METHODS AND COMPOSITIONS FOR PRODUCING HYDROCARBONS

20210040514 ยท 2021-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

Compositions and methods for producing aldehydes, alkanes, and alkenes are described herein. The aldehydes, alkanes, and alkenes can be used in biofuels.

Claims

1. A method of producing a hydrocarbon, the method comprising producing in a host cell a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36, or a variant thereof, and isolating the hydrocarbon from the host cell.

2. A method of producing a hydrocarbon, the method comprising producing in a host cell a polypeptide comprising an amino acid sequence having at least about 70% identity to SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36, and isolating the hydrocarbon from the host cell.

3. A method of producing a hydrocarbon, the method comprising producing in a host cell a polypeptide comprising the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 with one or more amino acid substitutions, additions, insertions, or deletions, wherein the polypeptide has decarbonylase activity.

4.-43. (canceled)

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0137] FIG. A is a GC/MS trace of hydrocarbons produced by Prochlorococcus marinus CCMP1986 cells. FIG. 1B is a mass fragmentation pattern of the peak at 7.55 min of FIG. 1A.

[0138] FIG. 2A is a GC/MS trace of hydrocarbons produced by Nostoc punctiforme PCC73102 cells. FIG. 2B is a mass fragmentation pattern of the peak at 8.73 min of FIG. 2A.

[0139] FIG. 3A is a GC/MS trace of hydrocarbons produced by Gloeobaceter violaceus ATCC29082 cells. FIG. 3B is a mass fragmentation pattern of the peak at 8.72 min of FIG. 3A.

[0140] FIG. 4A is a GC/MS trace of hydrocarbons produced by Synechocystic sp. PCC6803 cells. FIG. 4B is a mass fragmentation pattern of the peak at 7.36 min of FIG. 4A.

[0141] FIG. 5A is a GC/MS trace of hydrocarbons produced by Synechocystis sp. PCC6803 wild type cells. FIG. 5B is a GC/MS trace of hydrocarbons produced by Synechocystis sp. PCC6803 cells with a deletion of the sll0208 and sll0209 genes.

[0142] FIG. 6A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 wild type cells. FIG. 6B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65).

[0143] FIG. 7 is a GC/MS trace of hydrocarbons produced by E. coli cells expressing Cyanothece sp. ATCC51142 cce_1430 (YP_001802846) (SEQ ID NO:69).

[0144] FIG. 8A is a GC/MS trace of hydrocarbons produced by E. coli cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Synechococcus elongatus PCC7942 YP_400610 (Synpcc7942_1593) (SEQ ID NO:1). FIG. 8B depicts mass fragmentation patterns of the peak at 6.98 min of FIG. 8A and of pentadecane. FIG. 8C depicts mass fragmentation patterns of the peak at 8.12 min of FIG. 8A and of 8-heptadecene.

[0145] FIG. 9 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:5).

[0146] FIG. 10 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Synechocystis sp. PCC6803 sll0208 (NP_442147) (SEQ ID NO:3).

[0147] FIG. 11 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Nostoc sp. PCC7210 alr5283 (NP_489323) (SEQ ID NO:7).

[0148] FIG. 12 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Acaryochloris marina MBIC11017 AM1_4041 (YP_001518340) (SEQ ID NO:46).

[0149] FIG. 13 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Thermosynechococcus elongatus BP-1 tll1313 (NP_682103) (SEQ ID NO:47).

[0150] FIG. 14 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Synechococcus sp. JA-3-3Ab CYA_0415 (YP_473897) (SEQ ID NO:48).

[0151] FIG. 15 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Gloeobacter violaceus PCC7421 gll3146 (NP_926092) (SEQ ID NO:15).

[0152] FIG. 16 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Prochlorococcus marinus MIT9313 PMT1231 (NP_895059) (SEQ ID NO:49).

[0153] FIG. 17 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Prochlorococcus marinus CCMP1986 PMM0532 (NP_892650) (SEQ ID NO:19).

[0154] FIG. 18 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Prochlorococcus mariunus NATL2A PMN2A_1863 (YP_293054) (SEQ ID NO:51).

[0155] FIG. 19 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Synechococcus sp. RS9917 RS9917_09941 (ZP_01079772) (SEQ ID NO:52).

[0156] FIG. 20 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and codon-optimized Synechococcus sp. RS9917 RS9917_12945 (ZP_01080370) (SEQ ID NO:53).

[0157] FIG. 21 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Cyanothece sp. ATCC51142 cce_0778 (YP_001802195) (SEQ ID NO:27).

[0158] FIG. 22 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Cyanothece sp. PCC7425 Cyan7425_0398 (YP_002481151) (SEQ ID NO:29).

[0159] FIG. 23 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Cyanothece sp. PCC7425 Cyan7425_2986 (YP_002483683) (SEQ ID NO:31).

[0160] FIG. 24A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Prochlorococcus marinus CCMP1986 PMM0533 (NP_892651) (SEQ ID NO:71). FIG. 24B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Prochlorococcus marinus CCMP1986 PMM0533 (NP_892651) (SEQ ID NO:71) and Prochlorococcus mariunus CCMP1986 PMM0532 (NP_892650) (SEQ ID NO:19).

[0161] FIG. 25A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD cells. FIG. 25B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD cells expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Acaryochloris marina MBIC11017 AM1_4041 (YP_001518340) (SEQ ID NO:9).

[0162] FIG. 26A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD cells expressing Synechocystis sp. PCC6803 sll0209 (NP_442146) (SEQ ID NO:67). FIG. 26B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD cells expressing Synechocystis sp. PCC6803 sll0209 (NP_442146) (SEQ ID NO:67) and Synechocystis sp. PCC6803 sll0208 (NP_442147) (SEQ ID NO:3).

[0163] FIG. 27A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadD lacZ::P.sub.trc-tesA cells expressing M. smegmatis strain MC2 155 MSMEG_5739 (YP_889972) (SEQ ID NO:85). FIG. 27B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 fadD lacZ::P.sub.trc-tesA cells expressing M. smegmatis strain MC2 155 MSMEG_5739 (YP_889972) (SEQ ID NO:85) and Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:5).

[0164] FIG. 28 is a graphic representation of hydrocarbons produced by E. coli MG1655 fadD lacZ::P.sub.trc-tesA cells expressing M. smegmatis strain MC2 155 MSMEG_5739 (YP_889972) (SEQ ID NO:85) either alone or in combination with Nostoc sp. PCC7120 alr5283 (SEQ ID NO:7), Nostoc punctiforme PCC73102 Npun02004178 (SEQ ID NO:5), P. mariunus CCMP1986 PMM0532 (SEQ ID NO:19), G. violaceus PCC7421 gll3146 (SEQ ID NO:15), Synechococcus sp. RS9917_09941 (SEQ ID NO:23), Synechococcus sp. RS9917_12945 (SEQ ID NO:25), or A. marina MBIC11017 AM1_4041 (SEQ ID NO:9).

[0165] FIG. 29A is a representation of the three-dimensional structure of a class I ribonuclease reductase subunit protein, RNR. FIG. 29B is a representation of the three-dimensional structure of Prochlorococcus marinus MIT9313 PMT1231 (NP_895059) (SEQ ID NO:17). FIG. 29C is a representation of the three-dimensional structure of the active site of Prochlorococcus marinus MIT9313 PMT1231 (NP_895059) (SEQ ID NO:17).

[0166] FIG. 30A is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:5). FIG. 30B is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) Y123F variant. FIG. 30C is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) Y126F variant.

[0167] FIG. 31 depicts GC/MS traces of hydrocarbons produced in vitro using Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:6) and octadecanal (A); Npun02004178 (ZP_00108838) (SEQ ID NO:6), octadecanal, spinach ferredoxin reductase, and NADPH (B); octadecanal, spinach ferredoxin, spinach ferredoxin reductase, and NADPH (C); or Npun02004178 (ZP_00108838) (SEQ ID NO:6), spinach ferredoxin, and spinach ferredoxin (D).

[0168] FIG. 32 depicts GC/MS traces of hydrocarbons produced in vitro using Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:6), NADPH, octadecanal, and either (A) spinach ferredoxin and spinach ferredoxin reductase; (B) N. punctiforme PCC73102 Npun02003626 (ZP_00109192) (SEQ ID NO:88) and N. punctiforme PCC73102 Npun02001001 (ZP_00111633) (SEQ ID NO:90); (C) Npun02003626 (ZP_00109192) (SEQ ID NO:88) and N. punctiforme PCC73102 Npun02003530 (ZP_00109422) (SEQ ID NO:92); or (D) Npun02003626 (ZP_00109192) (SEQ ID NO:88) and N. punctiforme PCC73102 Npun2003123 (ZP_00109501) (SEQ ID NO:94).

[0169] FIG. 33A is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66), NADH, and Mg.sup.2+. FIG. 33B is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66), NADPH, and Mg.sup.2+. FIG. 33C is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66) and NADPH.

[0170] FIG. 34A is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, labeled NADPH, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66), and unlabeled NADPH. FIG. 34B is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, labeled NADPH, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66), and S-(4-2H)NADPH. FIG. 34C is a GC/MS trace of hydrocarbons produced in vitro using octadecanoyl-CoA, labeled NADPH, Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:66), and R-(4-2H)NADPH.

[0171] FIG. 35 is a GC/MS trace of hydrocarbons in the cell-free supernatant produced by E. coli MG1655 fadE cells in Che-9 media expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65).

[0172] FIG. 36 is a GC/MS trace of hydrocarbons in the cell-free supernatant produced by E. coli MG1655 fadE cells in Che-9 media expressing Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) and Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838) (SEQ ID NO:5).

[0173] FIG. 37 is a GC/MS trace of hydrocarbons produced by E. coli MG1655 cells expressing Nostoc sp. PCC7120 alr5283 (NP_489323) (SEQ ID NO:7) and Nostoc sp. PCC7120 alr5284 (NP_489324) (SEQ ID NO:81).

[0174] FIG. 38A-38D is a list of examples of homologs of Synechococcus elongatus PCC7942 YP_400610 (Synpcc7942_1593) (SEQ ID NO:1) from a metagenomic database.

[0175] FIG. 39A-39D is a list of examples of homologs of Synechococcus elongatus PCC7942 YP_400611 (Synpcc7942_1594) (SEQ ID NO:65) from a metagenomic database.

[0176] FIG. 40A-40T is a table identifying various genes that can be expressed, overexpressed, or attenuated to increase production of particular substrates.

DETAILED DESCRIPTION

[0177] The invention provides compositions and methods of producing aldehydes, fatty alcohols, and hydrocarbons (such as alkanes, alkenes, and alkynes) from substrates, for example, an acyl-ACP, a fatty acid, an acyl-CoA, a fatty aldehyde, or a fatty alcohol substrate (e.g., as described in PCT/US08/058788, specifically incorporated by reference herein). Such aldehydes, alkanes, and alkenes are useful as biofuels (e.g., substitutes for gasoline, diesel, jet fuel, etc.), specialty chemicals (e.g., lubricants, fuel additive, etc.), or feedstock for further chemical conversion (e.g., fuels, polymers, plastics, textiles, solvents, adhesives, etc.). The invention is based, in part, on the identification of genes that are involved in aldehyde, alkane, and alkene biosynthesis.

[0178] Such alkane and alkene biosynthetic genes include, for example, Synechococcus elongatus PCC7942 Synpcc7942_1593 (SEQ ID NO:1), Synechocystis sp. PCC6803 sll0208 (SEQ ID NO:3), Nostoc punctiforme PCC 73102 Npun02004178 (SEQ ID NO:5), Nostoc sp. PCC 7120 alr5283 (SEQ ID NO:7), Acaryochloris marina MBIC11017 AM1_4041 (SEQ ID NO:9), Thermosynechococcus elongatus BP-1 tll1313 (SEQ ID NO:11), Synechococcus sp. JA-3-3A CYA_0415 (SEQ ID NO:13), Gloeobacter violaceus PCC 7421 gll3146 (SEQ ID NO:15), Prochlorococcus marinus MIT9313 PM123 (SEQ ID NO:17), Prochlorococcus marinus subsp. pastoris str. CCMP1986 PMM0532 (SEQ ID NO:19), Prochlorococcus marinus str. NATL2A PMN2A_1863 (SEQ ID NO:21), Synechococcus sp. RS9917 RS9917_09941 (SEQ ID NO:23), Synechococcus sp. RS9917 RS9917_12945 (SEQ ID NO:25), Cyanothece sp. ATCC51142 cce_0778 (SEQ ID NO:27), Cyanothece sp. PCC7245 Cyan7425DRAFT_1220 (SEQ ID NO:29), Cyanothece sp. PCC7245 cce_0778 (SEQ ID NO:31), Anabaena variabilis ATCC29413 YP_323043 (Ava_2533) (SEQ ID NO:33), and Synechococcus elongatus PCC6301 YP_170760 (syc0050_d) (SEQ ID NO:35). Other alkane and alkene biosynthetic genes are listed in Table 1 and FIG. 38.

[0179] Aldehyde biosynthetic genes include, for example, Synechococcus elongatus PCC7942 Synpcc7942_1594 (SEQ ID NO:65), Synechocystis sp. PCC6803 sll0209 (SEQ ID NO:67), Cyanothece sp. ATCC51142 cce_1430 (SEQ ID NO:69), Prochlorococcus marinus subsp. pastoris str. CCMP1986 PMM0533 (SEQ ID NO:71), Gloeobacter violaceus PCC7421 NP_96091 (gll3145) (SEQ ID NO:73), Nostoc punctiforme PCC73102 ZP_00108837 (Npun02004176) (SEQ ID NO:75), Anabaena variabilis ATCC29413 YP_323044 (Ava_2534) (SEQ ID NO:77), Synechococcus elongatus PCC6301 YP_170761 (syc0051_d) (SEQ ID NO:79), and Nostoc sp. PCC 7120 alr5284 (SEQ ID NO:81). Other aldehyde biosynthetic genes are listed in Table 1 and FIG. 39.

[0180] Using the methods described herein, aldehydes, fatty alcohols, alkanes, and alkenes can be prepared using one or more aldehyde, alkane, and/or alkene biosynthetic genes or polypeptides described herein, or variants thereof, utilizing host cells or cell-free methods.

TABLE-US-00001 TABLE 1 Aldehyde and alkane biosynthetic gene homologs in cyanobacterial genomes Alkane Biosynth. Gene Aldehyde Biosynth. Gene Cyanobacterium accession number % ID accession number % ID Synechococcus elongatus PCC 7942 YP_400610 100 YP_400611 100 Synechococcus elongatus PCC 6301 YP_170760 100 YP_170761 100 Microcoleus chthonoplastes PCC 7420 EDX75019 77 EDX74978 70 Arthrospira maxima CS-328 EDZ94963 78 EDZ94968 68 Lyngbya sp. PCC 8106 ZP_01619575 77 ZP_01619574 69 Nodularia spumigena CCY9414 ZP_01628096 77 ZP_01628095 70 Trichodesmium erythraeum IMS101 YP_721979 76 YP_721978 69 Microcystis aeruginosa NIES-843 YP_001660323 75 YP_001660322 68 Microcystis aeruginosa PCC 7806 CAO90780 74 CAO90781 67 Nostoc sp. PCC 7120 NP_489323 74 NP_489324 72 Nostoc azollae 0708 EEG05692 73 EEG05693 70 Anabaena variabilis ATCC 29413 YP_323043 74 YP_323044 73 Crocosphaera watsonii WH 8501 ZP_00514700 74 ZP_00516920 67 Synechocystis sp. PCC 6803 NP_442147 72 NP_442146 68 Synechococcus sp. PCC 7335 EDX86803 73 EDX87870 67 Cyanothece sp. ATCC 51142 YP_001802195 73 YP_001802846 67 Cyanothece sp. CCY0110 ZP_01728578 72 ZP_01728620 68 Nostoc punctiforme PCC 73102 ZP_00108838 72 ZP_00108837 71 Acaryochloris marina MBIC11017 YP_001518340 71 YP_001518341 66 Cyanothece sp. PCC 7425 YP_002481151 71 YP_002481152 70 Cyanothece sp. PCC 8801 ZP_02941459 70 ZP_02942716 69 Thermosynechococcus elongatus BP-1 NP_682103 70 NP_682102 70 Synechococcus sp. JA-2-3Ba(2-13) YP_478639 68 YP_478638 63 Synechococcus sp. RCC307 YP_001227842 67 YP_001227841 64 Synechococcus sp. WH 7803 YP_001224377 68 YP_001224378 65 Synechococcus sp. WH 8102 NP_897829 70 NP_897828 65 Synechococcus sp. WH 7805 ZP_01123214 68 ZP_01123215 65 uncultured marine type-A Synechococcus GOM 3O12 ABD96376 70 ABD96375 65 Synechococcus sp. JA-3-3Ab YP_473897 68 YP_473896 62 uncultured marine type-A Synechococcus GOM 3O6 ABD96328 70 ABD96327 65 uncultured marine type-A Synechococcus GOM 3M9 ABD96275 68 ABD96274 65 Synechococcus sp. CC9311 YP_731193 63 YP_731192 63 uncultured marine type-A Synechococcus 5B2 ABB92250 69 ABB92249 64 Synechococcus sp. WH 5701 ZP_01085338 66 ZP_01085337 67 Gloeobacter violaceus PCC 7421 NP_926092 63 NP_926091 67 Synechococcus sp. RS9916 ZP_01472594 69 ZP_01472595 66 Synechococcus sp. RS9917 ZP_01079772 68 ZP_01079773 65 Synechococcus sp. CC9605 YP_381055 66 YP_381056 66 Cyanobium sp. PCC 7001 EDY39806 64 EDY38361 64 Prochlorococcus marinus str. MIT 9303 YP_001016795 63 YP_001016797 66 Prochlorococcus marinus str. MIT9313 NP_895059 63 NP_895058 65 Synechococcus sp. CC9902 YP_377637 66 YP_377636 65

[0181] Aldehyde, Alkane, and Alkene Biosynthetic Genes and Variants

[0182] The methods and compositions described herein include, for example, alkane or alkene biosynthetic genes having the nucleotide sequence of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, or 35, as well as polynucleotide variants thereof. In some instances, the alkane or alkene biosynthetic gene encodes one or more of the amino acid motifs described herein. For example, the alkane or alkene biosynthetic gene can encode a polypeptide comprising SEQ ID NO:37, 38, 39, 41, 42, 43, or 44. The alkane or alkene biosynthetic gene can also include a polypeptide comprising SEQ ID NO:40 and also any one of SEQ ID NO:37, 38, or 39.

[0183] The methods and compositions described herein also include, for example, aldehyde biosynthetic genes having the nucleotide sequence of SEQ ID NO:65, 67, 69, 71, 73, 75, 77, 79, or 81, as well as polynucleotide variants thereof. In some instances, the aldehyde biosynthetic gene encodes one or more of the amino acid motifs described herein. For example, the aldehyde biosynthetic gene can encode a polypeptide comprising SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64.

[0184] The variants can be naturally occurring or created in vitro. In particular, such variants can be created using genetic engineering techniques, such as site directed mutagenesis, random chemical mutagenesis, Exonuclease III deletion procedures, and standard cloning techniques. Alternatively, such variants, fragments, analogs, or derivatives can be created using chemical synthesis or modification procedures.

[0185] Methods of making variants are well known in the art. These include procedures in which nucleic acid sequences obtained from natural isolates are modified to generate nucleic acids that encode polypeptides having characteristics that enhance their value in industrial or laboratory applications. In such procedures, a large number of variant sequences having one or more nucleotide differences with respect to the sequence obtained from the natural isolate are generated and characterized. Typically, these nucleotide differences result in amino acid changes with respect to the polypeptides encoded by the nucleic acids from the natural isolates.

[0186] For example, variants can be created using error prone PCR (see, e.g., Leung et al., Technique 1:11-15, 1989; and Caldwell et al., PCR Methods Applic. 2:28-33, 1992). In error prone PCR, PCR is performed under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product. Briefly, in such procedures, nucleic acids to be mutagenized (e.g., an aldehyde or alkane biosynthetic polynucleotide sequence), are mixed with PCR primers, reaction buffer, MgCl.sub.2, MnCl.sub.2, Taq polymerase, and an appropriate concentration of dNTPs for achieving a high rate of point mutation along the entire length of the PCR product. For example, the reaction can be performed using 20 fmoles of nucleic acid to be mutagenized (e.g., an aldehyde or alkane biosynthetic polynucleotide sequence), 30 pmole of each PCR primer, a reaction buffer comprising 50 mM KCl, 10 mM Tris HCl (pH 8.3), and 0.01% gelatin, 7 mM MgCl.sub.2, 0.5 mM MnCl.sub.2, 5 units of Taq polymerase, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, and 1 mM dTTP. PCR can be performed for 30 cycles of 94 C. for 1 min, 45 C. for 1 min, and 72 C. for 1 min. However, it will be appreciated that these parameters can be varied as appropriate. The mutagenized nucleic acids are then cloned into an appropriate vector and the activities of the polypeptides encoded by the mutagenized nucleic acids are evaluated.

[0187] Variants can also be created using oligonucleotide directed mutagenesis to generate site-specific mutations in any cloned DNA of interest. Oligonucleotide mutagenesis is described in, for example, Reidhaar-Olson et al., Science 241:53-57, 1988. Briefly, in such procedures a plurality of double stranded oligonucleotides bearing one or more mutations to be introduced into the cloned DNA are synthesized and inserted into the cloned DNA to be mutagenized (e.g., an aldehyde or alkane biosynthetic polynucleotide sequence). Clones containing the mutagenized DNA are recovered, and the activities of the polypeptides they encode are assessed.

[0188] Another method for generating variants is assembly PCR. Assembly PCR involves the assembly of a PCR product from a mixture of small DNA fragments. A large number of different PCR reactions occur in parallel in the same vial, with the products of one reaction priming the products of another reaction. Assembly PCR is described in, for example, U.S. Pat. No. 5,965,408.

[0189] Still another method of generating variants is sexual PCR mutagenesis. In sexual PCR mutagenesis, forced homologous recombination occurs between DNA molecules of different, but highly related, DNA sequence in vitro as a result of random fragmentation of the DNA molecule based on sequence homology. This is followed by fixation of the crossover by primer extension in a PCR reaction. Sexual PCR mutagenesis is described in, for example, Stemmer, PNAS, USA 91:10747-10751, 1994.

[0190] Variants can also be created by in vivo mutagenesis. In some embodiments, random mutations in a nucleic acid sequence are generated by propagating the sequence in a bacterial strain, such as an E. coli strain, which carries mutations in one or more of the DNA repair pathways. Such mutator strains have a higher random mutation rate than that of a wild-type strain. Propagating a DNA sequence (e.g., an aldehyde or alkane biosynthetic polynucleotide sequence) in one of these strains will eventually generate random mutations within the DNA. Mutator strains suitable for use for in vivo mutagenesis are described in, for example, PCT Publication No. WO 91/16427.

[0191] Variants can also be generated using cassette mutagenesis. In cassette mutagenesis, a small region of a double stranded DNA molecule is replaced with a synthetic oligonucleotide cassette that differs from the native sequence. The oligonucleotide often contains a completely and/or partially randomized native sequence.

[0192] Recursive ensemble mutagenesis can also be used to generate variants. Recursive ensemble mutagenesis is an algorithm for protein engineering (i.e., protein mutagenesis) developed to produce diverse populations of phenotypically related mutants whose members differ in amino acid sequence. This method uses a feedback mechanism to control successive rounds of combinatorial cassette mutagenesis. Recursive ensemble mutagenesis is described in, for example, Arkin et al., PNAS, USA 89:7811-7815, 1992.

[0193] In some embodiments, variants are created using exponential ensemble mutagenesis. Exponential ensemble mutagenesis is a process for generating combinatorial libraries with a high percentage of unique and functional mutants, wherein small groups of residues are randomized in parallel to identify, at each altered position, amino acids which lead to functional proteins. Exponential ensemble mutagenesis is described in, for example, Delegrave et al., Biotech. Res. 11:1548-1552, 1993. Random and site-directed mutagenesis are described in, for example, Arnold, Curr. Opin. Biotech. 4:450-455, 1993.

[0194] In some embodiments, variants are created using shuffling procedures wherein portions of a plurality of nucleic acids that encode distinct polypeptides are fused together to create chimeric nucleic acid sequences that encode chimeric polypeptides as described in, for example, U.S. Pat. Nos. 5,965,408 and 5,939,250.

[0195] Polynucleotide variants also include nucleic acid analogs. Nucleic acid analogs can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, stability, hybridization, or solubility of the nucleic acid. Modifications at the base moiety include deoxyuridine for deoxythymidine and 5-methyl-2-deoxycytidine or 5-bromo-2-doxycytidine for deoxycytidine. Modifications of the sugar moiety include modification of the 2 hydroxyl of the ribose sugar to form 2-O-methyl or 2-O-allyl sugars. The deoxyribose phosphate backbone can be modified to produce morpholino nucleic acids, in which each base moiety is linked to a six-membered, morpholino ring, or peptide nucleic acids, in which the deoxyphosphate backbone is replaced by a pseudopeptide backbone and the four bases are retained. (See, e.g., Summerton et al., Antisense Nucleic Acid Drug Dev. (1997) 7:187-195; and Hyrup et al., Bioorgan. Med. Chem. (1996) 4:5-23.) In addition, the deoxyphosphate backbone can be replaced with, for example, a phosphorothioate or phosphorodithioate backbone, a phosphoroamidite, or an alkyl phosphotriester backbone.

[0196] The aldehyde and alkane biosynthetic polypeptides Synpcc7942_1594 (SEQ ID NO:66) and Synpcc7942_1593 (SEQ ID NO:2) have homologs in other cyanobacteria (nonlimiting examples are depicted in Table 1). Thus, any polynucleotide sequence encoding a homolog listed in Table 1, or a variant thereof, can be used as an aldehyde or alkane biosynthetic polynucleotide in the methods described herein. Each cyanobacterium listed in Table 1 has copies of both genes. The level of sequence identity of the gene products ranges from 61% to 73% for Synpcc7942_1594 (SEQ ID NO:66) and from 43% to 78% for Synpcc7942_1593 (SEQ ID NO:2).

[0197] Further homologs of the aldehyde biosynthetic polypeptide Synpcc7942_1594 (SEQ ID NO:66) are listed in FIG. 39, and any polynucleotide sequence encoding a homolog listed in FIG. 39, or a variant thereof, can be used as an aldehyde biosynthetic polynucleotide in the methods described herein. Further homologs of the alkane biosynthetic polypeptide Synpcc7942_1593 (SEQ ID NO:2) are listed in FIG. 38, and any polynucleotide sequence encoding a homolog listed in FIG. 38, or a variant thereof, can be used as an alkane biosynthetic polynucleotide in the methods described herein.

[0198] In certain instances, an aldehyde, alkane, and/or alkene biosynthetic gene is codon optimized for expression in a particular host cell. For example, for expression in E. coli, one or more codons can be optimized as described in, e.g., Grosjean et al., Gene 18:199-209 (1982).

Aldehyde, Alkane, and Alkene Biosynthetic Polypeptides and Variants

[0199] The methods and compositions described herein also include alkane or alkene biosynthetic polypeptides having the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36, as well as polypeptide variants thereof. In some instances, an alkane or alkene biosynthetic polypeptide is one that includes one or more of the amino acid motifs described herein. For example, the alkane or alkene biosynthetic polypeptide can include the amino acid sequence of SEQ ID NO:37, 38, 39, 41, 42, 43, or 44. The alkane or alkene biosynthetic polypeptide can also include the amino acid sequence of SEQ ID NO:40 and also any one of SEQ ID NO:37, 38, or 39.

[0200] The methods and compositions described herein also include aldehyde biosynthetic polypeptides having the amino acid sequence of SEQ ID NO:66, 68, 70, 72, 74, 76, 78, 80, or 82, as well as polypeptide variants thereof. In some instances, an aldehyde biosynthetic polypeptide is one that includes one or more of the amino acid motifs described herein. For example, the aldehyde biosynthetic polypeptide can include the amino acid sequence of SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, or 64.

[0201] Aldehyde, alkane, and alkene biosynthetic polypeptide variants can be variants in which one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue). Such substituted amino acid residue may or may not be one encoded by the genetic code.

[0202] Conservative substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of similar characteristics. Typical conservative substitutions are the following replacements: replacement of an aliphatic amino acid, such as alanine, valine, leucine, and isoleucine, with another aliphatic amino acid; replacement of a serine with a threonine or vice versa; replacement of an acidic residue, such as aspartic acid and glutamic acid, with another acidic residue; replacement of a residue bearing an amide group, such as asparagine and glutamine, with another residue bearing an amide group; exchange of a basic residue, such as lysine and arginine, with another basic residue; and replacement of an aromatic residue, such as phenylalanine and tyrosine, with another aromatic residue.

[0203] Other polypeptide variants are those in which one or more amino acid residues include a substituent group. Still other polypeptide variants are those in which the polypeptide is associated with another compound, such as a compound to increase the half-life of the polypeptide (e.g., polyethylene glycol).

[0204] Additional polypeptide variants are those in which additional amino acids are fused to the polypeptide, such as a leader sequence, a secretory sequence, a proprotein sequence, or a sequence which facilitates purification, enrichment, or stabilization of the polypeptide.

[0205] In some instances, an alkane or alkene biosynthetic polypeptide variant retains the same biological function as a polypeptide having the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 (e.g., retains alkane or alkene biosynthetic activity) and has an amino acid sequence substantially identical thereto.

[0206] In other instances, the alkane or alkene biosynthetic polypeptide variants have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36. In another embodiment, the polypeptide variants include a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.

[0207] In some instances, an aldehyde biosynthetic polypeptide variant retains the same biological function as a polypeptide having the amino acid sequence of SEQ ID NO:66, 68, 70, 72, 74, 76, 78, 80, or 82 (e.g., retains aldehyde biosynthetic activity) and has an amino acid sequence substantially identical thereto.

[0208] In yet other instances, the aldehyde biosynthetic polypeptide variants have at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more than about 95% homology to the amino acid sequence of SEQ ID NO:66, 68, 70, 72, 74, 76, 78, 80, or 82. In another embodiment, the polypeptide variants include a fragment comprising at least about 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof.

[0209] The polypeptide variants or fragments thereof can be obtained by isolating nucleic acids encoding them using techniques described herein or by expressing synthetic nucleic acids encoding them. Alternatively, polypeptide variants or fragments thereof can be obtained through biochemical enrichment or purification procedures. The sequence of polypeptide variants or fragments can be determined by proteolytic digestion, gel electrophoresis, and/or microsequencing. The sequence of the alkane or alkene biosynthetic polypeptide variants or fragments can then be compared to the amino acid sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 using any of the programs described herein. The sequence of the aldehyde biosynthetic polypeptide variants or fragments can be compared to the amino acid sequence of SEQ ID NO:66, 68, 70, 72, 74, 76, 78, 80, or 82 using any of the programs described herein.

[0210] The polypeptide variants and fragments thereof can be assayed for aldehyde-, fatty alcohol-, alkane-, and/or alkene-producing activity using routine methods. For example, the polypeptide variants or fragment can be contacted with a substrate (e.g., a fatty acid derivative substrate or other substrate described herein) under conditions that allow the polypeptide variant to function. A decrease in the level of the substrate or an increase in the level of an aldehyde, alkane, or alkene can be measured to determine aldehyde-, fatty alcohol-, alkane-, or alkene-producing activity, respectively.

Anti-Aldehyde, Anti-Fatty Alcohol, Anti-Alkane, and Anti-Alkene Biosynthetic Polypeptide Antibodies

[0211] The aldehyde, fatty alcohol, alkane, and alkene biosynthetic polypeptides described herein can also be used to produce antibodies directed against aldehyde, fatty alcohol, alkane, and alkene biosynthetic polypeptides. Such antibodies can be used, for example, to detect the expression of an aldehyde, fatty alcohol, alkane, or alkene biosynthetic polypeptide using methods known in the art. The antibody can be, e.g., a polyclonal antibody; a monoclonal antibody or antigen binding fragment thereof; a modified antibody such as a chimeric antibody, reshaped antibody, humanized antibody, or fragment thereof (e.g., Fab, Fab, F(ab).sub.2); or a biosynthetic antibody, e.g., a single chain antibody, single domain antibody (DAB), Fv, single chain Fv (scFv), or the like.

[0212] Methods of making and using polyclonal and monoclonal antibodies are described, e.g., in Harlow et al., Using Antibodies: A Laboratory Manual: Portable Protocol I. Cold Spring Harbor Laboratory (Dec. 1, 1998). Methods for making modified antibodies and antibody fragments (e.g., chimeric antibodies, reshaped antibodies, humanized antibodies, or fragments thereof, e.g., Fab, Fab, F(ab).sub.2 fragments); or biosynthetic antibodies (e.g., single chain antibodies, single domain antibodies (DABs), Fv, single chain Fv (scFv), and the like), are known in the art and can be found, e.g., in Zola, Monoclonal Antibodies: Preparation and Use of Monoclonal Antibodies and Engineered Antibody Derivatives, Springer Verlag (Dec. 15, 2000; 1st edition).

Substrates

[0213] The compositions and methods described herein can be used to produce aldehydes, fatty alcohols, alkanes, and/or alkenes from an appropriate substrate. While not wishing to be bound by a particular theory, it is believed that the alkane or alkene biosynthetic polypeptides described herein produce alkanes or alkenes from substrates via a decarbonylation mechanism. In some instances, the substrate is a fatty acid derivative, e.g., a fatty aldehyde, and an alkane having particular branching patterns and carbon chain length can be produced from a fatty acid derivative, e.g., a fatty aldehyde, having those particular characteristics. In other instances, the substrate is an unsaturated fatty acid derivative, e.g., an unsaturated fatty aldehyde, and an alkene having particular branching patterns and carbon chain length can be produced from an unsaturated fatty acid derivative, e.g., an unsaturated fatty aldehyde, having those particular characteristics.

[0214] While not wishing to be bound by a particular theory, it is believed that the aldehyde biosynthetic polypeptides described herein produce aldehydes from substrates via a reduction mechanism. In certain instances, the substrate is an acyl-ACP.

[0215] While not wishing to be bound by a particular theory, it is believed that the fatty alcohols described herein are produced from substrates via a reduction mechanism. In certain instances, the substrate is a fatty aldehyde.

[0216] Accordingly, each step within a biosynthetic pathway that leads to the production of these substrates can be modified to produce or overproduce the substrate of interest. For example, known genes involved in the fatty acid biosynthetic pathway, the fatty aldehyde pathway, and the fatty alcohol pathway can be expressed, overexpressed, or attenuated in host cells to produce a desired substrate (see, e.g., PCT/US08/058788, specifically incorporated by reference herein). Exemplary genes are provided in FIG. 40.

Synthesis of Substrates

[0217] Fatty acid synthase (FAS) is a group of polypeptides that catalyze the initiation and elongation of acyl chains (Marrakchi et al., Biochemical Society, 30:1050-1055, 2002). The acyl carrier protein (ACP) along with the enzymes in the FAS pathway control the length, degree of saturation, and branching of the fatty acid derivatives produced. The fatty acid biosynthetic pathway involves the precursors acetyl-CoA and malonyl-CoA. The steps in this pathway are catalyzed by enzymes of the fatty acid biosynthesis (fab) and acetyl-CoA carboxylase (acc) gene families (see, e.g., Heath et al., Prog. Lipid Res. 40(6):467-97 (2001)).

[0218] Host cells can be engineered to express fatty acid derivative substrates by recombinantly expressing or overexpressing acetyl-CoA and/or malonyl-CoA synthase genes. For example, to increase acetyl-CoA production, one or more of the following genes can be expressed in a host cell: pdh, panK, aceEF (encoding the E1p dehydrogenase component and the E2p dihydrolipoamide acyltransferase component of the pyruvate and 2-oxoglutarate dehydrogenase complexes), fabH, fabD, fabG, acpP, and fabF. Exemplary GenBank accession numbers for these genes are: pdh (BAB34380, AAC73227, AAC73226), panK (also known as coaA, AAC76952), aceEF (AAC73227, AAC73226), fabH (AAC74175), fabD (AAC74176), fabG (AAC74177), acpP (AAC74178), fabF (AAC74179). Additionally, the expression levels of fadE, gpsA, ldhA, pflb, adhE, pta, poxB, ackA, and/or ackB can be attenuated or knocked-out in an engineered host cell by transformation with conditionally replicative or non-replicative plasmids containing null or deletion mutations of the corresponding genes or by substituting promoter or enhancer sequences. Exemplary GenBank accession numbers for these genes are: fadE (AAC73325), gspA (AAC76632), ldhA (AAC74462), pflb (AAC73989), adhE (AAC74323), pta (AAC75357), poxB (AAC73958), ackA (AAC75356), and ackB (BAB81430). The resulting host cells will have increased acetyl-CoA production levels when grown in an appropriate environment.

[0219] Malonyl-CoA overexpression can be effected by introducing accABCD (e.g., accession number AAC73296, EC 6.4.1.2) into a host cell. Fatty acids can be further overexpressed in host cells by introducing into the host cell a DNA sequence encoding a lipase (e.g., accession numbers CAA89087, CAA98876).

[0220] In addition, inhibiting PlsB can lead to an increase in the levels of long chain acyl-ACP, which will inhibit early steps in the pathway (e.g., accABCD, fabH, and fab). The plsB (e.g., accession number AAC77011) D311E mutation can be used to increase the amount of available acyl-CoA.

[0221] In addition, a host cell can be engineered to overexpress a sfa gene (suppressor of fabA, e.g., accession number AAN79592) to increase production of monounsaturated fatty acids (Rock et al., J. Bacteriology 178:5382-5387, 1996).

[0222] In some instances, host cells can be engineered to express, overexpress, or attenuate expression of a thioesterase to increase fatty acid substrate production. The chain length of a fatty acid substrate is controlled by thioesterase. In some instances, a tes or fat gene can be overexpressed. In other instances, C.sub.10 fatty acids can be produced by attenuating thioesterase C.sub.18 (e.g., accession numbers AAC73596 and P0ADA1), which uses C.sub.18:1-ACP, and expressing thioesterase C.sub.10 (e.g., accession number Q39513), which uses C.sub.10-ACP. This results in a relatively homogeneous population of fatty acids that have a carbon chain length of 10. In yet other instances, C.sub.14 fatty acids can be produced by attenuating endogenous thioesterases that produce non-C.sub.14 fatty acids and expressing the thioesterases, that use C.sub.14-ACP (for example, accession number Q39473). In some situations, C.sub.12 fatty acids can be produced by expressing thioesterases that use C.sub.12-ACP (for example, accession number Q41635) and attenuating thioesterases that produce non-C.sub.12 fatty acids. Acetyl-CoA, malonyl-CoA, and fatty acid overproduction can be verified using methods known in the art, for example, by using radioactive precursors, HPLC, and GC-MS subsequent to cell lysis. Non-limiting examples of thioesterases that can be used in the methods described herein are listed in Table 2.

TABLE-US-00002 TABLE 2 Thioesterases Preferential Accession Number Source Organism Gene product produced AAC73596 E. coli tesA without C.sub.18:1 leader sequence AAC73555 E. coli tesB Q41635, AAA34215 Umbellularia california fatB C.sub.12:0 Q39513; AAC49269 Cuphea hookeriana fatB2 C.sub.8:0-C.sub.10:0 AAC49269; AAC72881 Cuphea hookeriana fatB3 C.sub.14:0-C.sub.16:0 Q39473, AAC49151 Cinnamonum camphorum fatB C.sub.14:0 CAA85388 Arabidopsis thaliana fatB [M141T]* C.sub.16:1 NP 189147; NP 193041 Arabidopsis thaliana fatA C.sub.18:1 CAC39106 Bradyrhiizobium japonicum fatA C.sub.18:1 AAC72883 Cuphea hookeriana fatA C.sub.18:1 AAL79361 Helianthus annus fatA1 *Mayer et al., BMC Plant Biology 7: 1-11, 2007

[0223] Formation of Branched Aldehydes, Fatty Alcohols, Alkanes, and Alkenes

[0224] Aldehydes, fatty alcohols, alkanes, an alkenes can be produced that contain branch points by using branched fatty acid derivatives as substrates. For example, although E. coli naturally produces straight chain fatty acid derivatives (sFAs), E. coli can be engineered to produce branched chain fatty acid derivatives (brFAs) by introducing and expressing or overexpressing genes that provide branched precursors in the E. coli (e.g., bkd, ilv, icm, and fab gene families). Additionally, a host cell can be engineered to express or overexpress genes encoding proteins for the elongation of brFAs (e.g., ACP, FabF, etc.) and/or to delete or attenuate the corresponding host cell genes that normally lead to sFAs.

[0225] The first step in forming brFAs is the production of the corresponding -keto acids by a branched-chain amino acid aminotransferase. Host cells may endogenously include genes encoding such enzymes or such genes can be recombinantly introduced. E. coli, for example, endogenously expresses such an enzyme, IlvE (EC 2.6.1.42; GenBank accession YP_026247). In some host cells, a heterologous branched-chain amino acid aminotransferase may not be expressed. However, E. coli IlvE or any other branched-chain amino acid aminotransferase (e.g., IlvE from Lactococcus lactis (GenBank accession AAF34406), IlvE from Pseudomonas putida (GenBank accession NP_745648), or IlvE from Streptomyces coelicolor (GenBank accession NP_629657)), if not endogenous, can be introduced and recombinantly expressed.

[0226] The second step is the oxidative decarboxylation of the -ketoacids to the corresponding branched-chain acyl-CoA. This reaction can be catalyzed by a branched-chain -keto acid dehydrogenase complex (bkd; EC 1.2.4.4.) (Denoya et al., J. Bacteriol. 177:3504, 1995), which consists of E1/ (decarboxylase), E2 (dihydrolipoyl transacylase), and E3 (dihydrolipoyl dehydrogenase) subunits. These branched-chain -keto acid dehydrogenase complexes are similar to pyruvate and -ketoglutarate dehydrogenase complexes. Any microorganism that possesses brFAs and/or grows on branched-chain amino acids can be used as a source to isolate bkd genes for expression in host cells, for example, E. coli. Furthermore, E. coli has the E3 component as part of its pyruvate dehydrogenase complex (lpd, EC 1.8.1.4, GenBank accession NP_414658). Thus, it can be sufficient to express only the E a/$ and E2 bkd genes. Table 3 lists non-limiting examples of bkd genes from several microorganisms that can be recombinantly introduced and expressed in a host cell to provide branched-chain acyl-CoA precursors.

TABLE-US-00003 TABLE 3 Bkd genes from selected microorganisms GenBank Organism Gene Accession # Streptomyces coelicolor bkdA1 (E1) NP_628006 bkdB1 (E1) NP_628005 bkdC1 (E2) NP_638004 Streptomyces coelicolor bkdA2 (E1) NP_733618 bkdB2 (E1) NP_628019 bkdC2 (E2) NP_628018 Streptomyces avermitilis bkdA (E1a) BAC72074 bkdB (E1b) BAC72075 bkdC (E2) BAC72076 Streptomyces avermitilis bkdF (E1) BAC72088 bkdG (E1) BAC72089 bkdH (E2) BAC72090 Bacillus subtilis bkdAA (E1) NP_390288 bkdAB (E1) NP_390288 bkdB (E2) NP_390288 Pseudomonas putida bkdA1 (E1) AAA65614 bkdA2 (E1) AAA65615 bkdC (E2) AAA65617

[0227] In another example, isobutyryl-CoA can be made in a host cell, for example in E. coli, through the coexpression of a crotonyl-CoA reductase (Ccr, EC 1.6.5.5, 1.1.1.1) and isobutyryl-CoA mutase (large subunit IcmA, EC 5.4.99.2; small subunit IcmB, EC 5.4.99.2) (Han and Reynolds, J. Bacteriol. 179:5157, 1997). Crotonyl-CoA is an intermediate in fatty acid biosynthesis in E. coli and other microorganisms. Non-limiting examples of ccr and icm genes from selected microorganisms are listed in Table 4.

TABLE-US-00004 TABLE 4 Ccr and icm genes from selected microorganisms GenBank Organism Gene Accession # Streptomyces coelicolor Ccr NP_630556 icmA NP_629554 icmB NP_630904 Streptomyces cinnamonensis ccr AAD53915 icmA AAC08713 icmB AJ246005

[0228] In addition to expression of the bkd genes, the initiation of brFA biosynthesis utilizes -ketoacyl-acyl-carrier-protein synthase III (FabH, EC 2.3.1.41) with specificity for branched chain acyl-CoAs (Li et al., J. Bacteriol. 187:3795-3799, 2005). Non-limiting examples of such FabH enzymes are listed in Table 5. fabH genes that are involved in fatty acid biosynthesis of any brFA-containing microorganism can be expressed in a host cell. The Bkd and FabH enzymes from host cells that do not naturally make brFA may not support brFA production. Therefore, bkd and fabH can be expressed recombinantly. Vectors containing the bkd and fabH genes can be inserted into such a host cell. Similarly, the endogenous level of Bkd and FabH production may not be sufficient to produce brFA. In this case, they can be overexpressed. Additionally, other components of the fatty acid biosynthesis pathway can be expressed or overexpressed, such as acyl carrier proteins (ACPs) and -ketoacyl-acyl-carrier-protein synthase II (fabF, EC 2.3.1.41) (non-limiting examples of candidates are listed in Table 5). In addition to expressing these genes, some genes in the endogenous fatty acid biosynthesis pathway can be attenuated in the host cell (e.g., the E. coli genes fabH (GenBank accession #NP_415609) and/or fabF (GenBank accession #NP_415613)).

TABLE-US-00005 TABLE 5 FabH, ACP and fabF genes from selected microorganisms with brFAs GenBank Organism Gene Accession # Streptomyces coelicolor fabH1 NP_626634 ACP NP_626635 fabF NP_626636 Streptomyces avermitilis fabH3 NP_823466 fabC3 (ACP) NP_823467 fabF NP_823468 Bacillus subtilis fabH_A NP_389015 fabH_B NP_388898 ACP NP_389474 fabF NP_389016 Stenotrophomonas SmalDRAFT_0818 (FabH) ZP_01643059 maltophilia SmalDRAFT_0821 (ACP) ZP_01643063 SmalDRAFT_0822 (FabF) ZP_01643064 Legionella pneumophila FabH YP_123672 ACP YP_123675 fabF YP_123676

Formation of Cyclic Aldehydes, Fatty Alcohols, Alkanes, and Alkenes

[0229] Cyclic aldehydes, fatty alcohols, alkanes, and alkenes can be produced by using cyclic fatty acid derivatives as substrates. To produce cyclic fatty acid derivative substrates, genes that provide cyclic precursors (e.g., the ans, chc, and plm gene families) can be introduced into the host cell and expressed to allow initiation of fatty acid biosynthesis from cyclic precursors. For example, to convert a host cell, such as E. coli, into one capable of synthesizing co-cyclic fatty acid derivatives (cyFA), a gene that provides the cyclic precursor cyclohexylcarbonyl-CoA (CHC-CoA) (Cropp et al., Nature Biotech. 18:980-983, 2000) can be introduced and expressed in the host cell. Non-limiting examples of genes that provide CHC-CoA in E. coli include: ansJ, ansK, ansL, chcA, and ansM from the ansatrienin gene cluster of Streptomyces collinus (Chen et al., Eur. J. Biochem. 261: 98-107, 1999) or plmJ, plmK, plmL, chcA, and plmM from the phoslactomycin B gene cluster of Streptomyces sp. HK803 (Palaniappan et al., J. Biol. Chem. 278:35552-35557, 2003) together with the chcB gene (Patton et al., Biochem. 39:7595-7604, 2000) from S. collinus, S. avermitilis, or S. coelicolor (see Table 6). The genes listed in Table 5 can then be expressed to allow initiation and elongation of -cyclic fatty acids. Alternatively, the homologous genes can be isolated from microorganisms that make cyFA and expressed in a host cell (e.g., E. coli).

TABLE-US-00006 TABLE 6 Genes for the synthesis of CHC-CoA GenBank Organism Gene Accession # Streptomyces collinus ansJK U72144* ansL chcA ansM chcB AF268489 Streptomyces sp. HK803 pmlJK AAQ84158 pmlL AAQ84159 chcA AAQ84160 pmlM AAQ84161 Streptomyces coelicolor chcB/caiD NP_629292 Streptomyces avermitilis chcB/caiD NP_629292 *Only chcA is annotated in GenBank entry U72144, ansJKLM are according to Chen et al. (Eur. J. Biochem. 261: 98-107, 1999).

[0230] The genes listed in Table 5 (fabH, ACP, and fabF) allow initiation and elongation of -cyclic fatty acid derivatives because they have broad substrate specificity. If the coexpression of any of these genes with the genes listed in Table 6 does not yield cyFA, then fabH, ACP, and/or fabF homologs from microorganisms that make cyFAs (e.g., those listed in Table 7) can be isolated (e.g., by using degenerate PCR primers or heterologous DNA sequence probes) and coexpressed.

TABLE-US-00007 TABLE 7 Non-limiting examples of microorganisms that contain -cyclic fatty acids Organism Reference Curtobacterium pusillum ATCC19096 Alicyclobacillus acidoterrestris ATCC49025 Alicyclobacillus acidocaldarius ATCC27009 Alicyclobacillus cycloheptanicus * Moore, J. Org. Chem. 62: pp. 2173, 1997 * Uses cycloheptylcarbonyl-CoA and not cyclohexylcarbonyl-CoA as precursor for cyFA biosynthesis.

Aldehyde, Fatty Alcohol, and Alkene Saturation Levels

[0231] The degree of saturation in fatty acid derivatives can be controlled by regulating the degree of saturation of fatty acid derivative intermediates. The sfa, gns, and fab families of genes can be expressed or overexpressed to control the saturation of fatty acids. FIG. 40 lists non-limiting examples of genes in these gene families that may be used in the methods and host cells described herein.

[0232] Host cells can be engineered to produce unsaturated fatty acids by engineering the host cell to overexpress fabB or by growing the host cell at low temperatures (e.g., less than 37 C.). FabB has preference to cis-63decenoyl-ACP and results in unsaturated fatty acid production in E. coli. Overexpression of fabB results in the production of a significant percentage of unsaturated fatty acids (de Mendoza et al., J. Biol. Chem. 258:2098-2101, 1983). The gene fabB may be inserted into and expressed in host cells not naturally having the gene. These unsaturated fatty acid derivatives can then be used as intermediates in host cells that are engineered to produce fatty acid derivatives, such as fatty aldehydes, fatty alcohols, or alkenes.

[0233] In other instances, a repressor of fatty acid biosynthesis, for example, fabR (GenBank accession NP_418398), can be deleted, which will also result in increased unsaturated fatty acid production in E. coli (Zhang et al., J. Biol. Chem. 277:15558, 2002). Similar deletions may be made in other host cells. A further increase in unsaturated fatty acid derivatives may be achieved, for example, by overexpressing fabM (trans-2, cis-3-decenoyl-ACP isomerase, GenBank accession DAA05501) and controlled expression of fabK (trans-2-enoyl-ACP reductase II, GenBank accession NP_357969) from Streptococcus pneumoniae (Marrakchi et al., J. Biol. Chem. 277: 44809, 2002), while deleting E. coli fabI (trans-2-enoyl-ACP reductase, GenBank accession NP_415804). In some examples, the endogenous fabF gene can be attenuated, thus increasing the percentage of palmitoleate (C16:1) produced.

Other Substrates

[0234] Other substrates that can be used to produce aldehydes, fatty alcohols, alkanes, and alkenes in the methods described herein are acyl-ACP, acyl-CoA, a fatty aldehyde, or a fatty alcohol, which are described in, for example, PCT/US08/058788. Exemplary genes that can be altered to express or overexpress these substrates in host cells are listed in FIG. 40. Other exemplary genes are described in PCT/US08/058788.

Genetic Engineering of Host Cells to Produce Aldehydes, Fatty Alcohols, Alkanes, and Alkenes

[0235] Various host cells can be used to produce aldehydes, fatty alcohols, alkanes, and/or alkenes, as described herein. A host cell can be any prokaryotic or eukaryotic cell. For example, a polypeptide described herein can be expressed in bacterial cells (such as E. coli), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) cells, COS cells, VERO cells, BHK cells, HeLa cells, Cv1 cells, MDCK cells, 293 cells, 3T3 cells, or PC12 cells). Other exemplary host cells include cells from the members of the genus Escherichia, Bacillus, Lactobacillus, Rhodococcus, Pseudomonas, Aspergillus, Trichoderma, Neurospora, Fusarium, Humicola, Rhizomucor, Kluyveromyces, Pichia, Mucor, Myceliophtora, Penicillium, Phanerochaete, Pleurotus, Trametes, Chrysosporium, Saccharomyces, Schizosaccharomyces, Yarrowia, or Streptomyces. Yet other exemplary host cells can be a Bacillus lentus cell, a Bacillus brevis cell, a Bacillus stearothermophilus cell, a Bacillus licheniformis cell, a Bacillus alkalophilus cell, a Bacillus coagulans cell, a Bacillus circulans cell, a Bacillus pumilis cell, a Bacillus thuringiensis cell, a Bacillus clausii cell, a Bacillus megaterium cell, a Bacillus subtilis cell, a Bacillus amyloliquefaciens cell, a Trichoderma koningii cell, a Trichoderma viride cell, a Trichoderma reesei cell, a Trichoderma longibrachiatum cell, an Aspergillus awamori cell, an Aspergillus fumigates cell, an Aspergillus foetidus cell, an Aspergillus nidulans cell, an Aspergillus niger cell, an Aspergillus oryzae cell, a Humicola insolens cell, a Humicola lanuginose cell, a Rhizomucor miehei cell, a Mucor michei cell, a Streptomyces lividans cell, a Streptomyces murinus cell, or an Actinomycetes cell.

[0236] Other nonlimiting examples of host cells are those listed in Table 1.

[0237] In a preferred embodiment, the host cell is an E. coli cell. In a more preferred embodiment, the host cell is from E. coli strains B, C, K, or W. Other suitable host cells are known to those skilled in the art.

[0238] Various methods well known in the art can be used to genetically engineer host cells to produce aldehydes, fatty alcohols, alkanes and/or alkenes. The methods include the use of vectors, preferably expression vectors, containing a nucleic acid encoding an aldehyde, fatty alcohol, alkane, and/or alkene biosynthetic polypeptide described herein, or a polypeptide variant or fragment thereof. As used herein, the term vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell and are thereby replicated along with the host genome. Moreover, certain vectors, such as expression vectors, are capable of directing the expression of genes to which they are operatively linked. In general, expression vectors used in recombinant DNA techniques are often in the form of plasmids. However, other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses, and adeno-associated viruses), can also be used.

[0239] The recombinant expression vectors described herein include a nucleic acid described herein in a form suitable for expression of the nucleic acid in a host cell. The recombinant expression vectors can include one or more control sequences, selected on the basis of the host cell to be used for expression. The control sequence is operably linked to the nucleic acid sequence to be expressed. Such control sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Control sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors described herein can be introduced into host cells to produce polypeptides, including fusion polypeptides, encoded by the nucleic acids as described herein.

[0240] Recombinant expression vectors can be designed for expression of an aldehyde, fatty alcohol, alkane, and/or alkene biosynthetic polypeptide or variant in prokaryotic or eukaryotic cells (e.g., bacterial cells, such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells). Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example, by using T7 promoter regulatory sequences and T7 polymerase.

[0241] Expression of polypeptides in prokaryotes, for example, E. coli, is most often carried out with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion polypeptides. Fusion vectors add a number of amino acids to a polypeptide encoded therein, usually to the amino terminus of the recombinant polypeptide. Such fusion vectors typically serve three purposes: (1) to increase expression of the recombinant polypeptide; (2) to increase the solubility of the recombinant polypeptide; and (3) to aid in the purification of the recombinant polypeptide by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant polypeptide. This enables separation of the recombinant polypeptide from the fusion moiety after purification of the fusion polypeptide. Examples of such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin, and enterokinase. Exemplary fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith et al., Gene (1988) 67:31-40), pMAL (New England Biolabs, Beverly, Mass.), and pRITS (Pharmacia, Piscataway, N.J.), which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant polypeptide.

[0242] Examples of inducible, non-fusion E. coli expression vectors include pTrc (Amann et al., Gene (1988) 69:301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.

[0243] One strategy to maximize recombinant polypeptide expression is to express the polypeptide in a host cell with an impaired capacity to proteolytically cleave the recombinant polypeptide (see Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Another strategy is to alter the nucleic acid sequence to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in the host cell (Wada et al., Nucleic Acids Res. (1992) 20:2111-2118). Such alteration of nucleic acid sequences can be carried out by standard DNA synthesis techniques.

[0244] In another embodiment, the host cell is a yeast cell. In this embodiment, the expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerevisiae include pYepSecl (Baldari et al., EMBO J. (1987) 6:229-234), pMFa (Kurjan et al., Cell (1982) 30:933-943), pJRY88 (Schultz et al., Gene (1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (Invitrogen Corp, San Diego, Calif.).

[0245] Alternatively, a polypeptide described herein can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include, for example, the pAc series (Smith et al., Mol. Cell Biol. (1983) 3:2156-2165) and the pVL series (Lucklow et al., Virology (1989) 170:31-39).

[0246] In yet another embodiment, the nucleic acids described herein can be expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al., EMBO J. (1987) 6:187-195). When used in mammalian cells, the expression vector's control functions can be provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. Other suitable expression systems for both prokaryotic and eukaryotic cells are described in chapters 16 and 17 of Sambrook et al., eds., Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

[0247] Vectors can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms transformation and transfection refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in, for example, Sambrook et al. (supra).

[0248] For stable transformation of bacterial cells, it is known that, depending upon the expression vector and transformation technique used, only a small fraction of cells will take-up and replicate the expression vector. In order to identify and select these transformants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Selectable markers include those that confer resistance to drugs, such as ampacillin, kanamycin, chloramphenicol, or tetracycline. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0249] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin, and methotrexate. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that encoding a polypeptide described herein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0250] In certain methods, an aldehyde biosynthetic polypeptide and an alkane or alkene biosynthetic polypeptide are co-expressed in a single host cell. In alternate methods, an aldehyde biosynthetic polypeptide and an alcohol dehydrogenase polypeptide are co-expressed in a single host cell.

Transport Proteins

[0251] Transport proteins can export polypeptides and hydrocarbons (e.g., aldehydes, alkanes, and/or alkenes) out of a host cell. Many transport and efflux proteins serve to excrete a wide variety of compounds and can be naturally modified to be selective for particular types of hydrocarbons.

[0252] Non-limiting examples of suitable transport proteins are ATP-Binding Cassette (ABC) transport proteins, efflux proteins, and fatty acid transporter proteins (FATP). Additional non-limiting examples of suitable transport proteins include the ABC transport proteins from organisms such as Caenorhabditis elegans, Arabidopsis thalania, Alkaligenes eutrophus, and Rhodococcus erythropolis. Exemplary ABC transport proteins that can be used are listed in FIG. 40 (e.g., CER5, AtMRP5, AmiS2, and AtPGP1). Host cells can also be chosen for their endogenous ability to secrete hydrocarbons. The efficiency of hydrocarbon production and secretion into the host cell environment (e.g., culture medium, fermentation broth) can be expressed as a ratio of intracellular product to extracellular product. In some examples, the ratio can be about 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, or 1:5.

Fermentation

[0253] The production and isolation of aldehydes, fatty alcohols, alkanes and/or alkenes can be enhanced by employing beneficial fermentation techniques. One method for maximizing production while reducing costs is increasing the percentage of the carbon source that is converted to hydrocarbon products.

[0254] During normal cellular lifecycles, carbon is used in cellular functions, such as producing lipids, saccharides, proteins, organic acids, and nucleic acids. Reducing the amount of carbon necessary for growth-related activities can increase the efficiency of carbon source conversion to product. This can be achieved by, for example, first growing host cells to a desired density (for example, a density achieved at the peak of the log phase of growth). At such a point, replication checkpoint genes can be harnessed to stop the growth of cells. Specifically, quorum sensing mechanisms (reviewed in Camilli et al., Science 311:1113, 2006; Venturi FEMS Microbio. Rev. 30:274-291, 2006; and Reading et al., FEMS Microbiol. Lett. 254:1-11, 2006) can be used to activate checkpoint genes, such as p53, p21, or other checkpoint genes.

[0255] Genes that can be activated to stop cell replication and growth in E. coli include umuDC genes. The overexpression of umuDC genes stops the progression from stationary phase to exponential growth (Murli et al., J. of Bact. 182:1127, 2000). UmuC is a DNA polymerase that can carry out translesion synthesis over non-coding lesionsthe mechanistic basis of most UV and chemical mutagenesis. The umuDC gene products are involved in the process of translesion synthesis and also serve as a DNA sequence damage checkpoint. The umuDC gene products include UmuC, UmuD, umuD, UmuD.sub.2C, UmuD.sub.2, and UmuD.sub.2. Simultaneously, product-producing genes can be activated, thus minimizing the need for replication and maintenance pathways to be used while an aldehyde, alkane and/or alkene is being made. Host cells can also be engineered to express umuC and umuD from E. coli in pBAD24 under the prpBCDE promoter system through de novo synthesis of this gene with the appropriate end-product production genes.

[0256] The percentage of input carbons converted to aldehydes, fatty alcohols, alkanes and/or alkenes can be a cost driver. The more efficient the process is (i.e., the higher the percentage of input carbons converted to aldehydes, fatty alcohols, alkanes and/or alkenes), the less expensive the process will be. For oxygen-containing carbon sources (e.g., glucose and other carbohydrate based sources), the oxygen must be released in the form of carbon dioxide. For every 2 oxygen atoms released, a carbon atom is also released leading to a maximal theoretical metabolic efficiency of approximately 34% (w/w) (for fatty acid derived products). This figure, however, changes for other hydrocarbon products and carbon sources. Typical efficiencies in the literature are approximately less than 5%. Host cells engineered to produce aldehydes, alkanes and/or alkenes can have greater than about 1, 3, 5, 10, 15, 20, 25, and 30% efficiency. In one example, host cells can exhibit an efficiency of about 10% to about 25%. In other examples, such host cells can exhibit an efficiency of about 25% to about 30%. In other examples, host cells can exhibit greater than 30% efficiency.

[0257] The host cell can be additionally engineered to express recombinant cellulosomes, such as those described in PCT application number PCT/US2007/003736. These cellulosomes can allow the host cell to use cellulosic material as a carbon source. For example, the host cell can be additionally engineered to express invertases (EC 3.2.1.26) so that sucrose can be used as a carbon source. Similarly, the host cell can be engineered using the teachings described in U.S. Pat. Nos. 5,000,000; 5,028,539; 5,424,202; 5,482,846; and 5,602,030; so that the host cell can assimilate carbon efficiently and use cellulosic materials as carbon sources.

[0258] In one example, the fermentation chamber can enclose a fermentation that is undergoing a continuous reduction. In this instance, a stable reductive environment can be created. The electron balance can be maintained by the release of carbon dioxide (in gaseous form). Efforts to augment the NAD/H and NADP/H balance can also facilitate in stabilizing the electron balance. The availability of intracellular NADPH can also be enhanced by engineering the host cell to express an NADH:NADPH transhydrogenase. The expression of one or more NADH:NADPH transhydrogenases converts the NADH produced in glycolysis to NADPH, which can enhance the production of aldehydes, alkanes and/or alkenes.

[0259] For small scale production, the engineered host cells can be grown in batches of, for example, around 100 mL, 500 mL, 1 L, 2 L, 5 L, or 10 L; fermented; and induced to express desired aldehydes, fatty alcohols, alkanes and/or alkenes based on the specific genes encoded in the appropriate plasmids. For example, E. coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the aldehyde, fatty alcohol, alkane, or alkene synthesis pathway) as well as pUMVC1 (with kanamycin resistance and the acetyl CoA/malonyl CoA overexpression system) can be incubated overnight in 2 L flasks at 37 C. shaken at >200 rpm in 500 mL LB medium supplemented with 75 g/mL ampicillin and 50 g/mL kanamycin until cultures reach an OD.sub.600 of >0.8. Upon achieving an OD.sub.600 of >0.8, the cells can be supplemented with 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating UmuC and UmuD proteins. Induction can be performed for 6 hrs at 30 C. After incubation, the media can be examined for aldehydes, fatty alcohols, alkanes and/or alkenes using GC-MS.

[0260] For large scale production, the engineered host cells can be grown in batches of 10 L, 100 L, 1000 L, or larger; fermented; and induced to express desired aldehydes, fatty alcohols, alkanes and/or alkenes based on the specific genes encoded in the appropriate plasmids. For example, E. coli BL21(DE3) cells harboring pBAD24 (with ampicillin resistance and the aldehyde and/or alkane synthesis pathway) as well as pUMVC1 (with kanamycin resistance and the acetyl-CoA/malonyl-CoA overexpression system) can be incubated from a 500 mL seed culture for 10 L fermentations (5 L for 100 L fermentations, etc.) in LB media (glycerol free) with 50 g/mL kanamycin and 75 g/mL ampicillin at 37 C., and shaken at >200 rpm until cultures reach an OD.sub.600 of >0.8 (typically 16 hrs). Media can be continuously supplemented to maintain 25 mM sodium proprionate (pH 8.0) to activate the engineered gene systems for production and to stop cellular proliferation by activating umuC and umuD proteins. Media can be continuously supplemented with glucose to maintain a concentration 25 g/100 mL.

[0261] After the first hour of induction, aliquots of no more than 10% of the total cell volume can be removed each hour and allowed to sit without agitation to allow the aldehydes, alkanes and/or alkenes to rise to the surface and undergo a spontaneous phase separation. The aldehyde, fatty alcohols, alkane and/or alkene component can then be collected, and the aqueous phase returned to the reaction chamber. The reaction chamber can be operated continuously. When the OD.sub.600 drops below 0.6, the cells can be replaced with a new batch grown from a seed culture.

Producing Aldehydes, Fatty Alcohols, Alkanes and Alkenes Using Cell-Free Methods

[0262] In some methods described herein, an aldehyde, fatty alcohols, alkane and/or alkene can be produced using a purified polypeptide described herein and a substrate described herein. For example, a host cell can be engineered to express aldehyde, fatty alcohols, alkane and/or alkene biosynthetic polypeptide or variant as described herein. The host cell can be cultured under conditions suitable to allow expression of the polypeptide. Cell free extracts can then be generated using known methods. For example, the host cells can be lysed using detergents or by sonication. The expressed polypeptides can be purified using known methods. After obtaining the cell free extracts, substrates described herein can be added to the cell free extracts and maintained under conditions to allow conversion of the substrates to aldehydes, fatty alcohols, alkanes and/or alkenes. The aldehydes, fatty alcohols, alkanes and/or alkenes can then be separated and purified using known techniques.

Post-Production Processing

[0263] The aldehydes, fatty alcohols, alkanes and/or alkenes produced during fermentation can be separated from the fermentation media. Any known technique for separating aldehydes, fatty alcohols, alkanes and/or alkenes from aqueous media can be used. One exemplary separation process is a two phase (bi-phasic) separation process. This process involves fermenting the genetically engineered host cells under conditions sufficient to produce an aldehyde, fatty alcohols, alkane and/or alkene, allowing the aldehyde, fatty alcohols, alkane and/or alkene to collect in an organic phase, and separating the organic phase from the aqueous fermentation broth. This method can be practiced in both a batch and continuous fermentation setting.

[0264] Bi-phasic separation uses the relative immiscibility of aldehydes, fatty alcohols, alkanes and/or alkenes to facilitate separation. Immiscible refers to the relative inability of a compound to dissolve in water and is defined by the compound's partition coefficient. One of ordinary skill in the art will appreciate that by choosing a fermentation broth and organic phase, such that the aldehyde, alkane and/or alkene being produced has a high log P value, the aldehyde, alkane and/or alkene can separate into the organic phase, even at very low concentrations, in the fermentation vessel.

[0265] The aldehydes, fatty alcohols, alkanes and/or alkenes produced by the methods described herein can be relatively immiscible in the fermentation broth, as well as in the cytoplasm. Therefore, the aldehyde, fatty alcohols, alkane and/or alkene can collect in an organic phase either intracellularly or extracellularly. The collection of the products in the organic phase can lessen the impact of the aldehyde, fatty alcohols, alkane and/or alkene on cellular function and can allow the host cell to produce more product.

[0266] The methods described herein can result in the production of homogeneous compounds wherein at least about 60%, 70%, 80%, 90%, or 95% of the aldehydes, fatty alcohols, alkanes and/or alkenes produced will have carbon chain lengths that vary by less than about 6 carbons, less than about 4 carbons, or less than about 2 carbons. These compounds can also be produced with a relatively uniform degree of saturation. These compounds can be used directly as fuels, fuel additives, specialty chemicals, starting materials for production of other chemical compounds (e.g., polymers, surfactants, plastics, textiles, solvents, adhesives, etc.), or personal care product additives. These compounds can also be used as feedstock for subsequent reactions, for example, hydrogenation, catalytic cracking (via hydrogenation, pyrolisis, or both), to make other products.

[0267] In some embodiments, the aldehydes, fatty alcohols, alkanes and/or alkenes produced using methods described herein can contain between about 50% and about 90% carbon; or between about 5% and about 25% hydrogen. In other embodiments, the aldehydes, fatty alcohols, alkanes and/or alkenes produced using methods described herein can contain between about 65% and about 85% carbon; or between about 10% and about 15% hydrogen.

Fuel Compositions and Specialty Chemical Compositions

[0268] The aldehydes, fatty alcohols, alkanes and/or alkenes described herein can be used as or converted into a fuel or as a specialty chemical. One of ordinary skill in the art will appreciate that, depending upon the intended purpose of the fuel or specialty chemical, different aldehydes, fatty alcohols, alkanes and/or alkenes can be produced and used. For example, a branched aldehyde, fatty alcohol, alkane and/or alkene may be desirable for automobile fuel that is intended to be used in cold climates. In addition, when the aldehydes, fatty alcohols, alkanes and/or alkenes described herein are used as a feedstock for fuel or specialty chemical production, one of ordinary skill in the art will appreciate that the characteristics of the aldehyde, fatty alcohol, alkane and/or alkene feedstock will affect the characteristics of the fuel or specialty chemical produced. Hence, the characteristics of the fuel or specialty chemical product can be selected for by producing particular aldehydes, fatty alcohols, alkanes and/or alkenes for use as a feedstock.

[0269] Using the methods described herein, biofuels having desired fuel qualities can be produced from aldehydes, fatty alcohols, alkanes and/or alkenes. Biologically produced aldehydes, fatty alcohols, alkanes and/or alkenes represent a new source of biofuels, which can be used as jet fuel, diesel, or gasoline. Some biofuels made using aldehydes, fatty alcohols, alkanes and/or alkenes have not been produced from renewable sources and are new compositions of matter. These new fuels or specialty chemicals can be distinguished from fuels or specialty chemicals derived from petrochemical carbon on the basis of dual carbon-isotopic fingerprinting. Additionally, the specific source of biosourced carbon (e.g., glucose vs. glycerol) can be determined by dual carbon-isotopic fingerprinting (see, e.g., U.S. Pat. No. 7,169,588, in particular col. 4, line 31, to col. 6, line 8).

[0270] The aldehydes, fatty alcohols, alkanes and/or alkenes and the associated biofuels, specialty chemicals, and mixtures can be distinguished from their petrochemical derived counterparts on the basis of .sup.14C (f.sub.M) and dual carbon-isotopic fingerprinting. In some examples, the aldehyde, fatty alcohol, alkane and/or alkene in the biofuel composition can have a fraction of modern carbon (f.sub.M 14C) of, for example, at least about 1.003, 1.010, or 1.5.

[0271] In some examples, a biofuel composition can be made that includes aldehydes, fatty alcohols, alkanes and/or alkenes having .sup.3C of from about 15.4 to about 10.9, where the aldehydes, fatty alcohols, alkanes and/or alkenes account for at least about 85% of biosourced material (i.e., derived from a renewable resource, such as biomass, cellulosic materials, and sugars) in the composition.

[0272] The ability to distinguish these biologically derived products is beneficial in tracking these materials in commerce. For example, fuels or specialty chemicals comprising both biologically derived and petroleum-based carbon isotope profiles can be distinguished from fuels and specialty chemicals made only of petroleum-based materials. Thus, the aldehydes, fatty alcohols, alkanes and/or alkenes described herein can be followed in commerce or identified in commerce as a biofuel on the basis of their unique profile. In addition, other competing materials can be identified as being biologically derived or derived from a petrochemical source.

[0273] Fuel additives are used to enhance the performance of a fuel or engine. For example, fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity, viscosity, oxidative stability, ignition quality, octane level, and/or flash point. In the United States, all fuel additives must be registered with Environmental Protection Agency. The names of fuel additives and the companies that sell the fuel additives are publicly available by contacting the EPA or by viewing the agency's website. One of ordinary skill in the art will appreciate that the aldehyde- and/or alkane-based biofuels described herein can be mixed with one or more fuel additives to impart a desired quality.

[0274] The aldehyde, fatty alcohols, alkane and/or alkene-based biofuels described herein can be mixed with other fuels, such as various alcohols, such as ethanol and butanol, and petroleum-derived products, such as gasoline, diesel, or jet fuel.

[0275] In some examples, the mixture can include at least about 10%, 15%, 20%, 30%, 40%, 50%, or 60% by weight of the aldehyde, fatty alcohols, alkane, or alkene. In other examples, a biofuel composition can be made that includes at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% of an aldehyde, fatty alcohols, alkane, or alkene that includes a carbon chain that is 8, 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 carbons in length. Such biofuel compositions can additionally include at least one additive selected from a cloud point lowering additive that can lower the cloud point to less than about 5 C., or 0 C.; a surfactant; a microemulsion; at least about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, or 95% diesel fuel from triglycerides; petroleum-derived gasoline; or diesel fuel from petroleum.

EXAMPLES

[0276] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Example 1. Detection and Verification of Alkane Biosynthesis in Selected Cyanobacteria

[0277] Seven cyanobacteria, whose complete genome sequences are publicly available, were selected for verification and/or detection of alkane biosynthesis: Synechococcus elongatus PCC7942, Synechococcus elongatus PCC6301, Anabaena variabilis ATCC29413, Synechocystis sp. PCC6803, Nostoc punctiforme PCC73102, Gloeobacter violaceus ATCC 29082, and Prochlorococcus marinus CCMP1986. Only the first three cyanobacterial strains from this list had previously been reported to contain alkanes (Han et al., J. Am. Chem. Soc. 91:5156-5159 (1969); Fehler et al., Biochem. 9:418-422 (1970)). The strains were grown photoautotrophically in shake flasks in 100 mL of the appropriate media (listed in Table 8) for 3-7 days at 30 C. at a light intensity of approximately 3,500 lux. Cells were extracted for alkane detection as follows: cells from 1 mL culture volume were centrifuged for 1 min at 13,000 rpm, the cell pellets were resuspended in methanol, vortexed for 1 min and then sonicated for 30 min. After centrifugation for 3 min at 13,000 rpm, the supernatants were transferred to fresh vials and analyzed by GC-MS. The samples were analyzed on either 30 m DP-5 capillary column (0.25 mm internal diameter) or a 30 m high temperature DP-5 capillary column (0.25 mm internal diameter) using the following method.

[0278] After a 1 L splitless injection (inlet temperature held at 300 C.) onto the GC/MS column, the oven was held at 100 C. for 3 mins. The temperature was ramped up to 320 C. at a rate of 20 C./min. The oven was held at 320 C. for an additional 5 min. The flow rate of the carrier gas helium was 1.3 mL/min. The MS quadrapole scanned from 50 to 550 m/z. Retention times and fragmentation patterns of product peaks were compared with authentic references to confirm peak identity.

[0279] Out of the seven strains, six produced mainly heptadecane and one produced pentadecane (P. marinus CCMP1986); one of these strains produced methyl-heptadecane in addition to heptadecane (A. variabilis ATCC29413) (see Table 8). Therefore, alkane biosynthesis in three previously reported cyanobacteria was verified, and alkane biosynthesis was detected in four cyanobacteria that were not previously known to produce alkanes: P. marinus CCMP1986 (see FIG. 1), N. punctiforme PCC73102 (see FIG. 2), G. violaceus ATCC 29082 (see FIG. 3) and Synechocystis sp. PCC6803 (see FIG. 4).

[0280] FIG. 1A depicts the GC/MS trace of Prochlorococcus marinus CCMP1986 cells extracted with methanol. The peak at 7.55 min had the same retention time as pentadecane (Sigma). In FIG. 1B, the mass fragmentation pattern of the pentadecane peak is shown. The 212 peak corresponds to the molecular weight of pentadecane.

[0281] FIG. 2A depicts the GC/MS trace of Nostoc punctiforme PCC73102 cells extracted with methanol. The peak at 8.73 min has the same retention time as heptadecane (Sigma). In FIG. 2B, the mass fragmentation pattern of the heptadecane peak is shown. The 240 peak corresponds to the molecular weight of heptadecane.

[0282] FIG. 3A depicts the GC/MS trace of Gloeobaceter violaceus ATCC29082 cells extracted with methanol. The peak at 8.72 min has the same retention time as heptadecane (Sigma). In FIG. 3B, the mass fragmentation pattern of the heptadecane peak is shown. The 240 peak corresponds to the molecular weight of heptadecane.

[0283] FIG. 4A depicts the GC/MS trace of Synechocystic sp. PCC6803 cells extracted with methanol. The peak at 7.36 min has the same retention time as heptadecane (Sigma). In FIG. 4B, the mass fragmentation pattern of the heptadecane peak is shown. The 240 peak corresponds to the molecular weight of heptadecane.

TABLE-US-00008 TABLE 8 Hydrocarbons detected in selected cyanobacteria Alkanes Cyanobacterium ATCC# Genome Medium reported verified .sup.2 Synechococcus elongatus PCC7942 27144 2.7 Mb BG-11 C17:0 C17:0, C15:0 Synechococcus elongatus PCC6301 33912 2.7 Mb BG-11 C17:0 C17:0, C15:0 Anabaena variabilis 29413 6.4 Mb BG-11 C17:0, 7- or 8-Me-C17:0 C17:0, Me-C17:0 Synechocystis sp. PCC6803 27184 3.5 Mb BG-11 C17:0, C15:0 Prochlorococcus marinus CCMP1986 .sup.1 1.7 Mb C15:0 Nostoc punctiforme PCC73102 29133 9.0 Mb ATCC819 C17:0 Gloeobacter violaceus 29082 4.6 Mb BG11 C17:0 .sup.1 cells for extraction were a gift from Jacob Waldbauer (MIT) .sup.2 major hydrocarbon is in bold

[0284] Genomic analysis yielded two genes that were present in the alkane-producing strains. The Synechococcus elongatus PCC7942 homologs of these genes are depicted in Table 9 and are Synpcc7942_1593 (SEQ ID NO:1) and Synpcc7942_1594 (SEQ ID NO:65).

TABLE-US-00009 TABLE 9 Alkane-producing cyanobacterial genes Gene Object Genbank ID Locus Tag accession Gene Name Length COG Pfam InterPro Notes 637800026 Synpcc7942_1593 YP_400610 hypothetical protein 231 aa pfam02915 IPR009078 ferritin/ribonucleotide IPR003251 reductase-like rubreryhtrin 637800027 Synpcc7942_1594 YP_400611 hypothetical protein 341 aa COG5322 pfam00106 IPR000408 predicted dehydrogenase IPR016040 NAD(P)-binding IPR002198 short chain dehydrogenase

Example 2. Deletion of the Sll0208 and Sll0209 Genes in Synechocystis sp. PCC6803 Leads to Loss of Alkane Biosynthesis

[0285] The genes encoding the putative decarbonylase (sll0208; NP_442147) (SEQ ID NO:3) and aldehyde-generating enzyme (sll0209; NP_442146) (SEQ ID NO:67) of Synechocystis sp. PCC6803 were deleted as follows. Approximately 1 kb of upstream and downstream flanking DNA were amplified using primer sll0208/9-KO1 (CGCGGATCCCTTGATTCTACTGCGGCGAGT) with primer sll0208/9-KO2 (CACGCACCTAGGTTCACACTCCCATGGTATAACAGGGGCGTTGGACTCC TGTG) and primer sll0208/9-KO3 (GTTATACCATGGGAGTGTGAACCTAGGTGCGTGGCCGACAGGATAGGG-CGTGT) with primer sll0208/9-KO4 (CGCGGATCCAACGCATCCTCACTAGTCGGG), respectively. The PCR products were used in a cross-over PCR with primers sll0208/9-KO1 and sll0208/9-KO4 to amplify the approximately 2 kb sll0208/sll0209 deletion cassette, which was cloned into the BamHI site of the cloning vector pUC19. A kanamycin resistance cassette (aph, KanR) was then amplified from plasmid pRL27 (Larsen et al., Arch. Microbiol. 178:193 (2002)) using primers Kan-aph-F (CATGCCATGGAAAGCCACGTTGTGTCTCAAAATCTCTG) and Kan-aph-R (CTAGTCTAGAGCGCTGAGGTCTGCCTCGTGAA), which was then cut with NcoI and XbaI and cloned into the NcoI and AvrII sites of the s10208/sll0209 deletion cassette, creating a sll0208/sll0209-deletion KanR-insertion cassette in pUC19. The cassette-containing vector, which does not replicate in cyanobacteria, was transformed into Synechocystis sp. PCC6803 (Zang et al., 2007, J. Microbiol., vol. 45, pp. 241) and transformants (e.g., chromosomal integrants by double-homologous recombination) were selected on BG-11 agar plates containing 100 g/mL Kanamycin in a light-equipped incubator at 30 C. Kanamycin resistant colonies were restreaked once and then subjected to genotypic analysis using PCR with diagnostic primers.

[0286] Confirmed deletion-insertion mutants were cultivated in 12 mL of BG11 medium with 50 g/mL Kanamycin for 4 days at 30 C. in a light-equipped shaker-incubator. 1 mL of broth was then centrifuged (1 min at 13,000 g) and the cell pellets were extracted with 0.1 mL methanol. After extraction, the samples were again centrifuged and the supernatants were subjected to GC-MS analysis as described in Example 1.

[0287] As shown in FIG. 5, the Synechocystis sp. PCC6803 strains in which the sll0208 and sll0209 genes were deleted lost their ability to produce heptadecene and octadecenal. This result demonstrates that the sll0208 and sll0209 genes in Synechocystis sp. PCC6803 and the orthologous genes in other cyanobacteria (see Table 1) are responsible for alkane and fatty aldehyde biosynthesis in these organisms.

Example 3. Production of Fatty Aldehydes and Fatty Alcohols in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594

[0288] The genomic DNA encoding Synechococcus elongatus PCC7942 orf1594 (YP_400611; putative aldehyde-generating enzyme) (SEQ ID NO:65) was amplified and cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.trc promoter. The resulting construct (OP80-PCC7942_1594) was transformed into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media with 1% (w/v) glucose as carbon source and supplemented with 100 g/mL spectinomycin. When the culture reached OD.sub.600 of 0.8-1.0, it was induced with 1 mM IPTG and cells were grown for an additional 18-20 h at 37 C. Cells from 0.5 mL of culture were extracted with 0.5 mL of ethyl acetate. After sonication for 60 min, the sample was centrifuged at 15,000 rpm for 5 min. The solvent layer was analyzed by GC-MS as described in Example 1.

[0289] As shown in FIG. 6, E. coli cells transformed with the Synechococcus elongatus PCC7942 orf1594-bearing vector produced the following fatty aldehydes and fatty alcohols: hexadecanal, octadecenal, tetradecenol, hexadecenol, hexadecanol and octadecenol. This result indicates that PCC7942 orf1594 (i) generates aldehydes in-vivo as possible substrates for decarbonylation and (ii) may reduce acyl-ACPs as substrates, which are the most abundant form of activated fatty acids in wild type E. coli cells. Therefore, the enzyme was named Acyl-ACP reductase. In-vivo, the fatty aldehydes apparently are further reduced to the corresponding fatty alcohols by an endogenous E. coli aldehyde reductase activity.

Example 4. Production of Fatty Aldehydes and Fatty Alcohols in E. coli Through Heterologous Expression of Cyanothece sp. ATCC51142 Cce_1430

[0290] The genomic DNA encoding Cyanothece sp. ATCC51142 cce_1430 (YP_001802846; putative aldehyde-generating enzyme) (SEQ ID NO:69) was amplified and cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.trc promoter. The resulting construct was transformed into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media with 1% (w/v) glucose as carbon source and supplemented with 100 g/mL spectinomycin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0291] As shown in FIG. 7, E. coli cells transformed with the Cyanothece sp. ATCC51142 cce_1430-bearing vector produced the following fatty aldehydes and fatty alcohols: hexadecanal, octadecenal, tetradecenol, hexadecenol, hexadecanol and octadecenol. This result indicates that ATCC51142 cce_1430 (i) generates aldehydes in-vivo as possible substrates for decarbonylation and (ii) may reduce acyl-ACPs as substrates, which are the most abundant form of activated fatty acids in wild type E. coli cells. Therefore, this enzyme is also an Acyl-ACP reductase.

Example 5. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Synechococcus elongatus PCC7942 Orf1593

[0292] The genomic DNA encoding Synechococcus elongatus PCC7942 orf1593 (YP_400610; putative decarbonylase) (SEQ ID NO:1) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0293] As shown in FIG. 8, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and S. elongatus PCC7942_1593-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that PCC7942_1593 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 6. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Nostoc punctiforme PCC73102 Npun02004178

[0294] The genomic DNA encoding Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838; putative decarbonylase) (SEQ ID NO:5) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0295] As shown in FIG. 9, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and N. punctiforme PCC73102 Npun02004178-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also tridecane, pentadecene, pentadecane and heptadecene. This result indicates that Npun02004178 in E. coli converts tetradecanal, hexadecenal, hexadecanal and octadecenal to tridecane, pentadecene, pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 7. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Synechocystis sp. PCC6803 sll0208

[0296] The genomic DNA encoding Synechocystis sp. PCC6803 sll0208 (NP_442147; putative decarbonylase) (SEQ ID NO:3) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.t.c promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0297] As shown in FIG. 10, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Synechocystis sp. PCC6803 sll0208-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that Npun02004178 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 8. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Nostoc sp. PCC7210 Alr5283

[0298] The genomic DNA encoding Nostoc sp. PCC7210 alr5283 (NP_489323; putative decarbonylase) (SEQ ID NO:7) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0299] As shown in FIG. 11, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Nostoc sp. PCC7210 alr5283-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that alr5283 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 9. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Acaryochloris Marina MBIC11017 AM1_4041

[0300] The genomic DNA encoding Acaryochloris marina MBIC11017 AM1_4041 (YP_001518340; putative decarbonylase) (SEQ ID NO:9) was codon optimized for expression in E. coli (SEQ ID NO:46), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0301] As shown in FIG. 12, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and A. marina MBIC11017 AM1_4041-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also tridecane, pentadecene, pentadecane and heptadecene. This result indicates that AM1_4041 in E. coli converts tetradecanal, hexadecenal, hexadecanal and octadecenal to tridecane, pentadecene, pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 10. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Thermosynechococcus elongatus BP-1 Tll1313

[0302] The genomic DNA encoding Thermosynechococcus elongatus BP-1 tll1313 (NP_682103; putative decarbonylase) (SEQ ID NO:11) was codon optimized for expression in E. coli (SEQ ID NO:47), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0303] As shown in FIG. 13, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and T. elongatus BP-1 tll1313-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that tll1313 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 11. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Synechococcus sp. JA-3-3Ab CYA_0415

[0304] The genomic DNA encoding Synechococcus sp. JA-3-3Ab CYA_0415 (YP_473897; putative decarbonylase) (SEQ ID NO:13) was codon optimized for expression in E. coli (SEQ ID NO:48), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0305] As shown in FIG. 14, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Synechococcus sp. JA-3-3Ab CYA_0415-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that Npun02004178 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 12. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Gloeobacter violaceus PCC7421 Gll3146

[0306] The genomic DNA encoding Gloeobacter violaceus PCC7421 gll3146 (NP_926092; putative decarbonylase) (SEQ ID NO:15) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.t.c promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0307] As shown in FIG. 15, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and G. violaceus PCC7421 gll3146-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that gll3146 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 13. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Prochlorococcus marinus MIT9313 PMT1231

[0308] The genomic DNA encoding Prochlorococcus marinus MIT9313 PMT1231 (NP_895059; putative decarbonylase) (SEQ ID NO:17) was codon optimized for expression in E. coli (SEQ ID NO:49), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0309] As shown in FIG. 16, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and P. marinus MIT9313 PMT1231-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that PMT1231 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 14. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Prochlorococcus marinus CCMP1986 PMM0532

[0310] The genomic DNA encoding Prochlorococcus marinus CCMP1986 PMM0532 (NP_892650; putative decarbonylase) (SEQ ID NO:19) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0311] As shown in FIG. 17, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and P. marinus CCMP1986 PMM0532-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that PMM0532 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 15. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Prochlorococcus mariunus NATL2A PMN2A_1863

[0312] The genomic DNA encoding Prochlorococcus mariunus NATL2A PMN2A_1863 (YP_293054; putative decarbonylase) (SEQ ID NO:21) was codon optimized for expression in E. coli (SEQ ID NO:51), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0313] As shown in FIG. 18, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and P. mariunus NATL2A PMN2A_1863-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that PMN2A_1863 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 16. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Synechococcus sp. RS9917 RS9917_09941

[0314] The genomic DNA encoding Synechococcus sp. RS9917 RS9917_09941 (ZP_01079772; putative decarbonylase) (SEQ ID NO:23) was codon optimized for expression in E. coli (SEQ ID NO:52), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0315] As shown in FIG. 19, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Synechococcus sp. RS9917 RS9917_09941-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that RS9917_09941 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 17. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Synechococcus sp. RS9917 RS9917_12945

[0316] The genomic DNA encoding Synechococcus sp. RS9917 RS9917_12945 (ZP_01080370; putative decarbonylase) (SEQ ID NO:25) was codon optimized for expression in E. coli (SEQ ID NO:53), synthesized, and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0317] As shown in FIG. 20, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Synechococcus sp. RS9917 RS9917_12945-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also pentadecane and heptadecene. This result indicates that RS9917_12945 in E. coli converts hexadecanal and octadecenal to pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 18. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Cyanothece Sp. ATCC51142 Cce_0778

[0318] The genomic DNA encoding Cyanothece sp. ATCC51142 cce_0778 (YP_001802195; putative decarbonylase) (SEQ ID NO:27) was synthesized and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0319] As shown in FIG. 21, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Cyanothece sp. ATCC51142 cce_0778-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also tridecane, pentadecene, pentadecane and heptadecene. This result indicates that ATCC51142 cce_0778 in E. coli converts tetradecanal, hexadecenal, hexadecanal and octadecenal to tridecane, pentadecene, pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 19. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Cyanothece sp. PCC7425 Cyan7425_0398

[0320] The genomic DNA encoding Cyanothece sp. PCC7425 Cyan7425_0398 (YP_002481151; putative decarbonylase) (SEQ ID NO:29) was synthesized and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0321] As shown in FIG. 22, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Cyanothece sp. PCC7425 Cyan7425_0398-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also tridecane, pentadecene, pentadecane and heptadecene. This result indicates that Cyan7425_0398in E. coli converts tetradecanal, hexadecenal, hexadecanal and octadecenal to tridecane, pentadecene, pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 20. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Cyanothece sp. PCC7425 Cyan7425_2986

[0322] The genomic DNA encoding Cyanothece sp. PCC7425 Cyan7425_2986 (YP_002483683; putative decarbonylase) (SEQ ID NO:31) was synthesized and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0323] As shown in FIG. 23, E. coli cells cotransformed with the S. elongatus PCC7942_1594 and Cyanothece sp. PCC7425 Cyan7425_2986-bearing vectors produced the same fatty aldehydes and fatty alcohols as in Example 3, but also tridecane, pentadecene, pentadecane and heptadecene. This result indicates that Cyan7425_2986 in E. coli converts tetradecanal, hexadecenal, hexadecanal and octadecenal to tridecane, pentadecene, pentadecane and heptadecene, respectively, and therefore is an active fatty aldehyde decarbonylase.

Example 21. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Prochlorococcus marinus CCMP1986 PMM0533 and Prochlorococcus mariunus CCMP1986 PMM0532

[0324] The genomic DNA encoding P. mariunus CCMP1986 PMM0533 (NP_892651; putative aldehyde-generating enzyme) (SEQ ID NO:71) and Prochlorococcus mariunus CCMP1986 PMM0532 (NP_892650; putative decarbonylase) (SEQ ID NO:19) were amplified and cloned into the NcoI and EcoRI sites of vector OP-80 and the NdeI and XhoI sites of vector OP-183, respectively. The resulting constructs were separately transformed and cotransformed into E. coli MG1655 and the cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0325] As shown in FIG. 24A, E. coli cells transformed with only the P. mariunus CCMP1986 PMM0533-bearing vector did not produce any fatty aldehydes or fatty alcohols. However, E. coli cells cotransformed with PMM0533 and PMM0532-bearing vectors produced hexadecanol, pentadecane and heptadecene (FIG. 24B). This result indicates that PMM0533 only provides fatty aldehyde substrates for the decarbonylation reaction when it interacts with a decarbonylase, such as PMM0532.

Example 22. Production of Alkanes and Alkenes in a Fatty Acyl-CoA-Producing E. coli Strain Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Acaryochloris marina MBIC11017 AM1_4041

[0326] The genomic DNA encoding Acaryochloris marina MBIC11017 AM1_4041 (YP_001518340; putative fatty aldehyde decarbonylase) (SEQ ID NO:9) was synthesized and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting construct was cotransformed with OP80-PCC7942_1594 into E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD. This strain expresses a cytoplasmic version of the E. coli thioesterase, TesA, and the E. coli acyl-CoA synthetase, FadD, under the control of the P.sub.trc promoter, and therefore produces fatty acyl-CoAs. The cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0327] As shown in FIG. 25, these E. coli cells cotransformed with S. elongatus PCC7942_1594 and A. marina MBIC11017 AM1_4041 also produced alkanes and fatty alcohols. This result indicates that S. elongatus PCC7942_1594 is able to use acyl-CoA as a substrate to produce hexadecenal, hexadecanal and octadecenal, which is then converted into pentadecene, pentadecane and heptadecene, respectively, by A. marina MBIC11017 AM1_4041.

Example 23. Production of Alkanes and Alkenes in a Fatty Acyl-CoA-Producing E. coli Strain Through Heterologous Expression of Synechocystis sp. PCC6803 Sll0209 and Synechocystis sp. PCC6803 Sll0208

[0328] The genomic DNA encoding Synechocystis sp. PCC6803 sll0208 (NP_442147; putative fatty aldehyde decarbonylase) (SEQ ID NO:3) was synthesized and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The genomic DNA encoding Synechocystis sp. PCC6803 sll0209 (NP_442146; acyl-ACP reductase) (SEQ ID NO:67) was synthesized and cloned into the NcoI and EcoRI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting constructs were cotransformed with into E. coli MG1655 fadE lacZ::P.sub.trc tesA-fadD. This strain expresses a cytoplasmic version of the E. coli thioesterase, TesA, and the E. coli acyl-CoA synthetase, FadD, under the control of the P.sub.trc promoter, and therefore produces fatty acyl-CoAs. The cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 26.

[0329] As shown in FIG. 26, these E. coli cells transformed with Synechocystis sp. PCC6803 sll0209 did not produce any fatty aldehydes or fatty alcohols. However, when cotransformed with Synechocystis sp. PCC6803 sll0208 and sll0209, they produced alkanes, fatty aldehydes and fatty alcohols. This result indicates that Synechocystis sp. PCC6803 sll0209 is able to use acyl-CoA as a substrate to produce fatty aldehydes such as tetradecanal, hexadecanal and octadecenal, but only when coexpressed with a fatty aldehyde decarbonylase. The fatty aldehydes apparently are further reduced to the corresponding fatty alcohols, tetradecanol, hexadecanol and octadecenol, by an endogenous E. coli aldehyde reductase activity. In this experiment, octadecenal was converted into heptadecene by Synechocystis sp. PCC6803 sll0208.

Example 24. Production of Alkanes and Alkenes in a Fatty Aldehyde-Producing E. coli Strain Through Heterologous Expression of Nostoc punctiforme PCC73102 Npun02004178 and Several of its Homologs

[0330] The genomic DNA encoding Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838; putative fatty aldehyde decarbonylase) (SEQ ID NO:5) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The genomic DNA encoding Mycobacterium smegmatis strain MC2 155 orf MSMEG_5739 (YP_889972, putative carboxylic acid reductase) (SEQ ID NO:85) was amplified and cloned into the NcoI and EcoRI sites of vector OP-180 (pCL1920 derivative) under the control of the P.sub.trc promoter. The two resulting constructs were cotransformed into E. coli MG1655 fadD lacZ::P.sub.trc-tesA. In this strain, fatty aldehydes were provided by MSMEG_5739, which reduces free fatty acids (formed by the action of TesA) to fatty aldehydes. The cells were grown at 37 C. in M9 minimal media supplemented with 100 g/mL spectinomycin and 100 g/mL carbenicillin. The cells were cultured and extracted as in Example 3 and analyzed by GC-MS as described in Example 1.

[0331] As shown in FIG. 27, these E. coli cells cotransformed with the N. punctiforme PCC73102 Npun02004178 and M. smegmatis strain MC2 155 MSMEG_5739-bearing vectors produced tridecane, pentadecene and pentadecane. This result indicates that Npun02004178 in E. coli converts tetradecanal, hexadecenal and hexadecanal provided by the carboxylic acid reductase MSMEG_5739 to tridecane, pentadecene and pentadecane. As shown in FIG. 28, in the same experimental set-up, the following fatty aldehyde decarbonylases also converted fatty aldehydes provided by MSMEG_5739 to the corresponding alkanes when expressed in E. coli MG1655 fadD lacZ::P.sub.trc-tesA: Nostoc sp. PCC7210 alr5283 (SEQ ID NO:7), P. mariunus CCMP1986 PMM0532 (SEQ ID NO:19), G. violaceus PCC7421 gll3146 (SEQ ID NO:15), Synechococcus sp. RS9917_09941 (SEQ ID NO:23), Synechococcus sp. RS9917_12945 (SEQ ID NO:25), and A. marina MBIC11017 AM1_4041 (SEQ ID NO:9).

Example 25: Cyanobacterial Fatty Aldehyde Decarbonylases Belong to the Class of Non-Heme Diiron Proteins. Site-Directed Mutagenesis of Conserved Histidines to Phenylalanines in Nostoc punctiforme PCC73102 Npun02004178 does not Abolish its Catalytic Function

[0332] As discussed in Example 13, the hypothetical protein PMT1231 from Prochlorococcus marinus MIT9313 (SEQ ID NO:18) is an active fatty aldehyde decarbonylase. Based on the three-dimensional structure of PMT1231, which is available at 1.8 resolution (pdb2OC5A) (see FIG. 29B), cyanobacterial fatty aldehyde decarbonylases have structural similarity with non-heme diiron proteins, in particular with class I ribonuclease reductase subunit proteins, RNR (Stubbe and Riggs-Gelasco, TIBS 1998, vol. 23., pp. 438) (see FIG. 29A). Class Ia and Ib RNR contains a diferric tyrosyl radical that mediates the catalytic activity of RNR (reduction of ribonucleotides to deoxyribonucleotides). In E. coli RNR, this tyrosine is in position 122 and is in close proximity to one of the active site's iron molecules. Structural alignment showed that PMT1231 contained a phenylalanine in the same position as RNRb tyr122, suggesting a different catalytic mechanism for cyanobacterial fatty aldehyde decarbonylases. However, an alignment of all decarbonylases showed that two tyrosine residues were completely conserved in all sequences, tyr135 and tyr138 with respect to PMT1231, with tyr135 being in close proximity (5.5 ) to one of the active site iron molecules (see FIG. 29C). To examine whether either of the two conserved tyrosine residues is involved in the catalytic mechanism of cyanobacterial fatty aldehyde decarbonylases, these residues were replaced with phenylalanine in Npun02004178 (tyr123 and tyr126) as follows.

[0333] The genomic DNA encoding S. elongatus PCC7942 ORF1594 (SEQ ID NO:65) was cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.trc promoter. The genomic DNA encoding N. punctiforme PCC73102 Npun02004178 (SEQ ID NO:5) was also cloned into the NdeI and XhoI sites of vector OP-183 (pACYC177 derivative) under the control of the P.sub.trc promoter. The latter construct was used as a template to introduce a mutation at positions 123 and 126 of the decarbonylase protein, changing the tyrosines to phenylalanines using the primers gttttgcgatcgcagcatttaacatttacatccccgttgccgacg and gttttgcgatcgcagcatataacattttcatccccgttgccgacg, respectively. The resulting constructs were then transformed into E. coli MG1655. The cells were grown at 37 C. in M9 minimal media supplemented with 1% glucose (w/v), and 100 g/mL carbenicillin and spectinomycin. The cells were cultured and extracted as in Example 3.

[0334] As shown in FIG. 30, the two Npun02004178 Tyr to Phe protein variants were active and produced alkanes when coexpressed with S. elongatus PCC7942 ORF1594. This result indicates that in contrast to class Ia and Ib RNR proteins, the catalytic mechanism of fatty aldehyde decarbonylases does not involve a tyrosyl radical.

Example 26: Biochemical Characterization of Nostoc punctiforme PCC73102 Npun02004178

[0335] The genomic DNA encoding N. punctiforme PCC73102 Npun2004178 (SEQ ID NO:5) was cloned into the NdeI and XhoI sites of vector pET-15b under the control of the T7 promoter. The resulting Npun02004178 protein contained an N-terminal His-tag. An E. coli BL21 strain (DE3) (Invitrogen) was transformed with the plasmid by routine chemical transformation techniques. Protein expression was carried out by first inoculating a colony of the E. coli strain in 5 mL of LB media supplemented with 100 mg/L of carbenicillin and shaken overnight at 37 C. to produce a starter culture. This starter cultures was used to inoculate 0.5 L of LB media supplemented with 100 mg/L of carbenecillin. The culture was shaken at 37 C. until an OD.sub.600 value of 0.8 was reached, and then IPTG was added to a final concentration of 1 mM. The culture was then shaken at 37 C. for approximately 3 additional h. The culture was then centrifuged at 3,700 rpm for 20 min at 4 C. The pellet was then resuspended in 10 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 supplemented with Bacterial ProteaseArrest (GBiosciences). The cells were then sonicated at 12 W on ice for 9 s with 1.5 s of sonication followed by 1.5 s of rest. This procedure was repeated 5 times with one min intervals between each sonication cycle. The cell free extract was centrifuged at 10,000 rpm for 30 min at 4 C. 5 mL of Ni-NTA (Qiagen) was added to the supernatant and the mixture was gently stirred at 4 C. The slurry was passed over a column removing the resin from the lysate. The resin was then washed with 30 mL of buffer containing 100 mM sodium phosphate buffer at pH 7.2 plus 30 mM imidazole. Finally, the protein was eluted with 10 mL of 100 mM sodium phosphate buffer at pH 7.2 plus 250 mM imidazole. The protein solution was dialyzed with 200 volumes of 100 mM sodium phosphate buffer at pH 7.2 with 20% glycerol. Protein concentration was determined using the Bradford assay (Biorad). 5.6 mg/mL of Npun02004178 protein was obtained.

[0336] To synthesize octadecanal for the decarbonylase reaction, 500 mg of octadecanol (Sigma) was dissolved in 25 mL of dichloromethane. Next, 200 mg of pyridinium chlorochromate (TCI America) was added to the solution and stirred overnight. The reaction mixture was dried under vacuum to remove the dichloromethane. The remaining products were resuspended in hexane and filtered through Whatman filter paper. The filtrate was then dried under vacuum and resuspended in 5 mL of hexane and purified by silica flash chromatography. The mixture was loaded onto the gravity fed column in hexane and then washed with two column volumes of hexane. The octadecanal was then eluted with an 8:1 mixture of hexane and ethyl acetate. Fractions containing octadecanal were pooled and analyzed using the GC/MS methods described below. The final product was 95% pure as determined by this method.

[0337] To test Npun02004178 protein for decarbonylation activity, the following enzyme assays were set-up. 200 L reactions were set up in 100 mM sodium phosphate buffer at pH 7.2 with the following components at their respective final concentrations: 30 M of purified Npun02004178 protein, 200 M octadecanal, 0.11 g/mL spinach ferredoxin (Sigma), 0.05 units/mL spinach ferredoxin reductase (Sigma), and 1 mM NADPH (Sigma). Negative controls included the above reaction without Npun02004178, the above reaction without octadecanal, and the above reaction without spinach ferredoxin, ferredoxin reductase and NADPH. Each reaction was incubated at 37 C. for 2 h before being extracted with 100 L ethyl acetate. Samples were analyzed by GC/MS using the following parameters: run time: 13.13 min; column: HP-5-MS Part No. 19091S-433E (length of 30 meters; I.D.: 0.25 mm narrowbore; film: 0.251M); inject: 111 Agilent 6850 inlet; inlet: 300 C splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 75 C. hold 5 min, 320 at 40 C./min, 320 hold 2 min; det: Agilent 5975B VL MSD; det. temp: 330 C.; scan: 50-550 M/Z. Heptadecane from Sigma was used as an authentic reference for determining compound retention time and fragmentation pattern.

[0338] As shown in FIG. 31, in-vitro conversion of octadecanal to heptadecane was observed in the presence of Npun02004178. The enzymatic decarbonylation of octadecanal by Npun02004178 was dependent on the addition of spinach ferredoxin reducatase, ferredoxin and NADPH.

[0339] Next, it was determined whether cyanobaterial ferredoxins and ferredoxin reductases can replace the spinach proteins in the in-vitro fatty aldehyde decarbonylase assay. The following four genes were cloned separately into the NdeI and XhoI sites of pET-15b: N. punctiforme PCC73102 Npun02003626 (ZP_00109192, ferredoxin oxidoreductase petH without the n-terminal allophycocyanin linker domain) (SEQ ID NO:87), N. punctiforme PCC73102 Npun02001001 (ZP_00111633, ferredoxin 1) (SEQ ID NO:89), N. punctiforme PCC73102 Npun02003530 (ZP_00109422, ferredoxin 2) (SEQ ID NO:91) and N. punctiforme PCC73102 Npun02003123 (ZP_00109501, ferredoxin 3) (SEQ ID NO:93). The four proteins were expressed and purified as described above. 1 mg/mL of each ferredoxin and 4 mg/mL of the ferredoxin oxidoreductase was obtained. The three cyanobacterial ferredoxins were tested with the cyanobacterial ferredoxin oxidoreductase using the enzymatic set-up described earlier with the following changes. The final concentration of the ferredoxin reductase was 60 g/mL and the ferredoxins were at 50 g/mL. The extracted enzymatic reactions were by GC/MS using the following parameters: run time: 6.33 min; column: J&W 122-5711 DB-5ht (length of 15 meters; I.D.: 0.25 mm narrowbore; film: 0.10 M); inject: 1 L Agilent 6850 inlet; inlet: 300 C. splitless; carrier gas: helium; flow: 1.3 mL/min; oven temp: 100 C. hold 0.5 min, 260 at 30 C./min, 260 hold 0.5 min; det: Agilent 5975B VL MSD; det. temp: 230 C.; scan: 50-550 M/Z.

[0340] As shown in FIG. 32, Npun2004178-dependent in-vitro conversion of octadecanal to heptadecane was observed in the presence of NADPH and the cyanobacterial ferredoxin oxidoreductase and any of the three cyanobacterial ferredoxins.

Example 27. Biochemical Characterization of Synechococcus elongatus PCC7942 Orf1594

[0341] The genomic DNA encoding S. elongatus PCC7492 orf1594 (SEQ ID NO:65) was cloned into the NcoI and XhoI sites of vector pET-28b under the control of the T7 promoter. The resulting PCC7942_orf1594 protein contained a C-terminal His-tag. An E. coli BL21 strain (DE3) (Invitrogen) was transformed with the plasmid and PCC7942_orf1594 protein was expressed and purified as described in Example 22. The protein solution was stored in the following buffer: 50 mM sodium phosphate, pH 7.5, 100 mM NaCl, 1 mM THP, 10% glycerol. Protein concentration was determined using the Bradford assay (Biorad). 2 mg/mL of PCC7942_orf1594 protein was obtained.

[0342] To test PCC7942_orf1594 protein for acyl-ACP or acyl-CoA reductase activity, the following enzyme assays were set-up. 100 L reactions were set-up in 50 mM Tris-HCl buffer at pH 7.5 with the following components at their respective final concentrations: 10 M of purified PCC7942_orf1594 protein, 0.01-1 mM acyl-CoA or acyl-ACP, 2 mM MgCl.sub.2, 0.2-2 mM NADPH. The reactions were incubated for 1 h at 37 C. and where stopped by adding 100 L ethyl acetate (containing 5 mg/l 1-octadecene as internal standard). Samples were vortexed for 15 min and centrifuged at max speed for 3 min for phase separation. 80 L of the top layer were transferred into GC glass vials and analyzed by GC/MS as described in Example 26. The amount of aldehyde formed was calculated based on the internal standard.

[0343] As shown in FIG. 33, PCC7942_orf1594 was able to reduce octadecanoyl-CoA to octadecanal. Reductase activity required divalent cations such as Mg.sup.2+, Mn.sup.2+ or Fe.sup.2+ and NADPH as electron donor. NADH did not support reductase activity. PCC7942_orf1594 was also able to reduce octadecenoyl-CoA and octadecenoyl-ACP to octadecenal. The K.sub.m values for the reduction of octadecanoyl-CoA, octadecenoyl-CoA and octadecenoyl-ACP in the presence of 2 mM NADPH were determined as 4520 M, 8222 M and 7.82 M, respectively. These results demonstrate that PCC7942_orf1594, in vitro, reduces both acyl-CoAs and acyl-ACPs and that the enzyme apparently has a higher affinity for acyl-ACPs as compared to acyl-CoAs. The K.sub.m value for NADPH in the presence of 0.5 mM octadecanoyl-CoA for PCC7942_orf1594 was determined as 40080 M.

[0344] Next, the stereospecific hydride transfer from NADPH to a fatty aldehyde catalyzed by PCC7942_orf1594 was examined. Deutero-NADPH was prepared according to the following protocol. 5 mg of NADP.sup.+ and 3.6 mg of D-glucose-1-d was added to 2.5 mL of 50 mM sodium phosphate buffer (pH 7.0). Enzymatic production of labeled NADPH was initiated by the addition of 5 units of glucose dehydrogenase from either Bacillus megaterium (USB Corporation) for the production of R-(4-2H)NADPH or Thermoplasma acidophilum (Sigma) for the production of S-(4-2H)NADPH. The reaction was incubated for 15 min at 37 C., centrifuge-filtered using a 10 KDa MWCO Amicon Ultra centrifuge filter (Millipore), flash frozen on dry ice, and stored at 80 C.

[0345] The in vitro assay reaction contained 50 mM Tris-HCl (pH 7.5), 10 M of purified PCC7942_orf1594 protein, 1 mM octadecanoyl-CoA, 2 mM MgCl.sub.2, and 50 L deutero-NADPH (prepared as described above) in a total volume of 100 L. After a 1 h incubation, the product of the enzymatic reaction was extracted and analyzed as described above. The resulting fatty aldehyde detected by GC/MS was octadecanal (see FIG. 34). Because hydride transfer from NADPH is stereospecific, both R-(4-2H)NADPH and S-(4-2H)NADPH were synthesized. Octadecanal with a plus one unit mass was observed using only the S-(4-2H)NADPH. The fact that the fatty aldehyde was labeled indicates that the deuterated hydrogen has been transferred from the labeled NADPH to the labeled fatty aldehyde. This demonstrates that NADPH is used in this enzymatic reaction and that the hydride transfer catalyzed by PCC7942_orf1594 is stereospecific.

Example 28. Intracellular and Extracellular Production of Fatty Aldehydes and Fatty Alcohols in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594

[0346] The genomic DNA encoding Synechococcus elongatus PCC7942 orf1594 (YP_400611; acyl-ACP reductase) (SEQ ID NO:65) was amplified and cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.h, promoter. The resulting construct was cotransformed into E. coli MG1655 fadE and the cells were grown at 37 C. in 15 mL Che-9 minimal media with 3% (w/v) glucose as carbon source and supplemented with 100 g/mL spectinomycin and carbenicillin, respectively. When the culture reached OD.sub.600 of 0.8-1.0, it was induced with 1 mM IPTG and cells were grown for an additional 24-48 h at 37 C. Che-9 minimal medium is defined as: 6 g/L Na.sub.2HPO.sub.4, 3 g/L KH.sub.2PO.sub.4, 0.5 g/L NaCl, 2 g/L NH.sub.4Cl, 0.25 g/L MgSO.sub.47 H.sub.2O, 11 mg/L CaC.sub.2, 27 mg/L Fe.sub.3Cl6 H.sub.2O, 2 mg/L ZnCl4 H.sub.2O, 2 mg/L Na.sub.2MoO.sub.42 H.sub.2O, 1.9 mg/L CuSO.sub.45 H.sub.2O, 0.5 mg/L H.sub.3BO.sub.3, 1 mg/L thiamine, 200 mM Bis-Tris (pH 7.25) and 0.1% (v/v) Triton-X100. When the culture reached OD.sub.600 of 1.0-1.2, it was induced with 1 mM IPTG and cells were allowed to grow for an additional 40 hrs at 37 C. Cells from 0.5 mL of culture were extracted with 0.5 mL of ethyl acetate for total hydrocarbon production as described in Example 26. Additionally, cells and supernatant were separated by centrifugation (4,000 g at RT for 10 min) and extracted separately.

[0347] The culture produced 620 mg/L fatty aldehydes (tetradecanal, heptadecenal, heptadecanal and octadecenal) and 1670 mg/L fatty alcohols (dodecanol, tetradecenol, tetradecanol, heptadecenol, heptadecanol and octadecenol). FIG. 35 shows the chromatogram of the extracted supernatant. It was determined that 73% of the fatty aldehydes and fatty alcohols were in the cell-free supernatant.

Example 29. Intracellular and Extracellular Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Synechococcus elongatus PCC7942 Orf1594 and Nostoc punctiforme PCC73102 Npun02004178

[0348] The genomic DNA encoding Synechococcus elongatus PCC7942 orf1594 (YP_400611; acyl-ACP reductase) (SEQ ID NO:65) was amplified and cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.h, promoter. The genomic DNA encoding Nostoc punctiforme PCC73102 Npun02004178 (ZP_00108838; fatty aldehyde decarbonylase) (SEQ ID NO:5) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.trc promoter. The resulting constructs were cotransformed into E. coli MG1655 fadE and the cells were grown at 37 C. in 15 mL Che9 minimal media with 3% (w/v) glucose as carbon source and supplemented with 100 g/mL spectinomycin and carbenicillin, respectively. The cells were grown, separated from the broth, extracted, and analyzed as described in Example 28.

[0349] The culture produced 323 mg/L alkanes and alkenes (tridecane, pentadecene, pentadecane and heptadecene), 367 mg/L fatty aldehydes (tetradecanal, heptadecenal, heptadecanal and octadecenal) and 819 mg/L fatty alcohols (tetradecanol, heptadecenol, heptadecanol and octadecenol). FIG. 36 shows the chromatogram of the extracted supernatant. It was determined that 86% of the alkanes, alkenes, fatty aldehydes and fatty alcohols were in the cell-free supernatant.

Example 30. Production of Alkanes and Alkenes in E. coli Through Heterologous Expression of Nostoc sp. PCC7210 Alr5284 and Nostoc sp. PCC7210 Alr5283

[0350] The genomic DNA encoding Nostoc sp. PCC7210 alr5284 (NP_489324; putative aldehyde-generating enzyme) (SEQ ID NO:81) was amplified and cloned into the NcoI and EcoRI sites of vector OP-80 (pCL1920 derivative) under the control of the P.sub.trc promoter. The genomic DNA encoding Nostoc sp. PCC7210 alr5283 (NP_489323; putative decarbonylase) (SEQ ID NO:7) was amplified and cloned into the NdeI and XhoI sites of vector OP-183 (pACYC derivative) under the control of the P.sub.f.c promoter. The resulting constructs were cotransformed into E. coli MG1655 and the cells were grown at 37 C. in 15 mL Che9 minimal media with 3% (w/v) glucose as carbon source and supplemented with 100 g/mL spectinomycin and carbenicillin, respectively (as described in Example 28). Cells from 0.5 mL of culture were extracted and analyzed as described in Example 3 and analyzed by GC-MS as described in Example 26.

[0351] As shown in FIG. 37, E. coli cells cotransformed with the Nostoc sp. PCC7210 alr5284 and Nostoc sp. PCC7210 alr5283-bearing vectors produced tridecane, pentadecene, pentadecane, tetradecanol and hexadecanol. This result indicates that coexpression of Nostoc sp. PCC7210 alr5284 and alr5283 is sufficient for E. coli to produce fatty alcohols, alkanes and alkenes.

OTHER EMBODIMENTS

[0352] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.