGAC-3′ (SEQ ID NO:47)) that is annealed to the molecular beacon template the stem is opened and the increase in distance of the two fluorophores is measured by the restoration of FAM fluorescence (excitation 485 nm, emission 518 nm). Assay was monitored in 50 μL reactions containing 0.2 μM substrate (molecular beacon) mixed with 0.2 mM dNTP in 1× reaction buffer (250 mM Tris-HCl, pH 8.5, 250 mM, KCl, 25 mM MgCl.sub.2) and 1×DB (1 mg/ml BSA, 5 mM DTT, 10% glycerol). The mixture was first incubated at 25° C. for 5 min, and the reaction was started by adding the purified enzyme. Increase in fluorescence was measured (excitation 485 nm, emission 518 nm) for 15 min with 10 sec intervals (total of 91 reads). All measurements were done in Corning black 96-well plate (Sigma Aldrich, CLS3991-25EA).
Isolation of Proteins in Growth Media for SDS-PAGE
[0308] A. wodanis 03/09/160 was grown in a media with 5 g yeast extract, 25 g NaCl and 10 g casamino acids. This media does not contain any high molecular weight protein when analysed on SDS-PAGE. The strain was grown for 48 h reaching OD.sup.600=2. The culture was spun down and the supernatant was sterile filtered through a 0.45 μM filter. The spent growth media was then up-concentrated 5 times using a spin filter with 3K cut-off, to a protein concentration of 6.3 mg/ml.
[0309] The concentrated growth media was analyzed on SDS-PAGE and the protein was identified Tandem mass spectrometry (MS-MS) service at the Tromso University Proteomics Platform (TUPP).
Isolation of Periplasmic Proteins
[0310] A culture of A. wodanis was centrifuged and the pellet was resuspended in a volume corresponding 1/10 of the original volume in periplasmic lysis buffer (0.2M Tris-HCl pH 8.0, 200 g/I sucrose and 0.1M EDTA). The suspension was incubated on ice for 20 minutes followed by centrifugation. The supernatant contained periplasmic proteins (a second step with MgCl.sub.2 resulted in complete lysis of the cells).
Quantification of sfGFP in Growth Media and Periplasm
[0311] A. wodanis 03/09/160 with or without vector containing sfGFP was grown in standard conditions in presence for IPTG for 48 h. The fluorescence was determined using a Spektramax photometer (ex 485 nm, em 525 nm) in the following samples: 100 μl whole culture (media with cells), 100 μl supernatant, and 50 μl of the periplasmic fraction (prepared as above).
RNA Sequencing, Genome Sequencing and Bioinformatics Analyses
[0312] To find the most highly expressed genes A. wodanis 03/09/160 was first grown at standard growth conditions (LB supplememnted with 2.5% NaCl) and harvested at OD.sub.600 nm=2 (exponential phase). After cultivation, total RNA was purified from cell pellets using the Masterpure complete DNA & RNA purification kit (Epicentre) following the manufacturer's protocol. The RNA quality was then determined using a Bioanalyzer and a Prokaryote Total RNA Pico Chip (Agilent Technologies). 5 μg total RNA was then used in Ribo-Zero rRNA Removal Kit (bacteria) (Epicentre) according to manufacturer instructions to remove ribosomal (r) RNA. rRNA-depleted RNA samples were ethanol precipitated, and analyzed on a Bioanalyzer using mRNA Pico Chips (Agilent Technologies). RNA-sequencing libraries were generated from rRNA-depleted RNA samples using the ScriptSeq Complete library prep kit (Illumina) in combination with library size selection using a Pippin Prep cassette (Sage Science). The size selected cDNA library was sequenced with MiSeq Reagent Kit v3 with 2×75 bp read length over 150 cycles, generating 25 mill reads and 3.75 Gb.
[0313] Reads were quality checked using FastQC. Further analysis of the RNA-Seq data was performed using a Galaxy pipeline consisting of EDGE-pro v1.0.1 (Estimated Degree of Gene Expression in Prokaryotes) and DESeq, to align the reads to the A. wodanis 03/09/160 genome, and estimate gene expression value as “baseMean” (mean expression level across all replicates).
Genome Sequencing
[0314] Total DNA was isolated from A. wodanis 03/09/160 grown at standard conditions to stationary phase using Genomic-tip 100/g (Qiagen) according to the manufacturer protocol.
[0315] The final DNA concentration and quality were measured using a Nanodrop 2000c (Thermo Scientific) instrument, and the integrity of high molecular weight DNA was examined on a 1% agarose gel. Genomic DNA was sequenced at the Norwegian Sequencing Centre (NSC) using PacBio technology platform. Libraries were constructed using PacBio 20 kb library preparation protocol. Size selection of the final library was performed using BluePippin with a 7 kb cut-off. Libraries were sequenced on Pacific Biosciences RS II instrument using P6-C4 chemistry with 360 min movie time. PacBio reads were assembled using HGAP v3 (Chin et al., 2013), and Minimus2 (Sommer et al., 2007) was used to circularize contigs. RS_Resequencing.1 software (SMRT Analysis version v2.3.0) was used to map reads back to assembled and circularized sequence in order to correct sequence after circularization.
REFERENCES
[0316] 1. T. Miyashiro et al., The N-acetyl-D-glucosamine repressor NagC of Vibrio fischeri facilitates colonization of Euprymna scolopes. Mol Microbiol 82, 894-903 (2011). [0317] 2. D. L. Milton, R. O'Toole, P. Horstedt, H. Wolf-Watz, Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol 178, 1310-1319 (1996). [0318] 3. A. K. Dunn, D. S. Millikan, D. M. Adin, J. L. Bose, E. V. Stabb, New rfp- and pES213-derived tools for analyzing symbiotic Vibrio fischeri reveal patterns of infection and lux expression in situ. Applied and environmental microbiology 72, 802-810 (2006). [0319] 4. C. Li et al., FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method. BMC biotechnology 11, 92 (2011). [0320] 5. E. V. Stabb, E. G. Ruby, in Methods in enzymology. (Elsevier, 2002), vol. 358, pp. 413-426. [0321] 6. T. Miyashiro et al., The N-acetyl-d-glucosamine repressor NagC of Vibrio fischeri facilitates colonization of Euprymna scolopes. Molecular microbiology 82, 894-903 (2011). [0322] 7. C.-S. Chin et al., Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nature methods 10, 563-569 (2013). [0323] 8. D. D. Sommer, A. L. Delcher, S. L. Salzberg, M. Pop, Minimus: a fast, lightweight genome assembler. BMC bioinformatics 8, 64 (2007). [0324] 9. Summerer D, (2008) DNA polymerase profiling. Methods Mol Biol. 429:225-35. [0325] 10. Petersen T N, Brunak S, von Heijne G, Nielsen H: SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature methods 2011, 8:785. [0326] 11. Aronson D E, Costantini L M, Snapp E L: Superfolder GFP is fluorescent in oxidizing environments when targeted via the Sec translocon. Traffic 2011, 12. [0327] 12. Zhang Z, Tang R, Zhu D, Wang W, Yi L, Ma L: Non-peptide guided auto-secretion of recombinant proteins by super-folder green fluorescent protein in Escherichia coli. Sci Rep 2017, 7:6990. [0328] 13. Pedelacq J D, Cabantous S, Tran T, Terwilliger T C, Waldo G S: Engineering and characterization of a superfolder green fluorescent protein. Nat Biotechnol 2006, 24.
TABLE-US-00010 TABLE 1 Properties associated with A. wodanis strains used in this study Antibiotics resistance.sup.3 CHL TET CAR CAR KAN KAN Strain Origin.sup.1 GenBank.sup.2 2 μg/mL 10 μg/mL 100 μg/mL 200 μg/mL 50 μg/mL 100 μg/mL 06/09/139 S. salar GCA_000953695.1 NA NA NA NA NA NA 89/09/5532 (1) S. salar JQ361718 0 0 1 1 1 0.5 90/09/325 (5) S. salar JQ361719 0 0 1 1 1 0.5 02/09/569 (7) S. salar JQ361720 0 0 1 1 1 0.5 02/09/382 (8) S. salar JQ361721 0 0 1 1 1 0.5 01/09/401 (11) S. salar JQ361722 0 0 1 1 1 0.5 88/09/441 (12) (T) S. salar JQ361723 0 0 0.5 0.5 1 0.5 06/09/170 (27) S. salar JQ361727 0 0 1 1 0.5 0.5 06/09/178 (29) O. mykiss JQ361731 0 0 1 1 1 0.5 04/60/17347 (35) G. morhua JQ361730 0 0 1 1 1 0.5 03/09/160 (37) S. salar JQ361729 0 0 1 1 1 0.5 K7F1 150913 S. salar — 0 0 1 1 1 0.5 .sup.1S. salar = Salmo salar (Atlantic salmon); O. mykiss = Oncorhynchus mykiss (Rainbow trout); G. morhua = Gadus morhua(Atlantic cod); .sup.2GenBank accession numbers. The accession number for strain 06/09/139 refers to the genome assembly. The “JQ” Accession numbers are the accession numbers for rRNA genes. .sup.3CHL = chloramphenicol; TET = Tetracycline; CAR = Carbenicillin; KAN = Kanamycin. 0 = Susceptible, 0.5 = Intermediate Susceptible; 1 = Resistant. Abbreviations for antibiotics follow that of the American Society for Microbiology. NA = Not analysed.
TABLE-US-00011 TABLE 2 Top-ten most highly expressed genes in A. wodanis 03/09/160. Gene nr. Product Base mean Awod_I1781 Unknown 212918.07 Awod_I1528 Phosphoenolpyruvate carboxykinase [ATP] - 97425.05 Phosphoenolpyruvate carboxylase Awod_I1596 ATP synthase subunit beta - ATP synthase 69249.87 F1sector subunit beta - F-ATPase subunit beta Awod_I831 30S ribosomal protein S1 51427.88 Awod_I1398 50S ribosomal protein L16 45942.99 Awod_I1369 Immunogenic protein 42958.71 Awod_I1598 ATP synthase subunit alpha - ATP synthase 40648.19 F1sector subunit alpha - F-ATPase subunit alpha Awod_I1381 DNA-directed RNA polymerase subunit 37931.23 alpha - RNApolymerase subunit alpha - Transcriptase subunit alpha Awod_I2484 Alanine dehydrogenase 33312.94 Awod_I1407 Elongation factor Tu 30288.95
TABLE-US-00012 TABLE 3 Oligonucleotides used in this study No..sup.1 Name Sequence (5′-3′) O1 pTM214_2R GTCGACCTGCAGGCATGC O2 pTM14_2F GGTGAAGGGATCAATTCCCT O3 pTM214_1F CATGCTTAATTTCTCCTCTTTAATTAGATCC O4 A.s_exoI_F GGAGAAATTAAGCATGATGCATCATCACCATCACCATGGT O5 A.s exoI_ R ATGCCTGCAGGTCGACTCATGATACTAACTGTTGTACGTA O6 A.s_polII_F GGAGAAATTAAGCATGATGCATCATCACCATCACCATGGT O7 A.s_polII_ R ATGCCTGCAGGTCGACTTAGAATAGACCTAATTGAGAAGC O8 GFP_F AATTGATCCCTTCACCATGGGCAAAGTGAGCAAGGGCGAG O9 GFP_R ATGCCTGCAGGTCGACCTTGTACAGCTCGTCCATGCCGAG O10 v_pTM214_changeP_F GATCTCTGCAGTACCTGTGA O11 v_pTM214_changeP_R ATGCATCATCACCATCACCATG O12 i_1781p_F AGGTACTGCAGAGATCTTTACTGATAAAATGGTCATTTAT O13 i_1781p_R GATGGTGATGATGCATTATTTTTATCTCCAAATATATATT O14 V_5_1781_F GCTGCTGGAAGAAGTcCAAACTTCATTTGCTTACTCATGCTTAATTTCTCCTCTTTAAT O15 V_5_1781_R GACTTCTTCCAGCAGCGATCGCTGGTGCATTACTGAGCTTTCAGGGAATTGATCCCTTCC O16 His_tag_F ATGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGCC O17 His_tag_R CATCATCACCATCACCATTAACGACCTGCAGGCATGCAAGCTT O18 v_5his_F GCTCAGTAATGCACCAGCGATCGC O19 v_5his_R CATCATCACCATCACCATTAAGTC O20 i_5his_L6_F TGGTGCATTACTGAGCCAGCAGACCACCCAGAAAACACAG O21 i_5his_L6_R GGTGATGGTGATGATGTTAGCCGCTTGCTTTAATACGCCA O22 i_5his_strepADH_F TGGTGCATTACTGAGCGGTCGTGCAGTTGTGTTTGAAGAA O23 t_5his_strepADH_R GGTGATGGTGATGATGTGCACCATCAGGATGCGGACGACG O24 i_5his_MvExo_F TGGTGCATTACTGAGCGATAACAATTCGAACAAAAGAGCA O25 i_5his_MvExo_R GGTGATGGTGATGATGTGCGCCAATTATTTTTTGACCATA O26 i_5his_Halo_F TGGTGCATTACTGAGCGGTGATAGCACCATGCGTGCAGCA O27 1_5his_Halo_R GGTGATGGTGATGATGGGCCATATCCAGAACAATACGACC O28 i_5his_L1_F TGGTGCATTACTGAGCCAGTTTAGCGTTCTGGCAGGTAGC O29 i_5his_L1_R GGTGATGGTGATGATGAACACCAGGCTGACCATCCGGCAC O30 M.v_exoI_F AATTGATCCCTTCACCATGGATAACAATTCGAACAAAACA O31 M.v_exoI_R ATGCCTGCAGGTCGACTTATGCGCCAATTATTTTTTGACC .sup.1Oligonucleotide number
[0329] The oligonucleotide numbers in Table 3 correspond to the following SEQ ID NOs: O1=SEQ ID NO:6; O2=SEQ ID NO:7; O3=SEQ ID NO:8; O4=SEQ ID NO:9; O5=SEQ ID NO:10; O6=SEQ ID NO:11; O7=SEQ ID NO:12; O8=SEQ ID NO:13; O9=SEQ ID NO:14; O10=SEQ ID NO:15; O11=SEQ ID NO:16; O12=SEQ ID NO:17; O13=SEQ ID NO:18; O14=SEQ ID NO:19; O15=SEQ ID NO:20; O16=SEQ ID NO:21; O17=SEQ ID NO:22; O18=SEQ ID NO:23; O19=SEQ ID NO:24; O20=SEQ ID NO:25; O21=SEQ ID NO:26; O22=SEQ ID NO:27; O23=SEQ ID NO:28; O24=SEQ ID NO:29; O25=SEQ ID NO:30; O26=SEQ ID NO:31; O27=SEQ ID NO:32; O28=SEQ ID NO:33; O29=SEQ ID NO:34; O30=SEQ ID NO:35; O31=SEQ ID NO:36.
TABLE-US-00013 TABLE 4 Plasmids used in this study Vector Plasmid Vector Insert Plasmid namd No..sup.1 Relevant description backbone oligos .sup.2 oligos .sup.3 Ref. .sup.4 pTM214 V1 Carries P.sup.trc followed by [1] mCherry gene pNQ705 V2 Suicide vector. Carries [2] Cm.sup.r, pir for replicaiton. pVSV208 V3 Carries Cm.sup.r, rfp [3] pTM214_His-GFP V4 pTM214 carries N-term V5 O1 + O2 O8 + O9 This work His-tag gfp pTM214_AsExoI V5 pTM214 carries V1 O1 + O3 O4 + O5 This work ExonucleaseI from Aliivibrio salmonicida pTM214_AsPolII V6 pTM214 carries DNA V1 O1 + O3 O6 + O7 This work PolII from Aliivibrio salmonicida pTM214_P1781_GFP V7 pTM214 carries 300 bp V4 O1 + O11 O12 + O13 This work Awod_I1781 promoter/gfp pTM214_5′1781GFP-His V8 pTM214 carries 20-aa fusion/ V4 O14 + O17 O15 + O16 This work gfp/C-term His-tag. pTM214_5′1781_CsLig1 V9 pTM214 carries 20-aa fusion/ V8 O18 + O19 O28 + O29 This work Ligase1 from Cenarchaeum symbiosum/ C-term His-tag pTM214_5′1781_CpLig6 V10 pTM214 carries 20-aa fusion/ V8 O18 + O19 O20 + O21 This work Ligase6 from Colwellia psychrerythraea/ C-term His-tag pTM214_5′1781_MvExoI V11 pTM214 carries 20-aa fusion/ V8 O18 + O19 O24 + O25 This work ExonucleaseI from Moritella viscosa/ C-term His-tag pTM214_5′1781_AdhStrep V12 pTM214 carries 20-aa fusion/ V8 O18 + O19 O26 + O27 This work alkoholdehydrogenase from Streptomyces/ C-term His-tag pPSY001 V13 pVSV105 carries His-ZZ-gfp This work pTM214_MvExoI V14 pTM214 carries N-term His/ V4 O1 + O2 O30 + O31 This work ExonucleaseI from Moritella viscosa/ C-term His-tag pTM214_P1781_MvExoI V15 pTM214 carries 300 bp V7 O1 + O2 O30 + O32 This work Awod_I1781 promoter/ N-term His/ExonucleaseI from Moritella viscosa .sup.1Vector number. .sup.2 Oligonucleotides used for amplification of vector backbone during Fast cloning. Oligonucleotides are listed in Table 3. .sup.3 Oligonucleotides used for amplification of insert (target gene) during Fast cloning. Oligonucleotides are listed in Table 3. .sup.4 References. [1] Miyashiro et al. 2011, [2] Milton et al. 1992, [3] Dunn et al. 2006.