Genetically modified mice expressing humanized CD47
10918095 ยท 2021-02-16
Assignee
Inventors
- Yuelei SHEN (Beijing, CN)
- Yang Bai (Beijing, CN)
- Jian Ni (Beijing, CN)
- Rui Huang (Beijing, CN)
- Chengzhang Shang (Beijing, CN)
- Yanan Guo (Beijing, CN)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
C07K14/70596
CHEMISTRY; METALLURGY
G01N33/57492
PHYSICS
C12N15/1138
CHEMISTRY; METALLURGY
A01K2267/0393
HUMAN NECESSITIES
A01K67/0278
HUMAN NECESSITIES
A01K2217/072
HUMAN NECESSITIES
G01N2800/52
PHYSICS
International classification
C12N15/00
CHEMISTRY; METALLURGY
Abstract
The present disclosure relates to genetically modified non-human animals that express a human or chimeric (e.g., humanized) CD47, and methods of use thereof.
Claims
1. A genetically modified mouse whose genome comprises a nucleic acid sequence encoding a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 74, 75, 76, 77, 78, 79 or 80, operably linked to a promoter of the mouse CD47 gene, wherein the mouse functionally expresses the chimeric CD47.
2. The genetically modified mouse of claim 1, wherein the mouse does not express endogenous CD47.
3. The genetically modified mouse of claim 1, wherein the mouse is homozygous with respect to the nucleic acid sequence encoding the chimeric CD47 protein.
4. The genetically modified mouse of claim 1, wherein the genome of the mouse further comprises a nucleic acid sequence encoding a humanized signal regulatory protein alpha (SIRP).
5. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 74.
6. The genetically modified mouse of claim 1, wherein the nucleic acid sequence 9 encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 75.
7. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 76.
8. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 77.
9. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 78.
10. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 79.
11. The genetically modified mouse of claim 1, wherein the nucleic acid sequence encodes a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 80.
12. A method of evaluating a drug for the treatment of cancer, the method comprising: a) administering the drug to a genetically modified mouse that has a tumor comprising human cancer cells, and b) determining whether the drug inhibits the tumor, wherein the genetically modified mouse has a genome comprising a nucleic acid sequence encoding a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 74, 75, 76, 77, 78, 79 or 80 operably linked to a promoter of the mouse CD47 gene, and wherein the mouse functionally expresses the chimeric CD47.
13. The method of claim 12, wherein the drug is an anti-CD47 antibody.
14. A method of preparing a genetically modified mouse, the method comprising: 1) providing a plasmid comprising a human CD47 gene fragment from exon 2 of the human CD47 gene, a 5 homology arm, and a 3 homology arm, wherein the 5 and 3 homology arms target exon 2 of a mouse CD47 gene; 2) providing a first small guide RNA (sgRNA) that targets a nucleic acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8; 3) providing a second sgRNA that targets a nucleic acid sequence selected from the group consisting of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17; 4) modifying the genome of a mouse embryo using the plasmid of step 1), the first sgRNA of step 2), the second sgRNA of step 3), and Cas9; and 5) transplanting the embryo obtained in step 4) into a recipient mouse such that a transgenic mouse is obtained, wherein the transgenic mouse has a genome comprising a nucleic acid sequence encoding a chimeric CD47 protein comprising the amino acid sequence of SEQ ID NO: 74, 75, 76, 77, 78, 79 or 80, operably linked to a promoter of the mouse CD47 gene, wherein the mouse functionally expresses the chimeric CD47.
15. The genetically modified mouse of claim 14, wherein the first sgRNA targets SEQ ID NO: 6 and the second sgRNA targets SEQ ID NO: 9.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
DETAILED DESCRIPTION
(33) This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) CD47, and methods of use thereof.
(34) CD47, also known as integrin associated protein (IAP), is a transmembrane protein that in humans is encoded by the CD47 gene. CD47 belongs to the immunoglobulin superfamily and partners with membrane integrins and also binds the ligands thrombospondin-1 (TSP-1) and signal-regulatory protein alpha (SIRP). It is involved in a range of cellular processes, including apoptosis, proliferation, adhesion, and migration.
(35) CD47 provides a do not eat signal by binding to the N-terminus of signal regulatory protein alpha (SIRP) on immune cells and suppresses phagocytosis, and it is ubiquitously expressed in human cells and has been found to be overexpressed in many different tumor cells. Thus, targeting CD47 is in the spotlight of cancer immunotherapy. Blocking CD47 triggers the recognition and elimination of cancer cells by the innate immunity. There are at least three CD47 antagonists in phase I clinical trials, including Hu5F9-G4, CC-90002, and TTI-621. These antibodies or binding agents can be used to treat various tumors and cancers, e.g., solid tumors, hematologic malignancies (e.g., relapsed or refractory hematologic malignancies), acute myeloid leukemia, non-Hodgkin's lymphoma, breast cancer, bladder cancer, ovarian cancer, and small cell lung cancer tumors. These CD47 antagonists are described, e.g., in Huang et al. Targeting CD47: the achievements and concerns of current studies on cancer immunotherapy. Journal of thoracic disease 9.2 (2017): E168; Liu et al. Pre-clinical development of a humanized anti-CD47 antibody with anti-cancer therapeutic potential. PloS one 10.9 (2015): e0137345; Ansell et al. A phase 1 study of TTI-621, a novel immune checkpoint inhibitor targeting CD47, in patients with relapsed or refractory hematologic malignancies. (2016): 1812-1812; which are incorporated herein by reference in its entirety.
(36) Experimental animal models are an indispensable research tool for studying the effects of these antibodies. Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal's homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal's endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels. Furthermore, because of interaction between human CD47 and human SIRP, a desirable animal model for the investigation of anti-CD47 should faithfully mimic the interaction between human CD47 and human SIRP, elicit robust responses from both the innate and adaptive immunity, and recapitulate side effects of CD47 blockade on RBCs and platelets (Huang et al. Targeting CD47: the achievements and concerns of current studies on cancer immunotherapy. Journal of thoracic disease 9.2 (2017): E168).
(37) Unless otherwise specified, the practice of the methods described herein can take advantage of the techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature, for examples: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glovered., 1985); Oligonucleotide Synthesis (M. J. Gaited., 1984); Mullisetal U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames& S. J. Higginseds. 1984); Transcription And Translation (B. D. Hames& S. J. Higginseds. 1984); Culture Of Animal Cell (R. I. Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984), the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols. 154 and 155 (Wuetal. eds.) and Vol. 185, Gene Expression Technology (D. Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Caloseds., 1987, Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Hand book Of Experimental Immunology, Volumes V (D. M. Weir and C. C. Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986); each of which is incorporated herein by reference in its entirety.
(38) CD47
(39) CD47 is a 50 kDa heavily glycosylated, ubiquitously expressed membrane protein of the immunoglobulin superfamily with a single IgV-like domain at its N-terminus, a highly hydrophobic stretch with five membrane-spanning segments and an alternatively spliced cytoplasmic C-terminus. Each of the four alternatively spliced cytoplasmic tails exists in vivo at different frequencies, but all lack a substantial signaling domain.
(40) While CD47 was first identified as a membrane protein involved in 3 integrin-mediated signaling on leukocytes, it is now known to also interact with thrombospondin-1, signal regulatory protein-alpha (SIRP, also known as SIRPA, Sirp, Sirp, or CD172A), and others to regulate various cellular functions including cell migration, axon extension, cytokine production, and T cell activation.
(41) Recent studies have focused most on CD47-SIRP axis for its inhibitory role in phagocytosis. SIRP, also known as Src homology 2 domain-containing protein tyrosine phosphatase substrate 1/brain Ig-like molecule with tyrosine-based activation motif/cluster of differentiation antigen-like family member A (SHPS-1/BIT/CD172a), is another membrane protein of the immunoglobulin superfamily that is particularly abundant in the myeloid-lineage hematopoietic cells such as macrophages and dendritic cells. The ligation of SIRP on phagocytes by CD47 expressed on a neighboring cell results in phosphorylation of SIRP cytoplasmic immunoreceptor tyrosine-based inhibition (ITIM) motifs, leading to the recruitment of SHP-1 and SHP-2 phosphatases. One resulting downstream effect is the prevention of myosin-IIA accumulation at the phagocytic synapse and consequently inhibition of phagocytosis. Thus, CD47-SIRP interaction functions as a negative immune checkpoint to send a don't eat me signal to ensure that healthy autologous cells are not inappropriately phagocytosed.
(42) Overexpression of CD47 has been found in nearly all types of tumors, some of which include acute myeloid leukemia, non-Hodgkin's lymphoma, bladder cancer, and breast cancer. While CD47 is implicated in the regulation of cancer cell invasion and metastasis, its most well-studied and important function related to tumor development is prevention of phagocytosis via ligating with SIRP on the surrounding phagocytes. Also, CD47 expression on cancer stem cells (CSCs) implies its role in cancer recurrence. It can increase the chance of CSC survival, which in turn could repopulate a new tumor mass and cause a tumor relapse.
(43) CD47 down-regulation is also involved in the clearance of red blood cells (RBCs) and platelets by splenic macrophages, which may cause hemolytic anemia and idiopathic thrombocytopenic purpura, respectively. Thus, when CD47 antagonists are used as therapies, it is also very important to assess its toxicities.
(44) A detailed description of CD47 and its function can be found, e.g., in Liu, Xiaojuan, et al. Is CD47 an innate immune checkpoint for tumor evasion?. Journal of hematology & oncology 10.1 (2017): 12; Huang et al. Targeting CD47: the achievements and concerns of current studies on cancer immunotherapy. Journal of thoracic disease 9.2 (2017): E168; which are incorporated by reference herein in the entirety.
(45) In human genomes, CD47 gene (Gene ID: 961) locus has 11 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11. The CD47 protein has an extracellular N-terminal IgV domain, five transmembrane domains, a short C-terminal intracellular tail. In addition, it has two extracellular regions and two intracellular regions between neighboring transmembrane domains. The signal peptide is located at the extracellular N-terminal IgV domain of CD47. The nucleotide sequence for human CD47 mRNA is NM_001777.3 (SEQ ID NO: 59), and the amino acid sequence for human CD47 is NP_001768.1 (SEQ ID NO: 63). The location for each exon and each region in human CD47 nucleotide sequence and amino acid sequence is listed below:
(46) TABLE-US-00001 TABLE 1 NM_001777.3 NP_001768.1 Human CD47 5346 bp 323 aa (approximate location) (SEQ ID NO: 59) (SEQ ID NO: 63) Exon 1 1-226 1-15 Exon 2 227-580 16-133 Exon 3 581-670 134-163 Exon 4 671-778 164-199 Exon 5 779-871 200-230 Exon 6 872-964 231-261 Exon 7 965-1057 262-292 Exon 8 1058-1089 293-303 Exon 9 1090-1114 304-311 Exon 10 1115-1147 312-322 Exon 11 1148-5346 323 Signal peptide 181-234 1-18 Donor region in one 247-558* 23-126 example (with point mutation 375 (T.fwdarw.C))
(47) The extracellular N-terminal IgV domain is 19-141 of SEQ ID NO: 63, and the C-terminal intracellular tail is located at 290-323 of SEQ ID NO: 63. Thus, the donor region is located within the extracellular N-terminal IgV domain.
(48) Human CD47 also have several transcript variants. These variants are summarized below.
(49) TABLE-US-00002 TABLE 2 Human CD47 transcript variants Amino acid sequences NM_001777.3 NP_001768.1 SEQ ID NO: 59 (5346 bp) SEQ ID NO: 63 (323 aa) NM_198793.2 NP_942088.1 SEQ ID NO: 60 (5288 bp) SEQ ID NO: 64 (305 aa) XM_005247909.1 XP_005247966.1 SEQ ID NO: 61 (5021 bp) SEQ ID NO: 65 (293 aa) XM_005247908.1 XP_005247965.1 SEQ ID NO: 62 (5078 bp) SEQ ID NO: 66 (312 aa)
(50) In mice, CD47 gene locus has 10 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, and exon 10 (
(51) TABLE-US-00003 TABLE 3 NM_010581.3 NP_034711.1 Mouse CD47 1928 bp 324 aa (approximate location) (SEQ ID NO: 45) (SEQ ID NO: 52) Exon 1 1-179 1-15 Exon 2 180-527 16-131 Exon 3 528-590 132-152 Exon 4 591-680 153-182 Exon 5 681-788 183-218 Exon 6 789-881 219-249 Exon 7 882-974 250-280 Exon 8 975-1067 281-311 Exon 9 1068-1099 312-322 Exon 10 1100-1919 323-324 Signal peptide 134-187 1-18 Replaced region in one example 200-505 23-124
(52) The mouse CD47 gene (Gene ID: 16423) is located in Chromosome 16 of the mouse genome, which is located from 49855253 to 49912424, of NC_000082.6 (GRCm38.p4 (GCF_000001635.24)). The 5-UTR is from 49855618 to 49855786, exon 1 is from 49,855,618 to 49,855,832, the first intron is from 49,855,833 to 49,867,764, exon 2 is from 49,867,765 to 49,868,112, the second intron is from 49,868,113 to 49,869,017, exon 3 is from 49,869,018 to 49,869,080, the third intron is from 49,869,081 to 49,884,164, exon 4 is from 49,884,165 to 49,884,254, the fourth intron is from 49,884,255 to 49,894,176, exon 5 is from 49,894,177 to 49,894,284, the fifth intron is from 49,894,285 to 49,895,368, exon 6 is from 49,895,369 to 49,895,461, the sixth intron is from 49,895,462 to 49,896,355, exon 7 is from 49,896,356 to 49,896,448, the seventh intron is from 49,896,449 to 49,898,039, exon 8 is from 49,898,040 to 49,898,132, the eighth intron is from 49,898,133 to 49,906,780, exon 9 is from 49,906,781 to 49,906,812, the ninth intron is from 49,906,813 to 49,910,868, exon 10 is from 49,910,869 to 49,915,010, the 3-UTR is from 49910878 to 49,915,010, based on transcript NM_010581.3. All relevant information for mouse CD47 locus can be found in the NCBI website with Gene ID: 16423, which is incorporated by reference herein in its entirety.
(53) Like human CD47, mouse CD47 also have several transcript variants. These variants are summarized in Table 4.
(54)
(55) CD47 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for CD47 in Rattus norvegicus is 29364, the gene ID for CD47 in Macaca mulatta (Rhesus monkey) is 704980, the gene ID for CD47 in Canis lupus familiaris (dog) is 478552, and the gene ID for CD47 in Cavia porcellus (domestic guinea pig) is 100727770. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database.
(56) The present disclosure provides human or chimeric (e.g., humanized) CD47 nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, signal peptide, the extracellular N-terminal IgV domain, the transmembrane domains (e.g., the first transmembrane domain, the second transmembrane domain, the third transmembrane domain, the fourth transmembrane domain, and/or the fifth transmembrane domain), and/or the C-terminal intracellular region are replaced by the corresponding human sequence. As used herein, the first transmembrane domain refers to the first transmembrane domain starting from the N-terminal of CD47. Similarly, the second, third, fourth, and fifth transmembrane domain refers to the second, third, fourth, and fifth transmembrane domain starting from the N-terminal of CD47.
(57) In some embodiments, a region or portion of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, signal peptide, the extracellular N-terminal IgV domain, the transmembrane domains (e.g., the first transmembrane domain, the second transmembrane domain, the third transmembrane domain, the fourth transmembrane domain, and/or the fifth transmembrane domain), and/or the C-terminal intracellular region is replaced by the corresponding human sequence. The term region or portion can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, or 400 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, or 150 amino acid residues.
(58) In some embodiments, the region or portion can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, signal peptide, the extracellular N-terminal IgV domain, the transmembrane domains (e.g., the first transmembrane domain, the second transmembrane domain, the third transmembrane domain, the fourth transmembrane domain, and/or the fifth transmembrane domain), and/or the C-terminal intracellular region. In some embodiments, a region, a portion, or the entire sequence of mouse exon 2 is replaced by a region, a portion, or the entire sequence of human exon 2.
(59) In some embodiments, a region or portion of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, signal peptide, the extracellular N-terminal IgV domain, the transmembrane domains (e.g., the first transmembrane domain, the second transmembrane domain, the third transmembrane domain, the fourth transmembrane domain, and/or the fifth transmembrane domain), and/or the C-terminal intracellular region is deleted.
(60) The mouse CD47 has several transcript variants. A portion of these sequences can also be replaced by corresponding human sequences. Some exemplary sequences are shown in Table 4.
(61) TABLE-US-00004 TABLE 4 Mouse CD47 sequence Humanized CD47 sequence Amino acid Amino acid mRNA sequence sequence mRNA sequence sequence NM_010581.3 NP_034711.1 SEQ ID NO: 67 SEQ ID NO: 74 SEQ ID NO: 45 SEQ ID NO: 52 (1934 bp) (326 aa) (1928 bp) (324 aa) XM_006521809.3 XP_006521872.1 SEQ ID NO: 68 SEQ ID NO: 75 SEQ ID NO: 46 SEQ ID NO: 53 (3107 bp) (322 aa) (3101 bp) (320 aa) XM_006521806.3 XP_006521869.1 SEQ ID NO: 69 SEQ ID NO: 76 SEQ ID NO: 47 SEQ ID NO: 54 (3120 bp) (344 aa) (3114 bp) (342 aa) XM_006521807.3 XP_006521870.1 SEQ ID NO: 70 SEQ ID NO: 77 SEQ ID NO: 48 SEQ ID NO: 55 (3087 bp) (333 aa) (3081 bp) (331 aa) XM_006521810.3 XP_006521873.1 SEQ ID NO: 71 SEQ ID NO: 78 SEQ ID NO: 49 SEQ ID NO: 56 (3030 bp) (314 aa) (3024 bp) (312 aa) XM_006521808.3 XP_006521871.1 SEQ ID NO: 72 SEQ ID NO: 79 SEQ ID NO: 50 SEQ ID NO: 57 (3057 bp) (323 aa) (3051 bp) (321 aa) XM_006521811.3 XP_006521874.1 SEQ ID NO: 73 SEQ ID NO: 80 SEQ ID NO: 51 SEQ ID NO: 58 (2999 bp) (305 aa) (2993 bp) (303 aa)
(62) Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) CD47 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from mouse CD47 mRNA sequence (e.g., SEQ ID NO: 45, 46, 47, 48, 49, 50, or 51), mouse CD47 amino acid sequence (e.g., SEQ ID NO: 52, 53, 54, 55, 56, 57, 58), or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, or exon 10); and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from human CD47 mRNA sequence (e.g., SEQ ID NO: 59, 60, 61, or 62), human CD47 amino acid sequence (e.g., SEQ ID NO: 63, 64, 65, or 66), or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or exon 11).
(63) In some embodiments, the sequence encoding amino acids 23-124 of mouse CD47 (SEQ ID NO: 52) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CD47 (e.g., amino acids 23-126 of human CD47 (SEQ ID NO: 63).
(64) In some embodiments, the nucleic acids as described herein are operably linked to a promoter or regulatory element, e.g., an endogenous mouse CD47 promoter, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.
(65) In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse CD47 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or SEQ ID NO: 45, 46, 47, 48, 49, 50, or 51).
(66) In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse CD47 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or SEQ ID NO: 45, 46, 47, 48, 49, 50, or 51).
(67) In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire human CD47 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 59, 60, 61, or 62).
(68) In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human CD47 nucleotide sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 59, 60, 61, or 62).
(69) In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse CD47 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or SEQ ID NO: 52, 53, 54, 55, 56, 57, or 58).
(70) In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse CD47 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, or SEQ ID NO: 52, 53, 54, 55, 56, 57, or 58).
(71) In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human CD47 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 63, 64, 65, or 66).
(72) In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human CD47 amino acid sequence (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, or SEQ ID NO: 63, 64, 65, or 66).
(73) The present disclosure also provides a humanized CD47 mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:
(74) a) an amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80;
(75) b) an amino acid sequence having a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80;
(76) c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80 under a low stringency condition or a strict stringency condition;
(77) d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80;
(78) e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or
(79) f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80.
(80) The present disclosure also relates to a CD47 nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:
(81) a) a nucleic acid sequence as shown in SEQ ID NO: 67, 68, 69, 70, 71, 72, or 73, or a nucleic acid sequence encoding a homologous CD47 amino acid sequence of a humanized mouse;
(82) b) a nucleic acid sequence that is shown in SEQ ID NO: 23;
(83) c) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 23, 67, 68, 69, 70, 71, 72, or 73 under a low stringency condition or a strict stringency condition;
(84) d) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence as shown in SEQ ID NO: 23, 67, 68, 69, 70, 71, 72, or 73;
(85) e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80;
(86) f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80;
(87) g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or
(88) h) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80.
(89) The present disclosure further relates to a CD47 genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 23, 67, 68, 69, 70, 71, 72, or 73.
(90) The disclosure also provides an amino acid sequence that has a homology of at least 90% with, or at least 90% identical to the sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
(91) In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
(92) The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90% identical to the sequence shown in SEQ ID NO: 67, 68, 69, 70, 71, 72, or 73, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 67, 68, 69, 70, 71, 72, or 73 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
(93) In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 67, 68, 69, 70, 71, 72, or 73 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
(94) The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.
(95) In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.
(96) In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.
(97) To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90%, 95%, or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For purposes of the present disclosure, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
(98) The percentage of identical residues (percent identity) and the percentage of residues conserved with similar physicochemical properties (percent homology), e.g. leucine and isoleucine, can be used to measure sequence similarity. Residues conserved with similar physicochemical properties are well known in the art. The homology percentage, in many cases, is higher than the identity percentage.
(99) Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) CD47 from an endogenous non-human CD47 locus.
(100) Genetically Modified Animals
(101) As used herein, the term genetically-modified non-human animal refers to a non-human animal having genetic modification (e.g., exogenous DNA) in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of cells of the genetically-modified non-human animal have the genetic modification in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous CD47 locus that comprises an exogenous sequence (e.g., a human sequence), e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.
(102) As used herein, the term chimeric gene or chimeric nucleic acid refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wildtype nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.
(103) As used herein, the term chimeric protein or chimeric polypeptide refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wildtype amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.
(104) In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized CD47 gene or a humanized CD47 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human CD47 gene, at least one or more portions of the gene or the nucleic acid is from a non-human CD47 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a CD47 protein. The encoded CD47 protein is functional or has at least one activity of the human CD47 protein or the non-human CD47 protein, e.g., binding to human or non-human SIRP, promoting phosphorylation of SIRP cytoplasmic ITIM motif, inhibiting phagocytosis, downregulating immune response, binding TSP-1, suppressing c-Myc expression, and/or inhibiting self-renewal.
(105) In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized CD47 protein or a humanized CD47 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human CD47 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human CD47 protein. The humanized CD47 protein or the humanized CD47 polypeptide is functional or has at least one activity of the human CD47 protein or the non-human CD47 protein.
(106) In some embodiments, the humanized CD47 protein or the humanized CD47 polypeptide can bind to mouse SIRP, inhibit phagocytosis, and/or downregulate immune response. In some embodiments, the humanized CD47 protein or the humanized CD47 polypeptide cannot bind to mouse SIRP, thus cannot inhibit phagocytosis.
(107) The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey). For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.
(108) In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.
(109) In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/01a. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 12951/SV, 12951/SvIm), 129S2, 129S4, 129S5, 12959/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10:836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000), both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50% BALB/c-50% 12954/Sv; or 50% C57BL/6-50% 129).
(110) In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
(111) The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized CD47 animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor), can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin), physical means (e.g., irradiating the animal), and/or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2R knockout mice, NOD/SCID/cnull mice (Ito, M. et al., NOD/SCID/cnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100(9):3175-3182, 2002), nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human CD47 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2R knockout mice, NOD/SCID/c null mice, nude mice, Rag1 and/or Rag2 knockout mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature CD47 coding sequence with human mature CD47 coding sequence.
(112) The mouse genetic background can affect the interaction of CD47 and SIRP in the mouse. In mice with C57BL/6 background, the mouse SIRP has a relatively weak binding affinity with humanized or human CD47 protein. In contrast, in mice with BALB/c background, the binding affinity between mouse SIRP and human (or humanized) CD47 protein is similar to the binding affinity between mouse SIRP and mouse CD47 protein. Thus, in some embodiments, the humanized CD47 mouse with C57BL/6 background can be used to test the toxicity of anti-hCD47 antibodies. In some embodiments, the humanized CD47 mouse with BALB/c background can be used to test the toxicity of anti-hCD47 antibodies and/or the efficacy of anti-hCD47 antibodies in terms of inhibiting tumor growth. In some embodiments, mice (any background) with both humanized CD47 and humanized SIRP can be used to test the toxicity of anti-hCD47 antibodies and/or the efficacy of anti-hCD47 antibodies in terms of inhibiting tumor growth.
(113) Genetically modified non-human animals can comprise a modification of an endogenous non-human CD47 locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature CD47 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the mature CD47 protein sequence). Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells), in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous CD47 locus in the germline of the animal.
(114) Genetically modified animals can express a human CD47 and/or a chimeric (e.g., humanized) CD47 from endogenous mouse loci, wherein the endogenous mouse CD47 gene has been replaced with a human CD47 gene and/or a nucleotide sequence that encodes a region of human CD47 sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the human CD47 sequence. In various embodiments, an endogenous non-human CD47 locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature CD47 protein.
(115) In some embodiments, the genetically modified mice express the human CD47 and/or chimeric CD47 (e.g., humanized CD47) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement(s) at the endogenous mouse loci provide non-human animals that express human CD47 or chimeric CD47 (e.g., humanized CD47) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human CD47 or the chimeric CD47 (e.g., humanized CD47) expressed in animal can maintain one or more functions of the wildtype mouse or human CD47 in the animal. For example, CD47 can bind to human or non-human SIRP, and downregulate immune response, e.g., downregulate immune response by at least 10%, 20%, 30%, 40%, or 50%. Furthermore, in some embodiments, the animal does not express endogenous CD47. As used herein, the term endogenous CD47 refers to CD47 protein that is expressed from an endogenous CD47 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.
(116) The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human CD47 (e.g., SEQ ID NO: 63, 64, 65, or 66). In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 74, 75, 76, 77, 78, 79, or 80.
(117) The genome of the genetically modified animal can comprise a replacement at an endogenous CD47 gene locus of a sequence encoding a region of endogenous CD47 with a sequence encoding a corresponding region of human CD47. In some embodiments, the sequence that is replaced is any sequence within the endogenous CD47 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, 5-UTR, 3UTR, the first intron, the second intron, and the third intron, the fourth intron, the fifth intron, the sixth intron, the seventh intron, the eighth intron, or the ninth intron etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous CD47 gene. In some embodiments, the sequence that is replaced is exon 2 or part thereof, of an endogenous mouse CD47 gene locus.
(118) The genetically modified animal can have one or more cells expressing a human or chimeric CD47 (e.g., humanized CD47) having a N-terminal IgV domain and a C-terminal intracellular region, wherein the N-terminal IgV domain comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% identical to the N-terminal IgV domain of human CD47. In some embodiments, the N-terminal IgV domain of the humanized CD47 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 amino acids (e.g., contiguously or non-contiguously) that are identical to human CD47.
(119) Because human CD47 and non-human CD47 (e.g., mouse CD47) sequences, in many cases, are different, antibodies that bind to human CD47 will not necessarily have the same binding affinity with non-human CD47 or have the same effects to non-human CD47. Therefore, the genetically modified animal having a human or a humanized extracellular region can be used to better evaluate the effects of anti-human CD47 antibodies in an animal model. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to part or the entire sequence of exon 2 of human CD47, part or the entire sequence of the extracellular N-terminal IgV domain of human CD47 (with or without signal peptide), or part or the entire sequence of amino acids 23-126 of SEQ ID NO: 63.
(120) In some embodiments, the non-human animal can have, at an endogenous CD47 gene locus, a nucleotide sequence encoding a chimeric human/non-human CD47 polypeptide, wherein a human portion of the chimeric human/non-human CD47 polypeptide comprises a portion of human CD47 extracellular N-terminal IgV domain, and wherein the animal expresses a functional CD47 on a surface of a cell of the animal. The human portion of the chimeric human/non-human CD47 polypeptide can comprise a portion of exon 2 of human CD47. In some embodiments, the human portion of the chimeric human/non-human CD47 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99% identical to amino acids 23-126 of SEQ ID NO: 63.
(121) In some embodiments, the non-human portion of the chimeric human/non-human CD47 polypeptide comprises transmembrane domains, C-terminal intracellular region, and/or regions between transmembrane domains of an endogenous non-human CD47 polypeptide.
(122) Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous CD47 locus, or homozygous with respect to the replacement at the endogenous CD47 locus.
(123) In some embodiments, the humanized CD47 locus lacks a human CD47 5-UTR. In some embodiment, the humanized CD47 locus comprises a rodent (e.g., mouse) 5-UTR. In some embodiments, the humanization comprises a human 3-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human CD47 genes appear to be similarly regulated based on the similarity of their 5-flanking sequence. As shown in the present disclosure, humanized CD47 mice that comprise a replacement at an endogenous mouse CD47 locus, which retain mouse regulatory elements but comprise a humanization of CD47 encoding sequence, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized CD47 are grossly normal.
(124) The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene(s).
(125) In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.
(126) In some embodiments, the non-human mammal expresses a protein encoded by a humanized CD47 gene.
(127) In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse).
(128) The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
(129) The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized CD47 in the genome of the animal.
(130) In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized CD47 is provided. In some embodiments, the tissue-specific expression of human or humanized CD47 protein is provided.
(131) In some embodiments, the expression of human or humanized CD47 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance.
(132) Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents). In some embodiments, the non-human mammal is a mouse.
(133) Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.
(134) The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human CD47 protein can be detected by a variety of methods.
(135) There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies). In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized CD47 protein.
(136) Vectors
(137) The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5 end of a region to be altered (5 arm), which is selected from the CD47 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3 end of the region to be altered (3 arm), which is selected from the CD47 gene genomic DNAs in the length of 100 to 10,000 nucleotides.
(138) In some embodiments, a) the DNA fragment homologous to the 5 end of a conversion region to be altered (5 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000082.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000082.6.
(139) In some embodiments, a) the DNA fragment homologous to the 5 end of a region to be altered (5 arm) is selected from the nucleotides from the position 49866727 to the position 49867784 of the NCBI accession number NC_000082.6; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotides from the position 49868091 to the position 49869239 of the NCBI accession number NC_000082.6.
(140) In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, or about 5 kb.
(141) In some embodiments, the region to be altered is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, or exon 10 of CD47 gene (e.g., exon 2 of mouse CD47 gene).
(142) The targeting vector can further include a selected gene marker.
(143) In some embodiments, the sequence of the 5 arm is shown in SEQ ID NO: 24; and the sequence of the 3 arm is shown in SEQ ID NO: 32.
(144) In some embodiments, the sequence is derived from human (e.g., 108080013-108080324 of NC_000003.12). For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human CD47, preferably exon 2 of the human CD47. In some embodiments, the nucleotide sequence of the humanized CD47 encodes the entire or the part of human CD47 protein (e.g., SEQ ID NO: 63, 64, 65, or 66).
(145) The disclosure also relates to a cell comprising the targeting vectors as described above.
(146) In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.
(147) In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.
(148) In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell.
(149) Methods of Making Genetically Modified Animals
(150) Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ), homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., Delivery technologies for genome editing, Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.
(151) Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous CD47 gene locus, a sequence encoding a region of an endogenous CD47 with a sequence encoding a corresponding region of human or chimeric CD47. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.
(152)
(153) Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous CD47 locus (or site), a nucleic acid encoding a sequence encoding a region of endogenous CD47 with a sequence encoding a corresponding region of human CD47. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of a human CD47 gene. In some embodiments, the sequence includes a region of exon 2 of a human CD47 gene (e.g., amino acids 23-126 of SEQ ID NO: 63). In some embodiments, the region is located within the extracellular N-terminal IgV domain of CD47. In some embodiments, the endogenous CD47 locus is exon 2 of mouse CD47.
(154) In some embodiments, the methods of modifying a CD47 locus of a mouse to express a chimeric human/mouse CD47 peptide can include the steps of replacing at the endogenous mouse CD47 locus a nucleotide sequence encoding a mouse CD47 with a nucleotide sequence encoding a human CD47, thereby generating a sequence encoding a chimeric human/mouse CD47.
(155) In some embodiments, the nucleotide sequence encoding the chimeric human/mouse CD47 can include a first nucleotide sequence encoding a region of the extracellular N-terminal IgV domain of mouse CD47 (with or without the mouse or human signal peptide sequence); a second nucleotide sequence encoding a region of the extracellular N-terminal IgV domain of human CD47; a third nucleotide sequence encoding the five transmembrane regions, the regions between the transmembrane regions, and/or the C-terminal intracellular tail of a mouse CD47.
(156) In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, the second nucleotide sequence, and/or the third nucleotide sequence do not overlap). In some embodiments, the amino acid sequences as described herein do not overlap with each other.
(157) The present disclosure further provides a method for establishing a CD47 gene humanized animal model, involving the following steps:
(158) (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;
(159) (b) culturing the cell in a liquid culture medium;
(160) (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;
(161) (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c).
(162) In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 or BALB/c mouse).
(163) In some embodiments, the non-human mammal in step (c) is a female with pseudo pregnancy (or false pregnancy).
(164) In some embodiments, the fertilized eggs for the methods described above are C57BL/6 or BALB/c fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.
(165) Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the method described above.
(166) Methods of Using Genetically Modified Animals
(167) Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay. Inclusion in the human transgene of upstream and/or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and/or regulation of the transgene.
(168) In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.
(169) Genetically modified animals that express human or humanized CD47 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or efficacy of these human therapeutics in the animal models.
(170) In various aspects, genetically modified animals are provided that express human or humanized CD47, which are useful for testing agents that can decrease or block the interaction between CD47 and SIRP or the interaction between CD47 and other CD47 receptors or ligands (e.g., TSP-1), testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an CD47 agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout). In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, e.g., a B or T cell tumor).
(171) In some embodiments, the genetically modified animals can be used for determining effectiveness of an anti-CD47 antibody for the treatment of cancer. The methods involve administering the anti-CD47 antibody to the animal as described herein, wherein the animal has a tumor; and determining the inhibitory effects of the anti-CD47 antibody to the tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment), a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT.
(172) In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-CD47 antibody or anti-SIRP antibody prevents CD47 from binding to SIRP. In some embodiments, the anti-CD47 antibody or anti-SIRP antibody cannot prevent CD47 from binding to SIRP.
(173) In some embodiments, the genetically modified animals can be used for determining whether an anti-CD47 antibody is a CD47 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the agent (e.g., anti-CD47 antibodies) on CD47, e.g., whether the agent can stimulate macrophages, whether the agent can initiate an antitumor T-cell immune response, and/or whether the agent can upregulate the immune response or downregulate immune response. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer, or autoimmune diseases.
(174) The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI.sub.TV). The tumor growth inhibition rate can be calculated using the formula TGI.sub.TV (%)=(1TVt/TVc)100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.
(175) In some embodiments, the anti-CD47 antibody is designed for treating various cancers. As used herein, the term cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term tumor as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An adenocarcinoma refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term sarcoma is art recognized and refers to malignant tumors of mesenchymal derivation.
(176) In some embodiments, the anti-CD47 antibody or anti-SIRP antibody is designed for treating melanoma (e.g., advanced melanoma), non-small cell lung carcinoma (NSCLC), small cell lung cancer (SCLC), B-cell non-Hodgkin lymphoma, bladder cancer, and/or prostate cancer (e.g., metastatic hormone-refractory prostate cancer). In some embodiments, the antibody is designed for treating hepatocellular, ovarian, colon, or cervical carcinomas. In some embodiments, the antibody is designed for treating advanced breast cancer, advanced ovarian cancer, and/or advanced refractory solid tumor. In some embodiments, the antibody is designed for treating metastatic solid tumors, NSCLC, melanoma, non-Hodgkin lymphoma, colorectal cancer, and multiple myeloma. In some embodiments, the treatment is designed for treating acute myeloid leukemia, non-Hodgkin's lymphoma, bladder cancer, or breast cancer.
(177) In some embodiments, the antibody is designed for treating various autoimmune diseases. Thus, the methods as described herein can be used to determine the effectiveness of an antibody in inhibiting immune response.
(178) The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-CD47 antibody or anti-SIRP antibody). The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC), hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%.
(179) The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
(180) In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.
(181) The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the CD47 gene function, human CD47 antibodies, drugs for human CD47 targeting sites, the drugs or efficacies for human CD47 targeting sites, the drugs for immune-related diseases and antitumor drugs.
(182) Genetically Modified Animal Model with Two or More Human or Chimeric Genes
(183) The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric CD47 gene and a sequence encoding one or more additional human or chimeric protein.
(184) In some embodiments, the additional human or chimeric protein can be SIRP, programmed cell death protein 1 (PD-1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), Lymphocyte Activating 3 (LAG-3), B And T Lymphocyte Associated (BTLA), Programmed Cell Death 1 Ligand 1 (PD-L1), CD27, CD28, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT), T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3), Glucocorticoid-Induced TNFR-Related Protein (GITR), CD137, or TNF Receptor Superfamily Member 4 (TNFRSF4 or OX40).
(185) In some embodiments, the additional human or chimeric protein is SIRP. The animal that have a human or chimeric CD47 gene and a human or chimeric SIRP gene can be used to determine the toxicities and the efficacy of an anti-CD47 antibody or an anti-SIRP antibody at the same time. In some embodiments, one or more exons of SIRP are replaced by human sequences. In some embodiments, the replaced SIRP region is exon 2, exon 3, and/or exon 4 of the endogenous mouse SIRP gene.
(186) The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:
(187) (a) using the methods of introducing human CD47 gene or chimeric CD47 gene as described herein to obtain a genetically modified non-human animal;
(188) (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.
(189) In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric PD-1, CTLA-4, LAG-3, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, OX40, CD137, or SIRP. Some of these genetically modified non-human animal are described, e.g., in PCT/CN2017/090320, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/099576, PCT/CN2017/099574, PCT/CN2017/106024, PCT/CN2017/110494, PCT/CN2017/110435, PCT/CN2017/117984, PCT/CN2017/120388; each of which is incorporated herein by reference in its entirety.
(190) In some embodiments, the CD47 humanization is directly performed on a genetically modified animal having a human or chimeric SIRP, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, CD137, or OX40 gene.
(191) In some embodiments, the CD47 humanization is directly performed on a genetically modified animal having a human or chimeric SIRP.
(192) As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-CD47 antibody and an additional therapeutic agent for the treatment of cancer. The methods include administering the anti-CD47 antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to SIRP, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, CD47, TIGIT, TIM-3, GITR, CD137, or OX40. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-CD20 antibody (e.g., rituximab), an anti-EGFR antibody (e.g., cetuximab), and an anti-CD319 antibody (e.g., elotuzumab), or anti-PD-1 antibody (e.g., nivolumab).
(193) In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD47, CD80, CD86, PD-L1, and/or PD-L2.
(194) In some embodiments, the combination treatment is designed for treating various cancer as described herein, e.g., melanoma, non-small cell lung carcinoma (NSCLC), small cell lung cancer (SCLC), bladder cancer, prostate cancer (e.g., metastatic hormone-refractory prostate cancer), advanced breast cancer, advanced ovarian cancer, and/or advanced refractory solid tumor. In some embodiments, the combination treatment is designed for treating metastatic solid tumors, NSCLC, melanoma, B-cell non-Hodgkin lymphoma, colorectal cancer, and multiple myeloma. In some embodiments, the treatment is designed for treating acute myeloid leukemia, non-Hodgkin's lymphoma, bladder cancer, and breast cancer.
(195) In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and/or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor(s), from the patient.
EXAMPLES
(196) The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
(197) Materials and Methods
(198) The following materials were used in the following examples.
(199) C57BL/6 mice were purchased from the China Food and Drugs Research Institute National Rodent Experimental Animal Center.
(200) BALB/c mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.
(201) AIO kit was obtained from Beijing Biocytogen Co., Ltd. (Catalog number: BCG-DX-004).
(202) UCA kit was obtained from Beijing Biocytogen Co., Ltd. (Catalog number: BCG-DX-001)
(203) BbsI, EcoRI, BamHI, EcoRV, XbaI, and HindIII restriction enzymes were purchased from NEB (Catalog numbers: R0539L, R3101M, R3136M, R0195S, R0145M, and R3104M).
(204) TOP10 competent cells were purchased from the Tiangen Biotech (Beijing) Co. (Catalog number: CB104-02).
(205) Anti-mCD3 antibody was obtained from BD (Catalog number: 553057).
(206) Reverse Transcription Kit was obtained from Takara (Catalog number: 6110A).
(207) PerCP/Cy5.5 anti-mouse TCR chain (mTcR PerCP) antibody was purchased from Biolegend (Catalog number: 109228).
(208) Alexa Fluor 647 anti-mouse CD47 (mCD47 Alexa Fluor 647, mCD47 AF647) was purchased from Biolegend (Catalog number: 127510).
(209) PE anti-human CD47 (hCD47 PE) antibody was purchased from Biolegend (Catalog number: 323108).
(210) PE anti-mouse CD172a (SIRP) Antibody (mSIRP PE) was purchased from Biolegend (Catalog number: 144012).
(211) APC anti-human CD172a/b (SIRP/ Antibody (hSIRP APC) was purchased from Biolegend (Catalog number: 323810).
(212) PE anti-mouse CD11b (mCD11b PE) antibody was purchased from Biolegend (Catalog number: 101208).
(213) FITC anti-mouse F4/80 (mF4/80 FITC) antibody was purchased from Biolegend (Catalog number: 123108).
(214) The pHSG299 was purchased from Takara (Catalog number: 3299).
(215) KOD enzyme was purchased from Toyobo (Catalog number: KOD-101).
(216) Flow cytometer was purchased from BD Biosciences (model: FACS Calibur).
Example 1: Design of sgRNA for CD47 Gene
(217) The 5-terminal targeting sites (sgRNA1 to sgRNA8) and the 3-terminal targeting sites (sgRNA9 to sgRNA17) were designed and synthesized.
(218) The 5-terminal targeting sites and the 3-terminal targeting sites were all located in exon 2 of mouse CD47 gene. The targeting site sequences on CD47 for each sgRNA are shown below:
(219) TABLE-US-00005 sgRNA1targetsequence(SEQIDNO:1): 5-cccttgcatcgtccgtaatgtgg-3 sgRNA2targetsequence(SEQIDNO:2): 5-tccacattacggacgatgcaagg-3 sgRNA3targetsequence(SEQIDNO:3): 5-tgctttgcgcctccacattacgg-3 sgRNA4targetsequence(SEQIDNO:4): 5-cacttcatgcaatgaaactgtgg-3 sgRNA5targetsequence(SEQIDNO:5): 5-ccgaagaaatgtttgtgaagtgg-3 sgRNA6targetsequence(SEQIDNO:6): 5-attgcatgaagtgaactctatgg-3 sgRNA7targetsequence(SEQIDNO:7): 5-tcgtatattttcatctatgatgg-3 sgRNA8targetsequence(SEQIDNO:8): 5-ccacttcacaaacatttcttcgg-3 sgRNA9targetsequence(SEQIDNO:9): 5-aatggataagcgcgatgccatgg-3 sgRNA10targetsequence(SEQIDNO:10): 5-gataagcgcgatgccatggtggg-3 sgRNA11targetsequence(SEQIDNO:11): 5-gcaagtgtagtttcccaccatgg-3 sgRNA12targetsequence(SEQIDNO:12): 5-tcagtctcagacttaatcaatgg-3 sgRNA13targetsequence(SEQIDNO:13): 5-tgagactgagatttttgcactgg-3 sgRNA14targetsequence(SEQIDNO:14): 5-gcgcttatccattttcaaagagg-3 sgRNA15targetsequence(SEQIDNO:15): 5-tggcattgcctctttgaaaatgg-3 sgRNA16targetsequence(SEQIDNO:16): 5-gtgacagagttatccagagaagg-3 sgRNA17targetsequence(SEQIDNO:17): 5-tataactgttttgccttctctgg-3
Example 2: Testing sgRNA Activity
(220) The UCA kit was used to detect the activities of sgRNAs (
(221) The synthesized sgRNA sequences based on sgRNA6 and sgRNA9 target sequences are listed in the following table:
(222) TABLE-US-00006 TABLE5 sgRNA6andsgRNA9sequences sgRNA6sequences SEQIDNO:18 Upstream:5-taggcatgaagtgaactcta--3 SEQIDNO:19 Downstream:5-aaactagagttcacttcatg- 3 sgRNA9sequences SEQIDNO:20 Upstream:5-taggataagcgcgatgcca-3 SEQIDNO:21 Downstream:5-aaactggcatcgcgcttat-3
Example 3: Constructing pT7-sgRNA G2 Plasmids
(223) A map of pT7-sgRNA G2 vector is shown in
(224) The DNA fragment containing T7 promoter and sgRNA scaffold was synthesized, and linked to the backbone vector by restriction enzyme digestion (EcoRI and BamHI) and ligation. The target plasmid was confirmed by the sequencing results.
(225) The DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 22) is shown below:
(226) TABLE-US-00007 GAATTCTAATACGACTCACTATAGGGGGTCTTCGAGAAGACCTGTTTTA GAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTTTTAAAGGATCC
Example 4: Constructing Recombinant Expression Vectors pT7-CD47-6 and pT7-CD47-9
(227) After annealing, the chosen sgRNA (sgRNA6 and sgRNA9) were ligated to pT7-sgRNA plasmids (linearized with BbsI) to produce the expression vectors pT7-CD47-6 and pT7-CD47-9. The ligation reaction was set up as follows:
(228) TABLE-US-00008 TABLE 6 The ligation reaction mix (10 L) sgRNA after annealing 1 L (0.5 M) pT7-sgRNA vector 1 L (10 ng) T4 DNA Ligase 1 L (5 U) 10 T4 DNA Ligase buffer 1 L 50% PEG4000 1 L H.sub.2O Add to 10 L
(229) The ligation reaction was carried out at room temperature for 10 to 30 minutes. The ligation product was then transferred to 30 L of TOP10 competent cells. The cells were then plated on a petri dish with Kanamycin, and then cultured at 37 C. for at least 12 hours and then two clones were selected and added to LB medium with Kanamycin (5 ml), and then cultured at 37 C. at 250 rpm for at least 12 hours.
(230) Clones were randomly selected and sequenced to verify their sequences. The vectors with correct sequences were selected for subsequent experiments.
Example 5: Sequence Design for Humanized CD47
(231) Genomic DNA 12533-12838 on exon 2 of mouse CD47 gene was replaced with the corresponding portion of human CD47 gene (SEQ ID NO: 27), producing humanized mouse with the modified CD47 sequence as follows (the chimeric portion; SEQ ID NO: 23):
(232) TABLE-US-00009 tatatgcagattgtaatgaaatatttttgtgtatgtattccaggttcagc tcaactactgtttaataaaacaaaatctgtagaattcacgttttgtaatg acactgtcgtcattccatgctttgttactaatatggaggcacaaaacact actgaagtatacgtaaagtggaaatttaaaggaagagatatCtacacctt tgatggagctctaaacaagtccactgtccccactgactttagtagtgcaa aaattgaagtctcacaattactaaaaggagatgcctctttgaagatggat aagagtgatgctgtctcacacacaggaaactacacttgtgaagtaacaga attaaccagagaaggtgaaacgatcatagagctgaaaaaccgcacgggta agtgacacagtttgcctgttttgaaacgtgtgttgagatatggttgccac tgtgggagtgctgtaaggtggaaccttgcagaagtc
(233) SEQ ID NO: 23 shows only the modified portion of DNA sequence, wherein the italicized underlined region is from human CD47. The capital letter indicates a point mutation.
(234) Mice with humanized CD47 gene (modified exon 2 with human CD47 sequence) were generated. Because the human CD47 gene and the mouse CD47 gene both have multiple variants, the humanized mice can have different humanized CD47 gene variants as well. Non-limiting examples of mRNA sequences of humanized CD47 gene include SEQ ID NOs: 67-73, corresponding to amino acid sequences shown in SEQ ID NOs: 74-80. The same methods described herein can be used to generate other variants of humanized versions of mouse CD47 gene and the transgenic mice containing these variants.
Example 6: Construction of Homologous Recombination Targeting Vector
(235) The 5 homologous arm, and the 3 homologous arm were designed, amplified and ligated to the corresponding human sequence.
(236) The 5 Homologous Arm
(237) The 5 homologous arm comprises nucleic acid 49866727-49867784 of NCBI Accession No. NC_000082.6 (SEQ ID NO: 24). The primers for the 5 homologous arm include:
(238) TABLE-US-00010 Upstream primer (SEQ ID NO: 25): F: 5-tttaagaaggagatatacatgaattctgtctggtttacatagaa ggaggaact-3 Downstream primer (SEQ ID NO: 26): R: 5-gaattctacagattttgttttattaaacagtagttgagctgaac ctggaa-3
The Human Sequence Fragment
(239) The human sequence fragment (312 bp) (SEQ ID NO: 27) corresponds to 108080324-108080013 of NCBI Accession No. NC_000003.12 with point mutation T.fwdarw.C at position 108080196 (129th bp). The difference does not affect protein expression.
(240) The nucleic acid was introduced by amplifying two segments of DNA by PCR and using overlap PCR to produce the desired sequence (SEQ ID NO: 27). The PCR primers include the following:
(241) Group I:
(242) TABLE-US-00011 Upstream (SEQ ID NO: 28): F: 5-gttcagctcaactactgtttaataaaacaaaatctgtagaattc acg-3 Downstream (SEQ ID NO: 29): R: 5-gtttagagctccatcaaaggtgtagatatctcttcctttaaatt tccac-3
(243) Group II:
(244) TABLE-US-00012 Upstream (SEQ ID NO: 30): F: 5-gtggaaatttaaaggaagagatatctacacctttgatggagctc taaac-3 Downstream (SEQ ID NO: 31): R: 5-gtgcggtttttcagctctatgatcgtttcaccttctctggttaa ttc-3
The 3 Homologous Arm
(245) The 3 homologous arm comprises nucleic acid 49868091-49869239 of NCBI Accession No. NC_000082.6 (SEQ ID NO: 32). The primers for the 5 homologous arm include:
(246) TABLE-US-00013 Upstream primer (SEQ ID NO: 33): F: 5-ccagagaaggtgaaacgatcatagagctgaaaaaccgcacg ggtaag-3 Downstream primer (SEQ ID NO: 34): R: 5-ttgttagcagccggatctcaggatcctaacaacactgctgtcc gcaactc-3
(247) Genomic DNA of C57BL/6 mouse was used as template for PCR amplifications of the 5 homologous arm and the 3 homologous arm. Genomic DNA of human was used as template for PCR amplification of the human DNA fragment. The AIO kit was used to ligate the 5 homologous arm, the 3 homologous arm, and the human sequence fragment into the pClon-4G plasmid, thereby generating the pClon-4G-CD47 vector.
Example 7: Verification of Vector pClon-4G-CD47
(248) Six pClon-4G-CD47 clones were randomly selected and tested by three sets of restriction enzymes. Among them, EcoRI should generate 3579 bp+1371 bp+1082 bp fragments, EcoRV+XbaI should generate 4100 bp+1385 bp+547 bp fragments, HindIII+BamHI should generate 3456 bp+2576 bp fragments.
(249) The results were in line with the expectations (
Example 8: Microinjection and Embryo Transfer Using C57BL/6 Mice
(250) The pre-mixed Cas9 mRNA, pClon-4G-CD47 plasmid and in vitro transcription products of pT7-CD47-6, pT7-CD47-9 plasmids were injected into the cytoplasm or nucleus of mouse fertilized eggs (C57BL/6 background) with a microinjection instrument (using Ambion in vitro transcription kit to carry out the transcription according to the method provided in the product instruction). The embryo microinjection was carried out according to the method described, e.g., in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003. The injected fertilized eggs were then transferred to a culture medium for a short time culture, and then was transplanted into the oviduct of the recipient mouse to produce the genetically modified humanized mice (F0 generation). The mouse population was further expanded by cross-mating and self-mating to establish stable mouse lines. The humanized mouse was named as B-hCD47(C57BL/6). Further binding experiments showed that human CD47 or humanized CD47 proteins have a relatively weak binding affinity with mouse SIRP in B-hCD47(C57BL/6) mice.
Example 9: Microinjection and Embryo Transfer Using BALB/c Mice
(251) The pre-mixed Cas9 mRNA, pClon-4G-CD47 plasmid and in vitro transcription products of pT7-CD47-6, pT7-CD47-9 plasmids were injected into the cytoplasm or nucleus of mouse fertilized eggs (BALB/c background) with a microinjection instrument (using Ambion in vitro transcription kit to carry out the transcription according to the method provided in the product instruction). The embryo microinjection was carried out according to the method described, e.g., in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003. The injected fertilized eggs were then transferred to a culture medium for a short time culture, and then was transplanted into the oviduct of the recipient mouse to produce the genetically modified humanized mice (F0 generation). The mice population was further expanded by cross-mating and self-mating to establish stable mouse lines. The humanized mouse was named as B-hCD47(BALB/c). Further binding experiments showed that human CD47 or humanized CD47 proteins can bind to mouse SIRP in B-hCD47(BALB/c) mice, and the binding affinity is similar to the binding affinity between mouse SIRP and mouse CD47 protein.
Example 10: Verification of Genetic Modification
(252) 1. Genotype Determination for F0 Generation Mice
(253) PCR analysis was performed using mouse tail genomic DNA of F0 generation mice in both C57BL/6 background and BALB/c background. The primers are shown below with their relative locations.
(254) 5 End Primers:
(255) TABLE-US-00014 Upstream: L-GT-F (SEQ ID NO: 35), left side of 5homologous arm: 5-acccttagccagagagcacagagac-3 Downstream: L-GT-R (SEQ ID NO: 36), in exon 2: 5-tggggacagtggacttgtttagagc-3
3 End Primers:
(256) TABLE-US-00015 Upstream:R-GT-F(SEQIDNO:37),inexon2: 5-acactgtcgtcattccatgctttgt-3 Downstream:R-GT-R(SEQIDNO:38),rightsideof 3homologousarm: 5-acctggttctcaaagtgtcaccacc-3
(257) If the desired human sequence was inserted into the correct positions in the genome, PCR experiments using the above primers should generate only one band. The 5 end PCR experiment should produce a band at about 1,408 bp, and the 3 end PCR experiment should produce a band at about 1,612 bp.
(258) TABLE-US-00016 TABLE 7 The PCR reaction (20 L) 10 buffer 2 L dNTP (2 mM) 2 L MgSO.sub.4 (25 mM) 0.8 L Upstream primer (10 M) 0.6 L Downstream primer (10 M) 0.6 L Mouse tail genomic DNA 200 ng KOD-Plus-(1 U/L) 0.6 L ddH.sub.2O Add to 20 L
(259) TABLE-US-00017 TABLE 8 The PCR reaction conditions Temperature Time Cycles 94 C. 5 min 1 94 C. 30 sec 15 67 C. (0.7 C./cycle) 30 sec 68 C. 1 kb/min 98 C. 10 sec 25 56 C. 30 sec 68 C. 1 kb/min 68 C. 10 min 1 4 C. 10 min 1
(260) Results for humanized mice with C57BL/6 background are shown in
(261) Results for humanized mice with BALB/c background are shown in
(262) 2. Genotype Determination for F1 Generation Mice
(263) F1 generation mice were obtained by cross-mating F0 generation mice with wildtype mice in the same background. PCR experiments were performed using mouse tail genomic DNA from F1 generation mice. The PCR primers, setup, and conditions were the same as those used in the experiments above.
(264) Results for humanized mice in C57BL/6 background are shown in
(265) Results for humanized mice in BALB/c background are shown in
(266) These results show that the method described herein can be used to generate humanized CD47 mice with stable and inheritable genetic modifications.
(267) 3. Expression Level Analysis in Humanized Mice
(268) A humanized heterozygous F1 generation mouse was selected. Two wildtype mice in the same background were used as controls.
(269) 7.5 g of mouse anti-CD3 antibody was injected intraperitoneally to the mice. The spleens were collected 24 hours after the injection, and the spleen samples were grinded. The samples were then passed through 70 m cell mesh. The filtered cell suspensions were centrifuged and the supernatants were discarded. Erythrocyte lysis solution was added to the sample, which was lysed for 5 min and neutralized with PBS solution. The solution was centrifuged again and the supernatants were discarded. The cells were washed with PBS and tested in FACS and RT-PCR.
(270) FACS: Flow cytometry was performed with wildtype C57BL/6 mice (
(271) Flow cytometry was also performed with wildtype BALB/c mice (
(272) RT-PCR:
(273) RT-PCR experiments were performed to confirm the genetic makeup of humanized CD47 mice in C57BL/6 background (
(274) TABLE-US-00018 mCD47RT-PCRF2: (SEQIDNO:39) 5-GTCATCCCTTGCATCGTCCG-3 mCD47RT-PCRR2: (SEQIDNO:40) 5-ACTTCGCAAGTGTAGTTTCCCA-3 hCD47RT-PCRF1: (SEQIDNO:41) 5-ACACTGTCGTCATTCCATGCT-3 hCD47RT-PCRR1: (SEQIDNO:42) 5-CCTGTGTGTGAGACAGCATCA-3
(275) The primers targeting mouse CD47 sequence should produce a PCR band of about 230 bp. The primers targeting human CD47 sequence should yield a PCR band of about 226 bp in humanized CD47 mice.
(276) A 20 L PCR system was used under the conditions of: 95 C., 5 mins; 35 cycles of the conditions 95 C., 30 sec, 60 C., 30 sec, 72 C., 30 sec; 72 C., 10 mins; storing at 4 C. GAPDH was used as an internal control.
(277) Results for humanized CD47 mice in C57BL/6 background are shown in
(278) Results for humanized CD47 mice in BALB/c background are shown in
(279) The F1 generation humanized CD47 heterozygotes with the same background were mated with each other to produce humanized CD47 homozygotes. The same experiments described above were performed on these humanized CD47 homozygous mice. The FACS and RT-PCR results for humanized CD47 homozygous C57BL/6 mice are shown in
Example 11: CD47 Knockout Mice
(280) Since the cleavage of Cas9 results in DNA double strands break, and the homologous recombination repair may result in insertion/deletion mutations, it is possible to obtain CD47 knockout mice by the methods described herein. A pair of primers was thus designed to target the left side of the 5 target site and the right side of the 3 target site:
(281) TABLE-US-00019 (SEQ ID NO: 43) F: 5-ggtaaatttatccccaagatgcatggta-3 (SEQ ID NO: 44) R: 5-gccttaattcctcctagtgacttctgc-3
(282) This pair of primers should yield one PCR band with about 698 bp for wildtype mice, one band with about 386 bp for homozygous CD47 knockout mice, and both bands (698 bp+386 bp) for the heterozygous mice.
(283) The PCR reaction systems and conditions are shown in Table 9 and Table 10.
(284) TABLE-US-00020 TABLE 9 2 TSINGKE Master mix 10 L Upstream primer (0.2 M) 0.5 L Downstream primer (0.2 M) 0.5 L Genomic DNA from mouse tail 200 ng H.sub.2O Add to 20 L
(285) TABLE-US-00021 TABLE 10 Temperature Duration Cycles 94 C. 5 min 1 94 C. 30 sec 35 62 C. 30 sec 72 C. 1 kb/min 72 C. 35 sec 72 C. 10 min 1 4 C. 10 min 1
(286)
Example 12: Testing Toxicity Using Humanized CD47 Mouse Model
(287) CD47 is expressed on the surface of nearly all kinds of cells, especially in large amount on erythrocytes. Because antibodies against human CD47 do not bind to mouse CD47, the mouse model that are generally used cannot be used to test toxicity of therapeutic agents targeting human CD47. The humanized CD47 mice described herein express humanized CD47 protein, and anti-hCD47 antibodies can bind to CD47 in the humanized mice and block the transduction of the protective signal. Because erythrocytes express a large amount of CD47 on their surface, the binding of anti-CD47 antibodies blocks the CD47/SIRP signaling pathway, resulting in apoptosis of erythrocytes and in more serious cases resulting in death of the mice. The humanized CD47 mouse model as described herein can also be used to test the toxicity of the antibodies.
(288) In BALB/c mice, the mouse SIRP protein (mSIRP) can bind to humanized CD47 protein. The humanized CD47 mice with BLAB/c background can thus be used to test the toxicity of anti-hCD47 antibodies, the blocking effects of the antibodies, and the effects on antibody-dependent cellular phagocytosis (ADCP).
(289) Homozygous humanized CD47 mice in C57BL/6 background at the age of 7-9 weeks were intraperitoneally administered with either an antibody against human CD47 (treatment group, two mice in each treatment group), or physiological saline solution (control group, two mice in this group). There were seven treatment groups (n=2 in each group), and each group was injected with a randomly selected anti-hCD47 antibody (Ab1-Ab6) at 10 mg/kg. The injections were done in 24 hours after placing the mice into the treatment groups and the control group. The mice were then monitored and weighed daily. Any mouse with more than 20% weight loss was euthanized.
(290) The results are shown in
Example 13: Mice with Two or More Humanized Genes
(291) Mice with the humanized CD47 gene (e.g., animal model with humanized CD47 prepared using the methods as described in the present disclosure) can also be used to prepare an animal model with double-humanized or multi-humanized genes. For example, in Example 8 or Example 9, the embryonic stem cell used in the microinjection and embryo transfer process can be selected from the embryos of other genetically modified mice, so as to obtain double- or multiple-gene modified mouse models. The fertilized eggs of B-hCD47 mice can also be further genetically engineered to produce mouse lines with one or more humanized or otherwise genetically modified mouse models. In addition, the humanized CD47 animal model homozygote or heterozygote can be mated with other genetically modified homozygous or heterozygous animal models (or through IVF), and the progeny can be screened. According to the Mendelian law, there is a chance to obtain the double-gene or multiple-gene modified heterozygous animals, and then the heterozygous animals can be mated with each other to finally obtain the double-gene or multiple-gene modified homozygotes.
(292) In the case of generating double humanized CD47/SIRP mice, since the mouse CD47 gene and SIRP gene are located on different chromosomes, the double humanized CD47/SIRP mouse model was obtained by crossing the CD47 humanized mice with SIRP humanized mice.
(293) PCR analysis was performed on the genomic DNA collected from mouse tails of double humanized CD47/SIRP mice. Four pairs of primers were used. The specific sequences and product lengths are shown in the table below. The reaction system and reaction conditions are shown in Table 12 and Table 13. The results for a number of humanized CD47/SIRP mice are shown in
(294) TABLE-US-00022 TABLE 11 Primer sequences Product Primer Sequence length CD47 WT F: 5-ggtaaatttatccccaagatgcatggta-3(SEQ ID NO: 43) WT: 358 bp R: 5-acaaacatttcttcggtgctttgcg-3(SEQ ID NO: 81) CD47 MUT F: 5-ggtaaatttatccccaagatgcatggta-3(SEQ ID NO: 43) Mut: 426 bp R: 5-tggggacagtggacttgtttagagc-3(SEQ ID NO: 36) SIRPWT F: 5-gtcttgagttacaggctcatgtgggg-3(SEQ ID NO: 82) WT: 337 bp R: 5-cgaggaacgtattctcctgcgaaac-3(SEQ ID NO: 83) SIRPMUT F: 5-agctatgtggcttagcactctgtgc-3(SEQ ID NO: 84) Mut: 520 bp R: 5-cttaaactccacgtcatcggggctc-3(SEQ ID NO: 85)
(295) TABLE-US-00023 TABLE 12 PCR reaction system Composition Volume 2 Master Mix 10 L Upstream primer (10 M) 0.5 L Downstream primer (10 M) 0.5 L Mouse tail genomic DNA 200 ng KOD-Plus-(1 U/L) 0.6 L ddH.sub.2O Add to 20 L
(296) TABLE-US-00024 TABLE 13 PCR amplification reaction condition Temperature Time Cycles 95 C. 5 min 1 95 C. 30 sec 30 62 C. 30 sec 72 C. 30 sec 72 C. 10 min 1 4 C. 10 min 1
(297) Protein expression in the double humanized CD47/SIRP mice was further examined. A double humanized CD47/SIRP homozygote (C57BL/6 background, 5-6 weeks old) was selected for the study. Two wildtype C57BL/6 mice were selected as controls.
(298) 7.5 g of mouse anti-CD3 antibody was intraperitoneally administered to the mice. The spleens were collected 24 hours after the injection, and the spleen samples were grinded. The samples were then passed through 70 m cell mesh. The filtered cell suspensions were centrifuged and the supernatants were discarded. Erythrocyte lysis solution was added to the sample, which was lysed for 5 min and neutralized with PBS solution. The solution was centrifuged again and the supernatants were discarded. The cells were washed with PBS and tested in FACS and RT-PCR.
(299) FACS: Flow cytometry was performed with 1) antibody against mouse CD47 (mCD47 Alexa Fluor 647) and antibody against mouse TcR (mTcR PerCP) (
(300) As shown in
(301) RT-PCR: RT-PCR experiments were performed to confirm the genetic makeup of CD47.sup.H/H/SIRP.sup.H/H mice. Total RNA were extracted from spleens and reverse-transcribed into cDNA.
(302) The primer pair mCD47 RT-PCR F2 (SEQ ID NO:39) and mCD47 RT-PCR R2 (SEQ ID NO:40) was used to amplify a 230 bp sequence of mouse CD47. The primer pair hCD47 RT-PCR F1 (SEQ ID NO:41) and hCD47 RT-PCR R1 (SEQ ID NO:42) was used to amplify an approximately 226 bp sequence of human CD47.
(303) The primer pair mSIRP RT-PCR F2: 5-TTGCTGCTGGGGATTCGAC-3 (SEQ ID NO:86) and mSIRP RT-PCR R2: 5-CTGCTGGGGTGACATTACTGAT-3 (SEQ ID NO:87) was used to amplify an approximately 210 bp sequence of mouse SIRP.
(304) The primer pair hSIRP RT-PCR F1: 5-CCTGACAAGTCCGTGTTGG-3(SEQ ID NO:88) and hSIRP RT-PCR R1: 5-CTCCTCTGAACCACTGGATGG-3 (SEQ ID NO:89) was used to amplify an approximately 100 bp sequence of human SIRP.
(305) A 20 L PCR system was used under the conditions of: 95 C., 5 mins; 35 cycles of the conditions 95 C., 30 sec, 60 C., 30 sec, 72 C., 30 sec; 72 C., 10 mins; storing at 4 C. GAPDH was used as an internal control.
(306) RT-PCR results are shown in
(307) The CD47.sup.H/H/SIRP.sup.H/H mice can be used to further prepare a triple transgenic mouse model that are homozygous for humanized CD47, humanized SIRP, and humanized PD-1. CD47, SIRP, and PD-1 are all on different chromosomes. Mating (or IVF) CD47.sup.H/H/SIRP.sup.H/H mice with humanized PD-1 mouse (e.g. B-hPD-1 mice), following by screening and further mating can be used to produced triple humanized CD47/SIRP/PD-1 mice.
Example 14: Pharmacological Testing of Antibodies Using Double Humanized CD47/SIRP Mouse Model
(308) Double humanized (CD47/SIRP) mice CD47 (7-9 weeks) were subcutaneously injected with mouse colon cancer cell MC38. When the tumor volume grew to about 100 mm.sup.3, the mice were randomly divided to a control group and treatment groups (n=5/group). Each of the treatment groups was treated with one antibody. The six treatment groups were treated with six antibodies as follows: anti-hCD47 antibody AB1, anti-hCD47 antibody AB2, anti-hCD47 antibody AB3, anti-hSIRP antibody Ab-S1, anti-hSIRP antibody Ab-S2, and anti-hSIRP antibody Ab-S3. The control group was injected with physiological saline. The mice were measured for their tumor size and weighed twice a week, and euthanized when tumor size reached 3000 mm.sup.3.
(309) Overall, the animals in each group were healthy, and the body weights of all the treatment groups were not significantly different from the control group (
(310) Although the body weights did not show significant difference over the course of the entire experimental period (
(311) Table 14 shows results for this experiment, including the tumor volumes at the day of grouping (day 0), 14 days after the grouping, and at the end of the experiment, the survival rate of the mice, and the Tumor Growth Inhibition value (TGI.sub.TV %).
(312) TABLE-US-00025 TABLE 14 Tumor volume (mm.sup.3) Anti-hCD47 antibodies Day 0 Day 14 Day 21 Survival TGI.sub.TV % Control G1 128 12 939 120 2166 335 5/5 N/A Treatment G2 128 8 917 154 2007 438 5/5 7.8 G3 128 9 440 23 1227 229 5/5 46.7 G4 128 10 478 37 828 139 5/5 65.6 Tumor volume (mm.sup.3) Anti-hSIRP antibodies Day 0 Day 14 Day 17 Survival TGI.sub.TV % Control G1 117 4 827 208 967 221 5/5 N/A Treatment G2 116 4 685 96 999 320 5/5 0 G3 117 10 944 125 1342 170 5/5 0 G4 116 5 527 49 820 88 5/5 17.2
(313) All mice survived to the end of the experiment. In groups treated with anti-hCD47 antibodies, the average tumor volume is 2166335 mm.sup.3 in the control group (G1), 2007438 mm.sup.3 in the AB1 treatment group (G2), 1227229 mm.sup.3 in the AB2 treatment group (G3), and 828139 mm.sup.3 in the AB3 treatment group (G4). The average tumor size in G2 group did not show significant difference from that in the G1 group, while the average tumor sizes in G3 and G4 groups each showed significant (p<0.05) difference from that in G1 group, with the TGI.sub.Tv % being 46.7% and 65.6% respectively. The results indicate that the three anti-hCD47 antibodies showed different tumor inhibitory effects, while all were safe to use without obvious toxicity.
(314) In groups treated with anti-hSIRP antibodies, tumor inhibitory effects were not significant for the Ab-S1 (G2) and the Ab-S2 (G3) treatment groups compared to the control (G1) group. The Ab-S3 treatment group (G4) had an average tumor size of 82088 mm.sup.3, smaller than the control (G1) group. The results indicate that the three anti-hSIRP antibodies had different tumor inhibitory effects, with the Ab-S3 antibody having better tumor inhibitory effects than Ab-S1 and Ab-S2.
(315) This example demonstrates that the double humanized (CD47/SIRP) mouse model is useful for screening and testing for therapeutic agents (e.g. antibodies) targeting human CD47 or human SIRP. The mouse model is useful for testing efficacies of the therapeutic agents.
Example 15: Methods Based on Embryonic Stem Cell Technologies
(316) The non-human mammals described herein can also be prepared through other gene editing systems and approaches, including but not limited to: gene homologous recombination techniques based on embryonic stem cells (ES), zinc finger nuclease (ZFN) techniques, transcriptional activator-like effector factor nuclease (TALEN) technique, homing endonuclease (megakable base ribozyme), or other techniques.
(317) Based on the CD47 transcript NM_010581.3 and the corresponding protein sequence NP_034711.1,
(318) Vector construction can be carried out using methods known in the art, such as enzyme digestion and so on. The recombinant vector with correct sequence can be next transfected into mouse embryonic stem cells, such as C57BL/6 mouse embryonic stem cells, and then the recombinant vector can be screened by positive clone screening gene. The cells transfected with the recombinant vector are next screened by using the positive clone marker gene, and Southern Blot technique can be used for DNA recombination identification. For the selected correct positive clones, the positive clonal cells (black mice) are injected into the isolated blastocysts (white mice) by microinjection according to the method described in the book A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003. The resulting chimeric blastocysts formed following the injection are transferred to the culture medium for a short time culture and then transplanted into the fallopian tubes of the recipient mice (white mice) to produce F0 generation chimeric mice (black and white). The F0 generation chimeric mice with correct gene recombination are then selected by extracting the mouse tail genome and detecting by PCR for subsequent breeding and identification. The F1 generation mice are obtained by mating the F0 generation chimeric mice with wildtype mice. Stable gene recombination positive F1 heterozygous mice are selected by extracting rat tail genome and PCR detection. Next, the F1 heterozygous mice are mated to each other to obtain genetically recombinant positive F2 generation homozygous mice. In addition, the F1 heterozygous mice can also be mated with Flp or Cre mice to remove the positive clone screening marker gene (neo, etc.), and then the CD47 gene humanized homozygous mice can be obtained by mating these mice with each other. The methods of genotyping and using the F1 heterozygous mice or F2 homozygous mice are similar to the methods as described in the examples above.
Example 16: Quantification of Binding Between SIRP and Mouse or Human CD47
(319) Experiments were performed to test the binding affinity between CD47 and SIRP in mice with different backgrounds. Wildtype mice in C57BL6 background, wildtype mice in BALB/c background, and humanized SIRP mice (B-hSIRP) in C57BL/6 background were tested. Peritoneal cavity cells of mice were collected and plated on 96-well plates. Mouse CD47 proteins or human CD47 proteins were added to the wells and incubated with these cells. The cells in the wells were further incubated with a primary human antibody against mouse CD47 or human CD47, and a secondary antibody anti-human IgG (AF647-Anti-hIgG), which recognizes the primary antibodies. Fluorescent labeled antibodies against mouse CD11b (Anti-mCD11b PE) or against mouse F4/80 (Anti-mF4/80 FITC) were used to label different populations of mouse immune cells.
(320) The cells were then subject to flow cytometry analysis. The results were quantified and plotted in
(321) The results also show that the binding between human CD47 and endogenous mouse SIRP proteins in wildtype C57BL6 mice is weaker than in wildtype BALB/c mice (
Other Embodiments
(322) It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.