Biosensor based on Gβγ-interacting proteins to monitor G-protein activation
10877036 · 2020-12-29
Assignee
Inventors
- Michel Bouvier (Montréal, CA)
- Christian Le Gouill (Montréal, CA)
- Mireille Hogue (Laval, CA)
- Viktoriya Lukasheva (Pointe-Claire, CA)
Cpc classification
C12Y113/12007
CHEMISTRY; METALLURGY
G01N21/6428
PHYSICS
C07K14/723
CHEMISTRY; METALLURGY
C07K2319/60
CHEMISTRY; METALLURGY
G01N33/566
PHYSICS
C12N9/0069
CHEMISTRY; METALLURGY
G01N33/542
PHYSICS
G01N2333/726
PHYSICS
C07K2319/01
CHEMISTRY; METALLURGY
G01N2500/02
PHYSICS
International classification
G01N33/566
PHYSICS
Abstract
Resonance energy transfer (RET)- or protein-fragment complement assay (PCA)-based biosensors useful for assessing the activity of G-proteins are described. These biosensors are based on the competition between the G subunit and a G interacting protein ( IP) for the binding to the G dimer. These biosensors comprises (1) a IP and (2) a G or G protein; a GPCR; or a plasma membrane targeting domain, fused to suitable RET or PCA tags. Methods using such biosensors for different applications, including the identification of agents that modulates G-protein activity or for the characterization of GPCR signaling/regulation, such as G-protein preferences and activation profiles of GPCRs, are also described.
Claims
1. A biosensor system for detecting G-protein activity, said biosensor system comprising: (i) a first biosensor comprising: a first component comprising a GRK2 or GRK3 protein fused to the amino-terminal of (a) a bioluminescence resonance energy transfer (BRET) donor; or (b) a BRET acceptor; and a second component comprising a G protein and a G5 protein, wherein said G5 protein is fused to the carboxy-terminal of (a) a BRET donor; or (b) a BRET acceptor; (ii) a second biosensor comprising: the first and second components defined in (i); and a third component comprising a recombinant G protein; wherein (a) if said GRK2 or GRK3 protein is fused to said BRET donor, said G5 protein is fused to said BRET acceptor; (b) if said GRK2 or GRK3 protein is fused to said BRET acceptor, said G5 protein is fused to said BRET donor.
2. The biosensor system of claim 1, wherein said GRK2 or GRK3 protein is fused to said BRET acceptor and said G5 protein is fused to said BRET donor.
3. The biosensor system of claim 1, wherein said BRET donor is a bioluminescent protein.
4. The biosensor system of claim 3, wherein said bioluminescent protein is a luciferase.
5. The biosensor system of claim 1, wherein said BRET acceptor is a green fluorescent protein (GFP).
6. The biosensor system of claim 1, wherein the first component further comprises a plasma membrane (PM)-targeting moiety fused to (i) said GRK2 or GRK3 protein or (ii) said BRET donor or BRET acceptor.
7. The biosensor system of claim 6, wherein said PM-targeting moiety is fused at the C-terminus of said BRET donor or BRET acceptor.
8. The biosensor system of claim 6, further comprising a flexible linker between (i) said BRET donor or BRET acceptor and (ii) said PM-targeting moiety.
9. The biosensor system of claim 8, wherein said flexible linker has a length corresponding to about 50 to about 500 amino acids.
10. The biosensor system of claim 1, wherein said recombinant G protein is human G.sub.q, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G.sub.t-cone, G.sub.t-rod, G.sub.t-gust, G.sub.z, G.sub.oA, G.sub.oB, G.sub.olf, G.sub.11, G.sub.12, G.sub.13, G.sub.14, and G.sub.15/G.sub.16 protein, or promiscuous or non-selective G variant thereof.
11. The biosensor system of claim 1, wherein said first component comprises a GRK2 protein.
12. The biosensor system of claim 1, wherein the G protein in said first and second biosensors is a recombinant G protein.
13. The biosensor system of claim 1, wherein the biosensor system further comprises a G-protein-coupled receptor (GPCR).
14. The biosensor system of claim 1, wherein the biosensor system comprises a plurality of second biosensors, wherein each of said second biosensors comprises a different recombinant G protein.
15. The biosensor system of claim 14, wherein said different recombinant G proteins are at least two of the following G proteins: G.sub.q, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G.sub.t-cone, G.sub.t-rod, G.sub.t-gust, G.sub.z, G.sub.oA, G.sub.oB, G.sub.olf, G.sub.11, G.sub.12, G.sub.13, G.sub.14, and G.sub.15/G.sub.16.
16. A method for determining whether a G protein is activated by a GPCR agonist, said method comprising: (a) measuring the signal emitted by said BRET acceptor or reporter protein in the presence and absence of said GPCR agonist in the first and second biosensors of the biosensor system of claim 1, and (b) identifying whether the G protein is activated by said GPCR agonist based on the signal emitted by said BRET acceptor; wherein a higher increase of the signal measured in the presence of the GPCR agonist in said second biosensor relative to said first biosensor is indicative that the G protein is activated by said GPCR agonist, and wherein a similar or lower increase, or a decrease, of the signal measured in the presence of the GPCR agonist in said second biosensor relative to said first biosensor is indicative that said the G protein is not activated by said GPCR agonist.
17. A method for determining whether a test agent is an inhibitor or activator of a G protein of interest, said method comprising: (1) contacting the second biosensor(s) defined in claim 1 with a GPCR agonist or antagonist, wherein said recombinant G protein corresponds to said G protein of interest; (2) measuring the signal emitted by said BRET acceptor in the presence and absence of said test agent; and (3) determining whether said test agent is an inhibitor or activator of said G protein, wherein (i) a lower signal measured in the presence of the test agent following contacting with said GPCR agonist is indicative that said test agent is an inhibitor of said G protein of interest, and a similar or higher signal measured in the presence of the test agent following contacting with said GPCR agonist is indicative that said test agent is not an inhibitor of said G protein of interest; or (ii) a higher signal measured in the presence of the test agent following contacting with said GPCR antagonist is indicative that said test agent is an activator of said G protein of interest, and a similar or lower signal measured in the presence of the test agent following contacting with said GPCR antagonist is indicative that said test agent is not an activator of said G protein of interest.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1) In the appended drawings:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DISCLOSURE OF INVENTION
(24) Terms and symbols of genetics, molecular biology, biochemistry and nucleic acids used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like. All terms are to be understood with their typical meanings established in the relevant art.
(25) The articles a and an are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element. Throughout this specification, unless the context requires otherwise, the words comprise, comprises and comprising will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
(26) In the studies described herein, the present inventors have shown that a IP-competition-based biosensor may be used to monitor G-protein activation, without the need to modify the receptor and/or the G subunits. As it is based on competition, a single biosensor is needed to study all the different G-proteins and establish G-protein activation/coupling profiles based on the co-transfected G subunit. G-protein activation profiles are not only important for characterizing receptors and drug targets, but may also be useful in the drug discovery process for identifying, characterizing and optimizing GPCR5 ligands with biased signaling properties associated with therapeutic efficacy and reduced side effects.
(27) The present disclosure relates to a universal biosensor for monitoring G-protein activation, without having to modify either G protein subunits or G-protein activators (such as G-protein-coupled receptors (GPCR), activators of G-protein signaling (AGS), regulators of G-protein signaling or other chemical and biological entities). More specifically, the disclosure relates to the use of a G-interacting protein IP) to monitor the activation of the various hetero-trimeric G-proteins. Advantageously, the signaling biosensor disclosed herein allows for a sensitive and quantitative assay which can be used in large-scale screening assays and structure-activity relationship studies for the identification of ligands (agonists, antagonists, inverse agonists, allosteric modulators, etc.) targeting G-protein activity. Additionally, the biosensor disclosed herein represents a tool for assessing G-protein activation profiles and allows for compound profiling by addressing which specific G-proteins are activated upon stimulation.
(28) As shown in
(29) The present inventors have also shown that it is possible to monitor G-protein activation using a biosensor that measures the recruitment/localization of a IP (e.g., GRK), tagged with a BRET donor (e.g., RLuc), at the plasma membrane (where it interacts with the G complex bound to the GPCR) using a plasma membrane-targeting moiety tagged with a complementary BRET acceptor (e.g., rGFP). The increase in the concentration/density of IP at the plasma membrane, an indirect measure of the recruitment of the IP to the G complex, is detected by an increase in the BRET signal.
(30) The present inventors have further shown that it is possible to monitor G-protein activation using a biosensor that measures the recruitment of a IP (e.g., GRK), tagged with a BRET donor (e.g., RLuc), to a GPCR-tagged with a complementary BRET acceptor (e.g., rGFP) (
(31) In this context, the present disclosure relates to a IP-based G-protein activation biosensor and a system using such biosensor to assess activation of specific G-proteins promoted by their activators. The system comprises a G-protein activator; a G protein; and the biosensor described herein. The present disclosure further relates to a method for detecting G-proteins activation using the system disclosed herein.
(32) The present disclosure thus relates to a biosensor system for detecting G-protein activity, said biosensor system comprising the elements defined in (A) or (B): (A) (i) a first biosensor comprising: a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; and a second component comprising a fused G protein or a fused G protein, wherein said G protein or said G protein is fused to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; (ii) a second biosensor comprising: the first and second components defined in (i); and a third component comprising a recombinant G protein; wherein (a) if said IP is fused to said RET donor, said G or G protein is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said G or G protein is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said G or G protein is fused to said second fragment of said reporter protein; or (B) (i) a biosensor comprising a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; a second component comprising a fused G-protein coupled receptor (GPCR), wherein said GPCR is fused at its C-terminal to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; a third component comprising a recombinant G protein; wherein (a) if said IP is fused to said RET donor, said GPCR is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said GPCR is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said GPCR is fused to said second fragment of said reporter protein.
(33) The present disclosure thus relates to a biosensor comprising: (1) a first component comprising a G-interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; (2) a second component comprising a fused G protein or a fused G protein, wherein said G protein or said G protein is fused to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; (3) a third component comprising a recombinant G protein, wherein said recombinant G protein is a promiscuous or non-selective G protein, for example a G protein comprising a mutations at a position corresponding to residue 66, 67 and/or 75 of human G.sub.q, as described herein. In an embodiment, the biosensor further comprises a GPCR (native or recombinant), preferably an orphan GPCR.
(34) In an embodiment, the biosensor defined above further comprises a recombinant G protein and/or a recombinant G protein. In a further embodiment, the biosensor defined above further comprises a recombinant G protein and a recombinant G protein. In an embodiment, the biosensor defined above further comprises a GPCR, in a further embodiment a recombinant GPCR.
(35) In another aspect, the present disclosure thus relates to a biosensor comprising (i) a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; and (ii) a second component comprising a fused plasma membrane (PM)-targeting moiety, wherein said PM-targeting moiety is fused to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; wherein (a) if said IP is fused to said RET donor, said PM-targeting moiety is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said PM-targeting moiety is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said PM-targeting moiety is fused to said second fragment of said reporter protein.
(36) In one non-limiting embodiment, activity of the herein described biosensor is detectable based on a technique selected from resonance energy transfer (RET) such as bioluminescence resonance energy transfer (BRET) or fluorescence resonance energy transfer (FRET); protein complementation assay or protein-fragment complement assay (PCA) such as enzyme fragment complementation (EFC) or bimolecular fluorescence complementation (BiFC); and the like (see
(37) In resonance energy transfer approaches, the IP and G are tagged with an energy donor and acceptor, and upon G-protein activation, an increase in RET signal is observed. In the case of protein complementation assay, the IP and G are tagged with fragments of a reporter protein, such as a fluorescent protein or luminescent enzyme, and following G-protein activation, the complementation of the two fragments will lead to an increase in the reporter protein signal, for example the fluorescence signal or enzyme activity.
(38) Resonance energy transfer (abbreviated RET) is a mechanism describing energy transfer between two chromophores, having overlapping emission/absorption spectra. When the two chromophores (the donor and the acceptor), are within a short distance (e.g., 10-100 Angstroms) of one another and their transition dipoles are appropriately oriented, the donor chromophore is able to transfer its excited-state energy to the acceptor chromophore through non-radiative dipole-dipole coupling. One type of RET is Bioluminescence Resonance Energy Transfer (BRET) that is based on the non-radiative transfer of energy between a donor bioluminophore (bioluminescent enzyme such as luciferase) and an acceptor fluorophore (ex: GFP or YFP). Another type of RET is Fluorescence Resonance Energy Transfer (FRET) involves the transfer of energy from an excited donor fluorophore to an adjacent acceptor fluorophore. For example, CFP and YFP, two color variants of GFP, can be used as donor and acceptor, respectively.
(39) As used herein, the term fluorescent protein refers to any protein that becomes fluorescent upon excitation at an appropriate wavelength. A broad range of fluorescent proteins have been developed that feature fluorescence emission spectral profiles spanning almost the entire visible light spectrum. Non-limiting examples of green Fluorescent Protein include EGFP, GFP10, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire. Non-limiting Examples of blue fluorescent protein include EBFP, EBFP2, Azurite and mTagBFP. Non-limiting examples of Cyan Fluorescent proteins include ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1 (Teal). Non-limiting examples of Yellow fluorescent proteins include EYFP, Topaz, Venus, mVenus, mCitrine, mAmetrine, YPet, TagYFP, PhiYFP, ZsYellow1 and mBanana. Non-limiting Examples of orange fluorescent proteins include Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, DsRed, DsRed2, DsRed-Express (T1), DsRed-Monomer and mTangerine. Non-limiting Examples of red fluorescent proteins include mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum and AQ143.
(40) Overlap as used in the context of the present invention refers to the ability of the emitted light from a donor fluorescent protein or a luminescent enzyme (e.g., luciferase) to be of a wavelength capable of excitation of a fluorophore (acceptor fluorescent protein) placed in close proximity, usually within about 10-100 (about 1-10 nm). Accordingly, the donor fluorescent or luminescent protein and the acceptor fluorescent protein are selected so as to enable the transfer of energy from the donor fluorescent or luminescent protein, attached to a first component of the biosensor, to the acceptor fluorescent protein attached to a second component of the biosensor, when the first and second components are in close proximity (i.e., in the form of a complex or in the same cellular compartment, such as the plasma membrane). Such transfer of energy is commonly referred to as Fluorescence (or Frster) Resonance Energy Transfer or FRET (if the donor protein is a fluorescent protein), or Bioluminescence Resonance Energy Transfer or BRET (if the donor protein is a bioluminescent protein). Thus, any combination of donor fluorescent or luminescent protein and acceptor fluorescent proteins may be used in accordance with the present invention as long as the above criteria are met. Such combinations are typically referred as FRET or BRET pairs. The choice of a suitable fluorophore for use in a BRET assay will be known to one of skill in the art. In one embodiment, fluorophores include green fluorescent protein-wild type (GFP-wt), yellow fluorescent protein (YFP), Venus, Topaz, ZsYellow1, mOrange2, mKeima, blue fluorescent protein (BFP), cyan fluorescent protein (CFP), Tsapphire, mAmetrine, green fluorescent protein-2 (GFP2), renilla GFP (rGFP) and green fluorescent protein-10 (GFP10), or variants thereof. Fluorescent proteins having an excitation peak close to 400 nm may be particularly suitable. More particular examples of fluorophores include mAmetrine, cyan fluorescent protein (CFP), and GFP10. Representative examples of FRET pairs include BFP/CFP, BFP/GFP, BFP/YFP, BFP/DsRed, CFP/GFP, CFP/YFP, CFP/mVenus, GFP/YFP, GFP2/YFP, GFP/DsRed, TagBFP/TagGFP2, TagGFP2/TagRFP and the like (see, e.g., Mller et al., Front. Plant Sci., 4: 413, 2013). Representative examples of BRET pairs include luciferase (Luc)/GFP, LucNenus, Luc/Topaz, Luc/GFP-10, Luc/GFP-2, Luc/YFP, Luc/rGFP, and the like.
(41) As used herein, the term luciferase refers to the class of oxidative enzymes used in bioluminescence and which is distinct from a photoprotein. One example is the firefly luciferase (EC 1.13.12.7) from the firefly Photinus pyralis (P. pyralis luciferase). Several recombinant luciferases from several other species including luciferase from Renilla reniformis (GENBANK: AAA29804) and variants thereof (e.g., a stable variant of Renilla Luciferase e.g., RlucII (GENBANK: AAV52877.1), Rluc8 (GENBANK: EF446136.1) Gaussia Luciferase (Gluc, GENBANK: AAG54095.1), NanoLuc Luciferase (Promega) are also commercially available. Any luciferase can be used in accordance with the present invention as long as it can metabolize a luciferase substrate such as luciferins. Luciferins are a class of light-emitting heterocyclic compounds that are oxidized in the presence of luciferase to produce oxyluciferin and energy in the form of light. Non-limiting examples of luciferins include D-luciferin, imidazopyrazinone-based compounds such as coelenterazine (coelenterazine 400A (DeepBlueC), coelenterazine H and e-coelenterazine derivatives such as methoxy e-Coelenterazine (Prolume Purple I from NanoLight Technology), ViviRen (from Promega), Latia luciferin ((E)-2-methyl-4-(2,6,6-trimethyl-1-cyclohex-1-yl)-1-buten-1-ol formate), bacterial luciferin, Dinoflagellate luciferin, etc. Luciferase substrates may have slightly different emission spectra and will thus be selected to favor the optimal energy transfer to the acceptor. In an embodiment, the luciferase is wild-type (or native) Renilla Luciferase. In an embodiment, the luciferase is the stable variant of Renilla luciferase Rluc8. In another embodiment, the luciferase is Gaussia luciferase (GLuc). In a specific embodiment, the luciferase is Renilla Luciferase II (RlucII) and the luciferin is coelenterazine 400A.
(42) In an embodiment, one of the following BRET configurations is used in the biosensors and methods described herein: BRET1 that comprises coelenterazine-h (coel-h) and a YFP (YFP) or a GFP from Renilla (rGFP); BRET2 that comprises coelenterazine-400a (coel-400a) and a UV-excited (uvGFP) or a GFP from Renilla (rGFP); or BRET3 that comprises coel-h or v-coelenterazine (from Nanolight Technology) and the monomeric orange FP (mOrange). In a further embodiment, RLucII is used in the above-noted BRET configurations. In another embodiment, one of the following BRET configurations is used in the biosensors and methods described herein: RlucII/coel-400a/enhanced blue (EB) FP2, RlucII/coel-400a/super cyan fluorescent protein (SCFP3A), RlucII/coel-400a/mAmetrine or RlucII/coel-400a/GFP10. In an embodiment, the BRET donor is a Renilla luciferase (e.g., RLucII) and the BRET acceptor is a Renilla GFP (e.g., Renilla reniformis GFP).
(43) In PCA, each of the proteins (e.g., IP and G/G, or GPCR) is covalently linked to incomplete fragments of a reporter protein, and the interaction between IP and G/G brings the fragments of the reporter protein in close enough proximity to allow them to form a functional reporter protein whose activity can be measured. Any protein that can be split into two parts and reconstituted non-covalently may be used in the PCA-based biosensor. The term reporter protein refers to a protein that can be detected (e.g., by fluorescence, spectroscopy, luminometry, etc.) easily and that is not present normally (endogenously) in the system used. Typical reporter proteins used in PCA include enzymes (whose activity may be measured using a suitable substrate) such as dihydrofolate reductase (DHFR), -lactamase, -galactosidase or proteins that give colorimetric or fluorescent signals such as a luciferase (e.g., Renilla luciferase), GFP and variants thereof.
(44) In another non-limiting embodiment, the RET or PCA tags are located on: (i) the IP and the G protein, or (ii) the IP and the G protein. In a further non-limiting embodiment, the IP and the G or G subunits are tagged at their N-terminus, C-terminus or at any internal region within the proteins. In one embodiment, the IP and the G or G subunits are tagged at their N-terminus or C-terminus. In one non-limiting embodiment, the herein described PCA tags added to the IP and the G or G subunits can be, without being limited to, a fluorophore, a luciferase or a fragment thereof comprising a portion of a fluorescent protein or luminescent enzyme.
(45) GPCR refers to full length native GPCR molecules as well as mutant/variant GPCR molecules. A list of GPCRs is given in Foord et al (2005) Pharmacol Rev. 57, 279-288, which is incorporated herein by reference, and an updated list of GPCRs is available in the IUPHAR-DB database (Harmar A J, et al. (2009) IUPHAR-DB: the IUPHAR database of G protein-coupled receptors and ion channels. Nucl. Acids Res. 37 (Database issue): D680-D685; Sharman J L, et al., (2013) IUPHAR-DB: updated database content and new features. Nucl. Acids Res. 41 (Database Issue): D1083-8; Alexander S P H, Benson H E, Faccenda E, Pawson A J, Sharman J L, Spedding M, Peters J A and Harmar A J, CGTP Collaborators. (2013) The Concise Guide to PHARMACOLOGY 2013/14: G Protein-Coupled Receptors. Br J Pharmacol. 170: 1459-1581). In an embodiment, the GPCR is an orphan GPCR. The term orphan GPCR as used herein refers to an apparent receptor that has a similar structure to other identified GPCRs but whose endogenous ligand has not yet been identified. GPCR orphan receptors are often given the name GPR followed by a number, for example GPR1. An updated list of orphan GPCRs is available in the IUPHAR-DB database described above.
(46) In an embodiment, the GPCR is fused at its C-terminal to a RET donor or RET acceptor, in a further embodiment a RET donor, such as a luciferase (RLuc).
(47) The term recombinant as used herein refers to a protein molecule which is expressed from a recombinant nucleic acid molecule, i.e. a nucleic acid prepared by means of molecular biology/genetic engineering techniques, for example a protein that is expressed following transfection/transduction of a cell (or its progeny) with a nucleic acid (e.g., present in a vector) encoding the protein (as opposed to a protein that is naturally expressed by a cell).
(48) The term variant (or mutant) as used herein refers to a protein which is substantially similar in structure (amino acid sequence) and biological activity to the corresponding native protein. It includes fragments comprising one or more domains of a native protein, as well as fusion proteins comprising the native protein or a fragment thereof. A variant may comprises one or more mutations (substitutions, deletions, insertions) relative to the native protein in order to generate a protein having certain desired features, for example being constitutively active, inactive, altered binding to one or more ligands, etc. Individual substitutions, deletions or additions that alter, add or delete a single amino acid or-nucleotide or a small percentage of amino acids or nucleotides in the sequence create a conservatively modified variant, where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants and alleles of the invention.
(49) Homology or identity and homologous or identical refer to sequence and/or structural similarity between two polypeptides or two nucleic acid molecules. Homology/identity can be determined by comparing each position in the aligned sequences. A degree of homology/identity between nucleic acid or between amino acid sequences is a function of the number of identical or matching nucleotides or amino acids at positions shared by the sequences. As the term is used herein, a nucleic acid sequence is homologous to another sequence if the two sequences are substantially identical and the functional activity of the sequences is conserved (as used herein, the term homologous does not infer evolutionary relatedness). Two nucleic acid sequences are considered substantially identical if, when optimally aligned (with gaps permitted), they share at least about 50% sequence similarity or identity, or if the sequences share defined functional motifs. In alternative embodiments, sequence similarity in optimally aligned substantially identical sequences may be at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%. As used herein, a given percentage of homology/identity between sequences denotes the degree of sequence identity in optimally aligned sequences. An unrelated or non-homologous sequence shares less than 40% identity, though preferably less than about 25% identity, with any of the sequences described herein.
(50) In one non-limiting embodiment, the system includes a living cell, a membrane preparation, or both. The system defined herein is, but not limited to, a membrane preparation and said IP is tethered to the membrane via a membrane targeting linker, for example a protein/peptide linker comprising a plasma membrane (PM)-targeting domain (e.g., a plasma membrane-anchoring signal peptide). This plasma membrane-targeting domain may be, without being limited thereto, a lipid group covalently bound to the peptide chain such as palmitoylation, myristoylation or prenylation modifications (as the membrane anchoring signal from KRAS for example (Hancock 2003)), a transmembrane domain, or a polybasic region (as the one present in GRK5 for instance).
(51) In an embodiment, the PM-targeting moiety comprises a CAAX motif (C is cysteine residue, AA are two aliphatic residues, and X represents any amino acid. CAAX motifs are found in CAAX proteins that are defined as a group of proteins with a specific amino acid sequence at C-terminal that directs their post translational modification. CAAX proteins encompass a wide variety of molecules that include nuclear lamins (intermediate filaments) such as prelamin A, lamin B1 and lamin B2, Ras and a multitude of GTP-binding proteins (G proteins) such as Ras, Rho, Rac, and Cdc42, several protein kinases and phosphatases, etc. (see, e.g., Gao et al., Am J Transl Res. 2009; 1(3): 312-325). The proteins that have a CAAX motif or box at the end of the C-terminus typically need a prenylation process before the proteins migrate to the plasma membrane or nuclear membrane and exert different functions. In an embodiment, the CAAX box is derived from a human RAS family protein, for example HRAS, NRAS, Ral-A, KRAS4A or KRAS4B. The last C-terminal residues of RAS, NRAS, KRAS4A or KRAS4b (referred to as the hypervariable region or HVR) are depicted below, with the putative minimal plasma membrane targeting region in italics and the CAAX box underlined (see, e.g., Ahearn et al., Nature Reviews Molecular Cell Biology 13: 39-51, January 2012): HRAS: KLNPPDESGPGCMSCKCVLS; (SEQ ID NO:40); NRAS: KLNSSDDGTQGCMGLPCVVM; (SEQ ID NO: 41); KRAS4A: KISKEEKTPGCVKIKKCIIM; (SEQ ID NO:42); KRAS4B: KMSKDGKKKKKKSKTKCVIM; (SEQ ID NO:43); Ral-A/Ral1: KNGKKKRKSLAKRIRERCCIL (SEQ ID NO:44). In an embodiment, the membrane targeting moiety comprises the last 4 residues of the sequences depicted above. In a further embodiment, the membrane targeting moiety comprises the last 10 residues of the sequences depicted above. In an embodiment, the membrane targeting moiety comprises the C-terminal portion (e.g., about the last 10-30 or 15-25 amino acids) of a CAAX protein, for example a human RAS family protein, e.g., about the last 10-30, 15-25 or 20 amino acids of a human RAS family protein.
(52) In an embodiment, the PM-targeting moiety comprises the sequence KKKKKKSKTKCVIM (SEQ ID NO: 37) from KRAS4B. In another embodiment, the PM targeting moiety comprises the the plasma-membrane targeting palmitoylation sequence from hRas and prenylation signal sequence from Ral-A/Ral1 (sequence: CMSCKCCIL, SEQ ID NO:45).
(53) Several proteins also contain a non-lipid, polybasic domain that targets the PM such as Ras small GTPases, phosphatase PTEN, nonreceptor tyrosine kinase Src, actin regulators WASP and MARCKS, and G protein-coupled receptor kinases (GRKs) such as GRK5. In an embodiment, the polybasic domain is from GRK5, and comprises the sequence SPKKGLLQRLFKRQHQNNSKS (SEQ ID NO:46). In an embodiment, the PM-targeting moiety is fused at the C-terminal end of a RET donor or acceptor, and in a further embodiment a RET acceptor such as a GFP (e.g., rGFP). In another embodiment, the PM-targeting moiety is fused at the C-terminal end of a RET donor or acceptor, and in a further embodiment a RET acceptor such as a GFP (e.g., rGFP), and the RET donor or acceptor is fused at its N-terminal to a IP, such as a GRK protein or a G-interacting fragment/variant thereof.
(54) According to the present disclosure, G-protein activator include, but is not limited to, classical activation of G-proteins by GPCRs and other proteins that can also modulate the activity of these hetero-trimeric G-proteins, such as regulators of G-protein signaling (RGS), activators of G-protein signaling (AGS), and resistance to inhibitors of cholinesterase 8 proteins (Ric-8). In some of these non-canonical signaling pathways, the guanine exchange factor (GEF) activity classically exerted by GPCRs is replaced by another protein such as Ric-8 for example (Boularan and Kehrl, 2014).
(55) In one embodiment, the G-protein activator is a member of the GPCR family.
(56) G protein subunit as defined herein includes, but is not limited to, the 17 different known isoforms, their splice variants, and any mutated G proteins, for example those leading to non-selective/promiscuous G. In one non-limiting embodiment, the herein described G protein is selected amongst any of the natural mammalian G proteins, which includes G.sub.q, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G.sub.t-cone, G.sub.t-rod, G.sub.t-gust, G.sub.z, G.sub.on, G.sub.oB, G.sub.olf, G.sub.11, G.sub.12, G.sub.13, G.sub.14, and G.sub.15/16 (now designated GNA15), the splice variants of these isoforms, as well as functional variants thereof. In an embodiment, the G protein subunit is of the G, family. In an embodiment, the G protein subunit is of the G.sub.s family. In an embodiment, the G protein subunit is of the G.sub.q family. In an embodiment, the G protein subunit is of the G.sub.12.13 family. In an embodiment, the G protein is a promiscuous or non-selective G protein. In a further embodiment, the G protein is a mutated G proteins (e.g., G.sub.q proteins) having a substitution at any of the following positions, G66, Y67, F75 and any combinations thereof, or equivalent conserved substitution in other G subtypes, which results in non-selective G proteins that are activated by any GPCRs), including orphan receptors (i.e. that are able to interact with GPCRs independently from the preferential natural coupling of these receptors to specific G proteins, also commonly referred to as promiscuous G proteins), are also included in the present disclosure. In an embodiment, the recombinant G protein used in the biosensors/methods described herein is a promiscuous G protein, and the GPCR is an orphan GPCR.
(57) In another aspect, the present disclosure relates to a mutated G polypeptide comprising a mutation at a position corresponding to residue 67 and/or residue 75 of human G.sub.q protein. Said mutation may be an insertion, deletion, or a substitution, for example a non-conservative substitution.
(58) In an embodiment, the present invention relates to a mutated G polypeptide comprising any one of the sequences set forth in SEQ ID NOs:1-17, wherein the residue corresponding to residue 67 and/or residue 75 of human G.sub.q protein is mutated. In an embodiment, the mutation is at a position corresponding to residue 67 of human G.sub.q protein. In an embodiment, the mutation is at a position corresponding to residue 67 and is a substitution for a non-aromatic residue, in a further embodiment cysteine. In another embodiment, the mutation is at a position corresponding to residue 75 of human G.sub.q protein, and is a substitution for a non-aromatic residue, in a further embodiment the non-aromatic residue is glycine. Such mutated G polypeptide may be used in any of the biosensors and/or methods described herein. In one non-limiting embodiment, the mutated G.sub.q protein comprises one of the following substitutions, G.sub.qG66K, G.sub.qY67C and G.sub.qF75G, resulting in non-selective G proteins.
(59) In another aspect, the present disclosure relates to a nucleic acid comprising a sequence encoding the above-defined mutated G polypeptide. In another aspect, the present disclosure relates to a plasmid or vector comprising the above-defined nucleic acid. In another aspect, the present disclosure relates to a cell (host cell) comprising the above-defined nucleic acid or vector. In another aspect, the present invention provides a kit comprising a nucleic acid encoding the mutated G polypeptide defined herein. In an embodiment, the cell has been transfected or transformed with a nucleic acid encoding the mutated G polypeptide defined herein. The invention further provides a recombinant expression system, vectors and cells, such as those described above, for the expression of the mutated G polypeptide defined herein, using for example culture media and reagents well known in the art. The cell may be any cell capable of expressing mutated G polypeptide defined above. Suitable host cells and methods for expression of proteins are well known in the art. Any cell capable of expressing the mutated G polypeptide defined above may be used. For example, eukaryotic host cells such as mammalian cells may be used (e.g., rodent cells such as mouse, rat and hamster cell lines, human cells/cell lines). In another embodiment, the above-mentioned cell is a human cell line, for example an embryonic kidney cell line (e.g., HEK293 or HEK293T cells).
(60) In embodiments, the herein described G protein is selected amongst any of the known G proteins, which includes G1, G2, G3 (e.g., a short variant of G3, G3sh), G4 and G5
(61) (G5-S or G5-L), the splice variants of these isoforms, and functional variants thereof. In a further embodiment, the G protein is G1. In another embodiment, the G protein is G3. In a further embodiment, the G protein (e.g., G1) is N-terminally tagged with a BRET acceptor, such as a GFP.
(62) In embodiments, the herein described G protein is selected amongst any of the known human G proteins, which include G1, G2, G3, G4, G5, G7, G8, G.sub.19, G10, G11, G12 and G13, and functional variants thereof. In a further embodiment, the G protein is G5. In a further embodiment, the G protein (e.g., G5) is N-terminally tagged with a BRET donor, such as a luciferase. In another embodiment, the G protein (e.g., G5) is N-terminally tagged with a BRET acceptor, such as a GFP. In another embodiment, the G protein (e.g., G5) is N-terminally tagged with a first domain of a PCA-compatible reporter protein, e.g. a luciferase (e.g., Renilla luciferase).
(63) In an embodiment, the herein described IP is a protein that interacts with G dimer upon dissociation of the G heterotrimer and that comprises a pleckstrin homology (PH) domain, such as a G-protein coupled receptor kinase (GRK) protein (GRK2 or GRK3) or functional fragment thereof that comprises the C-terminal pleckstrin homology (PH) domain of a GRK protein (i.e. that maintain the ability to interact with a G dimer), a pleckstrin homology domain containing family G (with RhoGef domain) member 2 (PLEKHG2). The amino acid sequences of GRK2, GRK3 and PLEKHG2 are depicted in
(64) In embodiments, the domains of the fusion molecules described herein may be covalently linked either directly (e.g., through a peptide bond) or indirectly via a suitable linker moiety, e.g., a linker of one or more amino acids or another type of chemical linker (e.g., a carbohydrate linker, a lipid linker, a fatty acid linker, a polyether linker, PEG, etc. In an embodiment, one or more additional domain(s) may be inserted before (N-terminal), between or after (C-terminal) the domains defined above. In an embodiment, the domains of the fusion molecules are covalently linked through a peptide bond. In another embodiment, one or more of the components of the fusion molecules are linked through a peptide linker. Linkers may be employed to provide the desired conformation of the BRET/FRET label chromophores within the labeled compound, e.g., including the separation between chromophores in a BRET/FRET pair. The linkers may be bound to the C-terminal, the N-terminal, or at an intermediate position. In one embodiment, the linkers are peptide linkers, typically ranging from 2 to 30 amino acids in length, for example about 5 to about 20-25 amino acids. The composition and length of each of the linkers may be chosen depending on various properties desired such as flexibility and aqueous solubility. For instance, the peptide linker may comprise relatively small amino acid residues, including, but not limited to, glycine; small amino acid residues may reduce the steric bulk and increase the flexibility of the peptide linker. The peptide linker may also comprise polar amino acids, including, but not limited to, serine. Polar amino acid residues may increase the aqueous solubility of the peptide linker. Furthermore, programs such as Globplot 2.3 (Linding et al., GlobPlot: exploring protein sequences for globularity and disorder, Nucleic Acid Res 2003Vol. 31, No. 13, 3701-8), may be used to help determine the degree of disorder and globularity, thus also their degree of flexibility. In an embodiment, the peptide linker comprises one or more of the amino acid sequences disclosed in the Examples below.
(65) In one non-limiting embodiment, as illustrated in
(66) In one embodiment, the present disclosure relates to a system comprising: a GPCR; a G protein selected from the following: G.sub.q, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G.sub.t-cone, G.sub.t-rod, G.sub.t-gust, G.sub.z, G.sub.oA, G.sub.oB, G.sub.olf, G.sub.11, G.sub.12, G.sub.13, G.sub.14, and G.sub.15116, and mutated non-selective G proteins as described herein; a signaling biosensor comprising a GRK protein (GRK2 or GRK3) or fragment thereof that comprises the C-terminal pleckstrin homology (PH) domain of the GRK, tagged with a fluorophore, a luciferase or a fragment thereof comprising a portion of a fluorescent protein or luminescent enzyme, a G protein and a G protein, wherein the G protein or the G protein is tagged with a fluorophore, a luciferase or a fragment thereof comprising a portion of a fluorescent protein or luminescent enzyme.
(67) In one embodiment, the present disclosure relates to a system comprising: a GPCR; a G protein selected from the following: G.sub.q, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G.sub.t-cone, G.sub.t-rod, G.sub.t-gust, G.sub.z, G.sub.oA, G.sub.oB, G.sub.olf, G.sub.11, G.sub.12, G.sub.13, G.sub.14, and G.sub.15/16, and mutated G protein having a substitution at a position corresponding to any of the positions of G.sub.q: G66, Y67 and/or F75; a signaling biosensor comprising a GRK protein (GRK2 or GRK3) or fragment thereof that comprises the C-terminal pleckstrin homology (PH) domain of the GRK, tagged with a fluorophore, a luciferase or a fragment thereof comprising a portion of a fluorescent protein or luminescent enzyme, a G1 protein and a G5 protein, wherein the G protein or the G protein is tagged with a fluorophore, a luciferase or a fragment thereof comprising a portion of a fluorescent protein or luminescent enzyme.
(68) In accordance with another broad non-limiting aspect, the present disclosure relates to a system for characterizing a signaling signature of a ligand, the system comprising: an activator of G-protein activity; a G protein; and a biosensor or system as described herein.
(69) The present disclosure also relates to a system comprising nucleic acid sequences, which could be but is not limited to, a DNA molecule, RNA molecule, virus or plasmid, encoding proteins as defined in the present disclosure. In an embodiment, the present disclosure also relates to a nucleic acid comprising a sequence encoding one or more of the protein components (e.g., fusion proteins) of the biosensors described herein. In an embodiment, the nucleic acid comprises a sequence encoding a (i) a IP, (ii) a first fluorophore, a bioluminescent protein or a fragment thereof comprising a portion of a fluorescent protein or bioluminescent protein; (iii) a G protein; (iv) a second fluorophore, a bioluminescent protein or a fragment thereof comprising a portion of a fluorescent protein or bioluminescent protein and (v) a G protein. In a further embodiment, the nucleic acid further comprises one or more sequences encoding one or more linkers located between the components of the biosensor. In a further embodiment, the nucleic acid further comprises one or more transcriptional regulatory sequence(s), such as promoters, enhancers and/or other regulatory sequences, and/or one or more sequences involved in translation regulation, for example internal ribosome entry site (IRES) sequence(s).
(70) In an embodiment, the nucleic acid is present in a vector/plasmid, in a further embodiment an expression vector/plasmid. Such vectors comprise a nucleic acid sequence capable of encoding the above-defined components (e.g., fusion proteins) of the biosensor described herein operably linked to one or more transcriptional regulatory sequence(s).
(71) The term vector refers to a nucleic acid molecule, which is capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as expression vectors. A recombinant expression vector of the present invention can be constructed by standard techniques known to one of ordinary skill in the art and found, for example, in Sambrook et al. (1989) in Molecular Cloning: A Laboratory Manual. A variety of strategies are available for ligating fragments of DNA, the choice of which depends on the nature of the termini of the DNA fragments and can be readily determined by persons skilled in the art. The vectors of the present invention may also contain other sequence elements to facilitate vector propagation and selection in bacteria and host cells. In addition, the vectors of the present invention may comprise a sequence of nucleotides for one or more restriction endonuclease sites. Coding sequences, such as for selectable markers and reporter genes, are well known to persons skilled in the art.
(72) A recombinant expression vector comprising a nucleic acid sequence of the present invention may be introduced into a cell (a host cell), which may include a living cell capable of expressing the protein coding region from the defined recombinant expression vector. The living cell may include both a cultured cell and a cell within a living organism. Accordingly, the invention also provides host cells containing the recombinant expression vectors of the invention. The terms cell, host cell and recombinant host cell are used interchangeably herein. Such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
(73) Vector DNA can be introduced into cells via conventional transformation or transfection techniques. The terms transformation and transfection refer to techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection and viral-mediated transfection. Suitable methods for transforming or transfecting host cells can for example be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals. Transcriptional regulatory sequence/element is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably linked. A first nucleic acid sequence is operably-linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences. Generally, operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame. However, since for example enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably-linked but not contiguous.
(74) In an embodiment and as depicted in
(75) In another aspect, the present invention provides a kit comprising the nucleic acids and/or vectors defined herein.
(76) In another aspect, the present disclosure also provides a cell (e.g., host cell) comprising or expressing any of the protein components (e.g., fusion proteins, recombinant proteins) of any of the biosensors described herein. In an embodiment, the cell has been transfected or transformed with a nucleic acid encoding the mutated G polypeptide defined herein. The invention further provides a recombinant expression system, vectors and cells, such as those described above, for the expression of the mutated G polypeptide defined herein, using for example culture media and reagents well known in the art. The cell may be any cell capable of expressing mutated G polypeptide defined above. Suitable host cells and methods for expression of proteins are well known in the art. Any cell capable of expressing the mutated G polypeptide defined above may be used. For example, eukaryotic host cells such as mammalian cells may be used (e.g., rodent cells such as mouse, rat and hamster cell lines, human cells/cell lines). In another embodiment, the above-mentioned cell is a human cell line, for example an embryonic kidney cell line (e.g., HEK293 or HEK293T cells). In another aspect, the present disclosure also provides a membrane preparation comprising or expressing any of the protein components (e.g., fusion proteins, recombinant proteins) of any of the biosensors described herein, in a further embodiment a membrane-anchored fusion protein.
(77) The present disclosure further relates to a method for assessing a modulation in the recruitment of a G-interacting protein (IP) to a G subunit between a first condition and a second condition, said method comprising: providing one of the biosensor defined herein; measuring the BRET acceptor signal in said first and second conditions; wherein a difference in the BRET signal between said first and second conditions is indicative of a modulation in the recruitment of a G-interacting protein (IP) to a G subunit between the first condition and the second condition. In an embodiment, the first condition is the presence of a test agent and the second condition is the absence of a test agent, wherein a difference in the BRET signal is indicative that the test agent modulates (increases or decreases) the recruitment of the G-interacting protein (IP) to the G subunit. The recruitment of the G-interacting protein (IP) to the G subunit may be used as a readout for GPCR and/or G-protein activation.
(78) The present disclosure further relates to a method for detecting G-protein activation comprising a system described herein, the method comprising: 1) contacting said system with a compound that activates a G-protein, and 2) detecting the activation of the G-protein by measuring the signal of the biosensor. The method may further comprise the steps of 3) deriving G-protein functional coupling information from of the signal of the signaling biosensor, and 4) processing the information to determine the G-protein activation profile of the G-protein activator and the signaling signature of the compound. Using a biosensor system that comprises a plurality of biosensors, wherein each of the biosensors comprises a different recombinant G protein, it is possible to determine the G-protein coupling profile of any GPCR and/or GPCR ligand, as exemplified in
(79) The term compound, agent, test compound or test agent refers to any molecule (e.g., drug candidates) that may be screened by the method/biosensor of the invention may be obtained from any number of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means.
(80) The present disclosure further relates to a method for determining whether a test agent modulates the activity of a GPCR, said method comprising measuring the signal emitted by a RET acceptor or reporter protein in the presence and absence of said test agent in one of the biosensor described herein; wherein a higher signal measured in the presence of the agent is indicative that said test agent increases the activity of said GPCR, and a lower signal measured in the presence of the agent is indicative that said agent inhibits the activity of said GPCR. In an embodiment, the method comprises:
(81) (1) providing a biosensor comprising the elements defined in (A), (B) or (C): (A) (i) a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; (ii) a second component comprising a fused G protein or a fused G protein, wherein said G protein or said G protein is fused to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein, wherein (a) if said IP is fused to said RET donor, said G or G protein is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said G or G protein is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said G or G protein is fused to said second fragment of said reporter protein; (iii) a third component comprising a recombinant G protein; and (iv) a fourth component comprising said GPCR; (B) (i) a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; (ii) a second component comprising said GPCR fused at its C-terminal to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; (iii) a third component comprising a recombinant G protein; wherein (a) if said IP is fused to said RET donor, said GPCR is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said GPCR is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said GPCR is fused to said second fragment of said reporter protein; or (C) (i) a first component comprising a G interacting protein (IP) fused to (a) a RET donor; (b) a RET acceptor or (c) a first fragment of a reporter protein; (ii) a second component comprising a fused plasma membrane (PM)-targeting moiety, wherein said PM-targeting moiety is fused to (a) a RET donor; (b) a RET acceptor or (c) a second fragment of said reporter protein; wherein (a) if said IP is fused to said RET donor, said PM-targeting moiety is fused to said RET acceptor; (b) if said IP is fused to said RET acceptor, said PM-targeting moiety is fused to said RET donor; and (c) if said IP is fused to said first fragment of said reporter protein, said PM-targeting moiety is fused to said second fragment of said reporter protein; (iii) a third component comprising a recombinant G protein; and (iv) a fourth component comprising said GPCR; and
(82) (2) measuring the signal emitted by said RET acceptor or reporter protein in the presence and absence of said test agent; wherein a higher signal measured in the presence of the agent is indicative that said test agent increases the activity of said GPCR, and a lower signal measured in the presence of the agent is indicative that said agent inhibits the activity of said GPCR.
(83) In an embodiment, the above-mentioned method further comprises:
(84) (3) measuring the signal emitted by said RET acceptor or reporter protein in the biosensor(s) defined herein in the presence and absence of a test agent and in the presence of a GPCR agonist, wherein the recombinant G protein is coupled to the GPCR (i.e. is known to be coupled or activated by the GPCR); and
(85) (4) determining whether said test agent is an inhibitor of said G protein; wherein a lower signal measured in the presence of the test agent is indicative that the test agent is an inhibitor of the G protein, and a similar or higher signal measured in the presence of the test agent is indicative that the test agent is not an inhibitor of the G protein.
(86) In an embodiment, the term higher signal or lower signal as used herein refers to signal that is at least 10, 20, 30, 40, 45 or 50% higher (or lower) relative to the reference signal measured in the absence of the test agent. In another embodiment, the higher signal or lower signal is determined by showing a statistically significant difference (determined using a suitable statistical analysis) in the signal measured in the presence relative to the absence of the test agent, for example by combining the results obtained in a plurality of samples. Statistical analysis (ANOVA, Student t-test, Chi square, etc.) to determine significant differences between different sets of data are known in the art, and such analysis may be performed using suitable computer programs.
(87) The present disclosure further relates to a method for identifying the G protein(s) activated by a GPCR agonist (G-protein profiling/signature of the agonist), said method comprising (i) measuring the signal emitted by said RET acceptor or reporter protein in the presence and absence of said GPCR agonist in a plurality of biosensors as defined herein, wherein each of the biosensors comprises a different recombinant G protein; (ii) identifying the G protein(s) activated by said GPCR agonist; wherein a higher increase of the signal measured in the presence of the GPCR agonist in a biosensor comprising a recombinant G protein relative to a corresponding biosensor not expressing the recombinant G protein is indicative that the G protein is activated by said GPCR agonist, and wherein a similar or lower increase, or a decrease, of the signal measured in the presence of the GPCR agonist in a biosensor comprising a recombinant G protein relative to a corresponding biosensor not expressing the recombinant G protein is indicative that the G protein is not activated by said GPCR agonist. In an embodiment, the method comprises: (a) measuring the signal emitted by said RET acceptor or reporter protein in the presence and absence of said GPCR agonist in the first and in the plurality of second biosensors of the biosensor system defined herein, and (b) identifying the G protein(s) activated by said GPCR agonist; wherein a higher increase of the signal measured in the presence of the GPCR agonist in said second biosensor relative to said first biosensor is indicative that the G protein is activated by said GPCR agonist, and wherein a similar or lower increase, or a decrease, of the signal measured in the presence of the GPCR agonist in said second biosensor relative to said first biosensor is indicative that said the G protein is not activated by said GPCR agonist.
(88) Positive controls and negative controls may be used in the methods/assays described herein. Control and test samples may be performed multiple times to obtain statistically significant results.
(89) In an embodiment, the above-mentioned methods are high-throughput methods (high-throughput screening, HTS). The term high-throughput screening (HIS) as used herein refers to a method that allow screening rapidly and in parallel large numbers of compounds (hundreds, thousands) for binding activity or biological activity against target molecules. Such HTS methods are typically performed in microtiter plates having several wells, for example 384, 1536, or 3456 wells. For HTS, it is important that the readout signal be detected with high sensitivity, accuracy and reproducibility.
(90) Methods and devices to measure the BRET signal are well known in the art. The BRET signal may be measured, for example, by determining the intensity of the BRET acceptor signal (light intensity), and/or by calculating the ratio of the signal or light intensity emitted by the BRET acceptor over the signal or light intensity emitted by the BRET donor (BRET ratio). The BRET signal may be measured using a microplate reader or microscope with a suitable filter set for detecting the BRET donor and/or BRET acceptor light emissions.
(91) It should be understood that any combination/sub-combination of the features or embodiments described herein may be present or used in the biosensors, systems and/or methods described herein.
(92) In an embodiment, the biosensors, systems and/or methods described herein comprises one or more of the constructs/fusion proteins and/or recombinant proteins described in the Examples below and attached Figures, for example Rluc-G1 to G13, GRK-GFP, GRK-RlucF1, RlucF2-G5, GRK2-GFP-mem, Rluc-GRK2, GFP-G5, GFP-CAAX or GPCR-Rluc.
MODE(S) FOR CARRYING OUT THE INVENTION
(93) The present invention is illustrated in further details by the following non-limiting examples.
EXAMPLE 1
Materials and Methods
(94) Reagents. Angiotensin II (AngII; [Asp-Arg-Val-Tyr-Ile-His-Pro-Phe], SEQ ID NO: 49), poly-ornithine, poly-D-lysine, isoproterenol, rotigotine, epinephrine, norepinephrine, phenylephrine and Pertussis toxin were from Sigma. u46619 were from Cayman Chemical (Ann Arbor, Mich.). [Sar.sup.1, Ile.sup.8]-AngII (SI) and [Asp.sup.1, Val.sup.5, Gly.sup.8]-AngII (DVG) [Sar1-Val5-D-Phe8] AngII (SVdF) and [Sar1-D-Ala8] AngII were synthesized at the University de Sherbrooke (Canada, QC). UBO-Qic (L-threonine,(3R)-N-acetyl-3-hydroxy-L-leucyl-(aR)-a-hydroxybenzenepropanoyl-2,3-idehydro-N-methylalanyl-L-alanyl-N-methyl-L-alanyl-(3R)-3-[[(2S,3R)-3-hydroxy-4-methyl-1-oxo-2-[(1-oxopropyl)amino]pentyl]oxy]-L-leucyl-N,O-dimethyl-,(7.fwdarw.1)-lactone (9CI)) was obtained from Institute for Pharmaceutical Biology of the University of Bonn (Germany). Dulbecco's modified Eagles medium (DMEM), fetal bovine serum, OPTI-MEM, and other cell culture reagents were purchased from Invitrogen. Coelenterazine 400a, Coelenterazine H and Prolume Purple I were purchased from either Goldbio, Biotium or Nanolight Technology. Polyethylenimine (PEI; 25 kDa linear; was purchased from Polysciences (Warrington, Pa., USA). Salmon sperm DNA was purchased from Lifetechnologies (ThermoFisher). Phusion DNA polymerase was from Thermo Scientific. Restriction enzymes and T4 DNA ligase were obtained from NEB. Oligonucleotides for mutagenesis and PCR applications were synthetized at BioCorp DNA.
(95) Expression vectors: Receptors and G-proteins. The plasmid encoding AT1 R was a generous gift from Stphane Laporte (McGill University, Montral, Canada). G.sub.q, G.sub.11, G.sub.12, G.sub.13, G.sub.14, G.sub.15/16, G.sub.oA, G.sub.oB, G.sub.z, G.sub.s, G.sub.i1, G.sub.i2, G.sub.i3, G1, TPR, D.sub.2R and .sub.1BAR were obtained from the cDNA Resource Center (cDNA.org). Plasmids encoding mutant G proteins including G.sub.qG66K, G.sub.qY67C and G.sub.qF75G, were obtained by site-directed mutagenesis (PCR overlap) of the G.sub.q wild-type protein coding sequence using the primers depicted in Table I. The PCR fragments were digested with Acc65I+XhoI restriction enzymes and cloned in pCDNA3.1 Zeo(+) (from Invitrogen, Carlsbad, Calif.) digested Acc65I+XhoI. DNA sequencing was used for validation of the different constructs and to identify the specific substitutions created from degenerated primers.
(96) TABLE-US-00001 TABLEI Sequencesofprimersusedintheexperimentsdescribedherein Primers Sequences(5-3) ExternalprimersforPCRoverlap Forward(SEQIDNO:21) gacctgcgctagcgtttaaacttaagcttggtaccaccatg Reverse(SEQIDNO:22) gtcatccctaggctcgagttagaccagattgtactcctt DegenerateprimerstogenerateGly66 substitutions(G66D,G66E,G66N& G66K) Forward(SEQIDNO:23) tgagaatcatccatgggtcaRAWtactctgatgaagataaaag Reverse(SEQIDNO:24) cttttatcttcatcagagtaWTYtgacccatggatgattctca DegenerateprimerstogenerateTyr67 substitutions(Y67F,Y67L,Y67W&Y67C) Forward(SEQIDNO:25) gaatcatccatgggtcaggaTKStctgatgaagataaaagggg Reverse(SEQIDNO:26) aagccccttttatcttcatcWTYgtatcctgacccatggatga PrimerstogenerateY67Ssubstitution Forward(SEQIDNO:27) agaatcatccatgggtcaggatCctctgatgaagataaaagggg Reverse(SEQIDNO:28) ccccttttatcttcatcagagGatcctgacccatggatgattct PrimerstogenerateY67Gsubstitution Forward(SEQIDNO:29) agaatcatccatgggtcaggaGGctctgatgaagataaaagggg Reverse(SEQIDNO:30) ccccttttatcttcatcagagCCtcctgacccatggatgattct PrimerstogenerateF75Gsubstitution Forward(SEQIDNO:31) tctgatgaagataaaaggggcGGcaccaagctggtgtatcagaa Reverse(SEQIDNO:32) ttctgatacaccagcttggtgCCgccccttttatcttcatcaga
(97) Expression vectors: Biosensor constructs. Rluc-G5 and GFP-G: Plasmid encoding the fusion proteins Rluc-Gy1 to G13 and GFP1O-G5 were was obtained by PCR amplification of the G coding sequences which were then fused in frame at its N-terminus to the humanized Renilla luciferase II (hRlucII) sequence (a variant of the hRluc previously reported (Leduc, Breton et al. 2009), SEQ ID NO:39) into pcDNA3.1 vector (linker sequence: GSAGT, SEQ ID NO: 33), or to the GFP10 (a variant form of the green fluorescent protein (GFP) previously reported (Mercier, Salahpour et al. 2002, SEQ ID NO:38). GRK2-GFP and GRK3-GFP: GRK2-GFP, GRK3-GFP, GRK2 Cterm (SEQ ID NO:50)-GFP, GRK3 Cterm (SEQ ID NO:51)-GFP were generated by PCR amplification of GRK2 and GRK3, which were then fused at their C-terminus to the GFP10 into pcDNA3.1 Zeo(+) vector, generating a linker of 11 amino acid residues between the GRK and the GFP10 protein (linker sequence: GSAGTGKLPAT, SEQ ID NO: 34). GFP-GRK2 and GFP-GRK3: GRK2-GFP, GFP-GRK2 Cterm (SEQ ID NO:50), GFP-GRK3 Cterm (SEQ ID NO:51) were generated by PCR amplification of GRK2 and GRK3, which were then fused at their N-terminus to the GFP10 (SEQ ID NO:38) into pcDNA3.1 Zeo (+) vector, generating a linker of 7 amino acid residues between the GRK and the GFP10 protein (linker sequence: GSAGTGG, SEQ ID NO:52). GFP- and RlucII-tagged GRK2 mutants were generated by PCR-directed mutagenesis using a similar procedure. GRK2-Rluc F1 and Rluc F2-G5: The GRK2-Rluc F1 was obtained by PCR amplification of the coding sequence for residues 1 to 110 from the humanized Renate luciferase II sequence set forth in SEQ ID NO:39 (Rluc F1), which was subsequently fused to the C-terminus of the GRK2 protein in the pcDNA3.1 Zeo (+) vector, generating a 18 amino acids linker between the Rluc fragment and the GRK2 (linker sequence: GSAGWGKLGSAGSGSAGS, SEQ ID NO:35). The Rluc F2-G5 was obtained by PCR amplification of the coding sequence for residues 111 to 311 from the humanized Renilla luciferase sequence set forth in SEQ ID NO:39 (Rluc F2), which was subsequently fused in frame of the N-terminus of the G5 protein into the pcDNA3.1 Zeo(+) vector, generating a 11 amino acid residues linker between the Rluc fragment and the G5 (linker sequence: GSAGTGSAGTT, SEQ ID NO:36). GRK2-GFP-mem: The GRK2-GFP-mem construct encoding a fusion protein between the GRK2-GFP and a 200 amino acid residues flexible linker followed by the membrane anchoring signal of the human KRAS protein (prenylation motif: CAAX) (Hancock 2003) was generated as follows. First, a linker with a predicted disordered structure was created from a random sequence of 2000 residues. From this sequence, a segment of 200 residues with minimal globularity and maximum disorder index was selected, after elimination of aggregation hotspots, putative localization, interaction and phosphorylation motifs. This 200-amino acid flexible linker (SEQ ID NO:53) was directly synthesized and then fused in frame at the N-terminus of the membrane anchoring signal of human KRAS protein splice variant b (amino acid sequence: KKKKKKSKTKCVIM, SEQ ID NO:37) using FOR amplification. The flexible linker followed by KRAS prenylation signal was then sub-cloned into the GRK2-GFP pcDNA3.1 Zeo(+) vector, at the C-terminus of the GRK2-GFP protein. Polycistronic biosensor vector: The polycistronic vector encoding GRK2-GFP, Rluc-G5 and G1 was developed by first sub-cloning the WT and D110A mutant GRK2-GFP10 fusion proteins into the pLVX vector. Then, sub-cloning of IRES-G1 into pcDNA3.1 Rluc-G5 was performed to obtain pcDNA3.1 Rluc-G5-IRES-G1. Finally, the two constructs were assembled to generate a pLVX vector containing GRK2-GFP-IRES-Rluc-G5-IRES-G1. rGFP-CAAX: Plasmid encoding the fusion protein rGFP-CAAX was obtained by PCR amplification of rGFP coding sequence (SEQ ID NO:46) with a reverse primer encoding a linker (sequence: GSAGTMASNNTASG, SEQ ID NO:47) and the plasma-membrane targeting polybasic sequence and prenylation signal sequence from KRAS splice variant b: GKKKKKKSKTKCVIM (named: CAAX, SEQ ID NO:37). The CAAX plasma-membrane targeting sequence is in frame at the C-terminus of the rGFP coding sequence. The PCR fragment is sub-cloned into pcDNA3.1 (+) vector. RlucII-GRK2: The GRK2 cDNA was PCR-amplified and subcloned with RlucII at its N-terminus in pIREShyg3 expression vector (from Clonetech) with the linker: GGSGSGSGS (SEQ ID NO:48).
(98) Cell culture and transfections. Human embryonic kidney 293 (HEK293) cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum, 100 unit/ml penicillin/streptomycin at 37 C. in a humidified atmosphere with 5% CO.sub.2. Two days before the experiments, HEK293 cells were transfected with the indicated plasmids using poly-ethylenimine 25-kDa linear (PEI) as a transfecting agent (at a ratio of 3 to 1, PEI/DNA) (Hamdan, Rochdi et al. 2007), and then directly seeded in 96-well plates pre-treated with poly-L-ornithine hydrobromide or Poly-D-Lysine, at a density of 35,000 cells per well (for BRET and PCA assays in living cells), or 6-well plates at a density of 1,000,000 cells per well (for BRET assays on membrane preparations).
(99) BRET assays in living cells. Cells seeded in 96-well plates were washed twice with Phosphate Buffered Saline (PBS), followed by Tyrode buffer addition (composition: 137 mM NaCl, 0.9 mM KCl, 1 mM MgCl.sub.2, 11.9 mM NaHCO.sub.3, 3.6 mM NaH.sub.2PO.sub.4, 25 mM HEPES, 5.5 mM Glucose and 1 mM CaCl.sub.2, pH 7.4). The cells were then treated with the different ligands or vehicle for the indicated times. The Rluc substrate, coelenterazine 400a, was added at a final concentration of 2.5 M and cells were further incubated for an additional 5 minutes. BRET values were then collected using a Mithras LB940 Multimode Microplate Reader or a TRISTAR LB942 Multimode Microplate Reader, equipped with the following filters: 400 nm70 nm (energy donor) and 515 nm20 nm (energy acceptor). BRET values were determined by calculating the ratio of the light emitted by GFP (515 nm) over the light emitted by the Rluc (400 nm). To determine the % of activation (Stim as % of basal), BRET values obtained for the agonist treated cells where expressed as a percentage of the BRET values obtained with the corresponding cells treated with vehicle.
(100) BRET assays for GRK2-GFP translocation to RlucII-tagged receptor (
(101) BRET assays for RlucII-GRK2 translocation to the plasma-membrane labeled with rGFP-CAAX (Kras) (
(102) G-protein inhibitors. BRET assays were performed as described previously, except that cells were pre-treated overnight at 37 C. with 100 ng/ml of pertussis toxin, or, for 20 minutes at 37 C. with 100 nM of Ubo-Qic.
(103) Kinetics experiments. BRET assays were performed as described previously, except that BRET readings were collected at regular intervals, 5 min after coelenterazine addition, while ligands and vehicle were injected to the cells after 30 sec of BRET measurements.
(104) Z-factor determination. HEK293 cells were transfected as described with the indicated constructs (see description of
(105) Protein complementation assays using RlucII fragments. Cells were washed twice with PBS, followed by Tyrode buffer addition. The cells were then pre-treated with the Rluc substrate, coelenterazine 400a, at a final concentration of 2.5 M for 30 min at 37 C. The different ligands or vehicle were added for an additional 10 min. Luminescence values were then collected using a Mithras LB940 Multimode Microplate Reader, without any filters.
(106) BRET assays on membrane preparations. Cells seeded in 6-well plates were collected, re-suspended in lysis buffer (composition: 25 mM Tris-HCl pH 7.4, 2 mM EDTA, 5 mM MgCl.sub.2, 27% sucrose, 15 M GDP, 2 M GTP, 10 g/ml benzamidine, 5 g/ml soybean trypsin inhibitor and 5 g/ml leupeptin) and subjected to a polytron homogenization. Following centrifugation steps, the membrane pellets were resuspended in Tyrode buffer supplemented with 5 mM MgCl.sub.2, 15 M GDP and 15 M GTP. BRET experiments were then performed as described previously, using 400 g of membrane per well.
(107) BRET Titrations (in
EXAMPLE 2
Results
(108) To study the activation of specific G-proteins by GPCRs, an assay was developed based on the competition between G subunits and IP for their binding to G subunits. As depicted in
(109) Taking RET as an example of detection method, possible scenarios and corresponding results interpretation for IP-based biosensors of G-protein activation are shown in
(110)
(111) To assess the feasibility of using a IP to monitor G-protein activation, the GRK2 protein, which specifically interacts with free G dimers, was selected as a representative IP, and tagged at its C-terminus with the energy acceptor GFP10 (GFP), thus allowing the use of BRET as a readout of its interaction with G. The GRK2-GFP fusion protein was co-expressed with a G5 subunit tagged in N-terminus with the energy donor Renilla luciferase (Rluc), as well as with untagged G1 and G subunits. In addition to the biosensor components (GRK2-GFP and Rluc-G5), G1 and various G, cells were co-transfected with the thromboxane A2 receptor (TPR), which was chosen as an example of a prototypical GPCR. In the experiment depicted in
(112) In addition to the wild-type (native) G proteins, three G.sub.q mutants (G.sub.qG66K, G.sub.qY67C and G.sub.qF75G, were also used in the panel of G-proteins tested with the TPR. The substitution of the glycine residue at position 66 of the G.sub.q protein for a charged residue (GqG66K for example), had been previously described as resulting in G.sub.q protein mutants with promiscuous coupling properties, as they can also be activated by non-G.sub.q-coupled receptors (Heydorn, Ward et al. 2004). As can be seen on
(113) To further illustrate that a IP-based G-protein activation biosensor can be used to reveal the specificity of G-protein activation for different GPCRs, the dopamine D2 receptor (D.sub.2R) and the .sub.1B-adrenergic receptor (.sub.1BAR) were each co-expressed with GRK2-GFP, Rluc-G5, G1 and various G, and stimulated with their prototypical agonists; rotigotine for D.sub.2R, and phenylepinephrine for .sub.1BAR. As shown in
(114) Inhibitors of G-protein activity such as pertussis toxin (PTX) and Ubo-Qic (structurally related to the cyclic depsipeptide YM-254890) which selectively blocks G.sub.i and G.sub.q activation, respectively, have been extensively used in the field of GPCRs to characterize the coupling properties of receptors (Takasaki, Saito et al. 2004). Using the IP-based G-protein activation biosensor, experiments were performed with those selective G-protein inhibitors to demonstrate the specificity of the BRET signals obtained. For the TPR, which is coupled to G.sub.q activation, the BRET response measured using IP-based biosensor following agonist stimulation, was completely abolished upon Ubo-Qic pre-treatment, while PTX pre-treatment had no effect on this response (
(115) To further characterize the IP-based G-protein activation biosensor, kinetics of G.sub.i1 (
(116) To evaluate the robustness of the assay, Z-factors were determined for G-protein activation through typical G.sub.i-(D.sub.2R,
(117) In addition to the previously described potential applications of the -based biosensor in G-protein profiling of receptors and HTS, ligand characterization represents another application of this G-protein activation biosensor. GPCRs can preferentially engage different G-proteins and signaling pathways upon activation with different ligands, this phenomenon is known as ligand-biased signaling of GPCRs (Galandrin, Oligny-Longpre et al. 2007) (Kenakin and Christopoulos 2013). The biosensors described herein are particularly well suited for performing ligand profiling experiments since it is possible to assess the activity of all G-protein subtypes using the same RET partners. As a representative example, various ligands of the angiotensin II type 1 receptor (AT1R) were profiled using the IP-based G-protein activation biosensor (
(118) It was next assessed whether protein complementation assay (PCA), instead of RET-based assays, may be used to assess the interaction between the IP and the G subunits (
(119) It was next assess whether IPs other than GRK2 (such as GRK3) could be used to monitor G-protein activation in the IP-based G-protein activation biosensor. A fusion protein was generated between GRK3 and the energy acceptor GFP, and the resulting GRK3-GFP was co-expressed with Rluc-G5, G1, G.sub.i1 and the D.sub.2R, to obtain dose-response curves of dopamine. As seen in
(120) To simplify the use of the IP-based G-protein activation biosensor, a polycistronic vector encoding the GRK2-GFP, Rluc-G5 and G1 was developed (
(121) Another variant of the IP-based G-protein activation biosensor was developed, in which the GRK2 protein is tethered at the plasma membrane (PM) (
(122) The results depicted in
(123) Another biosensor to measure the competition between G subunits and IP for their binding to G subunits was developed;
(124) Another biosensor to measure the competition between G subunits and IP for their binding to G subunits was developed;
(125) Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word comprising is used as an open-ended term, substantially equivalent to the phrase including, but not limited to. The singular forms a, an and the include corresponding plural references unless the context clearly dictates otherwise.
REFERENCES
(126) 1. Boularan, C. and J. H. Kehrl (2014). Implications of non-canonical G-protein signaling for the immune system. Cell Signal 26(6): 1269-1282. 2. Galandrin, S., G. Oligny-Longpre and M. Bouvier (2007). The evasive nature of drug efficacy: implications for drug discovery. Trends in Pharmacological Sciences 28(8): 423-430. 3. Garland, S. L. (2013). Are GPCRs still a source of new targets? J Biomol Screen 18(9): 947-966. 4. Gilman, A. G. (1987). G-proteins: Transducers of receptor-generated signals. Annu Rev Biochem 56: 615-649. 5. Hamdan, F. F., M. D. Rochdi, B. Breton, D. Fessart, D. E. Michaud, P. G. Charest, S. A. Laporte and M. Bouvier (2007). Unraveling G protein-coupled receptor endocytosis pathways using real-time monitoring of agonist-promoted interaction between beta-arrestins and AP-2. J Biol Chem 282(40): 29089-29100. 6. Hancock, J. F. (2003). Ras proteins: different signals from different locations. Nat Rev Mol Cell Biol 4(5): 373-384. 7. Heydorn, A., R. J. Ward, R. Jorgensen, M. M. Rosenkilde, T. M. Frimurer, G. Milligan and E. Kostenis (2004). Identification of a novel site within G protein alpha subunits important for specificity of receptor-G protein interaction. Mol Pharmacol 66(2): 250-259. 8. Kenakin, T. and A. Christopoulos (2013). Signaling bias in new drug discovery: detection, quantification and therapeutic impact. Nat Rev Drug Discov 12(3): 205-216. 9. Leduc, M., B. Breton, C. Gales, C. Le Gouill, M. Bouvier, S. Chemtob and N. Heveker (2009). Functional selectivity of natural and synthetic prostaglandin EP4 receptor ligands. J Pharmacol Exp Ther 331(1): 297-307. 10. Mercier, J. F., A. Salahpour, S. Angers, A. Breit and M. Bouvier (2002). Quantitative assessment of the beta 1 and beta 2-adrenergic receptor homo and hetero-dimerization by bioluminescence resonance energy transfer. J Biol Chem 277: 44925-44931. 11. Pitcher, J. A., J. Inglese, J. B. Higgins, J. L. Arriza, P. J. Casey, C. Kim, J. L. Benovic, M. M. Kwatra, M. G. Caron and R. J. Lefkowitz (1992). Role of beta gamma subunits of G proteins in targeting the beta-adrenergic receptor kinase to membrane-bound receptors. Science 257(5074): 1264-1267. 12. Stefan, E., S. Aquin, N. Berger, C. R. Landry, B. Nyfeler, M. Bouvier and S. W. Michnick (2007). Quantification of dynamic protein complexes using Renilla luciferase fragment complementation applied to protein kinase A activities in vivo. Proc Natl Acad Sci USA 104(43): 16916-16921. 13. Takasaki, J., T. Saito, M. Taniguchi, T. Kawasaki, Y. Moritani, K. Hayashi and M. Kobori (2004). A novel Galphaq/11-selective inhibitor. J Biol Chem 279(46): 47438-47445. 14. Touhara, K., J. Inglese, J. A. Pitcher, G. Shaw and R. J. Lefkowitz (1994). Binding of G protein beta gamma-subunits to pleckstrin homology domains. J Biol Chem 269(14): 10217-10220. 15. Zhang, J. H., T. D. Chung and K. R. Oldenburg (1999). A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen 4(2): 67-73. 16. Cong et al., The Journal of Biological Chemistry, 276, 15192-15199. 17. Pitcher et al., The Journal of Biological Chemistry, 274, 34531-34534. 18. Penela et al., PNAS, 107(3): 1118-1123. 19. Choudhary et al., Mol Cell. 2009 36(2): 326-39. 20. Linding et al., GlobPlot: exploring protein sequences for globularity and disorder, Nucleic Acid Res 2003Vol. 31, No. 13, 3701-8.