METHOD OF DIAGNOSIS, PROGNOSIS OR TREATMENT OF NEURODEGENERATIVE DISEASES
20210018518 ยท 2021-01-21
Inventors
- Dulce PAPY-GARCIA (CHILY MAZARIN, FR)
- Minh Bao HUYNH (VITRY SUR SEINE, FR)
- Nadia SOUSSI-YANICOSTAS (PARIS, FR)
- Rita VOZARI (PARIS, FR)
- Fernando SINERIZ (Montigny Les Bretonneux, FR)
- Constantin YANICOSTAS (PARIS, FR)
Cpc classification
A61K31/713
HUMAN NECESSITIES
C12Y208/02029
CHEMISTRY; METALLURGY
G01N2333/47
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
A61K31/737
HUMAN NECESSITIES
G01N33/5308
PHYSICS
G01N2800/52
PHYSICS
C12Y208/02023
CHEMISTRY; METALLURGY
A61P25/28
HUMAN NECESSITIES
International classification
A61K31/713
HUMAN NECESSITIES
A61K31/737
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
Methods for the diagnosis and prognosis of neurodegenerative diseases, such as a Tauopathy or Alzheimer's disease, are described. Compositions and methods for the treatment of neurodegenerative diseases are also described.
Claims
1. A method of treating a neurodegenerative disease, advantageously a Tauopathy, in particular Alzheimer's disease, comprising administering to a subject in need an effective amount of a composition comprising at least one agent which directly or indirectly affects an activity and/or a level of: a) at least one gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 and coding for an heparin-glucosamine 3-O-sulfotransferase, and/or b) at least one transcription product of a gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 and coding for an heparin-glucosamine 3-O-sulfotransferase, and/or c) at least one translation product of said at least one gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 , said translation product being of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, and/or d) a fragment or derivative or variant of said gene, transcription product or translation product, and/or e) heparan sulfate, in particular the level of 3-O-sulfated heparan sulfate, notably the level of 3-O-sulfated heparan sulfate disaccharide, and/or f) abnormal phosphorylation of the Tau protein and/or total Tau protein, wherein said neurodegenerative disease is different from a prion disease, and wherein when said agent directly or indirectly affects the activity and/or the level: of heparan sulfate, or of abnormal phosphorylation of the Tau protein and/or total Tau protein, both activities and/or levels of heparan sulfate and of abnormal phosphorylation of the Tau protein and/or total Tau protein are affected by said agent, or of at least one other element chosen among said gene, said transcription product of said genes, said translation product of said genes, or said fragment or derivative or variant of said gene or said transcription product or translation product is also affected.
2. The method according to claim 1 wherein said at least one agent is selected from the group consisting of: a) a polysaccharide or an oligosaccharide having a molecular weight from about 2000 Daltons to about 20000 Daltons, preferably of about 20000 Daltons, and/or low molecular weight heparins, and/or ultralow molecular weight heparins and/or b) an oligonucleotide and/or c) a small molecule, inhibitor of heparin and heparan sulfate actions.
3. The method according to claim 2, wherein said polysaccharide or oligosaccharide is a heparan sulfate mimetic or a pentasaccharide.
4. The method according to claim 3, wherein said heparan sulfate mimetic is selected from F6 molecule, CR36, HIM 100, and HIM 2602.
5. The method according to claim 3, wherein said pentasaccharide is selected from Arixtra (fondaparinux), fucoidan, and pentosan polysulfate.
6. The method according to claim 2, wherein said low molecular weight heparin is enoxaparin (Lovenox).
7. The method according to any one of claims 2 to 5, wherein said agent is a polysaccharide or an oligosaccharide having a molecular weight of about 20000 Daltons, and wherein said agent is administered by intravenous route at a dose comprised from about 1.5 mg/Kg to about 50 mg/Kg or by oral route at dose from about 50 mg/kg to about 500 mg/kg.
8. The method according to claim 7, wherein said polysaccharide or oligosaccharide having a molecular weight of about 20000 Daltons is administered at a dose comprised from about 100 to 200 mg/kg by oral route.
9. The method according to claim 2, wherein said oligonucleotide is a siRNA or a morpholino antisense oligonucleotide.
10. The method according to claim 9, wherein said siRNA is selected from the list consisting of: sense siRNA of SEQ ID NO: 71 and antisense siRNA of SEQ ID NO: 72, sense siRNA of SEQ ID NO: 73 and antisense siRNA of SEQ ID NO: 74, sense siRNA of SEQ ID NO: 75 and antisense siRNA of SEQ ID NO: 76, sense siRNA of SEQ ID NO: 77 and antisense siRNA of SEQ ID NO: 78.
11. The method according to claim 9, wherein said morpholino antisense oligonucleotide is of SEQ ID NO: 5 or SEQ ID NO: 6.
12. The method according to any one of claims 9 to 11, wherein said agent is an oligonucleotide and wherein it is administered by intravenous route at a dose comprised from 0.1 to 1 mM.
13. The method according to claim 2, wherein said small molecule is an inhibitor of heparin and heparan sulfate actions.
14. The method according to claim 13, wherein said inhibitor is selected from protamine and protamine sulfate.
15. The method according to claim 14, wherein said agent is a small molecule and wherein it is administered by intravenous route at a dose comprised from 1.0 mg/Kg to about 50mg/Kg by intravenous route, or by oral route at a dose comprised from about 50 mg/kg to about 500 mg/kg.
16. The method according to claim 2, wherein said agent is an oligonucleotide and wherein said level of at least one transcription product being decreased is equal to about at least 50% of the original value.
17. The method according to claim 2, wherein said agent is an oligonucleotide of SEQ ID NO: 5 and wherein said at least one gene is of SEQ ID NO: 1.
18. The method according to claim 2, wherein said agent is an oligonucleotide of SEQ ID NO: 6 and wherein said at least one gene of SEQ ID NO: 3.
19. The method of treating according to claim 2, wherein said agent is an oligonucleotide and wherein said at least one gene consists of the two genes of SEQ ID NO: 1 and SEQ ID NO: 3, said oligonucleotide for the gene of SEQ ID NO: 1 being of SEQ ID NO: 5 and said oligonucleotide for the gene of SEQ ID NO: 3 being of SEQ ID NO: 6.
20. The method according to claim 2, wherein said agent is an oligonucleotide and wherein it is administered by intravenous route at a dose comprised from 0.1 to 1 mM.
21. The method according to claim 20, wherein said agent is administered by intravenous route at a dose of 0.5 mM.
22. The method according to claim 2, wherein said polysaccharide affects directly or indirectly said activity and/or level of the translation product of the gene of SEQ ID NO: 2.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0862]
[0863]
[0864]
[0865]
[0866]
TABLE-US-00001 TABLE 1 Characteristics of the subjects providing brains tissues. CERAD/ Immediate Senile Braak Age PMD.sup.a cause of plaques.sup.c/ and Sex (years) (h) Group death.sup.b mm.sup.2 Braak.sup.d M 62 20.2 Control Myocardial 32 I infarctation M 65 8.2 Control Hemotorax 47 0 trauma M 65 8.6 Control Guns shot 51 I F 73 15.3 Control Broncho- 65 II pneumonia M 61 9.3 Control Pulmonar 36 0 trombosis F 64 14.3 Control Liver 41 I traumatic rupture M 60 21.0 Control Broncho- 44 0 pneumonia F 76 24.0 Control Myocardio 65 I infarctation Mean 67.8 15.1 SD 02.9 2.2 M 84 19.0 AD Broncho- 78 IV pneumonia F 70 10.3 AD Broncho- 65 III pneumonia F 98 14.2 AD Broncho- 87 III pneumonia M 84 14.0 AD Aortic 84 IV rupture F 82 9.2 AD Traumatic 87 III torax F 75 19.2 AD Pulmonar 80 IV trombosis F 69 5.4 AD Myocardial 76 IV infarctation M 82 21.2 AD Myocardial 80 III infarctation Mean 76.8 14.1 SD 3.5 2.0 .sup.aPMD: post mortem delay. No significant PMD statistical difference (p = 0.7249) was found between the two groups. .sup.bSubjects died from guns shot diagnosis do not have traumatic brain lesions. .sup.cSenile plaques and NFT values represent an arithmetic mean (Mean SEM) calculated from the counts of six fields for each observed region. .sup.dCERAD score (A, B, or C)/Braak and Braak stage (I to VI).
[0867]
[0870]
[0871] Cryosections from Alzheimer's disease (AD) and aged matched human hippocampus were incubated with anti-HS (10E4) (
[0872] Sections were labelled with DAPI (
[0873]
[0874]
[0875]
[0876] X-axis: % Tau protein binding to total sulfated GAGs.
[0877] Y-axis: Control (white histogram), AD (black histogram).
[0878]
[0879]
[0880]
[0881] x-axis: time (h)
[0882] y-axis: pmol P Tau/mol Tau
Black triangles: heparin, black circles: GAGs-AD, white circles: GAGs-CT, white triangles: control.
[0883]
[0884] x-axis: time (h)
[0885] y-axis: pmol P Tau/mol Tau
Black triangles: heparin, black diamonds: Arixtra (3Sulfated), white diamonds: Hexa-Heparine (non 3 Sulfated), white triangles: control.
[0886]
[0887]
[0888] x-axis: Tau epitope: from left to right by the anti tau199, the anti tau 231, the anti tau 262 or the anti tau396 phosphorylated epitope
[0889] y-axis: pTau/ actine
[0890]
[0891]
[0892] x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope
[0893] y-axis: pTau/total-Tau
[0894]
[0895] x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope
[0896] y-axis: pTau/total-Tau
[0897]
[0898] x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope
[0899] y-axis: pTau/total-Tau
[0900]
[0901]
[0902]
[0903] The Driver construct contains the neuronal zebrafish promoter HuC driving the expression of Ga14-VP16, which binds to the UAS on the responder construct. It activates the bidirectional expression of hTAU-P301L and rhodamine (DsRed) via the minimal promoters. UAS-dependent gene expression of Tau and DsRed is indicated in living fish by DsRed fluorescence. Driver and Responder constructs are flanked by Tol2 transposon sites (
[0904]
[0905]
[0906]
[0907] X-axis: Phosphorylated Tau by total protein.
[0908] Y-axis: Left histogram: Wild type protein, right histogram: mutated Tau.
[0909]
[0910] Relative quantities of 3-OST-2 and 3-OST-4 were detected by realtime PCR in the transgenic hTAU-P301L fishes (indicated with DsRed) versus WT. Enzyme expression given by WT was considered as 100%.
[0911] X-axis: percentage of relative quantity
[0912] Y-axis: from left to right:
[0913] White and black histograms of the left side (3-OST-2): White: WT; black: DsRed
[0914] White and black histograms of the right side (3-OST-4): White: WT; black: DsRed
[0915]
[0916]
[0917] X-axis: percent of injected
[0918] Y-axis: left histogram: fatality, right histogram: survival
[0919]
[0920] X-axis: Phosphorylated Tau by g/ml of total protein.Y-axis: MO 3-OST-2
[0921]
[0922]
[0923]
[0924]
[0925]
[0926]
[0927]
[0928]
[0929]
[0930] pTau231 staining is lower and arrows show that axonal abnormalities could had been reversed in 3OST-2 splice morphants compared to DsRed/hTauP301L (10X, scale bar=50 mm).
[0931]
[0932]
[0933]
[0934] P-Tau231 staining is lower and axonal abnormalities are apparently in 3OST-2 splice morphants compared to DsRed/hTauP301L (20X, scale bar=20mm in the first row, 50mm in the second row)
[0935]
[0936]
[0937]
[0938] Histograms from left to right: Control, model (SAMP8), huperzine A, F6: IP 50 mg/kg, F6: IP 25 mg/kg, F6: p.o. 200 mg/kg, F6: p.o. 100 mg/kg.
[0939] F6 increased spatial retention in Morris water maze after 2 months treatment (7 month aged)
[0940]
[0941] upper WB: Tau199 and lower WB: GADPH
[0942] From left to right: Control, Model (SAMP8), Huperzine (anti Alzheimer control), treated SAMP with F6 25 mg/kg ip, treated SAMP with F6 50 mg/kg ip, treated SAMP with F6 100 mg/kg p.o., treated SAMP with F6 200 mg/kg p.o. for 2 months (from 5 month old to seven months old, twice a week).
[0943] The arrow in the model indicates an increase of hyperphosphorylated protein Tau compared with the control.
[0944] The arrow in the F6 treated (50 mg/kg) indicates a decrease of hyperphosphorylated protein Tau compared with the model.
[0945]
[0946]
[0947]
[0948]
[0949] Treated animals present a significant increase of memory.
[0950]
[0951] x-axis: from left to right: heparin, chondroitin sulfate A (CSA), chondroitin sulfate C (CSC), HS, fucoidan, F6.
[0952] y-axis: percentage of binding of test compound to hTau
[0953] Fucoidan and F6 are able to compete with heparin for the binding to human Tau protein.
[0954]
[0955] x-axis: time (min)
[0956] y-axis: percentage of transmembrane passage
[0957] Square: HM-oligosaccharide F6
[0958] Triangle (up): HM-oligosaccharide CR36
[0959] Diamond: HM2602
[0960] Triangle (down): oligo-dextrane
[0961]
[0962] All patients have been diagnosed with AD by clinical and biochemical evaluations with increased degree of AD (+, ++, +++). Said presented degree of AD (+, ++, +++) was assumed by pTau231 levels in CSF measured by densitometry analysis of the WB.
[0963] 3 samples were analyzed each time.
[0964] x-axis: from left to right : AD+, AD++and AD+++. [0965] For each AD degree, from left to right histograms: pTau231, HS3ST2, HS.
[0966] left y-axis: optical density/protein concentration (arbitrary units)
[0967] right y-axis: total HS amount (g/mL)
[0968] This figure shows that the concentration of OST-2, HS and phosphorylated Tau are between is significantly increased with the degree of AD (from AD+to AD+++).
[0969]
[0970] Total Tau used in the ELISA assay was commercially available.
[0971] These results show that the CSF containing the highest amount of pTau contains also the HS with the highest capacity to inhibit Tau binding to the immobilized heparin.
[0972] Each CSF sample was assayed 3 times in the binding test.
[0973] This indicates a correlation between the tauopathie and the capacity of CSF HS to bind Total Tau.
[0974]
[0975]
[0976]
[0979]
[0980]
[0981]
[0982]
[0983] Cells were fixed and labeled A) Stressed cells untreated by the drug. B) Stressed cells treated with F6 (10 g/mL). C) Tau aggregates were counted in 10 different fields and in 3 different cultures for each condition.
[0984]
[0985]
[0986]
[0987] x-Axis: from left to right: non stressed, stressed, stressed+F6 (0.1 g/mL), and stressed+F6 (10 g/mL).
[0988] y-axis: Number of fluorescent Tau aggregates per field.
[0989] F6 molecule markedly decreases the number of fluorescent Tau aggregates.
[0990]
[0991]
[0992] x-axis: from left to right: control without A, control with A, A+F6 (1 g/mL), A+F6 (10 g/mL);
[0993] y-axis: % of viable cells as determined by a MTT test
[0994] A p value <0.05 was considered to be statistically significant
[0995] Note that *0.05, **0.01 and ***0.001.
[0996]
[0997] x-axis: from left to right: control without A, control with A, A+E5 (10 g/mL); A+F6 (10 g/mL); A+D6 (10 g/mL);
[0998] y-axis: % of viable cells as determined by a MTT test
[0999] Columns are compared to control+A: p value0.05 was considered to be statistically significant
[1000] Note that *0.05, **0.01 and ***0.001.
[1001]
[1002] Heparan sulfate mimetics decrease phosphorylated Tau.
[1003]
[1004]
[1005]
[1006]
[1007] x-axis: from left to right: control, A12h, A62 24h, dextran, D4, D6, E5, F6.
[1008] y-axis: pTau 396/-actine (% of control)
[1009] Statistics are done with the average signal from two WB
[1010] Heparan sulfate mimetics decrease phosphorylated Tau.
[1011]
[1012] Heparan sulfate mimetics such as D4, E5 and F6 decrease phosphorylated Tau.
EXAMPLES
Example 1. Brain Tissue Dissection From Control and AD Human Brain Tissue
[1013] Post-mortem human brain sampling was performed according to the Consortium to Establish a Registry of AD (CERAD). Two experimental groups were included in the study, an aged group (n=8, control group) with subject ages ranging from 60 to 77 years with a mean of 67.82.9 years, and an AD group (n=8) with subjects ages ranging from 69 to 82 years with a mean of 76.83.5 years. Subjects included in the study received post-mortem evaluation by a board-certified neuropathologist. Post-mortem intervals varied from 8.0 h to 15.2 h for both groups. No significant statistical difference (p=0.1781) was found for post-mortem delay between the two groups. Brains were obtained at autopsy and halved sagitally within 2 h after autopsy. One hemisphere was cut into 2-cm-thick slabs along the frontal plane from which the hippocampus (temporal lobe), cortex, and cerebellum were dissected. Tissues were immediately frozen after dissection in dry ice. Tissue samples were stored at 80 C. until use.
Example 2. Senile Plaques and Neurofibrillary Tangles (NFT) Quantification in Control and AD Human Brain Tissue
[1014] Neuropathologic changes in brains were investigated using Consortium to Establish a Registry for Alzheimer's Disease (CERAD) and Braak and Braak guidelines. Senile plaques and NFT were determined on Bielschowskystained sections of middle frontal gyrus, middle temporal gyrus, inferior parietal lobule, occipital pole, hippocampal CA1 and enthorinal cortex. Senile plaques were counted using a 10 objective and NFT were counted with a 20 objective. An arithmetic mean was calculated (MeanSEM) from the counts of six fields for senile plaques/mm.sup.2 and NFT/mm.sup.2 for each region. Neuropathologic diagnosis was then made using the guidelines proposed by CERAD and Braak and Braak criteria. AD brains were characterized to be at stage III-V from hippocampal analysis. Control brains were determined to be non AD.
Example 3. Immunohistochemical HS and Tau Co-Localization on Human Hippocampus
[1015] Sections (20 m) of human hippocampus from Alzheimer and age-matched control were fixed with 3% acetic acid for 10 min at room temperature (rt). Sections were then incubated for 30 min with 3% BSA dissolved in phosphate-buffered saline (PBS) and permeabilized with 0.2% Triton X100 in PBS for 30 min. HS were stained with an anti-heparan sulfate (10E4 epitope, Seikagaku corp. by AMS Biotechnology) and anti-Tau phosphoSerine 262 (Millipore); dissolved in permeabilization buffer (1:200) and incubated for 1 h 30 min at rt. Fluorescence was introduced by staining tissue slides with a secondary antibody conjugated to an Alexa 568 fluoroprobe (Molecular Probes) and Alexa 488 fluoroprobe (Interchim). Then, sections were DAPI labelled for 3 min with a 1 g/mL DAPI solution and rinsed with methanol. Images were first obtained using a CCD monochrome camera (CFW-1310M, Scion Corporation, USA) fitted to a BH-2 epi-fluorescence optical microscope (Olympus). Image acquisition was obtained from the Scion VisiCapture 2.0 software. Image processing was done using ImageJ software (W. Rasband, National Institute of Mental Health, Md., USA). DAPI labelling of nuclei was quantified as the previously described (Blondet et al., 2006).
Example 4. Expression of 3-OST Enzymes in Alzheimer's Disease Hippocampus
[1016] Here, it has been investigated if the expression 3-OST enzymes involved in HS biosynthesis were altered in Alzheimer's disease compared to control hippocampus samples (Table 2). Results show a particular over-expression of the 3-OST-2 and 3-OST-4 in the Alzheimer's disease hippocampus. This may suggest the enhanced of 3-O-sulaftion in the HS chains of Alzheimer's disease brains and enhanced expression of 3-OST-2 transcripts can be thought characteristic of the disease. As control experiments, expected expression of glutamine synthetase (GS) and of glyceraldehyde-3-phosphate deshydrogenase (GAPDH), known to be enhanced in Alzheimer's disease brains (Burbaeva et al., 2005), were confirmed, as well the unchanged expression of the chemokine receptor 4 reported to keep stable in Alzheimer's disease compared to age-matched individuals (Cartier et al., 2005). Our results agreeing these expected increases of genes expressions (Table 2) indicate that, as shown by the RIN number, the quality of the biological material was consistent for these studies.
TABLE-US-00002 TABLE 2 Expression of human 3-OST enzymes by real time PCR Relative Relative quantity Expression quantity Alzheimer's Alzheimer's Target Enzymes control (g/mL) disease (g/mL) disease vs Heparan 3-OST-1 0.75 0.09 0.96 0.20 NS sulfate 3-OST-2 0.37 0.07 2.06 0.46 ** 3-OST-3a 0.35 0.08 2.17 0.86 * 3-OST-3b 0.58 0.21 1.76 0.43 * 3-OST-4 1.33 0.12 5.04 0.31 *** 3-OST-5 0.10 0.01 0.08 0.02 NS 3-OST-6 ND NS: no significant change in enzyme expression ND: the enzyme was not detected
[1017] RNA Extraction and RTqPCR from Control and AD Human Brain Tissue:
[1018] Total RNA was extracted from human hippocampus. For quantitative PCR (qPCR), primers (Eurofins, Germany) were designed by Primer3output. qPCR was performed from template cDNA according to the LightCycler FastSart DNA Master SYBR Green kit manufacturer's instructions (Roche, Germany). qPCR conditions were depended on primer set (Table 3). Samples were simultaneously amplified in single runs. Relative quantification of gene expression was performed using the comparative CT method, also referred to as the AACT method (Schefe et al., 2006). Two reference genes (-tubulin and TFIID) were used as endogenous controls. Normalization of these genes was accomplished with the Genorm program (Vandesompele et al., 2002).
TABLE-US-00003 TABLE3 OligonucleotidesforrealtimeqPCRinhumanhippocampus Oligonucleotide Oligonucleotide Genename Accessionnumber sequences(sense) sequences(anti-sense) NDST-1 NM_001543 GGAAGTGTGTCCGTGGTTC CCCTGGTAACTGTGCTCCAT (SEQIDNO:11) (SEQIDNO:12) NDST-2 NM_003635.3 CTCCAGTTGTGGAAGGTGGT CTTAGGGCTGGTGGACACAT (SEQIDNO:13) (SEQIDNO:14) NDST-3 NM_004784 CGACCTCCAACACCTACCAT TAGGACTGTGGGGTCTGTCC (SEQIDNO:15) (SEQIDNO:16) NDST-4 NM_022569 GCAACGGTGATTCAGGATCT TGTGCAGCCAAAAGTTCAAG (SEQIDNO:17) (SEQIDNO:18) GLCE NM_015554 GGAAGTGTGTCCGTGGTTCT CCCTGGTAACTGTGCTCCAT (SEQIDNO:19) (SEQIDNO:20) HS2STVar1 NM_012262 CGAAGTCCGAGAAATTGAGC AATGAAGTGCTTGCCGTTTT (SEQIDNO:21) (SEQIDNO:22) HS2STVar2 NM_001134492 CGAAGTCCGAGAAATTGAGC AATGAAGTGCTTGCCGTTTT (SEQIDNO:23) (SEQIDNO:24) HS6ST1 NM_004807 GGCCCTTCATGCAGTACAAT TACAGCTGCATGTCCAGGTC (SEQIDNO:25) (SEQIDNO:26) HS6ST2VarL NM_001077188 CGGGGTTCTCCAAACACTAA GTCTCGGAGGATGGTGATGT (SEQIDNO:27) (SEQIDNO:28) HS6ST2VarS NM_147175 AGGCTCCTTCAGACCCATTT TCGGATTTGGGTTCTGACTC (SEQIDNO:29) (SEQIDNO:30) HS6ST3 NM_153456 CATCTCCCCCTTCACACAGT CTCGTAAAGCTGCATGTCCA (SEQIDNO:31) (SEQIDNO:32) HS3ST1 NM_005114 ACCACATGCAGAAGCACAAG TTGAGGGCCTTGTAGTCCAC (SEQIDNO:33) (SEQIDNO:34) HS3ST2 NM_006043 GGAACCCCACTTCTTTGACA GTCGAGGAGCCTCTTGAGTG (SEQIDNO:7) (SEQIDNO:8) HS3ST3A1 NM_006042 ACGCCCAGTTACTTCGTCAC GAACGTCAAGCTCTCGAAGG (SEQIDNO:35) (SEQIDNO:36) HS3ST3B1 NM_006041 ACGCCCAGTTACTTCGTCAC TCTGCGTGTAGTCCGAGATG (SEQIDNO:37) (SEQIDNO:38) HS3ST4 NM_006040 AAGAGCAAAGGTCGGACTCA ACCCTCTTCCTGTTCCCACT (SEQIDNO:9) (SEQIDNO:10) HS3ST5 NM_153612.3 GCTAGAGGGGAAGGAGAGGA CCATCGACGACATGAAATTG (SEQIDNO:39) (SEQIDNO:40) HS3ST6 NM_001009606.2 CTGTCCCACTTCCTGTTCGT CCTTGGTGGCGTTGAAGTAG (SEQIDNO:41) (SEQIDNO:42) TUBA1A NM_006009.2 GCAACAACCTCTCCTCTTCG GAATCATCTCCTCCCCCAAT (SEQIDNO:43) (SEQIDNO:44) TBP(TFIID) NM_003194.4 TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA (SEQIDNO:45) (SEQIDNO:46)
Example 5. AD Patients for Cerebrospinal Fluid
[1019] Cerebrospinal fluid (CSF) samples were obtained by lumbar puncture from patients with clinical features of AD. Patients and samples were previously described by Sarazin et al. (Habert et al. Brain perfusion SPECT correlates with CSF biomarkers in Alzheimer's disease. Eur J Nucl Med Mol Imaging 2010; 37:589-593). Patients with AD fulfilled the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDSADRDA) criteria for probable AD. All subjects underwent the same clinical, biochemical (CSF biomarker measurements), and neuroimaging procedures. All patients had a routine MRI exploration, including fluid-attenuated inversion recovery (FLAIR), T1- and T2-weighted sequences. They did not show clinical or neuroimaging evidence of focal lesions and no cortical or subcortical vascular lesions. AD patients could display various degrees of cortical and/or subcortical atrophy. They had no medical conditions that would interfere with cognitive performance and no severe depression. All patients were treated with acetylcholine esterase inhibitors from the time of diagnosis. They were living in the community.
[1020] CSF Examination
[1021] CSF samples obtained by lumbar puncture were centrifuged for 10 min at 1,500 rpm at 4 C. to remove cells, aliquotted into 0.4-ml polypropylene tubes and stored at 80 C. until analysis.
[1022] Preparation of Tissue and CSF Protein Extracts for Phosphor-Tau and HS3ST-2 by Western Blotting
[1023] Frozen brain tissues were homogenized under liquid nitrogen vapors and the suspended in a Laemmli buffer 4 (1:100 -mercaptoethanol added previously). The mixture was boiled for 5 min and sonicated 5 min. Tubes were then centrifuged 10 min (1,500 rpm at 4 C.). Protein concentrations in tissue homogenates and CSF samples were calculated by using Pierce BCA Protein Assay kit, following manufacturer's instructionsand equal amounts of samples were electrophoresed on 10% gels (Invitrogen Corp). After transfer, membranes were blocked with blocking buffer (3% milk in PBS, 0.02% Tween-20) for 40 min and probed with an goat anti-HS3ST2 (T-15, Santa Cruz) 2 hours at room temperature). Membranes were rinsed once in PBST and then washed 3 times for 5 min in same buffer. Secondary antibody was diluted in PBST and incubated 45 min at RT (rabbit anti-goat, Jackson Immuno Research). Membranes were rinsed with PBST and washed 3 times for 5 min in the same buffer. Blots were developed with Immobilon Western Chemiluminiscent HRP Substrate (Millipore) following manufacturer's instructions.
[1024] After, the membrane was washed in TBS 1 and then incubated for 2 hours at room temperature with anti-pTau Thr231 (rabbit polyclonal, Millipore, ref 9668, lot NG1863963) diluted in 1% BSA in TBS, 0.1% Tween-20 (TBST). Membranes were washed 3 times in TBST for 5 minutes and then incubated with the secondary antibody (donkey anti-rabbit Jackson ImmunoResearch). Blots were developed with the same reagent.
[1025] Glycosaminoglycans (Heparan Sulfates and Chondroitin Sulfate) Extraction and Quantification from Brain and CSF
[1026] GAGS were extracted from brain tissue and CSF as follows: Frozen brain tissue samples were reduced to powder, homogenized and suspended in an extraction buffer (50 mM Tris, pH 7.9, 10 mM NaCl, 3 mM MgCl.sub.2 and 1% of Triton X-100) to final 25 mg of tissue per mL of buffer. CSF or brain homogenates were treated by proteinase K (PK) (Merck) (final 50 g/mL of sample) at 56 C. overnight followed by 30 min at 90 C. to inactivate the enzyme. After cooling to room temperature (rt), DNase I (Qiagen) was added (7.5 mU/mL of sample) and samples were incubated overnight at 37 C. Samples were then diluted 1:1 with 4 M NaCl, centrifuged (13000 g, 20 min) and pellet was discarded. Lipids were eliminated by 1:1 chloroform extraction and total sulfated GAGs were quantified according to the 1-9 dimethyl-methylene blue (DMMB) assay as described (Huynh et al Neurobiol Aging. 2011). Chondroitinase ABC (ChABC) (Sigma-Aldrich) or nitrous acid treatments were used to selectively quantify HS or CS in total GAG samples (Huynh et al 2011). A calibration curve constructed with known amounts of CS standard was included in each assay. The extraction and quantification method was validated in GAGS spiked rodent brain samples as previously described (Huynh et al, Neurobiol Aging. 2011).
[1027] GAGs Isolation (Heparan Sulfates and Chondroitin Sulfate) Extraction and Quantification from Brain and CSF
[1028] GAGS were isolated as follows: PK/DNAse digested samples were reached to 4 M NaCl final sample concentration and vigorously agitated during 10 min. Proteins were precipitated with TCA treatment (10% final concentration) and supernatants were then cleared by chloroform washing followed by rapid dialysis of the aqueous phase (Slide-A-Lyzer Mini Dialysis Units 3,500 MWCO, Pierce) against the extraction buffer and then pure water. After freeze drying, material was dissolved in water or in a glycanases digestion buffer (10 mM sodium acetate, 2 mM CaCl.sub.2, pH 7), as required. GAGs were then quantified by following the DMMB protocol. Identities and specific recovery of extracted HS or CS were performed by specific digestion with chondroitinase ABC (ChABC) for HS recovery, or by heparinases I/II/III or by nitrous acid treatment for CS recovery as previously described (Huynh et at, Neurobiol Aging. 2011).
[1029] Brain and CSF HS Disaccharide Analysis by LC/MS
[1030] Extracted and freeze dried GAGs samples from brain and CSF dissolved in the glycanases digestion buffer (10 mM sodium acetate, 2 mM CaCl.sub.2, pH 7) were simultaneously digested with heparinase I, II, and III cocktail (0.25 mU each, 24 h, 37 C.). After filtration, samples were filtered and injected to LC/MS system composed of a LTQ/orbitrap coupled to a capillary liquid chromatographic system (LC). The used separation and detection method was that described in Methods Enzymol. 2011 ou par la method de Yang et al (Ultra-performance ion-pairing liquid chromatography with on-line electrospray ion trap mass spectrometry for heparin disaccharide analysis. Analytical Biochemistry 415 (2011) 59-66).
Example 6. GAGs from Alzheimer's Disease have Increased Tau Binding Capacities
[1031] GAGs from Alzheimer's disease and age-matched control hippocampus were tested for their capacities to bind Tau protein by using the ELISA competition binding assay as described below.
[1032] Heparin/glycosaminoglycans competition assay towards human Tau protein: AD and control hippocampus extracted GAGS binding to human Tau protein (R&D systems) was evaluated by an ELISA based competition binding essay (Najjam et al., 1997). ELISA type 96 wells plates were coated with a 2 g/mL BSA-heparin conjugate solution prepared as previously described (Najjam et al., 1997). After washing with PBS/0.05% Tween-20 (washing solution), wells were saturated with 3% BSA in PBS. Then, the assayed protein (in PBS) was added to the plate in a concentration dependent manner in order to determine the protein concentration giving 50% of binding to immobilized heparin (ED.sub.50). From this data, tau protein doses used on the competition assay were fixed at 100 ng/mL. This tau concentration was used to examine changes on the Tau binding extents to immobilized heparin in the presence of soluble competing extracted GAGs (0, 0.01, 0.1, 0.5, 1 10, 100, and 500 ng/mL). Control and AD GAGs, and tau protein were simultaneously added to heparin immobilized wells and plates were incubated 1 h at rt. After washing, the protein remaining bond to the plate was targeted by a corresponding specific antibody (1:1000, 1 h, rt) followed by a peroxidase-labeled secondary antibody (1:5000, 1 h, rt). Peroxidase activity was measured by the tetramethylbenzidine (TMB) detection kit (Pierce). Reference binding (100%) was assigned to signal left when aged group GAGs were used (
Example 7. Phosphorylation of Human Tau by Brain GSK-3 Kinases in the Presence of Control and AD GAGs or 3-O-Sulfated or not HS Oligosaccharides
[1033] Phosphorylation by glycogen synthase kinase 3 (GSK-3). Recombinant hTau41 (Millipore) was incubated for 0 to 24 h with 1 unit/ml of recombinant GSK3 (Millipore) in the presence or absence of 50 mg/ml of heparin, Arixtra, or the heparin hexasaccharide non 3-O-sulfated. Phosphorylation assays (0.050 ml) were carried out at 30 C. and comprised 25 mM Tris-HCl, pH 7.4, 0.1 mM EGTA, 0.1 mM sodium orthovanadate, 2.5 mM PM (a specific inhibitor of cyclic AMP-dependent protein kinase), protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 5 mg/ml aprotinin, 5 mg/ml leupeptin, and 0.5 mg/ml pepstatin), tau protein (4 mM), 10 mM magnesium acetate, 2 mM [g-.sup.32P]ATP (approximately 100 cpm/nmol) 5 units/ml recombinant reconstituted GSK3. Reactions were initiated with ATP and aliquots were removed at various times ranging from 10 min to 24 h and used for SDS-polyacrylamide gel electrophoresis and immunoblotting. Immunoblots were performed as described (Masato Hasegawa et al., J Bio Chem. (1997) 272 (52), pp. 33118-33124). Alternatively, incorporation of .sup.32P radioactivity was measured after adsorption to Whatman P-81 paper, as described. Heparin and extracted GAGS were included in the assays at 50 mg/ml.
Example 8. Suppression of Glycosaminoglycans Sulfation in a Mutational-Dependent (hTauP301L) and in a Mutational Independent (Oxidative Stress) Cell Model of AD with Tau Hyperphosphorylation
[1034] Two cell types were used, (i) a wild type SH-SY5Y cells (mutation-independent model) in where abnormal phosphorylation is induced by oxidative stress and (ii) cells stably transfected with complete human tau protein having the mutation hTAU-P301L (mutation dependent model), characteristic of FTDP-17. As a consequence of the Tau mutation cells present high levels of abnormal phosphorylated Tau.
[1035] For the mutation dependent model cells were cultured as previously described (Schaeffer V et al., J Neurobiol 2006, Jul; 66(8):868-881). For the mutation independent model, human SH-SY5Y neuroblastoma cells were propagated in Dulbeco's modi/ced Eagle's medium (Gibco) with 5% fetal bovine serum and penicillin/streptomycin (5% CO.sub.2 and 95% air). For both models cells were plated at a density of 10.sup.6 cells/cm.sup.2 on 25 cm.sup.2 dish and incubated under standard conditions for 24 h. Then, cells (both models) were treated with 10 M retinoic acid (RA) for 3 days to induce their neural differentiation.
[1036] For the mutation independent models, differentiated cells were then treated with H.sub.2O.sub.2 (500 mM) for 30 min and medium was changed for fresh medium again supplemented with RA. This oxidative treatment induces abnormal tau phosphorylation in cells at Thr231 and Ser396 of Tau. Six hours after the oxidant elimination.
[1037] After 3 days of differentiation, cells from both models were treated with sodium chlorate, an inhibitor of GAGs sulfation, added at final 50 mM concentration in the presence of RA (10 M) to maintain differentiation. Cells were incubated under these conditions for additional 24 h, then, cells were washed, harvested and used for pTau flow cytometry and western blot analysis with anti-tau-pSer199 and anti-tau-pSer396 antibodies (Millipore).
Example 9. Silencing of 3-OST-2 (HS3ST2) in a Mutational-Dependent (hTauP301L) and in a Mutational Independent (Oxidative Stress) Cell Model of AD with Tau Hyperphosphorylation
[1038] Effect of HS3ST2 and HS3ST4 siRNA silencing was tested in the two described cell models of AD but chlorate treatment was replaced by a siRNA set forth by SEQ ID NO 73 for the sense and 74 for the antisense (10, 20, 40 and 80 nM) transfection with lipofectamine. In all cases cells were plated and incubated under standard conditions to 60% of confluence, siRNA silencing was directly performed in hTauP301L cells and before and after H.sub.2O.sub.2 stress for WT cells. Optionally, silenced cells and controls were differentiated with retinoic acid (10 M) for 3 days. Harvested cells were analyzed by flow cytometry using antibodies anti-tau-pSer199 and anti-tau-pSer396 (Millipore) using well known techniques. At least 10000 cells (events) were analyzed by point. HS3ST2 silencing was confirmed by RTqPCR of HS3ST2 transcripts analysis and by western blot for HS3ST2 protein expression.
[1039] Western Blot Analysis.
[1040] After harvesting, cells were and incubated in an ice bath for 5 min in a lysis buffer (50 mM Trus-HCl, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10 mM NaF, pH 8.0) containing 1 mM Na.sub.3VO.sub.4, and 0.1% protease inhibitor cocktail (Sigam). Lysates were centrifuged and proteins in the supernatants were quantified using the BCA protein assay kit (Pierce). Extracts corresponding to 30 g of proteins electrophoretically separated as described for tissue and CSF protein samples. Abnormally phosphorylated tau was detected by using anti-tau-pSerl 99 and anti-tau-pSer396 (Millipore) as described above. For analysis of the HS3ST2, previous immunoprecipitation (milteni kit) of the enzyme was required for improving detection in cultured cells. To evaluate protein loading, membranes were immediately stripped and reprobed for -actine. Results were expressed as a ratio of target protein to actine. Independent experiments were normalized to controls.
Example 10. Analysis of Hyperphosphorylation of Tau Protein in Zebrafish
[1041] In order to study the expression of 3-OSTs on mutated hyperphosphorylated Tau protein levels, we used a zebrafish transgenic line of hTau-P301L that shows the characteristic features of Taupathies including neuronal loss, Tau hyperphosphorylation, aggregation, tangles formation, and behavior alterations (Paquet et al., 2009). Brains of 5 day old hTau-P301L transgenic embryos were first labeled with antibodies against hyperphosphorylated Tau protein to assess whether the sites of hyperphosphorylation, indicative of Taupathies, were present. As expected we observed a hyperphosphorylation of Tau in the hTau-P301L mutated (
[1042] Abnormal phosphorylation is classically expressed as the ratio of abnormal phosphorylated Tau levels compared to total Tau protein levels analyzed in a same sample. In the transgenic zebrafish, the level of abnormal phosphorylated Tau/total Tau protein was determined by the P-Tau and T-Tau ELISA assays, as described below. A 90 fold increase in abnormally hyperphosphorylated Tau protein accumulation by the amount of total Tau protein was observed in transgenic hTAU-P301L compared to WT (
[1043] Transgenic hTAU-P301L embryos with morpholino-mediated knock-down of the 3-OST-2 coding gene with SEQ ID NO: 5 and the non-injected embryos were screened on the intensity of DsRed fluorescent protein at 24 hpf. With morpholino-mediated knock-down of the 3-OST-2 coding gene in the transgenic hTAU-P301L zebrafish model the level of hyperphosphorylation in Tau protein was investigated. First of all, the obtained zebrafish embryos from the crossing between WT line and transgenic zebrafish carrying the P301L mutation in Tau protein were injected with different morpholino concentrations, respectively 0.3 mM, 0.5 mM and 1 mM. The numbers of living embryos were assessed at 24 hours after injection and survival rates were determined. We observed that the morpholino concentration of 0.5 mM did not give major anomalies or deformities and the rate of survival among morphants was optimal (67% survival rate at 24 hours post-injection). Thus, this concentration was chosen for further analyses (
[1044] Transgenic zebrafish: The transgenic line expressing hTAU-P301L was kindly provided by Professor Christian Haas (Paquet et al., 2009). The animals were raised as described. Brefly, Mosaic DsRed-positive larvae were raised and out-crossed with wild-type fish. Zebrafish were maintained at 28 C. under standard conditions as described by Westerfield (1995). Developmental stages were determined as hours of post fertilization (hpf) as described by Kimmel et al. (1995). All experiments were performed in accordance with ethical policies for the care and use of laboratory vertebrate animals (Direction dpartementale des services veterinaries de Paris).
[1045] Total RNA Extraction from Zebrafish and qPCR
[1046] Total RNA was extracted from a pool of 100 dissected embryos of both WT and DsRed-positive zebrafish samples. The RNA extraction was accomplished by using the RNAeasy minikit (50). To determine the HS3ST2 expressions at the mRNA level, cDNA was synthesized from the isolated RNA by a reverse transcriptase reaction. Briefly, total extracted RNA (1 g) was incubated with random primers (30 g/mL) in a mixture of 5 mM dNTP's and RNase inhibitor (Invitrogen) for 5 min at 65 C. Followed by an incubation with respectively 5 first strand buffer, 1 mM DTT and RNase inhibitor Superscript II Rnase H-Reverse Transcriptase (Invitrogen) at 42 C. for 52 min and 15 at 70 C. A mixture with except the transcriptase was served as a negative control. For qPCR, primers were designed by Primer3output and obtained by Eurofins (Gemany) (Table 4). For qPCR, amplifications were performed on the LightCycler (Software version 3.5; Roche Switserland) with FastSart DNA Master SYBR Green I (Roche, Switzerland) used following the standard operating procedures provided by manufacturer. All samples were amplified simultaneously in one assay run. Relative quantification was performed as described above (Vandesompele et al., 2002, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:RESEARCH0034).
TABLE-US-00004 TABLE4 Humanandzebrafish(Daniorerio)3-OSTprimers Accession Oligonucleotide Oligonucleotide Enzymes number sequencessense sequencesanti-sense Human 3-OST-1 NM_005114 ACCACATGCAGAAGCACAAG TTGAGGGCCTTGTAGTCCAC (SEQIDNO:33) (SEQIDNO:34) 3-OST-2 NM_006043 GGAACCCCACTTCTTTGACA GTCGAGGAGCCTCTTGAGTG (SEQIDNO:7) (SEQIDNO:8) 3-OST-3a1 NM_006042 ACGCCCAGTTACTTCGTCAC GAACGTCAAGCTCTCGAAGG (SEQIDNO:35) (SEQIDNO:36) 3-OST-3b1 NM_006041 ACGCCCAGTTACTTCGTCAC TCTGCGTGTAGTCCGAGATG (SEQIDNO:37) (SEQIDNO:38) 3-OST-4 NM_006040 AAGAGCAAAGGTCGGACTCA ACCCTCTTCCTGTTCCCACT (SEQIDNO:9) (SEQIDNO:10) 3-OST-5 NM_153612.3 GCTAGAGGGGAAGGAGAGGA CCATCGACGACATGAAATTG (SEQIDNO:39) (SEQIDNO:40) GAPDH NM_002046.3 CCGTCTAGAAAAACCTGCC GCCAAATTCGTTGTCATACC (SEQIDNO:47) (SEQIDNO:48) A-tubulin NM_006009.2 GCAACAACCTCTCCTCTTCG GAATCATCTCCTCCCCCAAT (SEQIDNO:43) (SEQIDNO:44) TFIID NM_003194.4 TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA (SEQIDNO:45) (SEQIDNO:46) Danio 3-OST-1 NM_001080593.1 CGGTGTCTGCACAGCTCTAA CGACCAGCTCAAAGAACCTC rerio (SEQIDNO:49) (SEQIDNO:50) 3-OST-2 NM_001080608 CTCCAGTACTTCCGGCTGTC CTGCTGCTCTCTGGCTTCTT (SEQIDNO:51) (SEQIDNO:52) 3-OST-3X DQ812987.1 CAGGGAACTAATGCCCAAAA TCTCGCACCACGACTATCAG (SEQIDNO:53) (SEQIDNO:54) 3-OST-3Z DQ812988 GAAGAAACTCGGGCTCCTCT CGTCTCCTTCGCTCGATTAC (SEQIDNO:55) (SEQIDNO:56) 3-OST-4 NM_001080589 GCTCTTCACCTGGAAAGCTG AATCCTGCACTTTTGCCATC (SEQIDNO:57) (SEQIDNO:58) 3-OST-5 NM_001039926.1 ACTTTCGGAAGGGTCTGGAT GGTGGAGCTGTGAAGTAGCC (SEQIDNO:59) (SEQIDNO:60) 3-OST-6 DQ812991 CACCTGCATCTCCATCCTCT CTCTCGGCCTGAACTATTGC (SEQIDNO:61) (SEQIDNO:62) 3-OST-7 DQ812992 AAACACCGGGGTATTTCACA TCTTCACCAGCATGTTCTCG (SEQIDNO:63) (SEQIDNO:64) gapdh NM_001115114 GATACACGGAGCACCAGGTT GCCATCAGGTCACATACACG (SEQIDNO:65) (SEQIDNO:66) bactin1 NM_131031 CTCTTCCAGCCTTCCTTCCT CTTCTGCATACGGTCAGCAA (SEQIDNO:67) (SEQIDNO:68) tbp NM_200096 GAGCAACAGAGGCAACAACA GATAGGCGTCATAGGGGTGA (SEQIDNO:69) (SEQIDNO:70)
[1047] Morpholino-Mediated Knockdown of the HS3ST2 Coding Gene in the Transgenic Zebrafish Line Expressing hTAU-P301L
[1048] Morpholino oligonucleotides (MO) were designed to target the flanking region in the zebrafish 3-OST-2 gene in order to block the translation of the HS3ST2 mRNA: 5-ATGGCATATAGGT TCCTGTCAAGCC . . . -3. The morpholino antisense oligonucleotides were designed by Gene Tools (LLC One Summerton Way, Philomath, Oreg., USA). MO HS3ST2-ATG: 5-GGCTTGACAGGAACCTATATGCCAT-3.
[1049] Morpholino Injection.
[1050] The morpholinos were diluted to three different concentrations in Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO.sub.3), 5 mM HEPES pH 7.6) and co-injected with 0.3 mg/mL dextran rhodamine (Molecular Probes, Eugene, Oreg., USA). Transgenic zebrafish embryos at one-cell or two-cell stage were microinjected with approximately 2 nL of 0.5 mM, or 1 mM morpholino solution using a pressure microinjector and a Zeiss stereomicroscope (Zeiss). The three morpholino solutions were tested for fish viability, anomalies and deformities. Only viable concentrations that did not caused any major anomalies or deformities were used (0.5 mM). Embryos were maintained at 28 C. in fish water. After 20 hpf, embryos were incubated with 1X PTU (1-phenyl 2-thiourea), an inhibitor of all tyrosinase-dependent steps in the melanin pathway. The second day, after dechorionation, the DsRed-positive embryos were selected: only embryos showing a significant red fluorescent labeling, characteristic of mutated fish, were considered positive in the presence of the morpholino. Embryos were then fixed or dissected at 48, and 120 hpf.
[1051] Analysis of Hyperphosphorylation Tau Protein in Zebrafish by Immunocytochemistry
[1052] Zebrafish embryos were anaesthetized with 0.64 mM tricaine (Sigma-Aldrich, St. Louis, Mo., USA) and fixed in 4% paraformaldehyde for 1 hour at rt. 5 dpf embryos were fixed for 1 hour before brains were dissected in PBS. After 6 times washing with phosphate buffer for 5 minutes each, the dissected brains or whole embryos were blocked and permeabilized with 0.2% gelatin (Merck, Darmstadt, Germany) and 0.25% Triton X100 (Sigma-Aldrich, St. Louis, Mo., USA) for 1 hour at rt, followed by incubation of the primary antibodies anti-PHF-Tau antibody clone AT8 (Thermo Scientific) and anti-PHF-Tau antibody clones AT180 (Thermo Scientific) diluted at 1:100 in the buffer containing 0.02% NaN.sub.3. Also anti-DsRed (Clontech) was labeled, diluted at 1:50 in order to select positive DsRed embryos. After, brains or embryos were incubated with the solution of goat anti-mouse biotinylated antibody (Vector, 1:400 dilution) for 1 h30 min at rt, followed by an incubation for 1 hour at rt in a solution of Steptavidine Alexa 488 (Molecular probes, used at 1:400 dilution). Brains or embryos were mounted with 1% of agarose (low melting, Biorad) in PBS buffer. Images of morphant phenotype were captured under bright-field illumination using a stereomicroscope (SteREO Lumar. V12, Zeiss) equipped with a digital camera (DXM 1200F, Nikon) controlled by the ACT-1 software (Version 2.63 Nikon). Combination of fluorescent labelings was imaged using a microscope equipped with an ApoTome system (Zeiss) equipped with an AxioCam MRm camera (Zeiss) controlled by the Axiovision software.
[1053] Protein Extraction from Zebrafish and Tau Quantification by ELISA
[1054] The embryos resulting from crossing between AB line and transgenic zebrafish carrying the P301L mutated Tau gene were screened for the DsRed fluorescent protein at 24 hpf and at 48 hpf the vitellus was removed. A double volume of ice-cold extraction buffer containing 50 mM Tris HCl pH 8, 150 mM NaCl, 10% Triton X100, 1 mM EDTA, protease inhibitor (cocktail Roche), 10 mM NaF and 1 mM sodium orthovanadate was added to the embryos. Tissues were fragmented by sonication (Branson, Sonifier 250) and homogenized at 4 C. (Stuart rotator SB3). After 30 minutes of centrifugation at 10 000 rpm (Eppendorf Centrifuge, Sigma-202 MK) supernatant was decanted. Protein concentration was measured according to the Bradford method.
[1055] Abnormally phosphorylated Tau (P-Tau) was determined with the INNOTEST PHOSPHO-TAU (181P) ELISA (Innogenetics, Gent Belgium). Levels of P-Taul 81, characteristic of taupathy associated pathologies, were measured using a combination of monoclonal antibody HT7 (which recognizes amino acids 159-163 in normal Tau and P-Tau) and biotinylated monoclonal antibody AT270 (which recognizes P-Tau containing the phosphorylated threonine 181 residue). A synthetic phosphopeptide, furnished in the ELISA INNOTEST, was used for standardization.
[1056] Total Tau (T-tau) was measured by INNO TEST hTAU-Ag ELISA, (Innogenetics, Gent, Belgium). The T-Tau assay utilizes monoclonal antibody (AT120) for capture and biotinylated monoclonal antibodies (HT7 and BT2) for detection (Vanmechelen et al.,2000). Also A42, were determined by INNOTEST -Amyloid (1-42) ELISA, (Innogenetics, Gent, Belgium).
Example 11. Heparan Mimetic Synthesis (F6 and CR36) Inhibits Tau Hyperphosphorylation in Brain of SAMP8 Mice.
[1057] The general synthesis procedure is disclosed below:
TABLE-US-00005 Structural characteristics N glu.sup.b dsS.sup.c dsCM.sup.d HMs.sup.a (ref. NMR) (dp) (NMR) free X(NH.sub.2).sup.e(PheOMe) HM-oligo.CM.sub.L-S.sub.L-X.sub.L 6 to 15 0.22 Low Low (B) Low HM-oligo.CM.sub.M-S.sub.L-X.sub.H 6 to 15 0.17 High High (C) Low HM-oligo.CM.sub.M- 6 to 15 0.60 Low High S.sub.ML-X.sub.H (D) Medium HM-oligo.CM.sub.H- 6 to 15 0.20 Medium High S.sub.L-X.sub.H (E) Low HM-oligo.CM.sub.ML- 6 to 15 0.88 Medium High S.sub.M-X.sub.H (F) Medium .sup.aL: Low, M: Medium, H: High .sup.bPolymerization degree, determined by size exclusion chromatographi .sup.csulfatation degree (dsS), determined by NMR dosage with DMMB .sup.dcarboxymethylation level, estimated by .sup.1H NMR .sup.eAmidation level with Phenylalanine methyl ester (PheOMe), estimated by .sup.1H NMR
[1058] Heparan mimetics (BM) used in the present invention are dextran derivatives also known as RGTAs (for ReGeneraTing Agents) because of their tissue regenerative properties. These compounds have the general formula AaXxYy, in where A represents a monomer, including a glucose unit, X represents a RCOOR moiety, including a carboxymethyl moiety, Y represents an O- or N-sulfonate moiety covalently linked to A and having one of next formulas: ROSO.sub.3R, RNSO.sub.3R in where: R represents an alkyl chain with possible aromatic substitutions, including amino acid substitution, and R represents an hydrogen atom or a cation. a represent monomers number, x represents the substitution degree of the X moieties linked to monomer A, and y represents the substitution degree of Y groups on monomer A. CR36, F6, and other molecules responding to this definition are prepared as reported in previous patents. However, the synthesis and structure characterization of the compounds used in this invention is as specified below. The difference between the F6 and the CR36 synthesis is the starting dextran used in their synthesis, carboxymethylation, amidation and sulfations reactions are the same.
[1059] Carboxymethylation of dextran: For F6, a dextran T5 (MW=5000 Da) was used as starting material. For CR36, a dextran T10 (MW=10000 Da) was used as starting material. Dextran (30 g, 0.185 mol of glucose) was dissolved in 146 mL of water, and separately, 59.2 g of NaOH (1.4 mol) was dissolved in 59 mL of water. Both solutions were cooled to 4 C. The NaOH solution was slowly poured into the dextran solution under stirring and controlling temperature not to exceed 15 C. The reaction mixture was stirred for 20 min and then allowed to cool at 4 C. Monochloroacetic acid (61.3 g, 6.5 mol) was added in small portions with controlling reaction temperature <20 C., and then the reaction mixture was stirred at 50 C. during 40 min. The reaction was then quenched by purified by tangential ultrafiltration of the resulting aqueous solution using a 1000 molecular weight cutoff membrane, followed by freeze-drying as described. For preparation of products with higher carboxymethyl content the same procedure was repeated two or three times in order to obtained desired dsCM. D6, D4 and E5 are synthesized in a similar way.
[1060] Amidation Reactions. CMD (5 g, dsCM) 1.1, 21.5 mmol of COO.sup.) was dissolved in 136 mL of water, and then 71 mL of acetone was added. The temperature was kept at 40 C. To activate the carboxylic functions, 5.3 g of 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (21.5 mmol) in 20 mL of acetone was added, and the reaction mixture was stirred for 20 min at 40 C. The final solvent was composed by a ratio 60/40 water and acetone. Then, phenyalanine methyl ester (21.5 mmol) was added and the pH was adjusted to 7 by HCl 4 M. The reaction was stirred at 40 C. overnight. The final product was purified by tangential ultrafiltration of the resulting aqueous solution followed by freeze-drying.
[1061] SO.sub.3-DMF Mediated Synthesis of Sulfated Polysaccharides in the Presence of 2M2B. An aqueous 10 g/L solution of CMDPh (24.3 mmol of glucose) was dissolved in 40 mL of formamide and 160 mL of DMF. After complete dissolution, 40 mL of 2M2B (26.5 g, 378.6 mmol) was slowly added. A S0.sub.3-DMF complex (7.4 g, 48.6 mmol) was rapidly added, and the reaction mixture was stirred at 30 C. for 2 h. The reaction was quenched by slowly pouring it into 200 mL of NaHCO.sub.3 and the final product was purified by tangential ultrafiltration followed by freeze drying as described above. Amidated products were not protonated before sulfation.
[1062] Product Purification and Structure Characterization.
[1063] Product purification was systematically achieved by tangential ultrafiltration on a 1000 normal-molecular-weight cutoff (NMWCO) regenerated cellulose membrane (Pellicon2, 0.5 m.sup.2, Millipore, Mass.) against 5 L of NaCl 1 M and then 20 L of Milli-Q water. The resulting concentrated solution was freezedried. Pure dry products were homogenized to obtain a fine powder by a Universal mill Al 0 IKA (IKA-WERKE GMBH & CO. KG, Germany). 1H NMR spectra were recorded with a 200 MHz Bruker spectrometer and with a 600 MHz Varian spectrometer from samples in D2O using residual H2O peak as a standard (4.805 ppm). Absolute determination of molecular weights and size distributions were performed on polysaccharide solutions by a size exclusion chromatography (SEC) eluted in 0.1 M LiNO3 coupled to a multiangle laser lightscattering photometer (MALLS; Dawn DSP-F, Wyatt Technology, Santa Barbara, Calif.) connected in series to a differential refractive index detector (RI, ERC 7515A, Erma Cr. Inc., France). An TSK Gel G3000 PWXL (TosoHaas, Cambridge, U.K.) column was used for polysaccharide analysis. Degrees of substitution (ds), defined as the number of substituted carboxymethyl (dsCM), carboxymethyl amide (dsX), and sulfate (dsS) groups.
[1064] F6 : 0.61CM, 0.15L-Phe(OMe), 0.7S
[1065] wherein CM corresponds to the carboxymethyl groups (61% from possible 20 to 150% contents), S corresponds to the sulfate groups (70% from possible 20-150% contents); L-Phe(OMe) is present at 15% from possible 0-50% substitutions.
[1066] CR 36: Prepared from T10, NHX=L-Phe(OMe)) having the following degree of substitution: 59CM, 22L-Phe(OMe), 83S.
[1067] wherein CM corresponds to the carboxymethyl groups (59% from possible 20 to 150% contents), S corresponds to the sulfate groups (83% from possible 20-150% contents); L-Phe(OMe) is present at 22% from possible 0-50% substitutions.
[1068] Treatment of SAMP8 Mice with F6
[1069] A total of 60 5-month-old male SAMP8 and 14 5-month-old SAMR1 (normal control) were fed in clean grade animal houses at 22-24 with the humidity of 555% throughout 12 h light-dark cycle, all mice were fed with standard diet. The mean life spans of SAMP8 and SAMR1 were 152 and 303 months respectively. All mice were adaptively fed for five days, and then 60 SAMP8 mice were divided into six groups according to their weights, with 15 mice in each group: model group, Huperzine A group, F6 high-dose group (F6 H, 50 mg/kg), and F6 low-dose group (F6 L, 50 mg/kg). Huperzine A group was orally administered with 3.86 g/Kg Huperzine A (equivalent to clinical the dose of people, dissolved in normal sodium) once a day; F6 H group was intraperitoneally injected 50 mg.Math.Kg-1 F6 (dissolved in normal sodium) once every four days; F6 L group was intraperitoneally injected 25 mg.Math.Kg-1 F6 (dissolved in normal sodium) once every four days; the model group and SAMR1 normal control group (control) were orally administered with equivalent dose solute (200 L purified water) once a day. All groups were treated for 2 months before perform behavior and molecular biology detection.
[1070] Behavior and Molecular Biology Detection:
[1071] Determination of the effect of GAGS analogues on the learning and memory ability of SAM Behaviours detections were performed in order: place navigation (day 1-4), spatial probe test (day 5) and foot shock avoidance test (day 8-9). Place navigation Morris water maze (MWM) detection was performed referring to reported literature with minor modifications (reference). The escape latency, swimming distance, residence time in different quadrant, the length of swimming route in different quadrant, total length of swimming route, swimming speed, percentage of successful escape in each group were investigated. Before experiment, mice were first put onto the submerged platform for 15 s (adaptation phase), and then put into water faced to the pool wall in the first and third quadrant respectively. Mice freely swam in MVVM for 90 s, and the residence time on the platform longer than 5 s was considered as successfully searching for platform, the time from entering into water to successfully searching for platform was served as the escape latency. If mice did not successfully got platform in 90 s, the escape latency were recorded as 90 s. The mean escape latency every day was calculated to evaluate the ability to acquire spatial memory. All mice were continuously trained for 4 days, and the percentage of mice successfully searching for platform (swim-out rate) in each group every day was calculated.
[1072] Spatial probe test. The platform was removed on the day after finishing the place navigation (the fifth day). Each mouse freely swam from the third quadrant for 90 s. The number of annulus crossings (across the actual location where the platform had been located in place navigation determination), the swim distance rate and time rate in the same platform (the percentage of swim distance or time in the platform of the third quadrant compared to total swim distance or time for mice) within 90 s were recorded to evaluate the ability to acquire spatial memory.
[1073] Foot shock avoidance. Mice were performed foot shock avoidance test two days after finishing MWM test. The jumping apparatus was square and had eight rooms, with charged copper reticulum in the bottom of each room, its voltage could be controlled and regulated by computer, and a voltage of 40 V was used in this experiment. In the bottom of each room, an insulated circular platform with 5 cm diameter was put in the same side, fenders were put in the surrounding, the top side faced to the observer was transparent, and the other sides were non-transparent. The top of the room was moveable and could put into and take out of mice. Mice could stand in the insulated platform to avoid electric shock. The experiment had two phases: memory acquisition and memory consolidation.
[1074] Experiment of memory acquisition. mice were put into room for 2 min to be familiar with the environment, and then put on the copper reticulum at the beginning of the experiment and switched on (40 V) for 5 min. The latency of mice escaping onto the insulated platform for the first time after electric shock, time on platform within 5 min (time in safe area), time underwent electric shock (time in wrong area), times of electric shock and frequency of mice underwent electric shock were recorded as the learning performance to judge the ability of passive avoidance response.
[1075] Experiment of memory consolidation. mice were put onto platform to switch on for 5 min the next day after finishing the experiment of memory acquisition, the time when mice jumped down the platform into copper reticulum for the first time (latency), time in safe area (platform), time in wrong area (copper reticulum), frequency of electric shock and numbers of mice underwent electric shock were recorded to evaluate the memory performance.
[1076] Western blot. After finishing foot shock avoidance test, 2/3 of mice were collected blood by enucleating eyeball and then sacrificed. The whole brain was taken out on ice and washed with pooled normal sodium to remove blood, and then the left and right cerebral cortex and hippocampal area were respectively separated and put into freezing tubes, and finally preserved in liquid nitrogen. The left hippocampal area and cerebral cortex of three mice in each group were weighed, 1 mL protein lysate [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Trition X-100, 1 mM EDTA, 10 mM NaF, 1 mM Na.sub.3VO.sub.4, cocktail inhibitor 1%] were added into 20 mg grinned samples on ice for 30 min, and then centrifuged at 13,000 rpm for 15 min at 4 C., the supernatant was collected and preserved at 80 C. The protein content was determined by using BCA kit. A total of 30 g proteins were collected to perform Western blot. After SDS-PAGE, protein was transferred onto PVDF membrane at 4 C. and blocked for 1 h with 3% BSA, then added with the primary antibody to incubate overnight at 4 C. Following primary antibody were used: Anti-Tau 1 (1:200), anti-Tau5 (1:500), anti-pTau199/202 (1:1,000), anti-pTau231 (1:1,000), anti-pTau404 (1:1,000). The fluorescence-labeled secondary antibody was added and incubated for 1 h in dark at room temperature. Odyssey infrared imaging system was finally used to scan and analyze bands.
[1077] Fluorescence immunohistochemistry. Sample processing. After finishing foot shock avoidance test, mice were underwent endocardial perfusion with 0.1 M PBS for 5 min and 4% paraformaldehyde (0.1 M PBS, pH 7.4) for 10 min, when the liver and bowels of mice turned white and tail twitched, the whole brain was rapidly taken out and fixed with 4% paraformaldehyde for 24 h, and then put into 20% sucrose solution (in 0.1 M PBS, pH7.4) overnight at 4 C. And then went through dehydration procedures: 50% alcohol for 36 h, 70% alcohol for 48 h, 80% alcohol for 6 h, 95% alcohol for 4 h (2), 100% alcohol for 3 h for (3), dimethyl benzene for 1.5 h (2), paraffin wax for 4 h(2). Finally samples were performed with paraffin imbedding and serial sections with a thickness of 5 M.
[1078] Fluorescent staining: the formal experiment of fluorescent staining was developed on the basis that no positive staining was observed in non-specific primary immunostaining and non-specific secondary immunostaining of each determined index.
[1079] Deparaffinage: dimethyl benzene for 5 min for three times, 100% alcohol for 3 min for twice, 95% alcohol for 1 min, 70% alcohol for 1 min, 50% alcohol for 1 min, washed with water for 5 min.
[1080] Antigen retrieval: citrate water bath at 100 C. for 20 min, washed with water for 10 min, washed with PBS for 5 min for once. Antigen blocking: blocked with 3% BSA for 30 min at room temperature. Endogenous biotin blocking: performed according to the instructions of the kit. Blocked with solution A and B for 15 min respectively. The primary antibody: diluted with 1% BSA+0.2% Triton X-100+PBS and incubated overnight at 4 C. Anti Tau 5 (1:100), anti pTau199/202 (1:100), anti pTau231 (1:100), anti pTau262 (1:200), anti pTau396 (1:100), anti CS (1:100), anti cathepsin D (1:100), anti cathepsin B (1:50), anti HS (A04B08) (1:20). The secondary antibody: diluted with 1% BSA+0.2% Triton X-100+PBS (1:200) and incubated for 1 h at room temperature in dark place. HS was referred to reported literature (Ottenheijm et al., 2007), anti-VSV was diluted (1:5) and incubated for 1 h at room temperature and then performed staining.
[1081] Signal amplification: performed according to the instructions of the kit, two drips of solution A and B were respectively added into 10 mL PBS and incubated for 30 min at room temperature in dark place. Coloration: a drip of levamisole solution and two drips of solution A, B and C in the kit were respectively added into 5 ml Tris-Hcl (0.1 M, pH 8.2) and incubated for 20 min at room temperature in dark place. DAPI staining: used 1 g.Math.ml-1 DAPI to stain for 3 min at room temperature. Mounting and preserved at 4 C. in dark place. Taking pictures in time.
Example 12. F6 and CR36 Treatment on A42 Neurotoxicity in Differentiated or Undifferentiated SH-SY5Y Cells
[1082] F6 and CR36 were assayed on their capacities to modify A42 toxicity in differentiated and in undifferentiated human SH-SY5Y cells (Datki et al., 2003). Undifferentiated SH-SY5Y cells were maintained at 37 C. and 5% CO.sub.2 in DMEM supplemented with 10% FBS. For the assay, cells were seeded in 96 wells plates at 15000 cells/well and maintained in DMEM supplemented with 10% FBS for 24 h. For the differentiated cells assay, medium was supplemented with 10 M retinoic acid (Sigma-Aldrich) and cells were allowed to differentiate for 3 days. Retinoic acid treatment was not performed for the undifferentiated cells assay. Human A42 peptide (Sigma-Aldrich) was extemporary aggregated in aqueous solution (50 M) by gentle shaking at rt for 3 days. Aggregated A1342 was then added to the differentiated or undifferentiated cells at 10 M final concentration. This A42 peptide concentration was fixed by dose-effect experiments to obtain near 50% of cell viability (data not shown). F6, CR36, or control products (LiC12, heparin, enoxaparin, DMMB) were added to cells at 0.01, 0.1 or 1 g/mL final concentration with 10 M of aggregated A42 peptide and cells were incubated for 1 day. Cell viability was measured by the MTT assay (Mosmann, 1983). Briefly, medium was exchanged and 10 L of a MTT stock solution (5 mg/mL) was added to each well. Cells were incubated for 2 h at rt and the MTT solution was discarded. DMSO was added to each well and optical density was read at 560 nm. Optical density was directly correlated to cell count by means of calibration curves for both, differentiated an undifferentiated cells (data not shown).
EXAMPLE 12. Blood Brain Barrier (BBB) Passage
[1083] The Blood Brain Barrier (BBB) permeability studies were performed in BBB cells prepared as previously described (B. B. Weksler et al.; FASEB J. 2005 November; 19(13):1872-4) in hCMEC/D3 cell monolayers. Briefly, permeability of BBB to molecules of different sizes was measured on Transwell polycarbonate insert filters. HCMEC/D3 cells were seeded on the filters at a confluent density of 2105 cells/cm.sup.2 in EGM-2 medium. After 48 h, assayed molecules including F6, CR36, HM2602 and Oligo-Dextran were added to the upper chamber, the lower chamber was sampled at 10-min intervals and the molecules that passed through the cell-covered inserts was determined using DMMB method for detection of sulfated saccharides (
[1084] Data Analysis
[1085] Data analysis was performed by using Prism 5.0 (GraphPad Software Inc., CA) software, data were presented as meanSEM. Paired comparison was performed by using two-sample t test and Mann-Whitney Test, multiple comparison was performed by using Oneway ANOVA.
[1086] Conclusion
[1087] In human Alzheimer hippocampus an increase of GAG binding affinity for Tau was observed. Furthermore in Alzheimer's disease a strong staining with co-localization of HS and hyperphosphorylated Tau was observed which was concentrated around the nuclei. These results showed that HS increased in content in Alzheimer disease. This increase in HS was accompanied with alterations in the structure and composition of HS and together with putative increase in 3-O-sulfation as detected by transcript over-expression. 3-O-sulfation is a HS biosynthetic modification characteristically found in heparin and carried out by 3-O-sulfotransferases (3-OSTs). HS modified by 3-OSTs could then play important roles in Alzheimer's disease. The expression of two 3-OST isoforms was markedly increased in Alzheimer's disease brains. Our results, reinforced by literature data indicating that Tau conformational changes induced by heparin can induce Tau hyperphosphorylation, suggest that this pathological signature of rare sulfation pattern in HS from Alzheimer's disease brains could be involved in pathology. The presence of transcripts corresponding to 3-OST was confirmed in the transgenic hTAU-P301L zebrafish model used in this study. This model is also characterized by abnormal hyperphosphorylation of Tau protein.
[1088] Here, it has been demonstrated in vivo that by decreasing the expression of 3-OST-2 by morpholino, accumulation of abnormal Tau hyperphosphorylation was markedly decreased. This strongly suggests an essential requirement for HS in the phosphorylation process. Particularly, HS structure and composition seams to require 3-O-sulfation for pathological Tau modification. The decreased accumulation of hyperphosphorylated Tau after silencing of 3-OST-2 suggests that 3-O-sulfated HS stimulate interaction between Tau protein with kinases and/or phosphatases or that particular sulfated sequences of HS can regulate the affinity of Tau for kinases and/or phosphatases.
[1089] The changes induced in the structures of 3-O-sulfated HS present in Alzheimer disease, followed inhibition of 3-OST-2 may prevent a possible conformational Tau change that promotes microtubule disassembly and polymerization of the protein, this polymerization ends in the formation of insoluble PHFs, These changes might expose Tau to phosphatases, leading to lowered levels of phosphorylated Tau accumulation. Several evidences suggest that oligomeric forms of Tau might also have a role in disease pathogenesis, and dissolution of NFTs using drugs targeting Tau aggregation could conceivably result in increased amounts of available Tau oligomers. Thus, inhibition of 3-OST-2 protects cells from Tau abnormal phosphorylation, from microtubule disassembly and from PHFs formation.
[1090] The results of this study suggest the feasibility of targeting Tau phosphorylation by approaches other than inhibition of protein kinases or NFTs disaggregation strategies. The inhibitory effect of the 3-OST-2 morpholino on Tau phosphorylation in vivo, and/or the use of siRNA in cells, permit further studies on the mechanism of the inhibitory effect.
Example 13: All Peptide Neurotoxicity Protection Assay.
[1091] F6 or other HM were assayed on their capacities to modify Ab42 toxicity in differentiated and in undifferentiated human SH-SY5Y cells (Datki et al., 2003). Undifferentiated SH-SY5Y cells were maintained at 37 C. and 5% CO2 in DMEM supplemented with 10% FBS. For the assay, cells were seeded in 96 wells plates at 15 000 cells/well and maintained in DMEM supplemented with 10% FBS for 24 h. For the differentiated cells assay, medium was supplemented with 10 M retinoic acid (Sigma-Aldrich) and cells were allowed to differentiate for 3 days. Retinoic acid treatment was not performed for the undifferentiated cells assay. Human A25-35 peptide or A42 peptide (Sigma-Aldrich), as indicated, was extemporary aggregated (50 M) in aqueous solution by gentle shaking at rt for 3 days. Aggregated A42 was then added to the differentiated or undifferentiated cells at 10 M for A42 or 25 M for A25-35 (final concentrations). The A peptide concentration was fixed by dose-effect experiments to obtain near 50% of cell viability (data not shown). F6 or other molecules were added to cells at 1 or 10 g/mL final concentration with the aggregated A42 peptide and cells were incubated for 1 day. Cell viability was measured by the MTT assay (Mosmann, 1983). Briefly, medium was exchanged and 10 L of a MTT stock solution (5 mg/mL) was added to each well. Cells were incubated for 2 h at rt and the MTT solution was discarded. DMSO was added to each well and optical density was read at 560 nm. Optical density was directly correlated to cell count by means of calibration curves for both, differentiated an undifferentiated cells (data not shown).
[1092] Wester bloting of Tau : protein extracts (30 g of protein) were blotted for detection of p-Tau using antibody Tau180 (commercially available at Thermo Fisher Scientific Inc. |3747 N Meridian Rd, Rockford, Ill. USA 61101).
[1093] Structural features of the Heparan sulfate mimetics used in this study (example 13)
##STR00007##
TABLE-US-00006 Nombre of glu. (dp) dsS dsCM ds hydrophobicity Dextran (Dx) ~250 0 0 0 D4 ~50 0.2 0.75 0 E5 ~50 1 0.5 0 D6 8-15 1.2 0.6 0.2 F6 ~33 0.7 0.75 0.15
Results are presented