Methods and compositions for paper-based and hybrid microfluidic devices integrated with nucleic acid amplification for disease diagnosis

Abstract

Certain embodiments are directed to paper and its hybrid microfluidic devices integrated with nucleic acid amplification for simple, cost-effective, rapid, and sensitive pathogen detection, especially in low-resource settings.

Claims

1. A biochip for pathogen detection comprising a polymer/paper hybrid microfluidic device comprising at least four separate layers, wherein the at least four separate layers comprise: a top polymer layer comprising an inlet reservoir and microchannels connected to the inlet reservoir; a middle paper layer positioned below the top polymer layer, said middle paper layer comprising: (a) an amplification layer having at least one cylindrical amplification well forming a cylindrical hole in the amplification layer having an open top portion being in fluid communication with the inlet reservoir of the top layer, a closed bottom portion positioned 1 millimeter (mm) to 4 mm below the top layer, and a horizontal cross-sectional diameter 0.5 mm to 3 mm, the at least one amplification well is configured to receive an amplification mixture and perform a nucleic acid amplification reaction during use to produce an amplified product; (b) a detection layer in fluid communication with the amplification layer, the detection layer comprising at least one cylindrical detection well forming a cylindrical hole in the detection layer having a top portion and a closed bottom portion positioned 1 mm to 4 mm below the top layer, and a horizontal cross-sectional diameter 0.5 mm to 3 mm, said at least one detection well is in fluid communication with the at least one amplification well and is configured to receive an amplified product from the amplification well during use; a paper insert layer comprising an absorbed detection reagent, said paper insert layer having a thickness of 0.05 to 0.25 mm and a pore diameter of 5 micrometers (m) to 15 m and is positioned inside the at least one detection well and is disposed directly on the closed bottom part of the at least one cylindrical detection well, said paper insert layer forms a separate layer within the cylindrical detection well and is thinner than the detection layer; and a polymer or glass support layer positioned below the detection layer, wherein the top polymer layer, the middle paper layer, the paper insert layer and the polymer or glass support layer form the at least four separate layers of the polymer/paper hybrid microfluidic device.

2. The biochip of claim 1, wherein the polymer/paper hybrid microfluidic device comprises a plurality of amplification wells.

3. The biochip of claim 1, wherein the polymer is polydimethysiloxane (PDMS).

4. The biochip of claim 1, wherein the absorbed detection reagent on the paper insert layer comprises DNA primers.

5. The biochip of claim 1, wherein the polymer or glass support layer is glass.

6. The biochip of claim 1, wherein the amplification layer further comprises multiple sublayers.

7. The biochip of claim 6, wherein the multiple sublayers are cut to form amplification wells.

8. The biochip of claim 1, wherein the detection layer comprises the at least one cylindrical detection well linked to reagent delivery channels.

9. The biochip of claim 1, further comprising a sequence specific probe in the at least one cylindrical detection well.

10. The biochip of claim 1, wherein the top polymer layer further comprises a filter configured to remove components of a sample and to provide a filtered sample to the at least one cylindrical amplification well.

Description

DESCRIPTION OF THE DRAWINGS

(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.

(2) FIG. 1A-1C. Chip layout of the PDMS/paper hybrid microfluidic device for singleplexed pathogen detection. (a) 3D illustration of the schematic of the chip layout. The chip consists of one top PDMS layer, one middle PDMS layer and one glass slides for reagent delivery, LAMP reaction and structure support, respectively. A chromatography paper disk is situated inside each LAMP zone to preload LAMP primers. (b) A photograph of the hybrid microfluidic device for infectious disease diagnosis. (c) A cross-section view of the LAMP zone illustrating the principle of the LAMP detection.

(3) FIG. 2A-2D. On-chip LAMP detection of N meningitidis using purified DNA by a portable UV light pen (a) and fluorescence microscopy (b). Strong fluorescence was observed in N. meningitidis and PC LAMP zones, but not in NC zones. (c) Gray value of the LAMP products measured by ImageJ; (d) Fluorescent intensity of the LAMP products measured by fluorescence microscope. The purified DNA template used was 310.sup.6 copies per LAMP zone.

(4) FIG. 3A-3E. Instrument-free detection of N. meningitidis microorganisms. Fluorescence images of on-chip LAMP detection of N. meningitidis in ACSF under portable UV light (a) and by fluorescence microscopy (b). (c) Gray value of the LAMP products from pathogen/ACSF mixtures measured by fluorescence microscope. (d) Fluorescent intensity of the LAMP products from pathogen/ACSF mixtures measured by fluorescence microscope. (e) Gel electrophoresis of the on-chip LAMP products of N. meningitidis in ACSF. Lanes 1-3: 100 bp marker; LAMP products of N. meningitidis in ACSF; NC.

(5) FIG. 4. Calibration curve of nucleic acid concentration of the LAMP products (after LAMP amplification) versus the initial copy number of template DNA (before LAMP amplification) of N. meningitidis in ACSF.

(6) FIG. 5A-5C. LOD investigation. (a) Fluorescence images of LAMP products using a series of 10 fold diluted N. meningitidis DNA template solutions ranging from (1)-(4): 310.sup.2, 310.sup.1, 310.sup.0, 310.sup.1 DNA copies per LAMP zone. The on-chip LAMP products still exhibited strong fluorescence even the initial DNA templates were as low as 3 copies per LAMP zone. (b) Gray values of the image of (a)-3 for LAMP products from 3 copies DNA template. The dotted line is the calculated gray value of the cutoff line for N. meningitidis detection based on 3 times SD of negative controls. (c) Gel electrophoresis of on-chip LAMP products using a series of diluted DNA template solutions. Lanes 1-11: 100 bp marker, 310.sup.6, 310.sup.5, 310.sup.4, . . . , 310.sup.0, 310.sup.1, 310.sup.2 DNA copies of the template per LAMP zone, NC.

(7) FIG. 6A-6C. (a-b) Fluorescence images of pre-loaded Cy3-labelled primers in LAMP zones either with or without paper inside. When LAMP zones were dry, primers in paper-free LAMP zones accumulated on the edge of the LAMP zones, while primers in LAMP zones with paper inside were still uniformly distributed. (c) On-chip LAMP performance comparison between biochips with paper inside and without paper inside over a period of two months. Nucleic acid concentration of N. meningitidis LAMP products from LAMP zones with paper inside and without paper inside was measured to evaluate on-chip LAMP performance between these two different kinds of biochips. DNA concentration was normalized for convenient comparison.

(8) FIG. 7A-7B. Chip layout of the PDMS/paper hybrid microfluidic device for multiplexed instrument-free pathogen detection. (a) 3D illustration of the schematic of the chip layout. The chip consists of one top PDMS layer, one middle PDMS layer and one glass slides for reagent delivery, LAMP reaction and structure support, respectively. A chromatography paper disk is situated inside each LAMP zone to preload LAMP primers. (b) A photograph of the hybrid microfluidic device for multiplexed bacterial meningitis diagnosis.

(9) FIG. 8A-8E. On-chip LAMP multiplexed pathogen detection of N. meningitidis, S. pneumoniae and Hib using purified DNA by a portable UV light pen (a) and fluorescence microscopy (b). Strong fluorescence was observed in sample detection zones, but not in NC zones. (c) Gray value of the LAMP products measured by ImageJ; (d) Fluorescent intensity of the LAMP products measured by fluorescence microscope. (e) Gel electrophoresis of collected LAMP product for confirmatory analysis. Lanes 1-5: 100 bp ladder, LMAP product from N. meningitidis, S. pneumoniae and Hib, NC. Ladder-pattern DNA bands were observed in LMAP products from sample detection zones, whereas no DNA bands were observed in NC. The purified DNA template of N. meningitidis, S. pneumoniae and Hib used was 310.sup.6, 610.sup.6 and 510.sup.6, copies per LAMP zone.

(10) FIG. 9A-9D. LOD investigation by a portable UV light pen and gray values. (a) Detection of N. meningitidis by a portable UV light pen using a series of 10 fold diluted N. meningitidis DNA template solutions ranging from (1)-(4): 310.sup.1, 310.sup.0, 310.sup.1 DNA copies per LAMP zone, NC. (b) Detection of S. pneumoniae by a portable UV light pen using a series of 10 fold diluted S. pneumoniae DNA template solutions ranging from (1)-(4): 610.sup.1, 610.sup.0, 610.sup.1 DNA copies per LAMP zone, NC. (c) Detection of Hib by a portable UV light pen using a series of 10 fold diluted Hib DNA template solutions ranging from (1)-(4): 510.sup.1, 510.sup.0, 510.sup.1 DNA copies per LAMP zone, NC. (d) Gray values of the images of (a)-2, (b)-2, and (c)-2 for LAMP product from 3 copies N. meningitidis (N. M.) DNA template, 6 copies S. pneumoniae (S. P.) DNA template and 5 copies Hib (H. I.) DNA template as well as their corresponding NC respectively. The dash line was the cutoff gray value for its corresponding pathogen's LOD.

(11) FIG. 10A-10C. (A-C) Schematic of low-cost and multiplexed detection of meningitis causing pathogens on paper-based 3D microfluidic devices. There are two layers in the microfluidic system. DNA amplification unitLAMP is carried out in the top layer. (C) Illustration of detection principle using graphene-oxide nano-material. Fluorescence of fluorophore-labeled probes is quenched when probes are adsorbed on the surface of grapheme oxide (GO). In contrast, when the target DNA is present, the quenched fluorescence is restored.

(12) FIG. 11A-11B. 3D schematic illustration of a paper-based LAMP biochip integrated with DNA capture probe-based detection wells for high-sensitivity quantitative disease diagnosis. Detection principle is illustrated in the inset.

DESCRIPTION

(13) There are several laboratory guidelines available from the Centers for Disease Control and Prevention (CDC) and the WHO for the diagnosis of meningitis. Gram stain and cell culture are the most commonly used approaches for meningitis diagnosis (Brouwer et al. (2010) Clin Microbiol Rev, 23(3): 467-92). However, both have to be done in laboratories, and the processes are costly and time consuming, especially for cell culture. Although gram stain seems to be a relatively faster process after reaching the laboratory, it still has many limitations: (1) Gram stain is not reliable, since the absence of bacteria does not exclude bacterial meningitis as bacteria are seen in only 60% of cases; this figure is reduced by a further 20% if antibiotics were administered before the sample was taken. (2) Gram stain's detection sensitivity is low. (3) The gram stain approach needs well-trained personnel, due to the fact that sometimes poor staining occurs. Only a few poorly staining bacteria may be present on an entire slide, and inflammatory cells, erythrocytes, stained protein, and precipitated stain may obscure the bacteria. According to one study in 2008 by Nueman, up to 40% of cases of positive gram stain results can be due to contamination or misinterpretation (Neuman et al. (2008) Pediatr Infect Dis J, 27(4):309-13). Spinal tap or lumbar puncture is another diagnostic procedure to collect cerebrospinal fluid (CSF) for the meningitis examination, but it is an invasive procedure and can be only done by trained personnel.

(14) Recently, real-time polymerase chain reaction (qPCR) (Poppert et al. (2005) J Clin Microbiol, 43(7):3390-97; Richardson et al. (2003) J Clin Microbiol, 41(8):3851-53), conventional loop mediated isothermal amplification (LAMP) (Nagdev et al. (2011) J Clin Microbiol, 49(5):1861-65), and latex agglutination tests have been reported to provide faster detection of bacterial meningitis than cell culture. Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumonia are the three main bacterial pathogens that cause meningitis (Castillo, Laboratory Methods for the Diagnosis of Meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. In: WHO Manual, 2nd Edition. Harcourt, B (Ed. (World Health Organization, Center for Disease Control and Prevention, 2011)). The treatment for different types of bacteria varies. Therefore, it is important to know what type of bacterial meningitis before immediate and effective treatment. Nevertheless, most approaches do not provide multiplex diagnosis function. Nagdev et al. (2011) have reported an off-chip LAMP amplification method for the clinical diagnosis of meningitis, but only one type of bacterial meningitis (Tuberculosis Meningitis) can be detected and it needs a Loopamp real-time turbidimeter (Nagdev et al. (2011) J Clin Microbiol, 49(5):1861-65). Furthermore, these tests require expensive specialized equipment in laboratories, such as thermal cyclers, turbidimeters, centrifuges, fluorescence microscopes, and so on, which limits the applications of those approaches in low-resource settings.

(15) Certain embodiments are directed to a low-cost point of care (POC) device for rapid and high-sensitivity pathogen detection in resource-poor settings. Certain aspects provide a low cost approach for microbe detection through the use of paper-based microfluidics, e.g., all-paper microfluidic devices. Because of the miniaturization of reactions carried out in microfluidic systems, low reagent consumption is an intrinsic advantage that reduces costs associated with reagents and materials. In addition, paper is inexpensive and easy to obtain. The material cost for an all paper-based microfluidic device is only a few cents (Martinez et al. (2008) Lab Chip, 8(12): 2146-50).

(16) Certain devices and methods described herein are faster, compared to conventional detection methods, such as cell culture. In certain aspects a device described herein can be configured to detect meningitis-causing organisms. Rapid assay is crucial in meningitis diagnosis. The assay based on LAMP takes only 45 min to finish (Saleh et al. (2008) Dis Aquat Organ, 81(2): 143-51), which ensures the best chance for faster patient care and complete recovery. Certain embodiments can provide higher detection sensitivity than conventional meningitis diagnosis methods, due to the integration of DNA amplification on a chip, which can provide sensitivity close to the single-pathogen detection levelproviding for early diagnosis of meningitis.

(17) The integrated, multiplexed function of certain paper-based devices described herein allow for simultaneous testing of at least one, two, three or more pathogens, eliminating the need for separate laboratory testing for each pathogen. Certain aspects require minimal instrument demands and no specialized equipment, such as a thermal cycler and centrifuge. Certain aspects utilize a fluorescent or a colorimetric assay that is detectable by the naked eye, bringing the advantages of sensitive and efficient microfluidics analysis directly to the patient's POC. In certain aspects there is no need for a detector, other than the human eye. In a further aspect the a light pen, laser pointer, or equivalent device can be used to illuminate a detectable sample.

(18) Paper-based microfluidic devices can have certain beneficial features, including, but not limited to: (i) They are disposable, avoiding the spread of infectious diseases from used devices; (ii) fabricating paper-based devices is simple and does not require the use of clean-room facilities; (iii) Paper has good stackability, allowing the formation of 3D structures readily for complex assays; (iv) The high surface-to-volume ratio provided by the macroporous structure in the paper material improves DNA hybridization kinetics, allowing fast pathogen detection; and (v) Paper provided much more stable testing results than without paper over a period of two months (FIG. 6).

I. MICROFLUDIC DEVICE

(19) As shown in FIG. 1, certain embodiments of a microfluidic device for singleplexed pathogen detection can comprise at least three layers. Other embodiments can be single layer or two layer devices. The top layer can be a polymer layer used for reagent delivery, three micro-channels are formed in the top layer illustrated in FIG. 1. Also formed in the top layer is an inlet reservoir. The middle layer is a polymer layer having two or more loop-mediated isothermal amplification (LAMP) zones, outlet reservoirs and micro-channels downside, which are used for LAMP reaction and detection. The bottom layer is a support layer (e.g., a glass slide (length 75 mm, width 25 mm, depth 1.0 mm). Different LAMP zones can be used for negative control (NC), positive control (PC) and pathogen detection.

(20) The detection portion of the device comprises specific primers and/or specific probes for target pathogens or positive control DNA can be pre-loaded in the amplification chamber. In certain aspects an amplification chamber can be loaded with 1, 2, 3, 4, or more primer pairs. In certain aspects amplification and detection are performed in a single chamber. In a further aspect, an amplification reaction is transferred to a separate detection zone, e.g., by puncturing a wall of the amplification chamber and allowing the flow of amplicons to a detection region of the device. A device can be configured to transport a reaction mixture and/or sample from an inlet to fill the amplification chamber/zones. In certain aspect a filter is included in the device and positioned such that a sample being applied to the device is filtered prior to being transported to an amplification chamber/zone. After filling, the inlet and outlets can be sealed, e.g., with epoxy. Amplification is then performed at an appropriate temperature on a heating film for an appropriate amount of time.

(21) As shown in FIG. 2, certain embodiments of a microfluidic device with more channels and LAMP zones for multiplexed pathogen detection can comprise at least three layers. Microfluidic devices and systems can be configured to perform numbers of different analytical and/or synthetic operations within the confines of very small channels and chambers that are disposed within small scale integrated microfluidic devices. Multiplexing the basic system can substantially increase throughput, so that the operations of the system are carried out in highly parallelized system.

(22) Microfluidic devices and systems, because of their extremely small space requirements are particularly well suited for parallelization or multiplexing because large numbers of parallel analytical fluidic elements can be combined within a single integrated device that occupies a relatively small area. A parallelized or multiplexed device can be configured for high throughput screening assays. A multiplexing system will comprise a plurality of channels and microwells that are configured to analyze a number of different pathogens.

(23) In certain embodiments a paper-based microfluidic device may comprise at least two layers (FIG. 10), one layer having an amplification chamber and a second layer having a detection zone. The top layer can be nucleic acid amplification unit. The bottom paper layer can include microchannels and detection zones. In certain aspects the bottom layer comprises 2, 3, 4, 5, 6, or more microchannels. The microchannels can be in fluid communication with 2, 3, 4, 5, 6 or more detection zones. Each detection zone can have one or more detectable probes. In certain aspects the detectable moiety of the detectable probe is quenched. In certain aspects the detectable moiety is quenched by graphene oxide.

(24) In certain embodiments a paper-based microfluidic device may comprise multiple layers to form at least one DNA amplification well (FIG. 11), and one layer having an at least one detection zone. In certain aspects the detection layer comprises 2, 3, 4, 5, 6, or more microchannels. The microchannels can be in fluid communication with 2, 3, 4, 5, 6 or more detection zones. An insulation layer can be added between the detection layer and amplification zones to prevent reagent loss. Each detection zone can have one or more detectable probes. In certain aspects the detectable moiety of the detectable probe is quenched. In certain aspects the detectable moiety is quenched by graphene oxide.

(25) Integration of DNA Amplification on Chip.

(26) To increase the detection sensitivity and avoid contamination during sample transfer, certain embodiments have a DNA amplification unit or amplification chamber/zone integrated on the device. This chamber, unit, or zone can be provided on a separate layer of paper providing flexibility in sample handling. In certain aspects the bottom of the DNA amplification zone is sealed, for example with a thin layer of adhesive tape, and the top is covered with a tape layer, a cap or mineral oil to prevent liquid evaporation. Next, DNA samples are isothermally amplified at about 63 C. on a thin film heater by LAMP (Ahmad et al. (2011) Biomed Microdevices, 13(5): 929-37). In certain aspects, a portable heating system based on a proportional-integral-derivative (PID) temperature controller (Auber Inst, GA.), a thermocouple (Auber Inst.), and a heating film (Omega, CT) can be used. A battery-powered portable heating system can be used for field detection. During the DNA amplification process, the pathogen DNA can be labeled with fluorophores for DNA fluorescence detection in a later step.

(27) Conventional DNA PCR amplification requires a carefully controlled sequence of heating and cooling cycles. The fabrication of heaters and temperature sensors on chip is complicated (Liu et al. (2011) Lab Chip, 11(6): 1041-48). In contrast, certain embodiments of the LAMP method utilizes the Bacillus stearothermophilus DNA Polymerase, a thermally-stable enzyme with high displacement ability over the template-primer complex (Saleh et al. (2008) Dis Aquat Organ, 81(2): 143-51; Notomi et al. (2000) Nucleic Acids Res, 28(12): E63). This DNA amplification technique allows nucleic acid amplification to be carried out under thermally constant conditions, eliminating the use of expensive and cumbersome thermal cycler equipment in low-resource settings. The heating system is small enough to be placed in one's pocket and can be used in conjunction with a portable battery-powered heating system.

(28) Certain aspects described herein link graphene oxide (GO) to the paper substrate by a physical absorption method or covalent surface modification of paper. For surface modification, 3-aminopropyl-trimethoxysilane (APTMS) is immobilized on the paper surface by linkage with hydroxyl groups. The reaction of carboxyl groups from GO with amine groups from APTMS leads to the covalent attachment of GO on the paper surface. Once GO is linked to the paper in the detection zones, it will provide a platform on which to immobilize various DNA probe oligonucleotides (e.g., 5-AACCTTGAGCAATCCATTTATCCTGACGTTCT-3 (SEQ ID NO:1), 5-GCGGATTCCCAGTTGAGTGTGCGTGTAC-3(SEQ ID NO:2), 5-TGGTGCTAAGATGAAGTTATGGC-3(SEQ ID NO:3), for N. meningitidis, H. influenzae and S. pneumonia, respectively, for multiplex DNA sensing. ssDNA labeled with fluorophores can self-assemble onto the surface of GO to form a stable ssDNA-GO architecture, and its fluorescence will be quenched (Loh et al. (2010) Nat Chem, 2(12): 1015-24).

(29) In certain aspects, after DNA amplification, the seal underneath the DNA amplification zone will be penetrated and fluid communication with a channel on the bottom layer of paper established. In certain aspects DNA amplicons flow to different detection zones via the wicking effect of paper. This provides a simple strategy to actuate liquid flows in paper, without off-chip controllers and power. This feature can be useful for detection in the field and other resource-limited settings. Specific DNA capture probes targeted to different pathogens will be pre-adsorbed in the detection zones (e.g., via GO), allowing the detection of pathogens via DNA hybridization, simultaneously, and selectively.

(30) Certain embodiments incorporate a miniaturized portable fluorescence detection system using a light emitting diode (LED), such as violet LED (Tsai et al. (2003) Electrophoresis, 24(17): 3083-88), a UV LED, or a green laser pointer. The wavelength of 532 nm from a green laser pointer is a good fit with the excitation wavelength of one of the common probesCy3, but other combinations of light source and fluorophore can be used. A brief comparison among different diagnostic approaches is listed in Table 1.

(31) TABLE-US-00001 TABLE 1 Comparisons among different diagnostic approaches Chip material Heating For resource- cost system Detection poor settings Time needed Ours ~5 cents ~$70 ~$150 Yes <60 min qPCR N/A ~$65,000 No 2-30 hours Cell N/A ~$7,000, ~$6,000 No >48 hours culture incubators

(32) Instrument-Free Detection of Amplified Target DNA.

(33) Certain embodiments incorporate a visual fluorescent or a colorimetric detection method. Mori et al (2001) observed that during the LAMP amplification process, a magnesium pyrophosphate precipitate was formed as a turbid by-product of the nucleic acid amplification process (Mori et al. (2001) Biochem Biophys Res Commun, 289(1): 150-54). This precipitate forms only when the targeted DNA is present in the LAMP amplification process, such that the presence of the pyrophosphate can serve as an indicator of the presence of a pathogen's target DNA. Visual confirmation by the naked eye can be achieved by the addition of an intercalcating dye, SYBR green I, to detection zones (Ji et al. (2010) Poult Sci, 89(3): 477-83), that turns green in the presence of targeted pathogen DNA under normal light, while the original orange color is retained for a negative control (Parida et al. (2005) J Clin Microbiol, 43(6): 2895-2903). As such, clinical diagnosis of a pathogen (e.g., meningitis-causing pathogen) can be achieved by visual confirmation of the green color formed. This method will allow for a simplified instrument-free, multiplexed one-step visual determination of the presence of three meningitis-causing pathogens.

(34) In certain embodiments a filter or filtration layer can be included to remove red blood cells in order to avoid detection inference in subsequent steps.

(35) Certain configurations of the device include multiple nucleic acid amplification zones. These nucleic acid amplification zones can be dual function amplification/detection zones. Blood samples from individuals can be collected using a sample inlet that is loaded by pricking a finger with a lancet and applying blood drop similar to glucose testing using a POC glucometer. The filtration layer can remove blood cells. Bacterial cells can be lysed and DNA extracted using a new lysis buffer that we developed (lysis buffer (50 mM Tris buffer (pH 7.5), 4 M urea and 0.1% triton) which is fully compatible to LAMP reactions, while many others completely inhibited LAMP reaction, or by heating the sample to a high temperature (e.g. 95 C.) using a battery-powered portable heating system. In certain aspects different detection zones will have different primers. Different primers for different pathogen targets will be pre-loaded in the different detection zones. When the appropriate DNA is present, the primers interact with the sample. LAMP will only occur when the pathogen and the pathogen-specific primers are present enabling the test to be highly specific, as shown by a precipitate in different detection zones, or green fluorescence if calcein is used.

(36) In certain embodiments a microfluidic device is configured for meningitis diagnosis in a laboratory or home setting. In other embodiments a microfluidic device is configured to provide a POC device for field diagnosis. Furthermore, the microfluidic devices and methods presented will be used to detect various plant, animal, food-borne, and other infectious diseases (e.g., B. pertussis, HIV) in resource-limited settings.

(37) Colorimetric detection can be enhanced by UV light from UV LED, gold nanoparticles, quantum dots (QDs) (Edgar et al. (2006) Proc Natl Acad Sci USA, 103(13): 4841-45; Smith et al. (2006) Expert Rev Mol Diagn, 6(2): 231-44), and silver enhancement (Taton et al. (2000) Science, 289(5485): 1757-60) can be used as detectable moieties. Gold nanoparticles promote the reduction of Ag.sup.+, resulting in the color change from white to black on paper.

(38) In certain aspects GO is immobilized on the paper surface to adsorb DNA capture probes. If the efficiency of GO immobilization on paper is sufficient, a covalent immobilization of DNA capture probes can be used to graft DNA codes on paper. In certain aspects DNA capture probes can be immobilized on paper directly without using GO.

(39) Probes can be coupled to a variety of reporter moieties. Reporter moieties include fluorescent reporter moieties that can used to detect aptamer binding to a target. Fluorophores can be fluorescein isothiocyanate (FITC), allophycocyanin (APC), R-phycoerythrin (PE), peridinin chlorophyll protein (PerCP), Texas Red, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7; or fluorescence resonance energy tandem fluorophores such as PerCPCy5.5, PE-Cy5, PE-Cy5.5, PE-Cy7, PE-Texas Red, and APC-Cy7. Other fluorophores include, Alexa Fluor 350, Alexa Fluor 488, Alexa 25 Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 647; BODIPY dyes, such as BODIPY 493/503, BODIPY FL, BODIPY R6G, BODIPY 530/550, BODIPY TMR, BODIPY 558/568, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY TR, BODIPY 630/650, BODIPY 650/665; Cascade Blue, Cascade Yellow, Dansyl, lissamine rhodamine B, Marina Blue, Oregon Green 488, Oregon Green 514, Pacific Blue, rhodamine 6G, rhodamine green, rhodamine red, and tetramethylrhodamine, all of which are also useful for fluorescently labeling nucleic acids.

(40) In certain aspects the fluorescence of a probe can be quenched. Quenching refers to any process that decreases the fluorescence intensity of a given substance. A variety of processes can result in quenching, such as excited state reactions, energy transfer, complex-formation, and collisional quenching. Molecular oxygen, iodide ions, and acrylamide are common chemical quenchers. The chloride ion is a well-known quencher for quinine fluorescence. Typically quenching poses a problem for non-instant spectroscopic methods, such as laser-induced fluorescence, but can also be used in producing biosensors. In certain aspects the fluorescence of a labeled probe that is not bound to its target is quenched, wherein upon binding to its target the fluorescence is recovered and can be detected. The labeled probe is complexed with a quenching moiety while absorbed onto the paper layer of a device as described herein. Once the probe binds its target the fluorescence is recovered. Target binding results in recovered fluorescence.

(41) In certain aspects the fluorescence can be quenched by forming a probe/graphene oxide complex. In certain aspects the probe/graphene oxide complex is adsorbed to a paper substrate or layer. Graphene oxide (GO) is a compound of carbon, oxygen, and hydrogen in variable ratios, obtained by treating graphite with strong oxidizers. Graphene oxide (GO) is an intermediate on the route to chemically derived graphene, and it is easily synthesized. Its chemical structure is heterogeneous and consists of both large areas of conjugated sp2-systems and various electronically isolated oxygen containing functionalities. GO can act as a quencher of fluorescence and is easily dispersible in water. In certain aspects the quencher can be graphene, graphene oxide, carbon nanotubes, carbon nanoparticles or other materials. In some instances the binding of the target results in desorption of the probe, which in turn results in an increase in fluorescence.

II. PATHOGENIC MICROBES

(42) In one embodiment, the invention concerns rapid and accurate methods for detecting food-borne pathogens, including without limitation, parasites and their eggs, Noroviruses (Norwalk-like viruses), Campylobacter species, Giardia lamblia, Salmonella, Shigella, Cryptosporidium parvum, Clostridium species, Toxoplasma gondii, Staphylococcus aureus, Shiga toxin-producing Escherichia coli (STEC), Yersinia enterocolitica, Bacillus cereus, Bacillus anthracis, Cyclospora cayetanensis, Listeria monocytogenes, Vibrio parahemolyticus and V. vulnificus. The term microorganism or microbe as used in this disclosure includes a virus, bacterium, fungi, parasite, or parasite's egg.

(43) In certain aspects a pathogenic or potentially pathogenic microbe can be detected. A pathogenic microbe can be a virus, a bacterium, and/or a fungus. In certain aspects the device can be configured to detect a variety of microbes include viruses, bacteria, and fungi simultaneously. In certain aspects, a microbe includes a virus. The virus can be from the Adenoviridae, Coronaviridae, Filoviridae, Flaviviridae, Hepadnaviridae, Herpesviridae, Orthomyxoviridae, Paramyxovirinae, Pneumovirinae, Picornaviridae, Poxyiridae, Retroviridae, or Togaviridae family of viruses; and/or Parainfluenza, Influenza, H5N1, Marburg, Ebola, Severe acute respiratory syndrome coronavirus, Yellow fever virus, Human respiratory syncytial virus, Hantavirus, or Vaccinia virus.

(44) In yet a further aspect, the pathogenic or potentially pathogenic microbe can be a bacteria. A bacterium can be an intracellular, a gram positive, or a gram negative bacteria. In a further aspect, bacteria include, but is not limited to a Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Haemophilus influenzae type B (Hib), B. pertussis, B. parapertussis, B. holmesii, Escherichia, a Staphylococcus, a Bacillus, a Francisella, or a Yersinia bacteria. In still a further aspect, the bacteria is Bacillus anthracis, Yersinia pestis, Francisella tularensis, Pseudomonas aerugenosa, or Staphylococcus aureas. In still a further aspect, a bacteria is a drug resistant bacteria, such as a multiple drug resistant Staphylococcus aureas (MRSA). Representative medically relevant Gram-negative bacilli include Hemophilus influenzae, Klebsiella pneumoniae, Legionella pneumophila, Pseudomonas aeruginosa, Escherichia coli, Proteus mirabilis, Enterobacter cloacae, Serratia marcescens, Helicobacter pylori, Salmonella enteritidis, and Salmonella typhi. Representative gram positive bacteria include, but are not limited to Bacillus, Listeria, Staphylococcus, Streptococcus, Enterococcus, Actinobacteria and Clostridium Mycoplasma that lack cell walls and cannot be Gram stained, including those bacteria that are derived from such forms.

(45) In still another aspect, the pathogenic or potentially pathogenic microbe is a fungus, such as members of the family Aspergillus, Candida, Crytpococus, Histoplasma, Coccidioides, Blastomyces, Pneumocystis, or Zygomyces. In still further embodiments a fungus includes, but is not limited to Aspergillus fumigatus, Candida albicans, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, or Pneumocystis carinii. The family zygomycetes includes Basidiobolales (Basidiobolaceae), Dimargaritales (Dimargaritaceae), Endogonales (Endogonaceae), Entomophthorales (Ancylistaceae, Completoriaceae, Entomophthoraceae, Meristacraceae, Neozygitaceae), Kickxellales (Kickxellaceae), Mortierellales (Mortierellaceae), Mucorales, and Zoopagales.

III. EXAMPLES

(46) The following examples as well as the figures are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples or figures represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

Singleplexed Detection

(47) A. Methods and Materials

(48) LAMP Detection:

(49) The LAMP primers for the target ctrA gene sequence from Neisseria meningitidis, as shown in Table 2. Loopamp DNA amplification kit and Loopamp fluorescence detection reagent (calcein) were purchased from Eiken Co. Ltd., Japan. The Loopamp reaction mixture contained 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 8 mM MgSO.sub.4, 10 mM (NH.sub.4).sub.2SO.sub.4, 0.1% Tween 20, 0.8 M Betaine, 0.5 mM MnCl2, 1.4 mM dNTPs, 8U Bst Polymerase, 1.6 M each of the inner primer (FIP/BIP), 0.2 M each of the outer primer (F3/B3), 0.4 M each of the loop primer (LF/LB).

(50) Microfluidic Platform Fabrication:

(51) Polydimethylsiloxane (PDMS, Sylgard 184) was obtained from Dow Corning (Midland, Mich.), Whatman chromatography paper was purchased from Sigma (St. Louis, Mo.), Epoxy was purchased from ITW Devcon (Danvers, Mass.).

(52) DNA Isolation:

(53) DNA isolation kit and LAMP product purification kit were purchased from Qiagen (Valencia, Calif.).

(54) Bacteria Lysis Buffer:

(55) 50 mM Tris buffer (pH 7.5), 4 M urea, 0.1% triton. All the chemicals mentioned were purchased from Sigma (St. Louis, Mo.).

(56) Artificial Cerebrospinal Fluid (ACSF):

(57) 119 mM NaCl, 26.2 mM NaHCO.sub.3, 2.5 mM KCl, 1 mM NaH.sub.2PO.sub.4, 1.3 mM MgCl.sub.2, 10 mM glucose, gas with 5% CO.sub.2/95% O.sub.2 for 10-15 min, then add 2.5 mM CaCl.sub.2. Filter sterilize with a 0.22-m filter apparatus, and store at 4 C. All the chemicals mentioned were purchased from Sigma (St. Louis, Mo.).

(58) TABLE-US-00002 TABLE2 ctrALAMPprimersequences Primer Sequences(5-3) No.bases ctrA_FIP CAAACACACCACGCGCATCAGAT 41 (SEQIDNO:4) CTGAAGCCATTGGCCGTA ctrA_BIP TGTTCCGCTATACGCCATTGG 42 (SEQIDNO:5) TACTGCCATAACCTTGAGCAA ctrA_F3 AGC(C/T)AGAGGCTTATCGCTT 19 (SEQIDNO:6) ctrA_B3 ATACCGTTGGAATCTCTGCC 20 (SEQIDNO:7) ctrA_FL CGATCTTGCAAACCGCCC 18 (SEQIDNO:8) ctrA_BL GCAGAACGTCAGGATAAATGGA 22 (SEQIDNO:9)

(59) Microorganism Culture.

(60) N. meningitidis (ATCC 13098), S. pneumoniae (ATCC 49619) and Hib (ATCC 33533) were obtained from American Type Culture Collection (ATCC, Rockville, Md.). N. meningitidis and H. influenza were grown on chocolate II agar supplemented with hemoglobin and IsoVitalex plates (BD, Sparks, MD). S. pneumoniae was grown in TSA II agar plates supplemented with 5% sheep blood (BD, Sparks, MD). All the microorganisms were incubated at 37 C. for 48 h in an aerobic environment with 5% CO.sub.2.

(61) Microfluidic Platform Design and Fabrication.

(62) As shown in FIG. 1, the microfluidic device for singleplexed pathogen detection comprises three layers. The top layer is the PDMS layer used for reagent delivery, including 3 micro-channels, and an inlet reservoir. The middle layer is also a PDMS layer with 6 LAMP zones 70, 3 outlet reservoirs and micro-channels downside, which is used for LAMP reaction and detection. The bottom layer is a glass slide for support. Different LAMP zones were used for negative control (NC), positive control (PC) and N. meningitidis detection respectively. PC DNA and its primer mix come from the Loopamp DNA amplification kit.

(63) A chromatography paper was cut using a laser cutter and placed inside each LAMP zones. Then the specific primers for N. meningitidis and PC DNA were pre-coated into the LAMP zones with paper and dried in a vacuum desiccator. Then the reaction mixture was transported from inlet to fill with the LAMP zones. After that, the inlet and outlets were sealed with Epoxy. And the amplification was performed at 63 C. on a heating film for 45 minutes.

(64) PDMS films were produced by following standard soft lithography procedures (Xia and Whitesides, (1998) Rev. Mater. Sci., 1998: 31). Briefly, the liquid PDMS base and the curing agent (Corning, N.Y.) were mixed at a weight ratio of 10:1. Then the PDMS precursor mixture was poured onto a petri dish, degassed by vacuum in the vacuum desiccator for 30 minutes, and incubated at 60 C. for overnight. Unlike the commonly used PDMS molding, micro-channels were directly created on top of the PDMS film by using the laser cutter. Inlet reservoir in the top PDMS layer, outlet reservoirs and LAMP zones in the middle PDMS layer were drilled by using biopsy punches. By exposure in an oxidizing air plasma (Ithaca, N.Y.) for 30 s, PDMS films and the glass slide were irreversibly face-to-face sandwiched bonded.

(65) B. Results and Discussion

(66) PDMS/Paper Hybrid Microfluidic Devices.

(67) Paper has high surface-to-volume ratio property and form 3D structures. This property is ideal for reagents bounding to the surface of paper and benefit for assays (Martinez, (2011) Bioanalysis, 3:2589-92). In this work, chromatography paper was placed in the LAMP zones to form a PDMS/paper hybrid microfluidic device, serving as the substrate for adsorbing the primer in subsequent steps. And primer was absorbed and stored in the LAMP zones with paper uniformly even when they are dry, as we can see from the microscope image (FIG. 6) taking by a high-resolution fluorescence microscope (Ti-E, Nikon, NY) at the same exposure time. On the contrary, for the LAMP zones without paper, primer accumulated on the edge of the circle of LAMP zones when they are dry.

(68) In addition, dried paper is believed to be able to protect DNA in harsh conditions, and is commonly used to collect forensic samples (Smith and Burgoyne, (2004) BMC Ecology, 4(1): 4; Chaisomchit et al. (2005) Southeast Asian J Trop Med Public Health, 36(1): 270-273). Therefore, we believe the paper inside a ready-to-use devices can protect DNA primers, thus enabling stable results over a long period of time and long shelf life of the device, as shown in FIG. 6C. We investigated and compared the on-chip LAMP performance of the devices with paper inside and without paper inside over a period of two months at room temperature. We pre-coated LAMP primers of N. meningitidis in LAMP zones with paper inside or without paper inside. The two kinds of ready-to-use microfluidic chips were stored at the same conditions in dark. LAMP reactions were performed within 2 weeks, 4 weeks, 6 weeks and 8 weeks, respectively. LAMP products were quantified by using Nanodrop after each LAMP reaction to evaluate the on-chip LAMP performance. As shown in FIG. 2c, the nucleic acid concentration of LAMP product from LAMP zones without paper inside kept decreasing through the whole experimental period. A sharp decrease within the first two weeks was observed. At week 8, the on-chip LAMP performance decreased by 40%, which implied that the devices without paper inside were not able to provide consistent results over a period of time. Such devices without paper inside needed to be used right away. On the contrary, the on-chip LAMP performance from the device with paper inside maintained stable within two months. Only slight decrease (less than 6%) over time was observed. Therefore, we concluded that the introduction of paper in this hybrid microfluidic biochip as a primer storage substrate also enabled stable on-chip LAMP performance and longer shelf life than those without paper inside.

(69) N. meningitidis Detection Using Purified DNA.

(70) The feasibility of the PDMS/paper hybrid microfluidic platform for N. meningitidis detection was tested by using purified DNA. The N. meningitidis DNA template was obtained from bacterial culture and DNA isolation. By using this DNA template, we carried out the LAMP on chip. 25.5 L LAMP reaction mix were transported, including the PC DNA, through the inlet reservoir into the LAMP zones, where the specific LAMP primers for the target N. meningitidis and PC DNA sequences have been precoated (no primer was pre-coated in the LAMP zones for NC). After the inlet and outlets reservoirs were sealed, the microfluidic device was placed on a heating film at 63 C. for 45 minutes for LAMP reaction. A notable feature of the device design is that the channels in the middle PDMS layer were independent without connections, so that this could effectively prevent cross-talk among the LAMP zones with different purposes (NC, PC and N. meningitidis detection) from each other during the LAMP reaction.

(71) Before LAMP, the fluorescence detection reagent calcein is quenched by manganese ion. After LAMP, the reaction by product pyrophosphate ions form a complex with manganese. And the free calcein combines with a magnesium ion to produce bright fluorescence. Therefore, the detection result could be directly determined by eyes based on the fluorescence of the LAMP zones under portable UV light. Results showed that N. meningitidis and PC exhibited bright green fluorescence under portable UV light after the LAMP reaction, NC did not, which could be seen from the picture (FIG. 2a). This was consistent with the averaged grey value of the picture measured by ImageJ software (FIG. 2b), which is used to indicate the 70 brightness of a pixel. And here the averaged grey value was indicators for fluorescence intensities. The fluorescent intensity was further measured by the fluorescence microscope directly (FIG. 3b and FIG. 3d). The fluorescence intensity of the N. meningitidis LAMP products was about 6 times more than that of the NC.

(72) In addition, cured Epoxy could be uncovered after heating, and the LAMP products could be collected from each outlet for further analysis. The obvious difference could be seen even by naked eyes after collecting the LAMP products into small tubes, which were used for further gel electrophoresis to confirm the result. Results show that the N. meningitidis LAMP products exhibited very bright fluorescent while the NC mixture had no difference after LAMP reaction. As expected, the ladder pattern bands of the N. meningitidis products verified the success of the on chip LAMP.

(73) Direct Pathogen Detection on a PDMS/Paper Hybrid Microfluidic Platform.

(74) There have been reports on direct and rapid PCR detection for clinic samples or pathogenic bacteria by using special lysis reagent without inhibition (Liu et al. (2011), Lab on a Chip, 11: 1041-48; Burr et al. (2001), Plant Mol Biol Rep, 19: 367-71; Vickers et al. (2011) Eur J Clin Microbiol Infect Dis, 30: 447-53; Ke et al. (2007) Sensors and Actuators B: Chemical, 120: 538-44). But for LAMP reaction, traditional sample preparation procedures such as DNA isolation and purification are needed, which consume a lot of time and have a risk of contamination. According to a report, LAMP on chip for identifying bacteria directly was achieved by using bacterial lysis buffer and heating (80 C.) for DNA release from bacterium (Fang et al. (2012) Lab on a Chip, 12: 1495-99). However, it had a strict requirement for sealing of the DNA release chamber to generate enough vapor pressure to pump out the bacteria/lysis buffer mixture, and even though the recovery was still very low (1 L liquid was obtained from 10 L mixture).

(75) The inventors carried out direct pathogen detection, which integrated the bacteria lysis procedure with on chip LAMP reaction with simple and easy sample preparations. Instead of using isolated DNA template, artificial cerebrospinal fluid (ACSF)/pathogen mixture was prepared to mimic the real clinic samples for on chip LAMP reaction. Details were as follows: First, colony from cultured plates was swabbed by using an inoculation loop and mixed with 20 L ACSF buffer to prepare the ACSF/pathogen mixture. A tiny amount should be enough as it was just visible to the eyes (avoiding agar contamination). Then 2 L of this mixture was added into 18 L bacterial lysis buffer, and incubated at room temperature for about 10 minutes. At last, 2 L of the ACSF/pathogen mixture lysate was used in LAMP reaction mixture (same amount as using DNA template) for LAMP reaction. The results showed that the LAMP products of the ACSF sample could still produce strong fluorescence as previously (FIG. 3a-3d). And gel electrophoresis confirmed the success of the LAMP reaction (FIG. 3e). The direct pathogen detection was very significant because it indicated that real samples could be directly used for the on chip LAMP reaction without any laborious and time-consuming DNA isolation or purification pretreatment in advance.

(76) Calibration Curve for N. meningitidis.

(77) The visual fluorescence detection was a rapid and direct method for end-point LAMP pathogen detection, from which a yes or no qualitative answer for point of care (POC) detection was achieved based on the fluorescence of the LAMP products. However, it cannot achieve quantitative results. By using the versatile microfluidic platform, quantitative analysis was achieved by collecting LAMP products for further simple off-chip treatment. In brief, a serial of 10 fold diluted ACSF/pathogen mixture lysate were prepared for LAMP reaction, the nucleic acid concentration of which was measured by Nanodrop to get the initial copy number of released DNA based on one LAMP zone. After the LAMP reaction, LAMP products collected, purified, and measured for nucleic acid concentration by Nanodrop to obtain a calibration curve (FIG. 4). The result showed the nucleic acid concentration increased in proportion to the initial copy number of template DNA. Therefore, by measuring the nucleic acid concentration of the LAMP products from samples, one can infer the amount of the initial bacteria and how serious the infection is.

(78) Limit of Detection (LOD) for N. meningitidis.

(79) By using a serial of 10 fold diluted initial copy number of DNA template, the limit of detection was tested. The top left LAMP zones of the device were used for NC. The other LAMP zones were used for N. meningitidis DNA detection. The LOD of N. meningitidis was 3 copies per LAMP zone. This was identical when measured by fluorescent intensity, direct visual inspection or gel electrophoresis. The results showed that even the initial DNA template were as low as 3 copies per LAMP zone, the on chip LAMP products still exhibited strong fluorescence. However, when the initial DNA template was less than one copy, the fluorescence of the LAMP zones was as dim as the NC (FIG. 5). The gel electrophoresis confirmed the result (FIG. 5c). The band of the LAMP products with initial DNA template at or more than 3 copies indicated the success of the on chip LAMP reaction. FIG. 5c shows gel electrophoresis of on-chip LAMP products with a serial of diluted initial copy number of template DNA. Lanes 1-11: 100 bp marker; 310.sup.6; 310.sup.5, 310.sup.4, . . . , 310.sup.0, 310.sup.1, 310.sup.2 initial copies of template DNA per LAMP zone, NC.

(80) The inventors have developed a versatile PDMS/paper hybrid microfluidic platform for rapid and sensitive detection of N. meningitidis. Due to the integrated LAMP DNA amplification on the chip, the limit of detection of 3 DNA copies of N. meningitidis has been achieved within 45 minutes, overcoming lengthy assay time and low-sensitivity issues in conventional methods for the diagnosis of meningitis. This hybrid microfluidic platform incorporates the advantages of high performance in liquid control from PDMS and of high porosity from paper for pre-loading LAMP primers.

(81) The function of this hybrid microfluidic system is versatile. (1) Its on-chip LAMP detection based on calcein under portable UV light doesn't require any bulky specialized equipment without the use of any centrifuges and cumbersome procedures for DNA isolation and purification. The instrument-free detection makes the microfluidic system highly capable for the diagnosis of meningitis in the field or in other resource-limited settings. (2) The design of the microfluidic biochip allows on-chip LAMP products to be readily extracted for more confirmatory tests (e.g. gel electrophoresis) and quantitative analysis based on the calibration curve, as demonstrated in this work. This feature is suitable to the in-depth analysis and study of patient samples in clinical laboratory settings. Combining features (1) and (2) can provide a comprehensive examination of patient samples in different settings. For instance, after an initial qualitative assay of a patient sample in the field or resource-limited settings, the sample tested by the biochip can be sent back to a clinical laboratory for further confirmatory tests or quantitative analysis to examine the disease seriousness of infection. Moreover, by designing and changing different primers specific to other infectious diseases, this microfluidic platform can have great potential in quick and early diagnosis of a broad range of other infectious diseases, such as, whooping cough, malaria, H1N1, and severe acute respiratory syndrome (SARS), especially for developing nations.

Example 2

Multiplexed Detection

(82) As shown in FIG. 7, by increasing the number of channels on the top layer and corresponding LAMP wells in the middle layer, the microfluidic device is capable of multiplexed detection. Herein, simultaneous detection of N. meningitidis, S. pneumoniae detection and Hib is just one of such examples. However, the channels and LAMP zones can be further scaled up for simultaneous detection of more different types of pathogens.

(83) Direct Pathogenic Microorganisms Detection by Using ACSF Samples.

(84) Similar to Example I, the pathogen detections were first tested by using purified DNA. However, real clinical samples are usually from cerebrospinal fluid (CSF) or blood, which need special treatment for pathogen lysis and DNA release for DNA amplification. Traditional clinical sample preparation procedures such as DNA isolation and purification not only consume a lot of time, rely on specialized equipment in laboratories, but also increase the risk of contamination, which are not applicable for point of care pathogen detection.

(85) In this work, we developed a direct pathogen detection approach with simple and easy sample preparation. To mimic the real clinical samples, we prepared artificial cerebrospinal fluid (ACSF) samples with pathogenic microorganisms contained for microfluidic chip LAMP reaction and detection. As shown in FIGS. 8a and 8b, LAMP product from the three pathogens by using ACSF sample produced bright fluorescence under a portable UV light pen and fluorescent microscope, with the gray value and fluorescence intensity indicated in FIGS. 8c and 8d. Gel electrophoresis of LAMP product from the three pathogens showed the ladder-pattern bands (FIG. 8e), confirming the success of the microfluidic on-chip LAMP for simultaneous detection of these three pathogen.

(86) Similarly, the quantitation of the three pathogens can be performed using the indirect approach we developed in Example I.

(87) Limit of Detection (LOD).

(88) By using a serial of 10 fold diluted initial copy number of template DNA, the limit of detection for each pathogen was tested. The LOD of N. meningitidis, S. pneumoniae and Hib was 3 copies, 6 copies and 5 copies per LAMP zone, respectively. This was identical when measured by gray value, fluorescent intensity or gel electrophoresis. Results (FIG. 9) indicated that even when the initial template DNA was as low as a few copies per LAMP zone, LAMP products still exhibited strong fluorescence. However, when the initial template DNA was less than one copy, the fluorescence of the LAMP zones was not lit up. Based on 3 fold standard deviations of the mean gray value of the negative controls on the basis of the negative control, the gray value of the cutoff line for N. meningitidis, S. pneumoniae and Hib was calculated, which was 48.1, 41.3 and 42.5 respectively. The gray value of the LAMP product from 3 copies of initial DNA template of N. meningitidis, 6 copies of initial DNA template of S. pneumoniae and 5 copies of initial DNA template of Hib was much higher than that of cutoff line. Gel electrophoresis confirmed the result.