GRAPHENE-ENABLED DNA BIOESENSORS WITH ENHANCED SENSITIVITY AND SPECIFICITY
20210048407 ยท 2021-02-18
Inventors
Cpc classification
G01N27/4145
PHYSICS
G01N27/327
PHYSICS
International classification
G01N27/414
PHYSICS
G01N27/327
PHYSICS
Abstract
Provided are electronic biosensors based on graphene field effect transistors that utilize engineered hairpin probe DNA that allows for target recycling and hybridization chain reactions.
Claims
1. A detector, comprising: a first portion of graphene; a first hairpin probe (H1) comprising a plurality of nucleotides, the first hairpin probe (H1) being linked to and being in electronic communication with the first portion of graphene, in its hairpin configuration, the first hairpin probe (H1) comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion, the first hairpin probe (H1) being configured to open upon binding by a target molecule (T) with the paired portion of the hairpin probe (H1), the binding giving rise to an H1-T complex having a paired region formed between the first hairpin probe (H1) and the target (T), the H1-T complex further having a protruding segment.
2. The detector of claim 1, wherein the paired portion of the first hairpin probe comprises an aptamer region, the aptamer region being configured to bind to the target molecule (T).
3. (canceled)
4. (canceled)
5. The detector of claim 1, further comprising an amount of a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further being capable of binding to the protruding segment and the paired region of the H1-T complex so as to displace the target (T) from the H1-T complex and give rise to a H1-H2 complex having a protruding segment.
6. The detector of claim 5, further comprising an amount of a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion that is capable of binding to the protruding segment of the H1-H2 complex so as open second hairpin helper (H3) and give rise to a H1-H2-H3 complex having a protruding segment.
7. The detector of claim 6, further comprising an amount of a third hairpin helper (H4) that comprises a plurality of polynucleotides, the third hairpin helper (H4) further comprising a toehold portion capable of binding to the protruding segment of the H1-H2-H3 complex so as give rise to a H1-H2-H3-H4 complex.
8. (canceled)
9. The detector of claim 1, further comprising a second hairpin probe (H1) comprising a plurality of nucleotides, the second hairpin probe (H1) being linked to and in electronic communication with the first portion of graphene, in its hairpin configuration, the second hairpin probe (H1) comprising (a) a bottom portion linked to the first portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion, the second hairpin probe (H1) differing from the first hairpin probe (H1) by at least one nucleotide.
10. The detector of claim 1, further comprising a monitor in electronic communication with the first portion of graphene, the monitor capable of detecting a signal related to one or more of (a) binding between a target and the first hairpin probe (H1) and (b) formation of a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers.
11. The detector of claim 10, wherein the signal is a change in Dirac voltage.
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. A method, comprising: to a first hairpin probe (H1) comprising a plurality of nucleotides, the first hairpin probe (H1) being linked to and in electronic communication with a first portion of graphene, in its hairpin configuration, the first hairpin probe (H1) comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion, contacting the first hairpin probe (H1) with a target molecule (T) under such conditions that the target molecule (T) binds with the paired portion of the hairpin probe (H1) and the first hairpin probe (H1) opens, the binding giving rise to an H1-T complex having a paired region formed between the first hairpin probe (H1) and the target (T), the H1-T complex further having a protruding segment.
20. The method of claim 19, further comprising contacting the H1-T complex with a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) being capable of binding to the protruding segment and the paired region of the H1-T complex, the contacting being performed so as to displace the target (T) from the H1-T complex and give rise to a H1-H2 complex having a protruding segment.
21. The method of claim 20, further comprising contacting the H1-H2 complex with a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion that is capable of binding to the protruding segment of the H1-H2 complex, the contacting being performed so as open second hairpin helper (H3) and give rise to a H1-H2-H3 complex having a protruding segment.
22. (canceled)
23. The method of claim 19, further comprising effecting contact between target (T) displaced from the H1-T complex and a further hairpin probe (H1,2), the second hairpin probe (H1,2) being complementary to the target (T), the contacting giving rise to an H1,2-T complex having a paired region formed between the further hairpin probe (H1,2) and the target (T), the H1,2-T complex further having a protruding segment.
24. The method of claim 23, further comprising contacting the H1,2-T complex with a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further being capable of binding to the protruding segment and the paired region of the H1,2-T complex, the contacting being performed so as to displace the target (T) from the H1,2-T complex and give rise to a H1,2-H2 complex having a protruding segment.
25. (canceled)
26. (canceled)
27. The method of claim 20, further comprising detecting a signal related to one or more of (a) binding between a target and the first hairpin probe (H1), and (b) formation of a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers.
28. The method of claim 27, wherein the signal is a change in Dirac voltage.
29. (canceled)
30. The method of claim 20, wherein the target is present at a concentration of less than about 100 fM.
31. (canceled)
32. (canceled)
33. A method, comprising: to one or more first hairpin probes (H1.sub.i=1 to n) each comprising a different plurality of nucleotides, the plurality of first hairpin probes being linked to and in electronic communication with a first portion of graphene, each of the plurality of first hairpin probes in its hairpin configuration comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion, contacting the plurality of first hairpin probes with one or more target molecules (T.sub.j, j=1 to m) under such conditions that one or more of the target molecules binds with the paired portion of one or more first hairpin probes and the first hairpin probe opens, the binding giving rise to an H1.sub.i-T.sub.j complex having a paired region formed between the first hairpin probe (H1.sub.i) and the target (T.sub.j), the H1.sub.i-T.sub.j complex further having a protruding segment.
34. The method of claim 33, further comprising contacting a H1.sub.i-T.sub.j complex with one or more first hairpin helpers (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further comprising a toehold portion that is capable of binding to the protruding segment and the paired region of the H1.sub.i-T.sub.j complex, the contacting being performed so as to displace the target (T.sub.i) from the H1.sub.i-T.sub.i complex and give rise to a H.sub.i-H2 complex having a protruding segment, one or more of the first hairpin helpers H2 optionally being unique to a particular H1.sub.i-T.sub.j complex.
35. The method of claim 34, further comprising contacting the H1.sub.i-H.sub.i complex with a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion capable of binding to the protruding segment of the H1.sub.i-H2.sub.i complex, the contacting being performed so as open second hairpin helper (H3) and give rise to a H1.sub.i-H2-H3 complex having a protruding segment.
36. (canceled)
37. The method of claim 33, further comprising detecting a signal related to one or more of (a) binding between one or more of the two or more targets (T.sub.i) and one or more first hairpin probes (H1.sub.j) and (b) a complex that comprises the first hairpin probe (H1.sub.j) and one or more hairpin helpers.
38. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] For the purpose of illustrating the invention, there is shown in the drawings a form that is presently preferred; it being understood, however, that this invention is not limited to the precise arrangements and instrumentalities shown.
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0034] The present disclosure may be understood more readily by reference to the following detailed description taken in connection with the accompanying figures and examples, which form a part of this disclosure. It is to be understood that this invention is not limited to the specific devices, methods, applications, conditions or parameters described and/or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed invention. Also, as used in the specification including the appended claims, the singular forms a, an, and the include the plural, and reference to a particular numerical value includes at least that particular value, unless the context clearly dictates otherwise. The term plurality, as used herein, means more than one. When a range of values is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent about, it will be understood that the particular value forms another embodiment. All ranges are inclusive and combinable, and it should be understood that steps may be performed in any order. Any documents cited herein are incorporated by reference in their entireties for any and all purposes.
[0035] It is to be appreciated that certain features of the invention which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination. Further, reference to values stated in ranges include each and every value within that range. In addition, the term comprising should be understood as having its standard, open-ended meaning, but also as encompassing consisting as well. For example, a device that comprises Part A and Part B may include parts in addition to Part A and Part B, but may also be formed only from Part A and Part B.
[0036] Label-free and multiplexed nucleic acid testing is of interest for genetic screening and clinical diagnosis, and nano-bioelectronics have shown great promise for this application. Graphene field effect transistors (GFETs) offer advantages of large surface-to-volume ratio, excellent biocompatibility, and high carrier mobility. GFETs can be readily functionalized with single-stranded probe DNA for detection of specific target oligonucleotides with complementary sequences.
[0037] By detecting the charge of targets (e.g., DNA) bound (e.g., hybridized) with the probe, GFETs typically offer a limit of detection (LOD) ranging from 1 fM to 100 pM. The broad range of sensitivities has been ascribed to the affinity-governed binding kinetics of target and probe DNA, which varies with the length of the complementary sequence: higher target-probe binding affinity and lower LOD are achieved for longer probe and target DNA oligomers.
[0038] For example, a LOD was reported of 100 pM for 22-mer target DNA and and 1 fM LOD for 60-mer target DNA due to the stronger target-probe affinity. Achieving a low LOD for oligonucleotides without the constraint of target sequence length, e.g., sub-fM for a 20-mer, is useful for the early diagnosis of various diseases by detecting biomarkers of oligonucleotides, such as cardiovascular disease and cancer.
[0039] Exemplary Results
[0040]
[0041] The GFETs were functionalized by incubation in a solution of PBASE in N,N-dimethylformamide (DMF), followed by incubation in an aqueous solution of aminated hairpin probe DNA (
[0042] The I-V.sub.g characteristics for a GFET array were measured after each functionalization step. Immobilization of probe DNA led to an increase in the Dirac voltage (V.sub.D=71.36.0 V), which was explained quantitatively by assuming chemical gating of 56 elementary charges per probe oligomer, with a probe DNA density of 1.110.sup.3/m.sup.2.
[0043]
[0044] The GFET sensor, functionalized with the hairpin probe DNA (H1), was exposed to a mixture of target DNA (T) and three helper DNAs (H2, H3, H4). The target triggered the nucleation between H1 and T via base-pairing, mediating a branch migration that opened hairpin H1 to form a complex H1T. The protruding segment of H1T bound to the toehold of hairpin H2 (segment 3*; see
[0045] It should be understood that although targets can be nucleotides, targets can also be proteins, drug molecules, chemical species, waterborne impurities (e.g., mercury), contaminants, biomolecules, and other species of interest. It should also be understood that a hairpin probe (e.g., H1 in
[0046] Meanwhile, the protruding segment of H1H2 (segments 4 and 7) nucleated with hairpin H3 and triggered the hybridization chain reaction (HCR) with H4. The presence of T can be circularly used to trigger HCR, leading to long nicked double-stranded polymers for the amplification of DNA products that can be detected by GFET through chemical gating. The effectiveness of the self-assembly amplification was confirmed by electrophoresis analysis (see
[0047] The scheme described above is universal for the detection of short DNA or RNA by changing the sequences of segments 1, 2, 3, 1*, 2* and 3*, and H1 and H2 can be correspondingly modified and used with universal H3 and H4 for the amplification.
[0048] It should be understood that
[0049] In illustrative sensing experiments, GFET biosensor arrays were tested against a mixture of a known concentration of the target DNA in the presence of three helper DNA H2, H3, and H4, all at a concentration of 1 M, in 5saline-sodium citrate (SSC) hybridization buffer, and the I-V.sub.g characteristics were measured in the dry state. In all cases a positive shift of the Dirac voltage was observed (
[0050] To explore the dynamics of the self-assembly amplification in a non-limiting way, one may construct a mathematical model that reflects key biochemical reactions that connect the target DNA oligomer to the initiation of the amplification response mediated by the hairpins H1 and H2. The kinetic model is based on the assumption that the HCR reaction with H3 and H4 is non-reversible due to the high concentration of helper DNA species (1 M), so the model does not consider reactions involving the helpers H3 and H4. Even in its simplicity, the model recapitulated the measured target DNA dose-response curve (
[0051] The model predictions were validated experimentally (
[0052] To validate the effectiveness of detection based on target recycling and self-assembly amplification, the GFET arrays were tested against several positive controls. As shown in
[0053] The GFET arrays were then tested against various negative controls, all at a concentration of 10 nM, to confirm that the response reflected specific binding of the complementary target DNA. As seen from
[0054] Finally, demonstrated multiplexed detection of target DNAs T and T with a GFET sensor array was demonstrated, through the use of site-specific functionalization using two different hairpin probe DNAs. The second set of probe DNA (H1) and helper DNA (H2) were redesigned according to the base sequence of the second target DNA (T) to trigger the self-assembly reaction in the presence of H3 and H4. As shown in
CONCLUSIONS
[0055] Provided are manufacturable GFET nucleic acid sensors based on hairpin probe DNA designed to enable signal amplification by target recycling and a hybridization chain reaction. In one exemplary embodiment, based upon a 1 hour detection time, the limit of detection was 5 fM for a 21-mer, an improvement of 20,000 over earlier reports based on complementary probe DNA. The limit of detection can be lowered to below 1 fM by extending the time, in agreement with a simplified kinetic model. The approach showed excellent specificity against single base mismatches at the 3 or 5 end, as expected due to the design characteristics of the hairpin probe, and simultaneous detection of multiple targets was also demonstrated. The disclosed approach offers a platform for DNA detection at a low concentration even for short DNA targets. The scalability and sensitivity of the GFET devices make them potentially applicable for disease diagnosis and label-free genetic diagnosis.
[0056] Materials and Methods
[0057] Graphene Synthesis
[0058] Graphene was synthesized in a low-pressure chemical vapor deposition system (OTF-1200X-4-C4-SL-UL, MTI Corp.). Cu foils (Alfa Aesar Item #46365) were cleaned with 5.4% HNO.sub.3 for 40 seconds and two DI water baths for 2 min, and then thoroughly blown dry using N.sub.2 gas. The reaction chamber was pumped to a base pressure of 50 mTorr. The Cu growth substrate was annealed at 1020 C. for 30 minutes with a gas flow of 500 sccm Ar and 80 sccm H2. Monolayer graphene was then grown using methane as a carbon source at a flow rate of 5 sccm for 5 mins and then 10 sccm for 15 mins with 80 sccm H2. The reactor was rapidly cooled to room temperature under a flow of 80 sccm H2 and 10 sccm CH.sub.4.
[0059] GFET Sensor Array Fabrication
[0060] Photolithographic processing was used to define an electrode array for 100 back-gated graphene FETs on a highly p-doped Si wafer with a 250 nm thermal oxide layer. The contact metallization was 5 nm Cr/40 nm Au, deposited by thermal evaporation. Graphene was then transferred onto the metallized SiO.sub.2/Si chip using the PMMA assisted bubbling transfer method.
[0061] Briefly, PMMA-coated graphene/Cu was slowly immersed into a 50 mM NaOH aqueous solution with a 20 V potential difference applied between the copper foil and the solution. PMMA-supported graphene was separated from the Cu foil by hydrogen gas bubbles formed at the Cu surface. After three deionized water baths (resistivity of 18.2 M-cm), the PMMA/graphene film was transferred onto the metallized SiO.sub.2/Si chip, followed by air drying and baking at 150 C. for 3 minutes.
[0062] After removal of PMMA by immersion in acetone overnight, the chips were spin coated with a photoresist bilayer of PMGI (MicroChem Corp.) and S1813 (Shipley). Graphene channels were defined using photolithography and oxygen plasma etching (Pressure: 1.25 Torr, Power: 50 W, Duration: 35 seconds). The photoresist residue on graphene channels was removed by a N-Methyl Pyrrolidinone (NMP) based stripper (NANO Remover PG, MicroChem Corp.), acetone and IPA to obtain the array of 100 FETs. Finally, the array was annealed in H2/Ar forming gas at 225 C. to reduce photoresist residues.
[0063] AFM Characterization
[0064] An atomic force microscope (AFM, Icon Bruker) equipped with a probe with a tip radius of <10 nm (TAP300Al-G, Budgetsensors) was used to evaluate the height increase for the PBASE functionalization and probe DNA immobilization.
[0065] PBASE Functionalization with Hairpin Probe DNA Immobilization and Testing Against Target or Control Solutions
[0066] GFET sensors were soaked in a 0.2 mM PBASE (Sigma-Aldrich) in DMF for 20 h and then washed thoroughly with DMF, IPA, and DI water for 3 min each. The hairpin structure of the probe DNA was formed by heating the probe DNA at 95 C. for 5 minutes, allowed by gradual cooling to room temperature before use. GFET sensors were then incubated in 1 M aqueous solution of hairpin probe DNA (sequence is listed in Table 1) in DI water for 3 hours in a humid atmosphere to suppress the evaporation of the DNA solution. This was followed by washing with two DI water baths (2 min each) and drying with N.sub.2 gas. After I-V.sub.g measurement, the probe DNA-immobilized GFET devices were immersed in 200 L of DNA mixture with known concentrations of target and helper DNA (1 M for H2, H3 and H4, respectively) for 1 hour to allow for DNA hybridization. The devices were washed with two DI water baths, followed by drying with N.sub.2 gas before measurement of the electrical properties.
[0067] The GFETs I-V.sub.g characteristics were measured after each functionalization step. Self-assembly of the PBASE layer led to an increased Dirac voltage (V.sub.D=18.81.5 V), which is explained by assuming that NHS groups are hydrolyzed into carboxyl groups, which deprotonate and acquire a negative charge. Functionalization with PBASE also led to decreased hole carrier mobility to =1070200 cm.sup.2/V-s, Immobilization of probe DNA led to a further increase in the Dirac voltage (V.sub.D=71.36.0 V), corresponding to a hole carrier density of of 610.sup.12 cm.sup.2 induced by the hairpin probe DNA. This is explained quantitatively by assuming chemical gating of 56 negative charges for each probe oligomer, so the observed Dirac voltage increase corresponds to a probe DNA density of 1.110.sup.3/m.sup.2. This high density of immobilized probe DNA is consistent with the AFM images in
[0068] Design of Hairpin Structures
[0069] The target triggered self-assembly amplification circuit was based on a combination of four-hairpin DNA.
[0070] By using the UNAFold web server (unafold.rna.albany.edu), one can find that the target triggered amplification is sensitive to short DNA or RNA. Provided here are hairpins that maximize the free energy benefit per polymerization step while retaining hairpin metastability in these conditions. The four hairpin structures do not necessarily initially interact with each other.
[0071] Triggered Self-Assembly HCR Amplification
[0072] After immobilization of hairpin probe DNA H1 on GFETs, the target DNA with a known concentration (100 aM to 1 M) and three helper DNAs (H2, H3, H4) at a concentration of 1 M were introduced in an aqueous solution mixture with 5SSC buffer. The four hairpin species, H1 (Probe), H2 (Helper), H3 (Helper) and H4 (Helper), coexist in metastable state in the absence of T (target). Exposure of target triggers the nucleation of H1 and T via base-pairing to the single-stranded toehold 1* of T (
[0073] H1T complex then nucleates with hairpin H2 by means of base-pairing to toehold 3*, mediating a branch migration that opens the hairpin to form the complex H1TH2, which is inherently unstable. T then dissociates from the complex H1TH2, leaving a stable H1H2 duplex with a protruding segment 4 and 7. The dissociated T is recycled into the DNA mixture, nucleates with a new H1 and triggers the same circuit as described above.
[0074] The protruding segment of H1H2 nucleates with hairpin H3 via base-pairing to single-stranded toehold 4*, mediating a branch migration that opens the hairpin H3 and forms a complex H1H2H3 releasing of single-stranded segment 8 and 7. This complex nucleates with hairpin H4 by means of base-pairing to toehold 8*, mediating a branch migration that opens the hairpin to form complex H1H2H3H4 releasing of single-stranded segment 4 and 7. Thus, the initiator sequence is regenerated, providing the basis for a hybridization chain reaction of alternating H3 and H4 polymerization steps.
[0075] In this amplification system, target DNA can be circularly used to trigger HCR amplification, which results in the generation of numerous long nicked double-stranded amplification polymers. Due to the target recycling and self-assembly amplification nature, the presence of low concentration of target is expected to generate a large number of annealed H1H2H3H4 complexes, which can potentially result in a significant change of Dirac voltage for GFET detection of trace amount of target DNAs and RNAs.
[0076] Electrical Measurement and Evaluation
[0077] Electrical measurements were performed under ambient conditions in a probe station equipped with a probe card that is capable of measuring the 100 devices simultaneously. Current-gate voltage (I-V.sub.g) measurements were carried out using a Keithley 2400 sourcemeter, with a bias voltage of 0.1V. The gate voltage was applied using a Keithley 6487 voltage source. Dirac point voltage and hole carrier mobility were extracted by fitting the hole branch of the o-V.sub.g curve to the equation:
.sup.1(V.sub.g)=[c.sub.g(V.sub.DV.sub.g)].sup.1+.sub.s.sup.1
[0078] where c.sub.g is the gate capacitance per unit area for the 250 nm thick SiO.sub.2 (11.5 nF/cm.sup.2), is the hole carrier mobility, V.sub.D is the Dirac voltage, and .sub.s is the saturation conductivity as V.sub.g.fwdarw..
[0079] Kinetic Model
[0080] A computational model was constructed that simulates the amplification response that enables the detection of a DNA oligomer. Specifically, the model reflects key biochemical reactions that connect the target DNA oligomer sequence to initiation of the amplification response mediated by the Hairpin H1 and H2. The model is based on mass action kinetics and comprises 5 coupled ordinary differential equations (ODEs), each of which expresses the rate of change in the concentration of a biochemical species:
[0081] The model's input is the target DNA oligomer concentration and its output is the concentration time course (i.e., kinetic trajectory) for each biochemical species considered. The initial concentrations of the Hairpin H1 and H2 are set to 4 M and 1 M, respectively. The model reactions and parameters representing the rates of different molecular and cellular processes, such as target DNA oligomer-Helper association/dissociation, are defined in Table 2. All computational analyses were performed in the software suite MATLAB R2017a (MathWorks, Natick, Mass.), and the ODEs were solved using the ODE15S solver with an absolute tolerance of 10.sup.15 M and a relative tolerance of 10.sup.12.
[0082] Agarose Gel Electrophoresis
[0083] The target triggered self-assembly amplification was confirmed on a step-by-step basis using agarose gel electrophoresis (
[0084] Table 1 below provides the DNA sequences employed in this work, the bases are listed from the 5 end to 3 end
TABLE-US-00001 Category Name Sequence Probe H1 ACTCAGCTTGTCAAATACACGAA TGTCTCCGTGTATTTGACAAGTA CCTTTTTTTT-NH.sub.2 Helper H2 ACACGGAGACATTCGTGTATTTG ACAAGAATGTCTCACAATGGTGT TTGTT Helper H3 ACAATGGTGTTTGTTTCTGAAAC AACAAACACCATTGTGAGACATT Helper H4 GTTTCAGAAACAAACACCATTGT AATGTCTCACAATGGTGTTTGTT Target T CGTGTATTTGACAAGCTGAGT Non-complementary C35 AGTGTATTTGACAAGCTGAGA Non-complementary C3 CGTGTATTTGACAAGCTGAGA Non-complementary C5 AGTGTATTTGACAAGCTGAGT Negativecontrol H2 GCGAGCCTGTATCTGCGGTCGCT forH2 Control TGTGAACGAGGAGTAAGCGTCCC GTGCG Probe H1 CGCGTACCAAAAGTAATAATGAA TGTCTCCATTATTACTTTTGGAT CCGTTTTTTT-NH.sub.2 Target T CATTATTACTTTTGGTACGCG Helper H2 TAATGGAGACATTCATTATTACT TTTGGAATGTCTCACAATGGTGT TTGTT
[0085] Table 2 below provides exemplary parameters used in the computational model
TABLE-US-00002 Parameters # Reactions Name Value Unit 1 H1 + Target .fwdarw. H1T k1_on 10.sup.9 M.sup.1s.sup.1 2 H1T .fwdarw. H1 + Target k1_off 0 s.sup.1 3 H1T + H2 .fwdarw. H1H2 + Target k2_on 10.sup.9 M.sup.1s.sup.1 4 H1H2 + Target k2_off 0 s.sup.1
Exemplary Embodiments
[0086] The following exemplary embodiments are illustrative only and do not necessarily limit the scope of the present disclosure or of the claims attached hereto.
[0087] Embodiment 1. A detector, comprising:
[0088] a first portion of graphene;
[0089] a first hairpin probe (H1) comprising a plurality of nucleotides, the first hairpin probe (H1) being linked to and being in electronic communication with the first portion of graphene, in its hairpin configuration,
[0090] the first hairpin probe (H1) comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion,
[0091] the first hairpin probe (H1) being configured to open upon binding by a target molecule (T) (e.g., a nucleotide) with the paired portion of the hairpin probe (H1), the binding giving rise to an H1-T complex having a paired region formed between the first hairpin probe (H1) and the target (T), the H1-T complex further having a protruding segment.
[0092] Suitable targets include, e.g., nucleotide, proteins, chemical species, drug molecules, contaminants, biomolecules, metals, or any combination thereof. Proteins are particularly suitable targets. Contaminants (e.g., bacteria, viruses, and the like) are also suitable targets.
[0093] The length of a target can be suitably 15 nucleotides (nt) or longer, though this is not a requirement. A target can have a length of, e.g., 1-10 nt, 1-50 nt, 1-100 nt, 1-1000 nt, 1-5000 nt, or even greater than 5000 nt. The target can suitably have a length of from about 10 to about 2000 nt, or even from about 15 nt to about 1500 nt and all intermediate values, e.g., 15-1500, 20-1200, 30-1000, 50-700, 75-500, or even 100-300 nt.
[0094] Embodiment 2. The detector of Embodiment 1, wherein the paired portion of the first hairpin probe comprises an aptamer region, the aptamer region being configured to bind to the target molecule (T). An aptamer can be configured and/or selected based on the target the detector is intended to detect.
[0095] Aptamers can be selected for virtually any desired target, including non-immunogenic or toxic proteins. Aptamers can be, e.g., via the systematic evolution of ligands by exponential enrichment (SELEX) method, without the constraints imposed by having to be selected or produced in a living organism. E.g., Sensors (Basel). 2008 July; 8(7): 4296-4307, incorporated herein by reference in its entirety for all purposes.
[0096] Embodiment 3. The detector of Embodiment 1, wherein the paired portion of the first hairpin probe (H1) comprises at least 2 base-base hybridized pairs. (By base-base hybridization is meant hydrogen bond coordination between two bases, e.g., an A-T base paid hybridization and/or a C-G base pair hybridization.)
[0097] Embodiment 4. The detector of Embodiment 3, wherein the paired portion of the first hairpin probe (H1) comprises from 2 to 200 base-base hybridized pairs.
[0098] Without being bound to any particular theory, hairpin structures can have identical secondary structures, with stems of, e.g., length 15-20 bp. a toehold of, e.g., length 6-8 nt and a loop of, e.g., length 8-15 nt. The length of probe H1 can be, e.g., 56-72 nt, though this is not a requirement.
[0099] Embodiment 5. The detector of any of Embodiments 1-4, further comprising an amount of a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further being capable of binding to the protruding segment and the paired region of the H1-T complex so as to displace the target (T) from the H1-T complex and give rise to a H1-H2 complex having a protruding segment.
[0100] Without being bound to any particular theory, a first hairpin helper can be designed according to the secondary structure of H1 so as to displace the target T from the H1-T complex. A H2 structure can have, e.g., a stem of length 8-15 bp, a toehold of length 5-10 nt, and a loop of length 15 nt. A H2 can have a length of from about 51 to about 75 nt, in some embodiments.
[0101] The following is an exemplary calculation regarding the molecular weight (M.W.) of exemplary nucleic acids.
[0102] M.W. of ssDNA=(# nucleotides303.7)+79.0
[0103] M.W. of dsDNA=(# nucleotides607.4)+157.9
[0104] M.W. of 3-NH2 of H1 is 209.2 g/mol
[0105] According to the foregoing, the M.W. of an exemplary H1-H2 complex can be 29,905 g/mol and the M.W. of H1-T complex is 23,831 g/mol.
[0106] Embodiment 6. The detector of Embodiment 5, further comprising an amount of a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion that is capable of binding (e.g., hybridizing) to the protruding segment of the H1-H2 complex so as open second hairpin helper (H3) and give rise to a H1-H2-H3 complex having a protruding segment.
[0107] Again without being bound to any particular theory, H3 can be designed according to the secondary structure of H1-H2 complex. H3 can have, e.g., a stem of length 15-20 bp, a toehold of, e.g., length 6-8 nt, and a loop of, e.g., length 6-8 nt, which means that the length of H3 can be 42-51 nt. Applying the M.W. calculations above, the molecular weight (M.W.) of an exemplary H1-H2 complex is 29,905 g/mol and the M.W. of an exemplary H1-H2-H3 complex is 51,069.5 g/mol.
[0108] Embodiment 7. The detector of Embodiment 6, further comprising an amount of a third hairpin helper (H4) that comprises a plurality of polynucleotides, the third hairpin helper (H4) further comprising a toehold portion capable of binding (e.g., hybridizing) to the protruding segment of the H1-H2-H3 complex so as give rise to a H1-H2-H3-H4 complex.
[0109] H4 can be, e.g., designed according to the secondary structure of H1-H2-H3 complex and it can have a stem of, e.g., length 15-20 bp, a toehold of, e.g., length 6-8 nt, and a loop of, e.g., length 6-8 nt, which means that the length of H4 can be, e.g., 42-51 nt.
[0110] Applying the M.W. calculations above, the M.W. of an exemplary H1-H2-H3 complex can be 51,069.5 g/mol, and the M.W. of an exemplary H1-H2-H3-H4 complex can be 71,815.6 g/mol. (With the chain reaction hybridization between H3 and H3, the M.W. of H1-H2-(H3-H4) will increase.)
[0111] Embodiment 8. The detector of any of Embodiments 1-7, wherein the detector comprises a plurality of hairpin probes (H1) being linked to and in electronic communication with the first portion of graphene.
[0112] A variety of linkers can be used. Some exemplary linkers include, e.g., 1-Pyrenebutyric acid N-hydroxysuccinimide ester (with aminated probe DNA); metallic nanoparticles (e.g., gold nanoparticles with sulfureted probe DNA); 4-carboxybenzenediazonium tetrafluoroborate (or other carboxybenzenediazonium compounds).
[0113] Embodiment 9. The detector of any of Embodiments 1-8, further comprising a second hairpin probe (H1) comprising a plurality of nucleotides, the second hairpin probe (H1) being linked to and in electronic communication with the first portion of graphene, in its hairpin configuration, the second hairpin probe (H1) comprising (a) a bottom portion linked to the first portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion, the second hairpin probe (H1) differing from the first hairpin probe (H1) by at least one nucleotide.
[0114] Embodiment 10. The detector of any of Embodiments 1-9, further comprising a monitor in electronic communication with the first portion of graphene, the monitor capable of detecting a signal related to one or more of (a) binding between a target and the first hairpin probe (H1) and (b) formation of a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers.
[0115] Embodiment 11. The detector of Embodiment 10, wherein the signal is a change in Dirac voltage. Other exemplary signals include, e.g., source-drain current at a fixed bias voltage and fixed gate voltage.
[0116] Embodiment 12. A method, comprising contacting a detector according to any of Embodiments 1-11 to a sample comprising an amount of a target (T).
[0117] Embodiment 13. The method of Embodiment 12, further comprising detecting a signal related to one or more of (a) binding between the target (T) and the first hairpin probe (H1), and (b) formation of a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers.
[0118] Embodiment 14. The method of any of Embodiments 12-13, wherein the target comprises 20 or fewer nucleotides.
[0119] Embodiment 15. The method of any of Embodiments 12-14, wherein the target is present from about 1 aM to about 100 M, e.g., from about 10 fM to about 100 fM.
[0120] Embodiment 16. The method of any of Embodiments 12-15, wherein the target comprises a nucleotide, protein, a chemical species, a drug molecule, a contaminant, a biomolecule, a metal, or any combination thereof.
[0121] Embodiment 17. The method of any of Embodiments 12-16, further comprising contacting the detector to a sample comprising two or more targets.
[0122] Embodiment 18. The method of Embodiment 17, further comprising detecting a signal related to one or more of (a) binding between one or more of the two or more targets and the first hairpin probe (H1), (b) a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers, (c) binding between one or more of the two or more targets and the second hairpin probe (H1), and (d) a complex that comprises the second hairpin probe (H1) and one or more hairpin helpers
[0123] Embodiment 19. A method, comprising:
[0124] to a first hairpin probe (H1) comprising a plurality of nucleotides, the first hairpin probe (H1) being linked to and in electronic communication with the first portion of graphene, in its hairpin configuration, the first hairpin probe (H1) comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion,
[0125] contacting the first hairpin probe (H1) with a target molecule (T) under such conditions that the target molecule (T) binds (e.g., hybridizes) with the paired portion of the hairpin probe (H1) and the first hairpin probe (H1) opens, the binding giving rise to an H1-T complex having a paired region formed between the first hairpin probe (H1) and the target (T), the H1-T complex further having a protruding segment.
[0126] Embodiment 20. The method of Embodiment 19, further comprising contacting the H1-T complex with a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) being capable of binding to the protruding segment and the paired region of the H1-T complex, the contacting being performed so as to displace the target (T) from the H1-T complex and give rise to a H1-H2 complex having a protruding segment.
[0127] Embodiment 21. The method of Embodiment 20, further comprising contacting the H1-H2 complex with a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion that is capable of binding to the protruding segment of the H1-H2 complex, the contacting being performed so as open second hairpin helper (H3) and give rise to a H1-H2-H3 complex having a protruding segment.
[0128] Embodiment 22. The method of Embodiment 21, further comprising contacting the H1-H2-H3 complex with a third hairpin helper (H4) that comprises a plurality of polynucleotides, the third hairpin helper (H4) further comprising a toehold portion that is capable of binding to the protruding segment of the H1-H2-H3 complex, the contacting being performed so as to give rise to a H1-H2-H3-H4 complex.
[0129] Embodiment 23. The method of any of Embodiments 19-22, further comprising effecting contact between target (T) displaced from the H1-T complex and a further hairpin probe (H1,2), the second hairpin probe (H1,2) being complementary to the target (T), the contacting giving rise to an H1,2-T complex having a paired region formed between the further hairpin probe (H1,2) and the target (T), the H1,2-T complex further having a protruding segment.
[0130] Embodiment 24. The method of Embodiment 23, further comprising contacting the H1,2-T complex with a first hairpin helper (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further being capable of hybridizing to the protruding segment and the paired region of the H1,2-T complex, the contacting being performed so as to displace the target (T) from the H1,2-T complex and give rise to a H1,2-H2 complex having a protruding segment.
[0131] Embodiment 25. The method of Embodiment 20, further comprising contacting the H1,2-H2 complex with a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion that is capable of binding to the protruding segment of the H1,2-H2 complex, the contacting being performed so as open second hairpin helper (H3) and give rise to a H1,2-H2-H3 complex having a protruding segment.
[0132] Embodiment 26. The method of Embodiment 21, further comprising contacting the H1,2-H2-H3 complex with a third hairpin helper (H4) that comprises a plurality of polynucleotides, the third hairpin helper (H4) further comprising a toehold portion that is capable of binding to the protruding segment of the H1,2-H2-H3 complex, the contacting being performed so as give rise to a H1,2-H2-H3-H4 complex.
[0133] Embodiment 27. The method of any of Embodiments 20-26, further comprising detecting a signal related to one or more of (a) binding between a target and the first hairpin probe (H1), and (b) formation of a complex that comprises the first hairpin probe (H1) and one or more hairpin helpers.
[0134] Embodiment 28. The method of Embodiment 27, wherein the signal is a change in Dirac voltage.
[0135] Embodiment 29. The method of any of Embodiments 20-28, wherein the target comprises 20 or fewer nucleotides.
[0136] Embodiment 30. The method of any of Embodiments 20-29, wherein the target is present at a concentration of less than about 100 fM.
[0137] Embodiment 31. The method of any one of Embodiments 20-29, wherein the target comprises a nucleotide, a protein, a chemical species, a drug molecule, a contaminant, a biomolecule, a metal, or any combination thereof.
[0138] Embodiment 32. The method of any of Embodiments 20-31, further comprising contacting the detector to a sample comprising two or more targets.
[0139] Embodiment 33. A method, comprising:
[0140] to one or more first hairpin probes (H1, i=1 to n) each comprising a different plurality of nucleotides,
[0141] the plurality of first hairpin probes being linked to and in electronic communication with a first portion of graphene,
[0142] each of the plurality of first hairpin probes in its hairpin configuration comprising (a) a bottom portion linked to the portion of graphene, (b) a paired portion, and (c) optionally an unpaired end portion,
[0143] contacting the plurality of first hairpin probes with one or more target molecules (T.sub.j, j=1 to m) under such conditions that one or more of the target molecules binds (e.g., hybridizes) with the paired portion of one or more first hairpin probes and the first hairpin probe opens,
[0144] the binding giving rise to an H1.sub.i-T.sub.j complex having a paired region formed between the first hairpin probe (H1.sub.i) and the target (T.sub.j), the H1.sub.i-T.sub.j complex further having a protruding segment.
[0145] Embodiment 34. The method of Embodiment 33, further comprising contacting a H1i-Tj complex with one or more first hairpin helpers (H2) that comprises a plurality of polynucleotides, the first hairpin helper (H2) further comprising a toehold portion that is capable of binding to the protruding segment and the paired region of the H1.sub.i-T.sub.j complex, the contacting being performed so as to displace the target (T.sub.i) from the H1.sub.i-T.sub.j complex and give rise to a Hi-H2 complex having a protruding segment, one or more of the first hairpin helpers H2 optionally being unique to a particular H1.sub.i-T.sub.j complex.
[0146] Embodiment 35. The method of Embodiment 34, further comprising contacting the H1i-Hi complex with a second hairpin helper (H3) that comprises a plurality of polynucleotides, the second hairpin helper (H3) further comprising a toehold portion capable of binding to the protruding segment of the H1.sub.i-H2.sub.i complex, the contacting being performed so as open second hairpin helper (H3) and give rise to a H1.sub.i-H2-H3 complex having a protruding segment.
[0147] Embodiment 36. The method of Embodiment 35, further comprising contacting the H1.sub.i-H2-H3 complex with a third hairpin helper (H4) that comprises a plurality of polynucleotides, the third hairpin helper (H4) further comprising a toehold portion capable of binding to the protruding segment of the H1.sub.i-H2-H3 complex, the contacting being performed so as open third hairpin helper (H4) and give rise to a H1.sub.i-H2-H3-H4 complex having a protruding segment.
[0148] Embodiment 37. The method of any of Embodiments 33-36, further comprising detecting a signal related to one or more of (a) binding between one or more of the two or more targets (T.sub.i) and one or more first hairpin probes (H1.sub.j) and (b) a complex that comprises the first hairpin probe (H1.sub.j) and one or more hairpin helpers.
[0149] Embodiment 38. The method of Embodiment 37, wherein the signal comprises a Dirac voltage.
REFERENCES
[0150] The following documents are incorporated herein in their entireties for any and all purposes. [0151] (1) Sawyers, C. L. Nature 2008, 452, 548-552. [0152] (2) McManus, D. D.; Freedman, J. E. Nat Rev Cardiol 2015, 12, 711-717. [0153] (3) Zhang, A.; Lieber, C. M. Chemical Reviews 2016, 116, 215-257. [0154] (4) Gao, Z.; Kang, H.; Naylor, C. H.; Streller, F.; Ducos, P.; Serrano, M. D.; Ping, J.; Zauberman, J.; Rajesh; Carpick, R. W.; Wang, Y.-J.; Park, Y. W.; Luo, Z.; Ren, L.; Johnson, A. T. C. ACS Applied Materials & Interfaces 2016, 8, 27546-27552. [0155] (5) Ping, J.; Vishnubhotla, R.; Vrudhula, A.; Johnson, A. T. C. ACS Nano 2016, 10, 8700-8704. [0156] (6) Xu, G.; Abbott, J.; Qin, L.; Yeung, K. Y. M.; Song, Y.; Yoon, H.; Kong, J.; Ham, D. Nat. Commun. 2014, 5. [0157] (7) Cai, B.; Wang, S.; Huang, L.; Ning, Y.; Zhang, Z.; Zhang, G.-J. ACS Nano 2014, 8, 2632-2638. [0158] (8) Xu, S.; Zhan, J.; Man, B.; Jiang, S.; Yue, W.; Gao, S.; Guo, C.; Liu, H.; Li, Z.; Wang, J.; Zhou, Y. Nat. Commun. 2017, 8, 14902. [0159] (9) Okahata, Y.; Kawase, M.; Niikura, K.; Ohtake, F.; Furusawa, H.; Ebara, Y. Anal. Chem. 1998, 70, 1288-1296. [0160] (10) Hayes, J.; Peruzzi, P. P.; Lawler, S. Trends in Molecular Medicine 20, 460-469. [0161] (11) Lerner, M. B.; Matsunaga, F.; Han, G. H.; Hong, S. J.; Xi, J.; Crook, A.; Perez-Aguilar, J. M.; Park, Y. W.; Saven, J. G.; Liu, R.; Johnson, A. T. C. Nano Lett. 2014, 14, 2709-2714. [0162] (12) Ouldridge, T. E.; Sulc, P.; Romano, F.; Doye, J. P. K.; Louis, A. A. Nucleic Acids Res. 2013, 41, 8886-8895. [0163] (13) SantaLucia, J. Proceedings of the National Academy of Sciences 1998, 95, 1460-1465. [0164] (14) Bonnet, G.; Tyagi, S.; Libchaber, A.; Kramer, F. R. Proceedings of the National Academy of Sciences 1999, 96, 6171-6176. [0165] (15) Tsourkas, A.; Behlke, M. A.; Rose, S. D.; Bao, G. Nucleic Acids Res. 2003, 31, 1319-1330. [0166] (16) Choi, H. M. T.; Beck, V. A.; Pierce, N. A. ACS Nano 2014, 8, 4284-4294. [0167] (17) Heller, I.; Janssens, A. M.; Mnnik, J.; Minot, E. D.; Lemay, S. G.; Dekker, C. Nano Lett. 2007, 8, 591-595. [0168] (18) Lerner, M. B.; Resczenski, J. M.; Amin, A.; Johnson, R. R.; Goldsmith, J. I.; Johnson, A. T. C. J. Am. Chem. Soc. 2012, 134, 14318-14321. [0169] (19) Wolfe, B. R.; Pierce, N. A. ACS Synthetic Biology 2015, 4, 1086-1100. [0170] (20) Dirks, R. M.; Pierce, N. A. Proc. Natl. Acad. Sci. U.S.A 2004, 101, 15275-15278. [0171] (21) Morozov, S. V.; Novoselov, K. S.; Katsnelson, M. I.; Schedin, F.; Elias, D. C.; Jaszczak, J. A.; Geim, A. K. Phys. Rev. Lett. 2008, 100, 016602. [0172] (22) Chen, F.; Xia, J.; Ferry, D. K.; Tao, N. Nano Lett. 2009, 9, 2571-2574. [0173] (23) Ping, J.; Xi, J.; Saven, J. G.; Liu, R.; Johnson, A. T. C. Biosensors and Bioelectronics 2015.