YEAST PROMOTORS FOR PROTEIN EXPRESSION
20210032643 ยท 2021-02-04
Inventors
- Ilya I. Tolstorukov (Claremont, CA)
- James M. Cregg (Claremont, CA)
- Thomas G. Chappell (San Marcos, CA)
- Knut R. Madden (Carlsbad, CA)
Cpc classification
C12N2800/60
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
Isolated nucleic acids, expression methods, host cells, expression vectors, and DNA constructs for producing proteins, and proteins produced using the expression methods are disclosed. More specifically, nucleic acids isolated from Pichia pastons having promoter activity and expression methods, host cells, expression vectors, and DNA constructs of using the Pichia pastons promoters to produce different proteins and polypeptides are disclosed.
Claims
1. (canceled)
2-76. (canceled)
77. A method of producing a protein, the method comprising the step of culturing in a culture medium a host cell comprising a first expression cassette comprising an isolated nucleic acid at least 95% identical to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6, or at least 95% identical to a fragment thereof, operably linked to a heterologous coding sequence encoding a protein, wherein the isolated nucleic acid comprises the sequence of a methanol inducible Pichia pastoris promoter, wherein the fragment extends about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, or about 700 nucleotides upstream from the 3 end of SEQ ID NO:1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, wherein the fragment is a continuous fragment of SEQ ID NO:1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, wherein the fragment comprises a TATA box sequence to direct initiation of transcription, wherein the culturing is done under conditions permitting expression of the protein, and wherein the protein is expressed using the first expression cassette in combination with a second expression cassette, said second cassette comprising (a) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein SEQ ID NO: 2 or SEQ ID NO: 4 have promoter activity; or (b) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising SEQ ID NO: 15 or SEQ ID NO: 16, wherein SEQ ID NO: 15 or SEQ ID NO: 16 have promoter activity; or (c) the heterologous coding sequence encoding the protein operably linked to a different AOX promoter than SEQ ID NO:15 or SEQ ID NO:16, an FLD promoter, a DAS promoter, or a methanol-regulated promoter; or (d) the isolated nucleic acid at least 95% identical to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6, or at least 95% identical to a fragment thereof, operably linked to the heterologous coding sequence encoding the protein.
78. The method of claim 77 wherein the isolated nucleic acid in the first expression cassette is at least 98% identical to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6, or at least 98% identical to the fragment thereof.
79. The method of claim 77 wherein the sequence of the isolated nucleic acid in the first expression cassette is a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6, or the fragment thereof.
80. The method of claim 77 wherein the sequence of the isolated nucleic acid in the first expression cassette is a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6.
81. The method of claim 77 wherein the heterologous coding sequence encodes a protein selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
82. The method of claim 77 wherein the heterologous coding sequence encodes an enzyme for use in animal feed.
83. The method of claim 82 wherein the enzyme is selected from the group consisting of a mannanase, an amylase, a glucanase, a protease, a cellulase, and a xylanase.
84. The method of claim 82 wherein the enzyme is a phytase.
85. The method of claim 82 wherein the enzyme is a galactosidase.
86. A host cell comprising a first expression cassette comprising an isolated nucleic acid at least 95% identical to a nucleic acid selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6, or at least 95% identical to a fragment thereof, operably linked to a heterologous coding sequence encoding a protein, wherein the isolated nucleic acid comprises the sequence of a methanol inducible Pichia pastoris promoter, wherein the fragment extends about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, or about 700 nucleotides upstream from the 3 end of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, wherein the fragment is a continuous fragment of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, wherein the fragment comprises a TATA box sequence to direct initiation of transcription, and a second expression cassette, said second cassette comprising (a) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising SEQ ID NO: 2 or SEQ ID NO: 4, wherein SEQ ID NO: 2 or SEQ ID NO: 4 have promoter activity; or (b) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising SEQ ID NO: 15 or SEQ ID NO: 16, wherein SEQ ID NO: 15 or SEQ ID NO: 16 have promoter activity; or (c) the heterologous coding sequence encoding the protein operably linked to a different AOX promoter than SEQ ID NO:15 or SEQ ID NO:16, an FLD promoter, a DAS promoter, or a methanol-regulated promoter; or (d) the isolated nucleic acid at least 95% identical to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, or at least 95% identical to a fragment thereof, operably linked to the heterologous coding sequence encoding the protein.
87. The host cell of claim 86 wherein the isolated nucleic acid in the first expression cassette is at least 98% identical to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, or at least 98% identical to the fragment thereof.
88. The host cell of claim 86 wherein the sequence of the isolated nucleic acid in the first expression cassette is SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6, or the fragment thereof.
89. The host cell of claim 86 wherein the sequence of the isolated nucleic acid in the first expression cassette is SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 6.
90. The host cell of claim 86 wherein the heterologous coding sequence encodes a protein selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
91. The host cell of claim 86 wherein the heterologous coding sequence encodes an enzyme for use in animal feed.
92. The host cell of claim 91 wherein the enzyme is selected from the group consisting of a mannanase, an amylase, a glucanase, a protease, a cellulase, and a xylanase.
93. The host cell of claim 91 wherein the enzyme is a phytase.
94. The host cell of claim 91 wherein the enzyme is a galactosidase.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
DETAILED DESCRIPTION OF THE ILLUSTRATIVE EMBODIMENTS
[0109] In one illustrative embodiment of the invention, an isolated nucleic acid is provided wherein the sequence of the isolated nucleic acid comprises a sequence, for example, at least 90%, 95%, or 98% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 as described herein, or at least 90%, 95%, or 98% identical to a fragment thereof, wherein the nucleic acid comprises the sequence of a methanol-inducible Pichia pastoris promoter. In another embodiment, the isolated nucleic acid sequence is a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or a fragment thereof. In other embodiments, expression vectors, host cells, and DNA constructs comprising these promoter sequences are provided.
[0110] In another embodiment, a method of producing a protein using these promoter sequences is provided. The method comprises the steps of culturing in a culture medium a host cell comprising a first expression cassette comprising any of the above promoter sequences operably linked to a heterologous coding sequence encoding a protein, wherein the culturing is done under conditions permitting expression of the protein. In another illustrative embodiment, an isolated protein produced according to this method is provided.
[0111] In one illustrative embodiment of the invention, an isolated nucleic acid is provided wherein the sequence of the isolated nucleic acid comprises a sequence, for example, at least 90%, 95%, or 98% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 as described herein, or at least 90%, 95%, or 98% identical to a fragment thereof, wherein the nucleic acid comprises the sequence of a constitutive Pichia pastoris promoter. In another embodiment, the isolated nucleic acid sequence is a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14, or a fragment thereof. In other embodiments, expression vectors, host cells, and DNA constructs comprising these promoter sequences are provided. The above-described promoters have been isolated from a yeast strain (i.e., NRRL Y11430) currently classified as a Pichia pastoris yeast strain. However, the classification may change at some point to a Komagataella species (e.g., Komagataella phaffii).
[0112] In another embodiment, a method of producing a protein using any of the promoter sequences in the preceding paragraph is provided. The method comprises the steps of culturing in a culture medium a host cell comprising a first expression cassette comprising any of the above promoter sequences operably linked to a heterologous coding sequence encoding a protein, wherein the culturing is done under conditions permitting expression of the protein. In another illustrative embodiment, an isolated protein produced according to this method is provided.
[0113] All of the embodiments described in the following clause list are contemplated for use in accordance with the invention. For all of the embodiments described in the following clauses, any applicable combination of embodiments is considered to be in accordance with the invention. Any embodiment described in the following clause list is also contemplated for use with any embodiment described in the Summary of Invention section of this application or in the Detailed Description of the Illustrative Embodiments section of this application.
[0114] 1. An isolated nucleic acid wherein the sequence of the isolated nucleic acid comprises a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 90% identical to a fragment thereof, wherein the isolated nucleic acid comprises the sequence of a methanol-inducible Pichia pastoris promoter.
[0115] 2. The isolated nucleic acid of clause 1 wherein the sequence of the isolated nucleic acid is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 95% identical to a fragment thereof.
[0116] 3. The isolated nucleic acid of clause 1 wherein the sequence of the isolated nucleic acid is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 98% identical to a fragment thereof.
[0117] 4. The isolated nucleic acid sequence of clause 1 wherein the sequence of the isolated nucleic acid is a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or a fragment thereof.
[0118] 5. The isolated nucleic acid of any one of clauses 1 to 4 operably linked to a heterologous coding sequence.
[0119] 6. The isolated nucleic acid of clause 5 wherein the heterologous coding sequence encodes a protein selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0120] 7. The isolated nucleic acid of clause 6 wherein the protein is an enzyme for use in animal feed.
[0121] 8. The isolated nucleic acid of clause 7 wherein the protein is selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a protease, a cellulase, and a xylanase.
[0122] 9. The isolated nucleic acid of clause 8 wherein the protein is a phytase.
[0123] 10. The isolated nucleic acid of clause 8 wherein the protein is a galactosidase.
[0124] 11. An expression vector comprising the isolated nucleic acid of any one of clauses 1 to 10.
[0125] 12. A host cell comprising the expression vector of clause 11.
[0126] 13. A host cell comprising the isolated nucleic acid of any one of clauses 1 to 10.
[0127] 14. The host cell of any one of clauses 12 or 13 wherein the host cell is a Pichia species.
[0128] 15. The host cell of clause 14 wherein the Pichia species is Pichia pastoris.
[0129] 16. A DNA construct comprising the isolated nucleic acid of any one of clauses 1 to 10.
[0130] 17. A method of producing a protein, the method comprising the step of
[0131] culturing in a culture medium a host cell comprising a first expression cassette comprising the isolated nucleic acid of any one of clauses 1 to 4 operably linked to a heterologous coding sequence encoding a protein, wherein the culturing is done under conditions permitting expression of the protein.
[0132] 18. The method of clause 17 wherein the protein is selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0133] 19. The method of clause 18 wherein the protein is an enzyme for use in animal feed.
[0134] 20. The method of clause 19 wherein the protein is selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a cellulase, a protease, and a xylanase.
[0135] 21. The method of clause 20 wherein the protein is a phytase.
[0136] 22. The method of clause 20 wherein the protein is a galactosidase.
[0137] 23. The method of any one of clauses 17 to 22 wherein the protein is expressed using the first expression cassette in combination with a second expression cassette.
[0138] 24. The method of clause 23 wherein the second expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other AOX 1 or AOX 2 promoter sequence.
[0139] 25. The method of clause 24 wherein the protein is expressed using the first expression cassette, the second expression cassette, and a third expression cassette.
[0140] 26. The method of clause 25 wherein the third expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 90% identical to a fragment thereof.
[0141] 27. The method of clause 23 wherein the second expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 90% identical to a fragment thereof.
[0142] 28. An isolated protein produced according to the method of any one of clauses 17 to 27.
[0143] 29. An isolated nucleic acid wherein the sequence of the isolated nucleic acid comprises a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14, or at least 90% identical to a fragment thereof, wherein the nucleic acid comprises the sequence of a constitutive Pichia pastoris promoter.
[0144] 30. The isolated nucleic acid of clause 29 wherein the sequence of the isolated nucleic acid is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 or at least 95% identical to a fragment thereof.
[0145] 31. The isolated nucleic acid of clause 29 wherein the sequence of the isolated nucleic acid is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 or at least 98% identical to a fragment thereof.
[0146] 32. The isolated nucleic acid sequence of clause 29 wherein the sequence of the isolated nucleic acid is a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14, or a fragment thereof. 33. The isolated nucleic acid of any one of clauses 29 to 32 operably linked to a heterologous coding sequence.
[0147] 34. The isolated nucleic acid of clause 33 wherein the heterologous coding sequence encodes a protein selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0148] 35. The isolated nucleic acid of clause 34 wherein the protein is an enzyme for use in animal feed.
[0149] 36. The isolated nucleic acid of clause 35 wherein the protein is selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a cellulase, a protease, and a xylanase.
[0150] 37. The isolated nucleic acid of clause 36 wherein the protein is a phytase.
[0151] 38. The isolated nucleic acid of clause 36 wherein the protein is a galactosidase.
[0152] 39. An expression vector comprising the isolated nucleic acid of any one of clauses 29 to 38.
[0153] 40. A host cell comprising the expression vector of clause 39.
[0154] 41. A host cell comprising the isolated nucleic acid of any one of clauses 29 to 38.
[0155] 42. The host cell of any one of clauses 40 or 41 wherein the host cell is a Pichia species.
[0156] 43. The host cell of clause 42 wherein the Pichia species is Pichia pastoris.
[0157] 44. A DNA construct comprising the isolated nucleic acid of any one of clauses 29 to 38.
[0158] 45. A method of producing a protein, the method comprising the step of
[0159] culturing in a culture medium a host cell comprising a first expression cassette comprising the isolated nucleic acid of any one of clauses 29 to 38 operably linked to a heterologous coding sequence encoding a protein, wherein the culturing is done under conditions permitting expression of the protein.
[0160] 46. The method of clause 45 wherein the protein is selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0161] 47. The method of clause 46 wherein the protein is an enzyme for use in animal feed.
[0162] 48. The method of clause 47 wherein the protein is selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a cellulase, a protease, and a xylanase.
[0163] 49. The method of clause 48 wherein the protein is a phytase.
[0164] 50. The method of clause 48 wherein the protein is a galactosidase.
[0165] 51. The method of any one of clauses 45 to 50 wherein the protein is expressed using the first expression cassette in combination with a second expression cassette.
[0166] 52. The method of clause 51 wherein the second expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other AOX 1 or AOX 2 promoter sequence.
[0167] 53. The method of clause 51 wherein the protein is expressed using the first expression cassette, the second expression cassette, and a third expression cassette.
[0168] 54. The method of clause 53 wherein the third expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, or at least 90% identical to a fragment thereof.
[0169] 55. The method of clause 51 wherein the second expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, or at least 90% identical to a fragment thereof.
[0170] 56. An isolated protein produced according to the method of any one of clauses 45 to 55.
[0171] 57. The host cell of any one of clauses 40 or 41 wherein the host cell is selected from the group consisting of Hansenula species, Pichia species, Saccharomyces species, Schizosaccharomyces species, Torulaspora species, a Candida species, a Yarrowia species, and Kluveromyces species.
[0172] 58. A host cell comprising the DNA construct of clause 44 wherein the host cell is selected from the group consisting of Hansenula species, Pichia species, Saccharomyces species, Schizosaccharomyces species, Torulaspora species, a Candida species, a Yarrowia species, and Kluveromyces species.
[0173] 59. The method of any one of clauses 45 to 55 wherein the host cell is selected from the group consisting of Hansenula species, Pichia species, Saccharomyces species, Schizosaccharomyces species, Torulaspora species, Candida species, a Yarrowia species, and Kluveromyces species.
[0174] 60. The host cell of any one of clauses 12 or 13 wherein the host cell is a methylotrophic yeast.
[0175] 61. The host cell of clause 60 wherein the host cell is selected from the group consisting of Hansenula species, Pichia species, and Candida species.
[0176] 62. A host cell comprising the DNA construct of clause 16 wherein the host cell is a methylotrophic yeast.
[0177] 63. The host cell of clause 62 selected from the group consisting of Hansenula species, Pichia species, and Candida species.
[0178] 64. The method of any one of clauses 17 to 27 wherein the host cell is a methylotrophic yeast.
[0179] 65. The method of clause 64 wherein the host cell is selected from the group consisting of Hansenula species, Pichia species, and Candida species.
[0180] 66. The method of any one of clauses 25 or 53 wherein the third expression cassette comprises the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other AOX 1 or AOX 2 promoter sequence.
[0181] 67. A method of producing one or more proteins, the method comprising the step of culturing in a culture medium a host cell comprising a first expression cassette, a second expression cassette, and one or more additional expression cassettes, wherein each of the one or more additional expression cassettes comprises the isolated nucleic acid of any one of clauses 1 to 4 operably linked to a heterologous coding sequence encoding the one or more proteins, wherein the culturing is done under conditions permitting expression of the one or more proteins.
[0182] 68. A method of producing one or more proteins, the method comprising the step of culturing in a culture medium a host cell comprising a first expression cassette, a second expression cassette, and one or more additional expression cassettes, wherein each of the one or more additional expression cassettes comprises the isolated nucleic acid of any one of clauses 29 to 38 operably linked to a heterologous coding sequence encoding the one or more proteins, wherein the culturing is done under conditions permitting expression of the one or more proteins.
[0183] 69. The method of any one of clauses 17 or 45 further comprising the step of purifying the protein from the medium of the cultured host cell.
[0184] 70. The method of any one of clauses 67 or 68 further comprising the step of purifying one or more of the one or more proteins from the medium of the cultured host cell.
[0185] 71. The isolated nucleic acid, host cell, expression vector, isolated protein, DNA construct, or method of any one of clauses 1 to 70 wherein the isolated nucleic acid consists of any one of SEQ ID NOS. 1 to 14, or a fragment thereof.
[0186] 72. An isolated nucleic acid consisting of any one of SEQ ID NOS. 1 to 14, or a fragment thereof.
[0187] The phrase consists of or consisting of means that the sequence specified by the SEQ ID NO. has no additional nucleotide sequences other than those corresponding to the SEQ ID NO.
[0188] 73. The isolated nucleic acid of clause 5 wherein the heterologous coding sequence encodes a protein or a polypeptide selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0189] 74. The isolated nucleic acid of clause 29 wherein the heterologous coding sequence encodes a protein or a polypeptide selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein, and a cell signaling protein.
[0190] 75. A method of producing a protein or a polypeptide, the method comprising the step of
[0191] culturing in a culture medium a host cell comprising a first expression cassette comprising the isolated nucleic acid of any one of clauses 1 to 4 operably linked to a heterologous coding sequence encoding the protein or the polypeptide, wherein the culturing is done under conditions permitting expression of the protein or the polypeptide.
[0192] 76. A method of producing a protein or a polypeptide, the method comprising the step of culturing in a culture medium a host cell comprising a first expression cassette comprising the isolated nucleic acid of any one of clauses 29 to 38 operably linked to a heterologous coding sequence encoding the protein or the polypeptide, wherein the culturing is done under conditions permitting expression of the protein or the polypeptide.
[0193] Any yeast expression system known to those skilled in the art can be used in accordance with the present invention. For example, various yeast expression systems are described in U.S. Pat. Nos. 6,451,572, 6,841,370, 6,974,690, 7,320,876, 7,078,035, 7,138,260, and PCT Publication No. WO 2007/112739, all incorporated herein by reference. In any of the embodiments described herein, any of these yeast expression systems can be used. Alternatively, any yeast species or yeast expression system suitable for expression of a protein can be used including yeast species, such as Saccharomyces species (e.g., Saccharomyces cerevisiae), Kluyveromyces species (e.g., Kluyveromyces lactis), Torulaspora species, Yarrowia species (e.g., Yarrowia lipolitica), Schizosaccharomyces species (e.g., Schizosaccharomyces pombe). In another embodiment, methylotrophic yeast species such as Pichia species (e.g., Pichia pastoris or Pichia methanolica), Hansenula species (e.g., Hansenula polymorpha), Torulopsis species, Komagataella species, Candida species (e.g., Candida boidinii), and Karwinskia species can be used, in particular when the promoter is a methanol-inducible promoter. In one embodiment the protein can be expressed in the methylotrophic yeast Pichia pastoris. Methylotrophic yeast are capable of utilizing methanol as a sole carbon source for the production of the energy resources necessary to maintain cellular function. Methylotrophic yeast contain genes encoding enzymes for methanol utilization such as the genes encoding alcohol oxidase. Any of these host cells can be a host cell strain that is heterologous to the promoter described herein (i.e., the host cell does not normally contain in nature the promoter described herein).
[0194] A yeast expression system can be used to produce a sufficient amount of the protein intracellularly, or secreted from the yeast cells so that the protein can be conveniently isolated and purified from the culture medium. As used herein, the term expression means transcription and/or translation of a nucleic acid in a host cell. A yeast expression system may include, but is not limited to, the yeast host cell and the expression vector (e.g., a DNA construct) used to express the protein. The expression vector can contain a promoter described herein and, as is known in the art, the promoter is heterologous to the expression vector (i.e., the combination does not occur in nature). In one embodiment, secretion of the protein into the culture medium is controlled by a signal peptide (e.g., the yeast -factor signal peptide, the yeast KILM1 signal peptide, the yeast PHO1 signal peptide, or the yeast SUC2 signal peptide) incorporated into the expression vector and which is capable of directing the secretion of the expressed protein out of the yeast cell. In other embodiments, other signal peptides suitable for facilitating secretion of the protein from yeast cells are known to those skilled in the art. In one aspect, the signal peptide is typically cleaved from the protein after secretion.
[0195] In various embodiments, any expression vector known to the skilled artisan (e.g., a vector that replicates autonomously or integrates into the host genome) and compatible with a yeast expression system can be used. As used herein, the term vector means any plasmid, or other vector, in double-stranded or single-stranded form or in linear or circular form that can transform a yeast cell by integration into the yeast cell genome or by existing extrachromosomally (e.g., an autonomously replicating plasmid). As is known in the art, a vector (e.g., expression vector or expression cassette) is a nucleic acid construct used to transform a host cell for expression of a protein, polypeptide, or peptide and the vector is not found in nature in the host cell it transforms.
[0196] In one embodiment, the expression vector has restriction endonuclease cleavage sites for the insertion of DNA fragments (e.g., one or more cloning sites and/or a multiple cloning site), and genetic markers for selection of transformants. For example, the genetic markers for selection of transformants can include a selection marker that allows a transformed yeast to grow on a medium devoid of a necessary nutrient that cannot be produced by a deficient strain, a selection marker that encodes an enzyme for which chromogenic substrates are known, or a selection marker that provides resistance to a drug, including, but not limited to, G418, Nourseothricin (Nat), Zeocin, Blasticidin, or Hygromycin. In another embodiment, the expression vector has a terminator sequence for transcription termination (e.g., the AOX 1 or HSP150 terminator). In another embodiment, the expression vector has a 3 untranslated region downstream from the protein coding sequence with a polyadenylation site. As used herein, 3 untranslated region means nucleotide sequences that are not translated into protein and are located downstream from a coding sequence for a protein. Typically, a 3 untranslated region includes regulatory sequences for mRNA processing. In another embodiment, the expression vector has an origin of replication (e.g., a bacterial origin of replication) for use in synthesizing and amplifying the vector, for example, in a bacterial host. Various expression vectors are described in U.S. Pat. Nos. 6,451,572, 6,841,370, 6,974,690, 7,320,876, 7,078,035, 7,138,260, and PCT Publication No. WO 2007/112739, all incorporated herein by reference. The construction and use of expression vectors is described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. In another embodiment, the expression vector, or a fragment thereof, can be synthesized de novo or PCR can be used to amplify and join sections of expression vectors.
[0197] As used herein, regulatory sequences means nucleotide sequences that are typically upstream or downstream from the 5 or 3 end, respectively, of a protein coding sequence. Regulatory sequences are not translated into protein. Regulatory sequences include, but are not limited to, sequences that affect RNA processing or stability, such as polyadenylation signal sequences, enhancers, repressor binding sites, and promoters.
[0198] In one embodiment, the protein coding sequence can be operably linked in the expression vector to the promoter sequence capable of directing the expression of the protein, for example, in yeast. As used herein, operably linked means functionally linked. As described herein, the promoter can be a constitutive or an inducible promoter, such as a methanol inducible promoter. As used herein, a constitutive promoter means a promoter that regulates expression of a gene of interest. The term constitutive promoter is known in the art. As used herein, an inducible promoter means a regulated promoter that is turned on in a cell by an external stimulus, such as a chemical, light, a change in temperature, a change in cell density, or a protein, such as a hormone. A methanol inducible promoter can have some constitutive activity, although a methanol inducible promoter has maximal activity when induced in the presence of methanol. Likewise, a constitutive promoter can have some inducible activity, but a constitutive promoter as used herein does not have maximal activity when induced in the presence of methanol.
[0199] As used herein promoter means a nucleotide sequence typically located upstream from the 5 end of a coding sequence for a protein that controls the transcription of RNA from DNA, in part, by interacting with various regulatory factors that control transcription. In one embodiment, the promoter may be derived from the same species of yeast as the yeast host cell used for protein expression. In another embodiment, the promoter may be derived from a different yeast species than the yeast host cell used for protein expression. In one embodiment, a promoter may include a TATA box sequence that acts as a recognition site to direct initiation of transcription, including, but not limited to one or more transcriptional enhancer elements. The enhancer elements may be proximal or distal to the TATA box sequence and may be in a normal 5 to 3 orientation or may be in a 3 to 5 orientation. In another embodiment, an enhancer element may be an enhancer element native to the promoter sequence or it may be a heterologous enhancer element inserted into the expression vector construct. An enhancer element as used herein is a regulatory element that can stimulate promoter activity.
[0200] In various illustrative embodiments described herein, the promoter can be an isolated nucleic acid wherein the sequence of the isolated nucleic acid comprises a sequence at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a fragment thereof, wherein the isolated nucleic acid comprises the sequence of a methanol-inducible Pichia pastoris promoter. In another embodiment, the isolated nucleic acid sequence is a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or a fragment thereof wherein the isolated nucleic acid comprises the sequence of a methanol-inducible Pichia pastoris promoter.
[0201] In other embodiments, the promoter can be an isolated nucleic acid wherein the sequence of the isolated nucleic acid comprises a sequence at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14 or at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a fragment thereof, wherein the isolated nucleic acid comprises the sequence of a constitutive Pichia pastoris promoter. In another embodiment, the isolated nucleic acid sequence is a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14, or a fragment thereof wherein the isolated nucleic acid comprises the sequence of a constitutive Pichia pastoris promoter.
[0202] As used herein an isolated nucleic acid means a nucleic acid that is substantially free of sequences that naturally flank the nucleic acid in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid in accordance with the invention can contain less than about 2 kb, less than about 1 kb, less than about 0.5 kb, less than about 0.1 kb of nucleotide sequences, less than about 0.05 kb, or no nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the organism from which the isolated nucleic acid is derived.
[0203] As used herein, a fragment thereof when referring to the isolated nucleic acid molecule means a fragment of the isolated nucleic acid of SEQ ID NOS: 1 to 14. In various illustrative embodiments, the fragment can be about 50 nucleotides in length, about 100 nucleotides in length, about 200 nucleotides in length, about 300 nucleotides in length, about 400 nucleotides in length, about 500 nucleotides in length, about 600 nucleotides in length, about 700 nucleotides in length, about 800 nucleotides in length, or about 900 nucleotides in length. In other embodiments, the fragment can extend about 50 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, or about 900 nucleotides upstream from the 3 end of the isolated nucleic acid of any of SEQ ID NOS: 1 to 14. In yet other embodiments, the fragment can include about 50 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, or about 350 nucleotides upstream and/or downstream from the TATA box sequence found in each of SEQ ID NOS: 1 to 14.
[0204] In various embodiments, the isolated nucleic acids described herein may be purified by techniques for purification of nucleic acids (e.g., DNA) that are well-known in the art. For example, the nucleic acids may be separated from contaminants by physical methods including, but not limited to, centrifugation, pressure techniques, or by using a substance with affinity for nucleic acids (e.g., DNA), such as, for example, silica beads. After sufficient washing, the isolated nucleic acids may be suspended in either water or a buffer. In other embodiments, commercial kits are available, such as Qiagen, Nuclisensm, and Wizard (Promega), and Promegam. Methods for purifying nucleic acids are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. An isolated nucleic acid as described herein may be an isolated nucleic acid that is also purified, or the isolated nucleic acid may be impure. A purified nucleic acid is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
[0205] The isolated nucleic acids described herein are capable of specific hybridization, under appropriate hybridization conditions (e.g., appropriate buffer, ionic strength, temperature, formamide, and MgCl.sub.2 concentrations), to a complementary nucleic acid. The isolated nucleic acids described herein can be modified by substitution, deletion, truncation, and/or can be fused with other nucleic acid molecules wherein the resulting isolated nucleic acids hybridize specifically to the complemetary nucleic acids.
[0206] Also within the scope of the invention are nucleic acids complementary to the isolated nucleic acids, or fragments thereof, described herein, and those that hybridize to the isolated nucleic acids described herein or those that hybridize to their complements under highly stringent conditions. As used herein, the term complementary refers to the ability of purine and pyrimidine nucleotide sequences to associate through hydrogen bonding to form double-stranded nucleic acid molecules. Guanine and cytosine, adenine and thymine, and adenine and uracil are complementary and can associate through hydrogen bonding resulting in the formation of double-stranded nucleic acid molecules when two nucleic acid molecules have complementary sequences. The complementary DNA sequences are referred to as a complement.
[0207] In accordance with the invention highly stringent conditions means hybridization at 65 C. in 5SSPE and 50% formamide, and washing at 65 C. in 0.5SSPE. Conditions for high stringency hybridization are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. In some illustrative aspects, hybridization can occur along the full-length of the isolated nucleic acid, or along part of its length, or to a fragment thereof.
[0208] Also included are isolated nucleic acid molecules having about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 92%, about 95%, 96%, 97%, 98%, and 99% identity to the isolated nucleic acids described herein, or to a fragment thereof. Determination of percent identity or similarity between sequences can be done, for example, by using the GAP program (Genetics Computer Group, software; now available via Accelrys on http://www.accelrys.com), and alignments can be done using, for example, the ClustalW algorithm (VNTI software, InforMax Inc.). A sequence database can be searched using the isolated nucleic acid sequence of interest, or the sequence of a fragment thereof. Algorithms for database searching are typically based on the BLAST software (Altschul et al., 1990). In some embodiments, the percent identity can be determined along the full-length of the isolated nucleic acid.
[0209] Techniques for synthesizing the isolated nucleic acids described herein are well-known in the art and include chemical syntheses and recombinant methods. Such techniques are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. Isolated nucleic acid molecules can also be made commercially. Techniques for synthesizing the isolated nucleic acids described herein are well-known in the art. The isolated nucleic acids described herein can be analyzed by techniques known in the art, such as restriction enzyme analysis or sequencing, to determine the sequence of the isolated nucleic acids. Thus, isolated nucleic acids described herein may be synthetic.
[0210] In illustrative aspects, yeast cells are transformed with an expression vector comprising a heterologous nucleic acid encoding the protein of interest operably linked to one of the promoters described herein using procedures well-known to those skilled in the art. The term transformation means the transfer of a nucleic acid, or a nucleic acid fragment, into a host cell. In illustrative embodiments, such transformation protocols include electroporation, lithium acetate methods, and use of spheroplasts. In illustrative aspects, the expressed nucleic acid coding sequence can be a heterologous nucleic acid coding sequence. As used herein, a heterologous coding sequence is defined as an artificial or synthetic nucleic acid or a nucleic acid originating from a different species than the species from which the promoter sequence was derived. Thus, a heterologous coding sequence linked to a promoter described herein does not occur in nature.
[0211] In various embodiments, the transformed yeast cells may be grown by techniques including batch and continuous fermentation in a liquid medium or on a semi-solid medium, or a solid medium. Typically, conditions permitting expression of the protein as used herein means conditions for batch or continuous fermentation of yeast in a liquid medium, but growth on a semi-solid medium, such as agar, is not excluded. Culture media for yeast cells are known in the art and are typically supplemented with a carbon source (e.g., glucose). A typical yeast culture medium is YPD broth (Sunrise Science Products, Inc.) comprising yeast extract (10 grams), Bacto peptone (20 grams), and dextrose (20 grams). In one illustrative aspect, the transformed yeast cells can be grown aerobically at 30 C. in a controlled pH environment (a pH of about 6) and with the carbon source (e.g., glucose) maintained continuously at a predetermined level known to support growth of the yeast cells to a desired density within a specific period of time.
[0212] In one illustrative embodiment, a method of producing a protein is provided. The method comprises the step of culturing in a culture medium a host cell comprising a first expression cassette comprising an isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to a heterologous coding sequence encoding a protein, wherein the culturing is done under conditions permitting expression of the protein. The method can further comprise the step of purifying the protein from the medium of the cultured host cell. As used herein, an expression cassette means the elements of an expression vector that direct the yeast cell to make RNA. An expression cassette comprises at least regulatory sequences (e.g., a promoter) and a coding sequence for the RNA and protein (i.e., an open reading frame). The isolated nucleic acid can be at least 80%, at least 85%, at least 90%, 92%, 95%, 96%, 97%, 98%, or 99% homologous to the isolated nucleic acid of any of SEQ ID NOS: 1 to 14, or a fragment thereof. In various illustrative aspects, the protein coding sequence can be from a bacterium, a yeast, a fungus, or a virus.
[0213] In this method embodiment, the protein can be expressed using the first expression cassette in combination with a second expression cassette. In another embodiment, the second expression cassette can comprise 1) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other known methanol-regulated promoter, such as AOX 1, AOX 2, FLD, or DAS promoter sequences, or 2) the isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to the heterologous coding sequence encoding the protein.
[0214] In yet another embodiment, the protein can be expressed using the first expression cassette, the second expression cassette, and a third expression cassette. In another illustrative aspect, the third expression cassette can comprise 1) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other known methanol-regulated promoters, such as AOX 1, AOX 2, FLD, or DAS promoter sequences, or 2) the isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to the heterologous coding sequence encoding the protein.
[0215] In another embodiment, any number of additional expression cassettes can be used and the expression cassettes can comprise 1) the heterologous coding sequence encoding the protein operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO: have promoter activity, or any other known methanol-regulated promoters, such as AOX 1, AOX 2, FLD, or DAS promoter sequences, or 2) the isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to the heterologous coding sequence encoding the protein. In another embodiment, the first expression cassette, the second expression cassette, and the third expression cassette as described above are used in the method, along with a fourth expression cassette, a fifth expression cassette, and a sixth expression cassette wherein all of the expression cassettes comprise the isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to the heterologous coding sequence encoding the protein.
[0216] In still another embodiment, a method of producing one or more proteins is provided. The method comprises the step of culturing in a culture medium a host cell comprising a first expression cassette, a second expression cassette, and, optionally, one or more additional expression cassettes, wherein each of the expression cassettes comprises 1) a heterologous coding sequence encoding the one or more proteins operably linked to an isolated nucleic acid having a sequence comprising the sequence of SEQ ID NO:15 or SEQ ID NO:16 wherein SEQ ID NO:15 and SEQ ID NO:16 have promoter activity, or any other known methanol-regulated promoters, such as AOX 1, AOX 2, FLD, or DAS promoter sequences, or 2) the isolated nucleic acid of any one of SEQ ID NOS: 1 to 14, or a fragment thereof, operably linked to a heterologous coding sequence encoding the one or more proteins, wherein the culturing is done under conditions permitting expression of the one or more proteins. The method can further comprise the step of purifying one of the one or more proteins from the medium of the cultured host cell.
[0217] In any of the embodiments described in the preceding two paragraphs, the isolated nucleic acid can be at least 80%, at least 85%, at least 90%, 92%, 95%, 96%, 97%, 98%, or 99% homologous to the isolated nucleic acid of any of SEQ ID NOS: 1 to 14, or a fragment thereof. In any of the embodiments described in the preceding two paragraphs, the expression cassettes can be included in one expression vector or in multiple expression vectors. In any of the embodiments described in the preceding two paragraphs, the expression vectors into which the expression cassettes are incorporated can be vectors that replicate autonomously or that integrate into the host cell genome.
[0218] In various illustrative embodiments, the protein encoded by the any of the heterologous coding sequences described herein operably linked to the promoter can be a protein selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein (e.g., a vaccine antigen), and a cell signaling protein. In one embodiment, the protein is an enzyme for use in animal feed. In this embodiment, the protein can be selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a cellulase, a protease, and a xylanase. In another embodiment, the protein can be an enzyme useful for glycosylation. In another aspect, more than one protein can be expressed by using multiple expression cassettes, each with a heterologous coding sequence, operably linked to a promoter. However, these protein examples are non-limiting and any protein, polypeptide, or peptide capable of being expressed in yeast can be expressed in accordance with the isolated nucleic acids, expression vectors, host cells, DNA constructs, methods, and isolated proteins described herein. The enzymes described above can be from any species (e.g., fungal species, such as a yeast species).
[0219] The yeast-expressed proteins for use in accordance with the present invention can be produced in purified form by conventional techniques. As used herein, isolated protein means a purified protein. A purified protein is substantially free from other yeast cell contaminants or contaminants from the culture medium. For example, substantially free from other yeast cell contaminants or contaminants from the culture medium means that the protein is at least about 60% pure, at least about 70% pure, at least about 80% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, about 60% pure, about 70% pure, about 80% pure, about 90% pure, about 95% pure, or about 98% pure (all based on dry weight). Typically, the protein is secreted into the yeast culture medium and is collected from the culture medium.
[0220] In one illustrative embodiment, for purification from the culture medium the protein can, for example, be subjected to ammonium sulfate precipitation followed by DEAE-Sepharose column chromatography. In other embodiments, conventional techniques known to those skilled in the art can be used such as ammonium sulfate or ethanol precipitation, acid extraction, gel filtration, anion or cation exchange chromatography, DEAE-Sepharose column chromatography, hydroxylapatite chromatography, lectin chromatography, affinity chromatography, solvent-solvent extraction, ultrafiltration, and HPLC.
[0221] Alternatively, purification steps may not be required because the protein may be present in such high concentrations in the culture medium that the protein is essentially pure in the culture medium (e.g., 70 to 80% pure). In one embodiment, the protein is collected from the culture medium without further purification steps by chilling the yeast culture (e.g., to about 4 C. to about 8 C.) and removing the yeast cells using such techniques as centrifugation, microfiltration, and rotary vacuum filtration. The protein in the cell-free medium can then be concentrated by such techniques as, for example, ultrafiltration and tangential flow filtration.
[0222] In some embodiments where the protein is not secreted into the culture medium, the yeast cells can be lysed, for example, by sonication, heat, or chemical treatment, and the homogenate centrifuged to remove cell debris. The supernatant can then be subjected to ammonium sulfate precipitation, and additional fractionation techniques as required, such as gel filtration, ion exchange chromatography, DEAE-Sepharose column chromatography, affinity chromatography, solvent-solvent extraction, ultrafiltration, and HPLC to purify the protein. It should be understood that the purification methods described above for purification of proteins from the culture medium or from lysed yeast cells are non-limiting and any purification techniques known to those skilled in the art can be used to purify the yeast-expressed protein if such techniques are required to obtain a substantially pure protein.
[0223] Various formulations of the purified protein preparations may be prepared in accordance with the invention. In some embodiments, the proteins can be stabilized through the addition of other proteins (e.g., gelatin and skim milk powder), chemical agents (e.g., glycerol, polyethylene glycol, EDTA, potassium sorbate, sodium benzoate, and reducing agents and aldehydes), polysaccharides, monosaccharides, lipids (hydrogenated vegetable oils), and the like. In one embodiment, proteins for addition to food products or animal feed blends can be dried (e.g., spray drying, drum drying, and lyophilization) and formulated as powders, granules, pills, mineral blocks, liquids, and gels through known processes. In one embodiment, gelling agents such as gelatin, alginate, collagen, agar, pectin and carrageenan can be used.
[0224] In alternate embodiments, the protein expression can be for intracellular expression, such as for enzymatic action in the yeast in a biotransformation process, or for display on the yeast cell surface. For such embodiments, the protein, expressed as described herein, is not purified.
[0225] In various embodiments, the proteins described above are selected from the group consisting of a toxin, an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein (e.g., a vaccine antigen), and a cell signaling protein. In another embodiment, the proteins described above are selected from the group consisting of an antibody, a hormone, an enzyme, a growth factor, a cytokine, a structural protein, an immunogenic protein (e.g., a vaccine antigen), and a cell signaling protein. In yet another embodiment the coding sequence for a protein, a fragment thereof, a fusion protein (e.g., a chimeric protein), or a peptide, can be used in accordance with the invention. In another embodiment, a modified protein can be expressed, such as a mutated protein or a protein with non-natural amino acids.
[0226] In one embodiment, the toxins can be proteins such as, for example, botulinum toxin or verotoxin-1, and after preparation using the methods, isolated nucleic acids, expression vectors, host cells, and DNA constructs described herein, the toxins can be modified using a targeting agent so that they are directed specifically to diseased cells. In another illustrative aspect, the antibody can be a humanized antibody, an antibody that is not humanized, a nanobody, or an antibody fragment, such as an Fab fragment of an antibody or a single-chain antibody. In another embodiment, the hormone can be, for example, a gonadotropin, an adrenocorticotrophic hormone, a growth hormone, vasopressin, oxytocin, somatostatin, gastrin, or leptin. In another illustrative embodiment, the growth factor can be insulin, epidermal growth factor, fibroblast growth factor, vascular endothelial growth factor, erythropoietin, platelet-derived growth factor, thrombopoietin, or a bone morphogenic protein. In one aspect, the cytokine can be IL-2, IFN-, IFN-, or GM-CSF. In another illustrative aspect, the vaccine proteins can be any suitable vaccine proteins that are immunogenic in a patient or an animal, including, but not limited to, HPV proteins (e.g., HPV 16 and HPV 18), and tetanus vaccine proteins, as examples. In another illustrative embodiment, the enzymes can be, for example, enzymes for animal feeds as discussed herein, acetylcholinesterase, or cyclooxygenase, or any other useful enzyme that can be expressed in yeast. In another embodiment, structural proteins can be expressed, for example, netrins, actin-binding proteins, or myosin, and, in another embodiment, cell signaling proteins such as ras proteins, kinases, the ErbB2 protein (the Her-2 receptor) can be expressed using the methods, isolated nucleic acids, expression vectors, host cells, and DNA constructs described herein.
[0227] In one embodiment, the protein is an enzyme for use in animal feed. In this embodiment, the protein can be selected from the group consisting of a phytase, a mannanase, a galactosidase, an amylase, a glucanase, a cellulase, a protease, and a xylanase, or a combination thereof. For example, a variety of phytases may be expressed according to the methods described herein. Exemplary of phytase genes (i.e., a phytase coding sequence) that can be expressed in accordance with the invention are phytase genes derived from bacteria, filamentous fungi, plants, and yeast, such as the appA (Gene Bank accession number M58708) and appA2 (Gene Bank accession number 250016) genes derived from Escherichia coli and the phyA and phyB genes derived from the fungus Aspergillus niger, or any mutant of these genes that retains or has improved myo-inositol hexakisphosphate phosphohydrolase activity (see, for example, Rodriguez et al., Arch. of Biochem. and Biophys. 382: 105-112 (2000), incorporated herein by reference). Substituted, deleted, and truncated phytase genes, or a fragment thereof, can also be expressed in accordance with the invention.
[0228] In one embodiment, the protein expressed using the methods described herein can be used in animal feed comprising an animal feed blend. In various embodiments, any animal feed blend known in the art can be used such as rapeseed meal, cottonseed meal, soybean meal, and cornmeal. Optional ingredients of the animal feed blend include sugars and complex carbohydrates such as both water-soluble and water-insoluble monosaccharides, disaccharides and polysaccharides. Optional amino acid ingredients that can be added to the feed blend are arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, valine, tyrosine ethyl HCl, alanine, aspartic acid, sodium glutamate, glycine, proline, serine, cysteine ethyl HCl, and analogs, and salts thereof. Vitamins that can be optionally added are thiamine HCl, riboflavin, pyridoxine HCl, niacin, niacinamide, inositol, choline chloride, calcium pantothenate, biotin, folic acid, ascorbic acid, and vitamins A, B, K, D, E, and the like. Minerals, protein ingredients, including protein obtained from meat meal or fish meal, liquid or powdered egg, fish solubles, whey protein concentrate, oils (e.g., soybean oil), cornstarch, calcium, inorganic phosphate, copper sulfate, salt, and limestone can also be added. Antioxidants can also be added.
[0229] In another embodiment, a kit comprising an expression vector comprising the isolated nucleic acid of SEQ ID NO: 1 to SEQ ID NO: 14, or a fragment thereof, is provided. In one illustrative aspect, the isolated nucleic acid, or the fragment, can be 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the isolated nucleic acid of SEQ ID NO: 1 to SEQ ID NO: 14, or to the fragment thereof. In various illustrative embodiments, the fragment can be about 50 nucleotides in length, about 100 nucleotides in length, about 200 nucleotides in length, about 300 nucleotides in length, about 400 nucleotides in length, about 500 nucleotides in length, about 600 nucleotides in length, about 700 nucleotides in length, about 800 nucleotides in length, or about 900 nucleotides in length. In other embodiments, the fragment can extend about 50 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, about 500 nucleotides, about 600 nucleotides, about 700 nucleotides, about 800 nucleotides, or about 900 nucleotides upstream from the 3 end of the isolated nucleic acid of any of SEQ ID NOS: 1 to 14. In yet other embodiments, the fragment can include about 50 nucleotides, about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, or about 350 nucleotides upstream and/or downstream from the TATA box sequence found in each of SEQ ID NOS: 1 to 14.
[0230] In one embodiment, the expression vector (i.e., with the heterologous promoter) included in the kit can have any of the other elements described herein, such as a selection marker, a cloning site, such as a multiple cloning site, an enhancer, a termination sequence, a signal peptide sequence, and the like. In another aspect, the expression vector can be a vector that replicates autonomously or integrates into the host cell genome. In another embodiment, the expression vector can be circularized or linearized (i.e., digested with a restriction enzyme so that a gene of interest can easily be cloned into the expression vector). In another embodiment, the kit can include an expression vector and a control open reading frame encoding a marker or control gene for expression (e.g., an open reading frame encoding a LacZ- fragment) for use as a control to show that the expression vector is competent to be ligated and to be used with a gene of interest.
[0231] In another illustrative embodiment, the kit can contain a tube containing a circular expression plasmid. In another embodiment, the kit can contain a tube with a linear expression vector that is digested with a restriction enzyme so it is ready to clone a gene of interest. In one embodiment, the tube can be sterilized. In either of these embodiments, the kit can also include a circular or linear expression vector and a control open reading frame encoding a marker or control gene for expression (e.g., an open reading frame encoding a LacZ- fragment) for use as a control in showing that the expression vector can be ligated with a gene of interest, and/or to show that the host cell is competent for transformation.
[0232] In yet another embodiment, the kit can contain multiple different expression vectors. In another embodiment, the multiple different expression vectors can contain the same promoter, but different selectable markers, such as genes for resistance to the drugs G418, Nourseothricin (Nat), Zeocin, Blasticidin, or Hygromycin. In this embodiment, the kit may also contain aliquots of the drugs (e.g., G418, Nourseothricin (Nat), Zeocin, Blasticidin, or Hygromycin) in tubes, or other containers, separate from the corresponding vectors.
[0233] In any of the kit embodiments described above, the isolated nucleic acid can consist of any one of SEQ ID NOS. 1 to 14, or a fragment thereof. The phrase consists of means that the sequence specified by the SEQ ID NO. has no additional nucleotide sequences other than those corresponding to the SEQ ID NO.
[0234] In another illustrative aspect, the kit can include other components for use with the expression vector, such as components for transformation of yeast cells, restriction enzymes for incorporating a protein coding sequence of interest into the expression vector, ligases, components for purification of expression vector constructs, buffers (e.g., a ligation buffer), instructions for use (e.g., to facilitate cloning), and any other components suitable for use in a kit for making and using the expression vectors described herein. In another embodiment, the expression vector or any other component of the kit can be included in the kit in a sealed tube (e.g., sterilized or not sterilized) or any other suitable container or package (e.g., sterilized or not sterilized). The kits described in the preceding paragraphs that include the expression vector comprise the expression vector comprising a promoter described herein operably linked to the vector which is heterologous to the promoter (i.e., the combination does not occur in nature).
[0235] The following examples provide illustrative methods for carrying out the practice of the present invention. As such, these examples are provided for illustrative purposes only and are not intended to be limiting.
EXAMPLES
Example 1
Promoter Expression Levels
[0236]
TABLE-US-00001 TABLE 1 Fermentation Samples glycerol 6 hr 2 hr methanol 6 hr methanol 18 hr methanol 48 hr methanol 66 hr methanol Gene starvation glycerol feed induction induction induction induction induction AOX1 958 54 21806 17607 10035 581 911 AOX2 185 28 10035 1374 1697 64 119 CAM1 316 166 13201 13201 24457 36959 36959 FLD1 3405 1293 11173 10632 13473 21806 14995 GPM2 884 549 7280 8614 8357 14995 17607 PP7435_Chr1-1351 2102 149 12171 13473 14995 17607 11173 PP7435_Chr1-0269 7766 8636 3252 3772 6615 9483 5969 PP7435_Chr2-0207 13473 17607 1520 858 4496 3914 3742 PP7435_Chr2-0208 21806 28506 2298 1136 7155 7280 8949 PP7435_Chr2-0790 2457 356 7829 7502 6433 2064 822 PP7435_Chr2-0809 5566 4305 1668 4205 4799 6758 2899 PP7435_Chr3-0476 6758 9425 1648 5566 6104 10632 10035 PP7435_Chr3-0842 243 134 8614 6987 5684 7155 12171 PP7435_Chr4-0069 7502 12171 1746 1162 7829 9425 13473 PP7435_Chr4-0800 5064 5916 2382 5415 5415 6987 3964 SPI1 275 203 673 376 267 164 195 TDH1 8949 841 2102 951 2965 813 104 TEF2 7155 2248 4305 7829 10632 3246 757 THI4 1668 68 14995 12171 2542 429 419 * All numbers as transcripts per million
TABLE-US-00002 TABLE 2 Shake Flask Samples strain 1: strain 2: strain 3: strain 4: strain glycerol glycerol glycerol glycerol 5: shake shake shake shake methanol Gene flask flask flask flask induction AOX1 7 8 24 22 3167 AOX2 12 16 9 8 109 CAM1 537 513 661 789 24110 FLD1 762 743 357 1202 17607 GPM2 303 352 699 561 9425 PP7435_Chr1-1351 9 10 15 19 10035 PP7435_Chr1-0269 5587 5535 11983 10362 6375 PP7435_Chr2-0207 2226 2152 3466 3246 680 PP7435_Chr2-0208 3167 3121 7502 4402 864 PP7435_Chr2-0790 41 48 31 26 1877 PP7435_Chr2-0809 6542 6433 2965 4305 6758 PP7435_Chr3-0476 28506 21806 28506 28506 7829 PP7435_Chr3-0842 14 16 48 44 1171 PP7435_Chr4-0069 4887 5684 8141 9425 6542 PP7435_Chr4-0800 21806 17607 10035 21806 7502 SPI1 2500 2035 4799 1529 136 TDH1 1770 5415 1177 1095 2654 TEF2 17607 28506 3914 3803 12171 THI4 10 58 40 30 452 * All numbers as transcripts per million
Example 2
Strain Growth for RNA Isolation to Examine Promoter Expression Levels
[0237] The BG10 strain was maintained as patches on YPD Agar plates. For transcriptome analysis, 50 ml cultures of the strain were inoculated from a patch and grown in BMGY at 30 C. (200 rpm) for approximately 16 hours. The stationary culture was diluted 100-fold into fresh BMGY medium and grown at 30 C. (200 rpm) for 6 hours. This time point was considered exponential growth with glycerol as the carbon source. Aliquots were spun down in 15 ml tubes. Thereafter, supernatants were discarded and the cell pellets were rapidly frozen in liquid nitrogen. Cell pellets were stored at 80 C. for subsequent total RNA isolation.
[0238] For RNA-Seq analysis during fermentation, a shake flask culture grown as described above was expanded into a 1-liter fermentor using standard methanol induction conditions. Cell samples were taken at various time points before, during, and at the end of the methanol induction. Cell pellets were collected and frozen in liquid nitrogen. Cell pellets were stored at 80 C. for subsequent total RNA isolation.
Example 3
Total RNA Isolation
[0239] FastRNA SPIN kits (MP Bio) were used to isolate total RNA. Cell lysis was performed using a BioSpec Mini-Beadbeater 96. Total RNA was eluted from the spin column in 15 l of RNase/DNasefree water, frozen in liquid nitrogen and stored at 80 C. RNA samples were shipped on dry ice for RNA-Seq analysis on an Illumina HiSeq machine. RNA samples were analyzed using an Agilent BioAnalyzer, and all showed intact yeast ribosomal RNA peaks.
Example 4
RNA Library Generation and Sequencing
[0240] mRNA libraries were prepared using Illumina reagents. A TruSeq RNA Sample Preparation Kit was used to selectively generate bar-coded cDNA from polyA RNA. After bar-coding and amplification, a total of 12 samples were pooled (8 fermentation samples, 4 shake flask samples) for analysis. Fifty base, single end reads were performed. Data was supplied to BioGrammatics in standard FASTQ format. Reads were trimmed based on ambiguous bases and quality score and then filtered to eliminate all trimmed reads that were less than 40 bases in length. Approximately 0.3% of reads were removed from each data set.
Example 5
RNA-Seq Analysis
[0241] Data sets from an Illumina HiSeq machine were imported into CLC Genomics Workbench (version 6). The standard software tools from CLC Genomics Workbench were used for RNA-Seq analysis. RNA reads were mapped onto a reference Pichia pastoris genome. Transcription profiles of 5202 annotated genes were generated across the 12 sample data sets. Based on the transcription profiles, genes with either constitutive or methanol regulated transcription patterns were identified.
Example 6
Protein Expression Analysis
[0242] Multiple promoters were inserted into a Promoter Tester Vector, (reporter plasmid, pJ-G-Agal,
TABLE-US-00003 TABLE3 PCRprimersforpromoters. Primer position SEQ onthe Promo- ID Forward Promoter ter NO: primer Primersequence sequence SAM 1 11231-F685 NNNGGTCTCNATCCACGAG 685 TTTCTGGACCGTATC SAM1 1 11231-F447 NNNGGTCTCTATCCGGAAA 447 ACGTTAAGAGATG SAM1 1 11231-F3 NNNGGTCTCTATCCCTCTA 532 CTAAATTGCCCCAAGTG Chr1- 2 1351-F1 NNNGGTCTCNATCCGATGG 606 1351 AGACTCAGTATGATGGGGC Chr1- 2 1351-F2 NNNGGTCTCNATCCAGTAT 595 1351 GATGGGGCAAGGAAAACG THI4 3 THI4-F1 NNNGGTCTCNATCCTGGAG 404 ACCCTTAACAGGTCG GPM2 4 GPM2-F1 NNNGGTCTCNATCCGTTGG 637 GAACTGTGCCTG Chr2- 5 790-F1 NNNGGTCTCNATCCACAGTG 543 0790 GTAGGTCCAACTTGG Chr3- 6 842-F1 NNNCGTCTCNATCCGTAGTA 635 0842 GCCTCTCCAGCCTG Chr1- 7 269-F1 NNNGGTCTCNATCCTGAAGC 611 0269 CCCTGCAACTACAGAG Chr2- 8 207-F1 NNNGGTCTCNATCCGTAGAC 632 0207 GACATCCAGAGAAGTAACAG Chr2- 9 208-F1 NNNGGTCTCNATCCTCAGGT 618 0208 CAGTCTTGAAGTCCTGAG Chr2- 10 809-F1 NNNGGTCTCNATCCTGTGGA 653 0809 ATTCCAAAGAAGGGG Chr4- 11 069-F1 NNNGGTCTCNATCCGTCCGT 467 0069 GATGTAAAATGAGACTAC Chr4- 12 800-F1 NNNGGTCTCNATCCAGTCAA 490 0800 CTGGGAGCTACGGT TEF2 13 TEF2-FF1 NNNGGTCTCNATCCGATGTG 729 AGGATGCGCTC Chr3- 14 476-F1 NNNGGTCTCNATCCTCAATG 650 0476 ACCACGGTAACATGAAAAC GAP GAP-F1 NNNGGTCTCNATCCAATGGA 619 CCAAATTGTTGCAAGGT DAS 07226F620 NNNGGTCTCCATCCCTTTGT 382 TGAGCAACA DAS 07226F518 NNNGGTCTCGATCCGCCCAA 483 ACGAACAG AOX AOXF1 NNNGGTCTCCATCCAAAGAC 931 GAAAGGTTGAATGA
Bg10 gDNA was isolated by breaking the cells by vigorous shaking with 0.5 mm Zirconia/Silica beads (BioSpec Products, Inc.) in the presence of phenol-Chloroform, prior to EtOH precipitation and suspension in a Tris-EDTA solution (10 mM Tris, 1 mM EDTA). PCR was performed for 35 cycles (98 C. for 10 sec, 55 C. for 10 sec, and 72 C. for 30 sec) with a proof reading polymerase by standard methods and the manufactures recommendations (New England BioLabs, NEB). After purification of the PCR amplicons (gel isolation and extraction, DNA Clean and Concentrator, Zymo-Research), the restriction enzyme sites strategically placed in the primers were then used to cut and ligate each purified PCR amplicon, independently, into pJ-G-A-gal reporter vector (
[0243] In all cases, the sequence of the promoters in these reporter plasmids was determined using primers 5 and 3 of the insertion site in the vector; sequence was obtained across the entire promoter and the cloning junctions (Genewiz, Inc.), and compared with the respective mRNA sequences to confirm the promoter clone identity. In all cases, the cloning junction between the promoter and the A-gal ORF was designed to position the A-gal ATG start codon, such that is was in the same position as the predicted ATG of the promoters native ORF start codon.
[0244] The purified, sequence verified, promoter-reporter constructs were linearized for transformation and integration into the Pichia genome of Bg10 Pichia cells by electroporation. After restriction enzyme digestion the DNA was cleaned and concentrated to approximately 200 ng/ul before each construct was independently transformed into electro-competent Pichia (Bg10, BioGrammatics, Inc.). The Bg10 cells were made competent by incubation of log phase cells with DTT and subsequent sorbitol washes (Pichia Protocols). After electroporation, transformants were selected on YPD with 800 ug/ml G418 and incubated at 30 C. for 3 days. Cells from isolated colonies were patched to similar YPD-G418 plates, and cells from these patches were used to measure the level of expression from the reporter genes.
Expression of the A-gal ORF, as regulated by the different promoters, was determined measuring the A-gal enzymatic activity. Reporter activity was scored from YPD agar plates made with 100 mM phosphate buffer, pH 6.5, and alpha-X-GAL as a chromogenic substrate. Reporter activity was detected by a blue colored product in, or around, the cells (
TABLE-US-00004 Relative Alpha Galactosidase Expression, Plate 12/A, Glucose Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Panel/row/column) Source expression (1-5) No: 7 A/A/2 Glucose 3 No: 7 A/A/3 Glucose 3 No: 7 A/A/4 Glucose 3 No: 7 A/B/1 Glucose 3 No: 8 A/B/2 Glucose 2 No: 8 A/B/3 Glucose 4 No: 8 A/B/4 Glucose 2 No: 8 A/B/5 Glucose 4 Control A/C/1 Glucose 0 No: 8 A/C/2 Glucose 2 No: 5 A/C/3 Glucose 3 No: 10 A/C/4 Glucose 2 No: 10 A/C/5 Glucose 3 No: 10 A/D/1 Glucose 3 No: 14 A/D/2 Glucose 2 No: 14 A/D/3 Glucose 4 No: 14 A/D/4 Glucose 0 No: 14 A/D/5 Glucose 5 Control A/E/1 Glucose 0 Control A/E/2 Glucose 0 No: 12 A/E/3 Glucose 2 No: 12 A/E/4 Glucose 2 No: 12 A/E/5 Glucose 1 09479 A/F/1 Glucose 3 09479 A/F/2 Glucose 2 09479 A/F/3 Glucose 3 No: 13 A/F/4 Glucose 4 UPP-513 A/F/5 Glucose 4 UPP-354 A/G/1 Glucose 4 DAS A/G/2 Glucose 0 1-0469 A/G/3 Glucose 4 GAP A/G/4 Glucose 3 No: 3 A/H/1 Glucose 2 No: 2 A/H/2 Glucose 0 No: 7 A/H/3 Glucose 0 No: 11 A/H/4 Glucose 3 No: 11 A/H/5 Glucose 3 No: 3 A/I/1 Glucose 2 No: 3 A/I/2 Glucose 2 No: 3 A/I/3 Glucose 1 No: 3 A/I/4 Glucose 2 No: 3 A/J/2 Glucose 1 No: 3 A/J/3 Glucose 2
TABLE-US-00005 Relative Alpha Galactosidase Expression, Plate 12/A, Glycerol Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Panel/row/column) Source expression (1-5) No: 7 A/A/2 Glycerol 3 No: 7 A/A/3 Glycerol 3 No: 7 A/A/4 Glycerol 3 No: 7 A/B/1 Glycerol 3 No: 8 A/B/2 Glycerol 3 No: 8 A/B/3 Glycerol 4 No: 8 A/B/4 Glycerol 3 No: 8 A/B/5 Glycerol 4 Control A/C/1 Glycerol 0 No: 8 A/C/2 Glycerol 2 No: 5 A/C/3 Glycerol 2 No: 10 A/C/4 Glycerol 2 No: 10 A/C/5 Glycerol 2 No: 10 A/D/1 Glycerol 2 No: 14 A/D/2 Glycerol 2 No: 14 A/D/3 Glycerol 4 No: 14 A/D/4 Glycerol 0 No: 14 A/D/5 Glycerol 5 Control A/E/1 Glycerol 0 Control A/E/2 Glycerol 0 No: 12 A/E/3 Glycerol 2 No: 12 A/E/4 Glycerol 2 No: 12 A/E/5 Glycerol 1 09479 A/F/1 Glycerol 3 09479 A/F/2 Glycerol 2 09479 A/F/3 Glycerol 3 No: 13 A/F/4 Glycerol 3 UPP-513 A/F/5 Glycerol 3 UPP-354 A/G/1 Glycerol 4 DAS A/G/2 Glycerol 0 1-0469 A/G/3 Glycerol 3 GAP A/G/4 Glycerol 2 No: 3 A/H/1 Glycerol 3 No: 2 A/H/2 Glycerol 0 No: 2 A/H/3 Glycerol 0 No: 11 A/H/4 Glycerol 2 No: 11 A/H/5 Glycerol 3 No: 3 A/I/1 Glycerol 2 No: 3 A/I/2 Glycerol 2 No: 3 A/I/3 Glycerol 1 No: 3 A/I/4 Glycerol 2 No: 3 A/J/2 Glycerol 1 No: 3 A/J/3 Glycerol 2
TABLE-US-00006 Relative Alpha Galactosidase Expression, Plate 12/A, Methanol plates. Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Panel/row/column) Source expression (1-5) No: 7 A/A/2 Methanol 2 No: 7 A/A/3 Methanol 3 No: 7 A/A/4 Methanol 2 No: 7 A/B/1 Methanol 2 No: 8 A/B/2 Methanol 3 No: 8 A/B/3 Methanol 4 No: 8 A/B/4 Methanol 2 No: 8 A/B/5 Methanol 4 Control A/C/1 Methanol 1 No: 8 A/C/2 Methanol 2 No: 5 A/C/3 Methanol 3 No: 10 A/C/4 Methanol 2 No: 10 A/C/5 Methanol 3 No: 10 A/D/1 Methanol 3 No: 14 A/D/2 Methanol 2 No: 14 A/D/3 Methanol 5 No: 14 A/D/4 Methanol 0 No: 14 A/D/5 Methanol 5 Control A/E/1 Methanol 0 Control A/E/2 Methanol 1 No: 12 A/E/3 Methanol 2 No: 12 A/E/4 Methanol 4 No: 12 A/E/5 Methanol 1 09479 A/F/1 Methanol 4 09479 A/F/2 Methanol 2 09479 A/F/3 Methanol 4 No: 13 A/F/4 Methanol 3 UPP-513 A/F/5 Methanol 3 UPP-354 A/G/1 Methanol 4 DAS A/G/2 Methanol 2 1-0469 A/G/3 Methanol 3 GAP A/G/4 Methanol 3 No: 3 A/H/1 Methanol 2 No: 2 A/H/2 Methanol 2 No: 2 A/H/3 Methanol 2 No: 11 A/H/4 Methanol 1 No: 11 A/H/5 Methanol 3 No: 3 A/I/1 Methanol 2 No: 3 A/I/2 Methanol 2 No: 3 A/I/3 Methanol 0 No: 3 A/I/4 Methanol 2 No: 3 A/J/2 Methanol 1 No: 3 A/J/3 Methanol 2
TABLE-US-00007 Relative Alpha Galactosidase Expression, Plate 12-A, Ethanol. Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Panel/row/column) Source expression (1-5) No: 7 A/A/2 Ethanol 2 No: 7 A/A/3 Ethanol 2 No: 7 A/A/4 Ethanol 2 No: 7 A/B/1 Ethanol 1 No: 8 A/B/2 Ethanol 0 No: 8 A/B/3 Ethanol 3 No: 8 A/B/4 Ethanol 2 No: 8 A/B/5 Ethanol 4 Control A/C/1 Ethanol 0 No: 8 A/C/2 Ethanol 1 No: 5 A/C/3 Ethanol 2 No: 10 A/C/4 Ethanol 1 No: 10 A/C/5 Ethanol 2 No: 10 A/D/1 Ethanol 2 No: 14 A/D/2 Ethanol 1 No: 14 A/D/3 Ethanol 5 No: 14 A/D/4 Ethanol 0 No: 14 A/D/5 Ethanol 5 Control A/E/1 Ethanol 0 Control A/E/2 Ethanol 0 No: 12 A/E/3 Ethanol 1 No: 12 A/E/4 Ethanol 1 No: 12 A/E/5 Ethanol 0 09479 A/F/1 Ethanol 3 09479 A/F/2 Ethanol 2 09479 A/F/3 Ethanol 3 No: 13 A/F/4 Ethanol 3 UPP-513 A/F/5 Ethanol 3 UPP-354 A/G/1 Ethanol 4 DAS A/G/2 Ethanol 0 1-0469 A/G/3 Ethanol 3 GAP A/G/4 Ethanol 2 No: 3 A/H/1 Ethanol 2 No: 2 A/H/2 Ethanol 0 No: 2 A/H/3 Ethanol 1 No: 11 A/H/4 Ethanol 2 No: 11 A/H/5 Ethanol 3 No: 3 A/I/1 Ethanol 2 No: 3 A/I/2 Ethanol 1 No: 3 A/I/3 Ethanol 0 No: 3 A/I/4 Ethanol 2 No: 3 A/J/2 Ethanol 1 No: 3 A/J/3 Ethanol 2
TABLE-US-00008 Relative Alpha Galactosidase Expression, Plate 23/B, Glucose Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Plate B/row/column) Source expression (1-5) No: 4 B/A/1 Glucose 0 No: 4 B/A/2 Glucose 0 No: 4 B/A/3 Glucose 0 No: 4 B/A/4 Glucose 0 No: 4 B/B/1 Glucose 0 11231 B/B/2 Glucose 0 11231 B/B/3 Glucose 0 No: 1 B/B/4 Glucose 0 No: 1 B/B/5 Glucose 0 No: 1 B/C/1 Glucose 0 No: 14 B/C/2 Glucose 0 No: 14 B/C/3 Glucose 0 No: 14 B/C/4 Glucose 0 No: 14 B/C/5 Glucose 0 No: 14 B/D/1 Glucose 2 No: 14 B/D/2 Glucose 1 No: 2 B/D/3 Glucose 0 No: 2 B/D/4 Glucose 0 No: 2 B/D/5 Glucose 0 No: 2 B/E/1 Glucose 0 No: 2 B/E/2 Glucose 0 No: 2 B/E/3 Glucose 0 No: 2 B/E/4 Glucose 0 No: 2 B/E/5 Glucose 0 UPP-513 B/F/1 Glucose 4 UPP-345 B/F/2 Glucose 4 DAS B/F/3 Glucose 0 1-0469 B/F/4 Glucose 3 GAP B/F/5 Glucose 4 09476 B/G/1 Glucose 2 UPP 222 B/G/2 Glucose 3 No: 13 B/G/3 Glucose 4 No: 13 B/G/4 Glucose 4 No: 2 B/H/1 Glucose 0 No: 2 B/H/2 Glucose 0 No: 13 B/H/3 Glucose 4 No: 2 B/H/4 Glucose 0 No: 3 B/I/2 Glucose 0 No: 2 B/I/3 Glucose 0 No: 3 B/I/4 Glucose 0 No: 3 B/J/3 Glucose 0
TABLE-US-00009 Relative Alpha Galactosidase Expression, Plate 23/B, Glycerol Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Plate B/row/column) Source expression (1-5) No: 4 B/A/1 Glycerol 0 No: 4 B/A/2 Glycerol 0 No: 4 B/A/3 Glycerol 0 No: 4 B/A/4 Glycerol 0 No: 4 B/B/1 Glycerol 0 11231 B/B/2 Glycerol 0 11231 B/B/3 Glycerol 0 No: 1 B/B/4 Glycerol 0 No: 1 B/B/5 Glycerol 0 No: 1 B/C/1 Glycerol 0 No: 14 B/C/2 Glycerol 0 No: 14 B/C/3 Glycerol 0 No: 14 B/C/4 Glycerol 0 No: 14 B/C/5 Glycerol 0 No: 14 B/D/1 Glycerol 2 No: 14 B/D/2 Glycerol 1 No: 2 B/D/3 Glycerol 0 No: 2 B/D/4 Glycerol 0 No: 2 B/D/5 Glycerol 0 No: 2 B/E/1 Glycerol 0 No: 2 B/E/2 Glycerol 0 No: 2 B/E/3 Glycerol 0 No: 2 B/E/4 Glycerol 0 No: 2 B/E/5 Glycerol 0 UPP-513 B/F/1 Glycerol 4 UPP-345 B/F/2 Glycerol 4 DAS B/F/3 Glycerol 0 1-0469 B/F/4 Glycerol 3 GAP B/F/5 Glycerol 4 09476 B/G/1 Glycerol 2 UPP 222 B/G/2 Glycerol 3 No: 13 B/G/3 Glycerol 4 No: 13 B/G/4 Glycerol 4 No: 2 B/H/1 Glycerol 0 No: 2 B/H/2 Glycerol 0 No: 13 B/H/3 Glycerol 4 No: 2 B/H/4 Glycerol 0 No: 3 B/I/2 Glycerol 0 No: 2 B/I/3 Glycerol 0 No: 3 B/I/4 Glycerol 0 No: 3 B/J/3 Glycerol 0
TABLE-US-00010 Relative Alpha Galactosidase Expression, plate 23-B, Methanol Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Plate/row/column) Source expression (1-5) No: 4 B/A/1 Methanol 4 No: 4 B/A/2 Methanol 4 No: 4 B/A/3 Methanol 4 No: 4 B/A/4 Methanol 4 No: 4 B/B/1 Methanol 4 11231 B/B/2 Methanol 2 11231 B/B/3 Methanol 3 No: 1 B/B/4 Methanol 4 No: 1 B/B/5 Methanol 5 No: 1 B/C/1 Methanol 4 No: 14 B/C/2 Methanol 3 No: 14 B/C/3 Methanol 2 No: 14 B/C/4 Methanol 1 No: 14 B/C/5 Methanol 0 No: 14 B/D/1 Methanol 2 No: 14 B/D/2 Methanol 1 No: 2 B/D/3 Methanol 3 No: 2 B/D/4 Methanol 3 No: 2 B/D/5 Methanol 3 No: 2 B/E/1 Methanol 4 No: 2 B/E/2 Methanol 2 No: 2 B/E/3 Methanol 3 No: 2 B/E/4 Methanol 3 No: 2 B/E/5 Methanol 3 UPP-513 B/F/1 Methanol 5 UPP-345 B/F/2 Methanol 5 DAS B/F/3 Methanol 3 1-0469 B/F/4 Methanol 3 GAP B/F/5 Methanol 3 09476 B/G/1 Methanol 2 UPP 222 B/G/2 Methanol 4 No: 13 B/G/3 Methanol 4 No: 13 B/G/4 Methanol 4 No: 2 B/H/1 Methanol 2 No: 2 B/H/2 Methanol 1 No: 13 B/H/3 Methanol 4 No: 2 B/H/4 Methanol 1 No: 3 B/I/2 Methanol 3 No: 2 B/I/3 Methanol 2 No: 3 B/I/4 Methanol 3 No: 3 B/J/3 Methanol 3
TABLE-US-00011 Relative Alpha Galactosidase Expression, Plate 23-B, Ethanol Promoter FIG. 18 Carbon Relative A-gal (seq ID/name) (Plate B/row/column) Source expression (1-5) No: 4 B/A/1 Ethanol 0 No: 4 B/A/2 Ethanol 0 No: 4 B/A/3 Ethanol 0 No: 4 B/A/4 Ethanol 0 No: 4 B/B/1 Ethanol 0 11231 B/B/2 Ethanol 0 11231 B/B/3 Ethanol 0 No: 1 B/B/4 Ethanol 0 No: 1 B/B/5 Ethanol 0 No: 1 B/C/1 Ethanol 0 No: 14 B/C/2 Ethanol 0 No: 14 B/C/3 Ethanol 0 No: 14 B/C/4 Ethanol 0 No: 14 B/C/5 Ethanol 0 No: 14 B/D/1 Ethanol 1 No: 14 B/D/2 Ethanol 0 No: 2 B/D/3 Ethanol 0 No: 2 B/D/4 Ethanol 0 No: 2 B/D/5 Ethanol 0 No: 2 B/E/1 Ethanol 0 No: 2 B/E/2 Ethanol 0 No: 2 B/E/3 Ethanol 0 No: 2 B/E/4 Ethanol 0 No: 2 B/E/5 Ethanol 0 UPP-513 B/F/1 Ethanol 4 UPP-345 B/F/2 Ethanol 4 DAS B/F/3 Ethanol 0 1-0469 B/F/4 Ethanol 3 GAP B/F/5 Ethanol 4 09476 B/G/1 Ethanol 2 UPP 222 B/G/2 Ethanol 3 No: 13 B/G/3 Ethanol 4 No: 13 B/G/4 Ethanol 4 No: 2 B/H/1 Ethanol 0 No: 2 B/H/2 Ethanol 0 No: 13 B/H/3 Ethanol 4 No: 2 B/H/4 Ethanol 0 No: 3 B/I/2 Ethanol 0 No: 2 B/I/3 Ethanol 0 No: 3 B/I/4 Ethanol 0 No: 3 B/J/3 Ethanol 0