FRAMESHIFT SUPPRESSOR tRNA COMPOSITIONS AND METHODS OF USE
20200385724 ยท 2020-12-10
Inventors
- Ahmed Hussein Badran (Cambridge, MA, US)
- Erika Alden DeBenedictis (Cambridge, MA, US)
- Kevin Michael Esvelt (Newton, MA, US)
Cpc classification
C12N2320/11
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N15/1058
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2320/13
CHEMISTRY; METALLURGY
C12N15/63
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention, in part, includes compositions comprising quadruplet decoding tRNAs and their encoding sequences. The invention also includes assay methods to assess quadruplet decoding as well as methods of preparing quadruplet decoding suppression tRNAs.
Claims
1. A composition comprising a polynucleotide molecule, the sequence of which is set forth as one of SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145.
2. The composition of claim 1, further comprising a vector sequence.
3. A cell comprising the composition of claim 1, comprising at least one polynucleotide molecule, the sequence of which is set forth as one of SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145.
4. The cell of claim 3, wherein the cell is a bacterial cell.
5. The cell of claim 3, wherein the cell is a mammalian cell, and optionally is a human cell.
6. The cell of claim 3, wherein the cell is an engineered cell.
7-24. (canceled)
25. A method of engineering an evolved quadruplet decoding suppressor tRNA, the method comprising: engineering an evolved quadruplet decoding suppressor tRNA from a preselected quadruplet decoding suppressor tRNA, wherein a means of the engineering comprises a phage-assisted continuing evolution (PACE) method.
26. The method of claim 25, wherein the PACE method comprises a bacteriophage-based directed evolution method.
27. The method of claim 25 or 26, wherein the PACE method comprises determining the presence of a successfully evolved quadruplet decoding suppressor tRNA.
28. The method of claim 27, wherein a means for determining the presence of the successfully evolved quadruplet decoding suppressor tRNA comprises detecting a phage propagation reporter, wherein successful quadruplet decoding by the evolved suppressor tRNA results in phage propagation.
29. The method of claim 27, wherein a means for determining the presence of the successful evolved quadruplet decoding suppressor tRNA comprises: (a) challenging (i) an essential phage protein encoded with one or more quadruplet codons and (ii) an evolved quadruplet decoding suppressor tRNA encoded on a phage from which the essential phage protein has been deleted, to infect a plurality of E. coli; and (b) detecting a functional phage produced in the challenged E. coli, wherein the functional phage produced indicates the presence of one or more successful quadruplet decoding(s) by the evolved quadruplet decoding suppressor tRNA.
30. The method of claim 29, wherein the essential phage protein is a pIII phage protein.
31-43. (canceled)
44. A method of protein translation, the method comprising preparing a DNA sequence comprising a quadruplet codon encoding one or more amino acids, decoding the quadruplet codon with a suppressor tRNA encoded by a sequence set forth as any one of SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145; and translating the DNA sequence to produce a protein comprising the encoded amino acids.
45. The method of claim 44, wherein the protein translation comprises both triplet and quadruplet codons.
46. The method of claim 44, wherein the protein translation is an all-quadruplet protein translation.
47. The method of claim 44, further comprising assessing one or more of the structure and function of the translated protein product.
48. The method of claim 44, wherein the decoding is performed in a cell.
49. The method of claim 48, wherein the cell is a bacterial cell.
50. The method of claim 48, wherein the cell is a mammalian cell, and optionally is a human cell.
51. The method of claim 48, wherein the cell is an engineered cell.
52-59. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
BRIEF DESCRIPTION OF CERTAIN SEQUENCES
[0045] SEQ ID NO: 1-15 shown in
[0046] SEQ ID NO: 16-21 shown in
[0047] SEQ ID NO: 22 and 23 shown in
[0048] SEQ ID NO: 24 shown in
TABLE-US-00001 SEQIDNO:25:ProK-lacOpromoterSequence(lacO siteshowninuppercaseletters): tgtgcttctcaaatgcctgaggccagtttgctcaggctctccccgtggag gtaataattgacgatatgatcagtgcacggctaactaagcggcctgctga ctttctcgccgatcaaaaggcattttgctattaagggattgacgagggcg tatctgcgcagtaagatAATTGTGAGCGGATAACAATT. SEQIDNO:26:encodesxLuxABsequence[whichis alsoreferredtohereinasLuxAB,seeNatChem Biol.2014March;10(3):216-222)]: atgaaatttggaaactattgcttacataccaacctccccaattacccaaa cagaggtaatgaaacgtttggttaaattaggtcgcatctctgaggagtgt ggttttgataccgtatggttactggagcatcatttcacggagtttggttt gcttggtaacccttatgtcgctgctgcatatttacttggcgcgactaaaa aattgaatgtaggaactgccgctattgttcttcccacagcccatccagta cgccaacttgaagatgtgaatttattggatcaaatgtcaaaaggacgatt tcggtaggtatttgccgagggctttacaacaaggactttcgcgtattcgg aacagatatgaataacagtcgcgccttagcggaatgctggtacgggctga taaagaatggcatgacagagggatatatggaagctgataatgaacatatc aagttccataaggtaaaagtaaaccccgcggcgtatagcagaggtggcgc accggtttatgtggtggctgaatcagcttcgacgactgagtgggctgctc aatttggcctaccgatgatattaagttggattataaatactaacgaaaag aaagcacaacttgagctttataatgaagtggctcaagaatatgggcacga tattcataatatcgaccattgcttatcatatataacatctgtagatcatg actcaattaaagcgaaagagatttgccggaaatttctggggcattggtat gattcttatgtgaatgctacgactatttttgatgattcagaccaaacaag aggttatgatttcaataaagggcagtggcgtgactttgtattaaaaggac ataaagatactaatcgccgtattgattacagttacgaaatcaatcccgtg ggaacgccgcaggaatgtattgacataattcaaaaagacattgatgctac aggaatatcaaatatttgttgtggatttgaagctaatggaacagtagacg aaattattgcttccatgaagctcttccagtctgatgtcatgccatttctt aaagaaaaacaacgttcgctattatattatggcggtggcggtagcggcgg tggcggtagcggcggtggcggtagcggcggtggcggtagcaaatttggat tgttcttccttaacttcatcaattcaacaactgttcaagaacagagtata gttcgcatgcaggaaataacggagtatgttgataagttgaattttgaaca gattttagtgtatgaaaatcatttttcagataatggtgttgtcggcgctc ctctgactgtttctggttttctgctcggtttaacagagaaaattaaaatt ggttcattaaatcacatcattacaactcatcatcctgtccgcatagcgga ggaagcttgcttattggatcagttaagtgaagggagatttattttagggt ttagtgattgcgaaaaaaaagatgaaatgcatttttttaatcgcccggtt gaatatcaacagcaactatttgaagagtgttatgaaatcattaacgatgc tttaacaacaggctattgtaatccagataacgatttttatagcttcccta aaatatctgtaaatccccatgcttatacgccaggcggacctcggaaatat gtaacagcaaccagtcatcatattgttgagtgggcggccaaaaaaggtat tcctctcatctttaagtgggatgattctaatgatgttagatatgaatatg ctgaaagatataaagccgttgcggataaatatgacgttgacctatcagag atagaccatcagttaatgatattagttaactataacgaagatagtaataa agctaaacaagagacgcgtgcatttattagtgattatgttcttgaaatgc accctaatgaaaatttcgaaaataaacttgaagaaataattgcagaaaac gctgtcggaaattatacggagtgtataactgcggctaagttggcaattga aaagtgtggtgcgaaaagtgtattgctgtcctttgaaccaatgaatgatt tgatgagccaaaaaaatgtaatcaatattgttgatgataatattaagaag taccacacggaatatacctaa. SEQIDNO:27encodesamodifiedxluxABsequence (UAGAreporteratresidue357,showninuppercase letters): atgaaatttggaaactattgcttacataccaacctccccaattacccaaa cagaggtaatgaaacgtttggttaaattaggtcgcatctctgaggagtgt ggttttgataccgtatggttactggagcatcatttcacggagtttggttt gcttggtaacccttatgtcgctgctgcatatttacttggcgcgactaaaa aattgaatgtaggaactgccgctattgttcttcccacagcccatccagta cgccaacttgaagatgtgaatttattggatcaaatgtcaaaaggacgatt tcggtaggtatttgccgagggctttacaacaaggactttcgcgtattcgg aacagatatgaataacagtcgcgccttagcggaatgctggtacgggctga taaagaatggcatgacagagggatatatggaagctgataatgaacatatc aagttccataaggtaaaagtaaaccccgcggcgtatagcagaggtggcgc accggtttatgtggtggctgaatcagcttcgacgactgagtgggctgctc aatttggcctaccgatgatattaagttggattataaatactaacgaaaag aaagcacaacttgagctttataatgaagtggctcaagaatatgggcacga tattcataatatcgaccattgcttatcatatataacatctgtagatcatg actcaattaaagcgaaagagatttgccggaaatttctggggcattggtat gattcttatgtgaatgctacgactatttttgatgattcagaccaaacaag aggttatgatttcaataaagggcagtggcgtgactttgtattaaaaggac ataaagatactaatcgccgtattgattacagttacgaaatcaatcccgtg ggaacgccgcaggaatgtattgacataattcaaaaagacattgatgctac aggaatatcaaatatttgttgtggatttgaagctaatggaacagtagacg aaattattgcttccatgaagctcttccagtctgatgtcatgccatttctt aaagaaaaacaacgtTAGActattatattatggcggtggcggtagcggcg gtggcggtagcggcggtggcggtagcggcggtggcggtagcaaatttgga ttgttcttccttaacttcatcaattcaacaactgttcaagaacagagtat agttcgcatgcaggaaataacggagtatgttgataagttgaattttgaac agattttagtgtatgaaaatcatttttcagataatggtgttgtcggcgct cctctgactgtttctggttttctgctcggtttaacagagaaaattaaaat tggttcattaaatcacatcattacaactcatcatcctgtccgcatagcgg aggaagcttgcttattggatcagttaagtgaagggagatttattttaggg tttagtgattgcgaaaaaaaagatgaaatgcatttttttaatcgcccggt tgaatatcaacagcaactatttgaagagtgttatgaaatcattaacgatg ctttaacaacaggctattgtaatccagataacgatttttatagcttccct aaaatatctgtaaatccccatgcttatacgccaggcggacctcggaaata tgtaacagcaaccagtcatcatattgttgagtgggcggccaaaaaaggta ttcctctcatctttaagtgggatgattctaatgatgttagatatgaatat gctgaaagatataaagccgttgcggataaatatgacgttgacctatcaga gatagaccatcagttaatgatattagttaactataacgaagatagtaata aagctaaacaagagacgcgtgcatttattagtgattatgttcttgaaatg caccctaatgaaaatttcgaaaataaacttgaagaaataattgcagaaaa cgctgtcggaaattatacggagtgtataactgcggctaagttggcaattg aaaagtgtggtgcgaaaagtgtattgctgtcctttgaaccaatgaatgat ttgatgagccaaaaaaatgtaatcaatattgttgatgataatattaagaa gtaccacacggaatatacctaa.
[0049] SEQ ID NOs: 28-67 shown in
[0050] SEQ ID Nos: 68-97 and 131-145 shown in
DETAILED DESCRIPTION
[0051] The invention, in part, includes novel suppressor tRNA molecules and methods of using same. The invention also includes reporters and assays with which to verify function of designed suppressor tRNA molecules, and the invention, in part includes methods to identify, design, and evolve efficient and effective suppressor tRNA molecules, which are also referred to herein as tRNA suppressor molecules.
[0052] To explore the feasibility of efficient quadruplet codon translation, studies were undertaken to engineer quadruplet decoding tRNA variants for every E. coli tRNA. To identify starting points, known suppressors were tested, and a number of rationally engineered suppressors using two different codon reassignment strategies were prepared and tested. To improve upon the resulting minimally functional quadruplet decoding tRNAs, aspects of the invention included use of rapid continuous directed evolution methods to evolve suppressors with improved quadruplet decoding efficiency for different tRNA scaffolds and different quadruplet codons. In every case, tRNA variants arose that exhibited substantial improvements in quadruplet decoding. The most efficient of the suppressors that were evolved using methods of the invention was determined to be capable of efficiently translating a protein that contained four frameshifts.
[0053] The invention, in part, includes quadruplet decoding tRNAs based on a representative E. coli tRNA scaffold for each of the 20 canonical amino acids. Information disclosed herein demonstrates that any tRNA can be converted to decode a four-base codon. Although quadruplet codon translation is generally much less efficient than triplet codon translation, directed evolution of the quadruplet tRNAs can result in substantial improvements. Many quadruplet tRNAs continue to be selectively charged by the cognate amino acid of the parent scaffold. Results of studies such as those disclosed herein indicate feasibility of creating a synthetic genetic code based entirely on quadruplet codons.
[0054] Embodiments of methods of the invention were used to prepare a catalog of 63 novel nave suppressors, which constitute the most comprehensive effort to engineer quadruplet decoding tRNAs to date. Methods of the invention were also used to determine that the anticodon loop sides frequently contributed to improved quadruplet decoding, and to demonstrate the extent to which codon size was controlled at the tRNA level. Embodiments of methods of the invention have been used to confirm that the ready access to higher activity variants that decode quadruplet codons in multiple contexts reveals inherent three-versus four-base promiscuity in translation machinery. Thus, methods of the invention offer a tractable strategy for genetic code expansion. As used herein the terms: quad and quadruplet may be used interchangeably. Quad tRNAs are also referred to herein qtRNAs herein and are named as amino acid identity of tRNA scaffold-codon; for example a serine tRNA with the 5-TCTA-3 anticodon is referred to as S-TAGA.
[0055] Methods of the invention include a novel strategy to overcome codon conflict by implementing an orthogonal translation apparatus in E. coli that exclusively and unambiguously translates four-base-codons, and cannot translate triplet codons. This apparatus requires a full complement of tRNAs that decode canonical amino acids using four-base codons. Methods of the invention have been used to prepare exclusive quadruplet-codon translation by engineering quadruplet-tRNAs for all of the 20 canonical amino acids. In these methods, the anticodon was manipulated in a representative E. coli tRNA scaffold corresponding to each of the 20 canonical amino acids and it was determined that all 20 can support four-base translation. Methods of the invention also include application of directed evolution to optimize the tRNA scaffold to contain the new anticodon. Mutations to the bases flanking the anticodon significantly improved quadruplet codon translation efficiency, usually with minimal impact on amino acid charging fidelity. It has now been shown that these engineered tRNAs can be used together with an orthogonal ribosome to translate a protein containing quadruplet codons. These results suggest that a dedicated quadruplet-codon translation apparatus as a feasible approach for genetic code expansion. See Rackham, O. & Chin, J. Nat Chem Biol 1, 159-166 (2005) for additional information on orthogonal RNAs.
[0056] Certain embodiments of methods of the invention were designed to be used to compare different suppressor tRNAs. Thus, some embodiments of the invention include a quantification technique that was designed to be capable of independently quantifying toxicity and quadruplet decoding efficiency. In certain embodiments of the invention reporter assays are provided. Certain embodiments of reporter assays of the invention can be used for one or more of reporting and quantifying toxicity and quadruplet decoding efficiency. Methods of the invention may include use of a frameshift-dependent bacterial luciferase reporter, which in some embodiments is prepared by integrating a quadruplet codon within xluxAB [xLuxAB is version of LuxAB that is covalently linked with short (GGGGS)4 linker, (see Nat Chem Biol. 2014 March; 10(3): 216-222), the sequence of xLuxAB that encodes the polypeptide, is set forth as SEQ ID NO: 26]. Failure to decode this codon leads to premature termination, versus in the event of successful frameshift suppressionluminescence results. In some embodiments of the reporter assay, luciferases are used. Luciferases are catalytic and do not experience maturation lag, which allows them to act as fast reporters that are especially sensitive in the low-activity range. Certain embodiments of the invention comprise a two-plasmid reporter system in which a suppressor tRNA is inducibly expressed from one plasmid and luciferase transcript is constitutively expressed from a second plasmid. In order to robustly compare toxic and non-toxic tRNAs in certain embodiments of the invention, luminescence measurements were measured kinetically, and internally standardized to the growth rate of the host bacteria. The reporter of the invention was validated using a previously reported engineered suppressor, and results confirmed that luminescence relied on codon-anticodon interactions and the presence of a quadruplet decoding tRNA, thus validating the reporter and methods of its use in assays such as those set forth herein. In a non-limiting example, certain embodiments of reporter assays of the invention have been used to identify that certain sequences encode suppressors that are one or both of toxic and lacking function, such as SEQ ID NOs: 68-87 set forth in
[0057] Additional aspects of the invention include designing and confirming methods of comprehensively engineering quadruplet decoding tRNAs through rational design and directed evolution. Methods of the invention in part, included identifying suppressor tRNAs' naturally occurring E. coli scaffolds, and methods of evolving these and other minimally functional suppressor tRNAs and improving their efficiency to decode quadruplet codons. Certain aspects of the invention also comprise a bacteriophage-based continuous directed evolution methods for use in methods of evolving translation components for improved quadruplet decoding translation. Use of such methods of the invention have at least several benefits. One, the use of phage activity reporters containing frameshifts in multiple locations reduced the risk of evolving transcript sequence-context specific cheaters. Also, it was identified that several evolved variants exhibit stem-recoding, confirming that this method is capable of evolving functional RNA that depends on secondary structure. Finally, certain embodiments of methods of the invention can be used to avoid the requirement of discrete library creation and screen steps. Methods of the invention can be used for tRNA evolution, and have shown they can be used to prepare suppressor tRNA variants with substantially improved quadruplet decoding efficiency.
[0058] Suppressor tRNAs of the invention and their encoding sequences can be used to translate a single DNA sequence that contains a quadruplet codon or codons into several distinct protein products by manipulating the presence of suppressor tRNAs rather than the DNA sequence. Methods of using suppressor tRNAs of the invention and their encoding sequences in include, but are not limited to preparing molecular sensors, circuits, and reporters. Prior methods used in genetic code expansion suffer from low incorporation efficiency and impure translated protein products due to promiscuity between triplet and quadruplet codon codes. Suppressor tRNAs of the invention can be used as the basis for encoding canonical amino acids in an exclusively quadruplet codon code, eliminating crosstalk between canonical and expanded genetic code and enabling high-fidelity all-quadruplet protein translation. Use of suppressor tRNAs of their encoding molecules permits expansion to an exclusively-quadruplet codon code and thus makes available an additional 235 free codons that can be assigned to non-canonical amino acids using additional exogenous tRNA/aminoacyl-tRNA synthetase (aaRS) pairs.
Transfer RNA (tRNA)
[0059] The terms transfer RNA or tRNA as used herein refer to a small RNA chain that transfers a specific amino acid to a growing peptide chain at the ribosomal site of protein synthesis during translation. A tRNA has a 3 terminal site for amino acid attachment. This covalent linkage is catalyzed by an aminoacyl tRNA synthetase. The tRNA also comprises a three-base region called the anticodon that can base-pair to the corresponding three base codon region on mRNA. In certain embodiments of the invention, a tRNA is a suppressor tRNA.
Four Base Codon Code and Suppressor tRNAs and Variants Thereof
[0060] The canonical genetic code uses three-base codons to encode proteins containing the 20 canonical amino acids. Synthetic biologists have proposed switching over to a four-base codon code, which could accommodate up to 255 different amino acids. This could enable addition of up to 235 non-canonical amino acids (NCAAs), which have been shown to be useful for creating protein therapeutics with enhanced properties. Achieving this system requires a complete set of tRNAs that incorporate the 20 canonical amino acids using four base codons (Frameshift suppressors). Existing frameshift suppressors were inefficient and incomplete and new frameshift suppressors are provided herein that have been prepared and tested.
[0061] A suppressor tRNA, also referred herein as a frameshift suppressor is a tRNA with a sequence element in the anticodon that allows it to recognize a stop codon and insert an amino acid in its place. Embodiments of the invention comprise use of suppressors having four-base codons. Generally, four-base (or Quadruplet) suppressor tRNAs have an expanded anticodon loop that is not a substrate for an endogenous synthetase and it decodes a quadruplet versus triplet codon. The four-base codon does not code for one of the natural amino acids.
[0062] A suppressor tRNA is a tRNA that alters the reading of a messenger RNA (mRNA) in a given translation system, for instance, by providing a mechanism for incorporating an amino acid into a peptide chain in response to a selector codon. For example, a suppressor tRNA of the invention can read a four-base codon. Exemplary modified suppressor tRNAs are provided herein including those encoded by sequences set forth as SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145.
[0063] In some embodiments of the invention, a suppressor tRNA molecule is a variant of a suppressor tRNA molecule disclosed herein. In a non-limiting example, a variant suppressor tRNA of the invention may be a fragment, homolog, or fusion sequence that retains an ability to transfer the amino acid cysteine to a growing polypeptide chain. In certain embodiments of the invention, a variant of a suppressor tRNA molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of a suppressor tRNA molecule set forth herein, which may also be referred to herein as the parent sequence of its variant. In variants of a sequence encoding a tRNA molecule set forth here, the anticodons are not varied from the parent to the variant. In certain embodiments of the invention, a variant of a sequence encoding a suppressor tRNA molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of the sequence encoding a suppressor tRNA molecule set forth herein, which may also be referred to herein as the parent sequence of its variant.
[0064] In some embodiments of the invention, a nucleic acid molecule encoding a suppressor tRNA molecule is a variant of a suppressor tRNA encoding molecule disclosed herein. In a non-limiting example, a variant suppressor tRNA encoding molecule of the invention may be a fragment, homolog, or fusion sequence that retains an ability encode a tRNA that is able to transfer the amino acid cysteine to a growing polypeptide chain. In certain embodiments of the invention, a variant of a suppressor tRNA-encoding molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of a suppressor tRNA-encoding molecule set forth herein, which may also be referred to herein as the parent sequence of its variant. In variants of a sequence encoding a tRNA molecule set forth here, the anticodons are not varied from the parent to the variant. In certain embodiments of the invention, a variant of a sequence encoding a suppressor tRNA molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of the sequence encoding a suppressor tRNA molecule set forth herein, which may also be referred to herein as the parent sequence of its variant.
tRNA Structure and Anticodons
[0065] Transfer RNA has a primary structure, a secondary structure (referred to as a cloverleaf structure), and a tertiary structure (an L-shaped three-dimensional structure that allows the tRNA to fit into appropriate sites of the ribosome). In a quadruplet suppressor tRNA an anticodon is a unit made up of four nucleotides that correspond to the four bases of the mRNA codon. Each quad tRNA contains a specific anticodon quad sequence that can base-pair to one or more quad codons for an amino acid. For example, one quadruplet codon for lysine is UCUA; the anticodon tRNA might be TAGA.
Suppressor tRNA Molecules
[0066] Some embodiments of the invention include compositions that include a suppressor tRNA molecule encoded by a sequence set forth as one of SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145. A composition may include one or more independently selected suppressor tRNA-encoding sequences and a composition of the invention may include one or more suppressor tRNAs of the invention. In certain embodiments, a composition comprising a suppressor tRNA or its encoding sequence may also include a detectable label. In some embodiments, the suppressor tRNA, or its encoding sequence comprises a detectable label. Non-limiting examples of detectable label polypeptides that may be included in a composition of the invention fluorescent labels, luminescent labels, or other suitable detectable art-known labels.
[0067] In some embodiments of the invention, a sequence encoding a suppressor tRNA of the invention, for example a sequence set forth as one of: SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145, is included in a vector. In certain embodiments more than one encoding sequence may be included in the vector. A vector used to generate a suppressor tRNA may also include a promoter sequence. A non-limiting example of a promoter that may be included is a PproK-lacO promoter sequence, or a functional variant thereof. A PproK-lacO promoter sequence is set forth herein as SEQ ID NO: 25. A skilled artisan will recognize other promoters suitable for use in a vector used in an embodiment of the invention.
LuxAB Reporter
[0068] According to another aspect of the invention, compositions are provided that include a variant LuxAB reporter molecule encoded with an independently selected quadruplet codon at one or more residues of a LuxAB protein sequence. The LuxAB reporter protein sequence is encoded by the sequence set forth as SEQ ID NO: 26. In certain embodiments, the variant LuxAB reporter molecule is encoded by a Lux reporter molecule that also includes an independently selected quadruplet codon at one or both of residue 164 and residue 357 of the LuxAB protein sequence. SEQ ID NO: 27 is an example of a variant LuxAB reporter molecule that includes the sequence set forth as SEQ ID NO: 26 with inclusion of a quadruplet codon at residue corresponding to 357 of expressed Lux. In some aspects of the invention an assay method is provided, the method comprising any embodiment of an aforementioned variant LuxAB composition.
Vectors/Promoters/Engineering Elements
[0069] Various vectors, cells, and other elements are used in certain embodiments of methods and compositions of the invention. As used herein, the term vector refers to a nucleic acid molecule capable of transporting between different genetic environments another nucleic acid to which it has been operatively linked. The term vector also refers to a virus or organism that is capable of transporting the nucleic acid molecule. One type of vector is an episome, i.e., a nucleic acid molecule capable of extra-chromosomal replication. Some useful vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as expression vectors. Other useful vectors, include, but are not limited to viruses such as lentiviruses, retroviruses, adenoviruses, and phages. Vectors useful in some methods of the invention can genetically insert a mutant light-activated ion channel polypeptides and variants thereof of the invention, into dividing and non-dividing cells and can insert mutant light-activated ion channel polypeptides and variants thereof of the invention to cells that are in vivo, in vitro, or ex vivo cells. The terms: protein and polypeptide may be used interchangeably herein.
[0070] Vectors useful in methods of the invention may include additional sequences including, but not limited to one or more signal sequences and/or promoter sequences, or a combination thereof. Expression vectors and methods of their use are well known in the art. Non-limiting examples of suitable expression vectors and methods for their use are provided herein. In certain embodiments of the invention, a vector may be a lentivirus comprising the gene for a mutant light-activated ion channel or variant thereof of the invention. A lentivirus is a non-limiting example of a vector that may be used to create stable cell line. The term cell line as used herein is an established cell culture that will continue to proliferate given the appropriate medium.
[0071] Promoters that may be used in methods and vectors of the invention include, but are not limited to, cell-specific promoters or general promoters. Methods for selecting and using cell-specific promoters and general promoters are well known in the art. A non-limiting example of a general purpose promoter that allows expression of a mutant light-activated ion channel polypeptide or variant thereof in a wide variety of cell typesthus a promoter for a gene that is widely expressed in a variety of cell types, for example a housekeeping gene can be used to express a mutant light-activated ion channel polypeptide, or variant thereof, in a variety of cell types. Non-limiting examples of general promoters are provided elsewhere herein and suitable alternative promoters are well known in the art.
[0072] In certain embodiments of the invention, a promoter may be an inducible promoter, examples of which include, but are not limited to a PproK-lacO promoter, as described herein.
Engineering Evolved Suppressor tRNAs
[0073] Methods of the invention also include engineering evolved quadruplet decoding suppressor tRNAs. Engineering methods of the invention include, in some embodiments, engineering an evolved quadruplet decoding suppressor tRNA from a preselected quadruplet decoding suppressor tRNA. In certain embodiments of the invention a method of evolving quadruplet decoding suppressor tRNA include a phage-assisted continuing evolution (PACE) method, which in certain embodiments of the invention, is a bacteriophage-based directed evolution method. In some embodiments of the invention a method of evolving suppressor tRNAs includes a means of determining the presence of a successfully evolved quadruplet decoding suppressor tRNA. A non-limiting example of a means for determining the presence of the successfully evolved quadruplet decoding suppressor tRNA includes detecting a phage propagation reporter, wherein successful quadruplet decoding by the evolved suppressor tRNA results in phage propagation. Examples of the preparation and use of phage propagation reporter are provide elsewhere herein, including in the Examples section and Figures. In certain embodiments of the invention, a means for determining the presence of the successful evolved quadruplet decoding suppressor tRNA includes: (a) challenging (i) an essential phage protein encoded with one or more quadruplet codons and (ii) an evolved quadruplet decoding suppressor tRNA encoded on a phage from which the essential phage protein has been deleted, to infect a plurality of E. coli. The challenging may then be followed by detecting a functional phage produced in the challenged E. coli, wherein the functional phage produced indicates the presence of one or more successful quadruplet decoding(s) by the evolved quadruplet decoding suppressor tRNA. In some embodiments, the essential phage protein is a pIII phage protein.
[0074] Methods of the invention include in some embodiments, Phage Assisted Continuous Evolution (PACE). PACE methods may be used in methods of the invention which to evolve a suppressor tRNA. In one embodiment, a sample to be evolved may include one or more suppressor tRNA molecules of interest to evolve. A sample in a receptacle in a system or method of the invention may also include one or more of a cell, fluid, an inducer, and other components appropriate for PACE methods. Additional general and specific examples of components that may be included in samples are provided elsewhere herein and additional art-known molecules are suitable to include in samples in embodiments of systems and methods of the invention. For additional details regarding PACE set up and use that can be used in conjunction with methods of the invention, see: Esvelt, K. M., et al., Nature 472, 499-503 (2011); Bryson, D. I., et al., (2017). Nat. Chem. Biol. December; 13(12):1253-1260; Packer, M. S., et al., Nat. Commun. 8, 956 (2017); Dickinson, B. C., et al., Nat. Commun. 5, 5352 (2014); Wang, T., et al., Nat. Chem. Biol. 14, 972-980 (2018); Zinkus-Boltz, J. & Dickinson, B. C. Nat. Chem. Biol. 13, 432-438 (2017); and Hu, J. H., et al., (2018). Nature April 5; 556(7699):57-63. Nature April 5; 556(7699):57-63. Nature April 5; 556(7699):57-63, each of which is incorporated herein in its entirety by reference].
Samples and Cells
[0075] Cells included in certain embodiments of systems and methods of the invention may be interchangeably referred to herein as cells or host cells. In certain embodiments of the invention, a host cell is a bacterial cell, a non-limiting example of which is a bacterial cell that can be infected with M13. Continuous evolution procedures in embodiments of systems and methods of the invention comprise F+ bacteria that are amenable to M13 infection. As is understood in the art, F+ bacteria possess F factor as a plasmid independent of the bacterial genome. A non-limiting example of a host cell that is used in some embodiments of methods and systems of the invention is an E. coli cell. Additional bacterial cells that are amenable to M13 infection are known in the art and are suitable for use in methods and systems of the invention. Bacteria can be used as cells and host cells in certain embodiments of the invention, including but not limited to embodiments comprising use of phage-assisted continuous evolution (PACE) methods. Additional information about and examples of bacteria suitable for use in methods and systems of the invention are known in the art, see for example, U.S. Pat. No. 9,394,537, the teaching of which is incorporated by reference herein in its entirety. It will be understood that in certain embodiments of the invention cells may include non-PACE methods and in such embodiments cells other than bacterial cells may be used. For example though not intended to be limiting, in some embodiments of the invention, non-bacterial cells can be used in other types of continuous directed evolution and tRNAs evolved using a similar approach to that disclosed herein. See for example, for yeast [Ravikumar, A. et al, (2014) Nature Chemical Biology, Vol. 10, March 2014, 175-177 and online methods: doi:10.1038/nchembio.143]) and mammalian cells (English, J. G. et al. (2019), Cell Vol. 178, 748-761, Jul. 25, 2019 and online methods). In some embodiments of the invention a cell is a eukaryotic cell. In some embodiments of the invention a cell is an invertebrate cell. In some embodiments of the invention, a cell is a vertebrate cell. In certain embodiments of the invention, a cell is an engineered cell, and is not a naturally occurring cell.
[0076] A host cell included in a system or method of the invention may be a cell comprising a horizontally transferable nucleic acid. In some embodiments, a host cell is provided that comprises at least one viral gene encoding a protein required for the generation of infectious viral particles under the control of a conditional promoter. As a non-limiting example, a host cell may comprise an accessory plasmid comprising a gene required for the generation of infectious phage particles, for example, M13 gIII, wherein the required gene is under the control of a conditional promoter, as described elsewhere herein. In some embodiments of the invention a conditional promoter is inserted into the genome of a host cell, wherein the genome of the host cell also includes a gene required to produce infectious viral particles.
[0077] Continued directed evolution systems and methods of the invention may include use of a phage, a viral vector, or naked DNA (e.g., a mobilization plasmid) for delivery or transfer of a gene of interest into a cell, or between cells, respectively. Transfer of a gene of interest from one host cell to a second host cell may be accomplished in a number of ways. For example, though not intended to be limiting, a transfer may occur using a transfer vector that is a virus that infects a cell, such as, but not limited to a bacteriophage or a retroviral vector. In certain embodiments, a viral vector is a phage vector that infects bacterial host cells. In certain embodiments of continuous evolution methods, a transfer vector is a conjugative plasmid transferred from one bacterial cell to a second bacterial cell. It will be understood that in some aspects of the invention, transfer of a gene of interest from one cell to a second cell is dependent on an activity of the gene of interest.
Protein Production
[0078] In some embodiments of the invention, suppressor tRNAs of the invention and/or their encoding sequences can be used in methods to prepare a plurality of different proteins from the same DNA sequence. As used herein the term plurality means more than one, for example, at least: 2, 3, 4, 5, 6, 7, 8, 9 10, or more. Certain embodiments of methods of the invention include using a plurality of different suppressor tRNA sequences to decode the same DNA sequence. In this way, the sequence of each of the plurality of suppressor tRNA may decode the DNA sequence, thereby directing translation of the DNA sequence. The different decoding of the DNA sequence by the plurality of suppressor tRNAs, produces a plurality of different protein products. Certain embodiments of the invention include a composition comprising a plurality of selected suppressor tRNAs of the invention that are expressed and decode DNA sequences also present in the composition. It will be understood that embodiments of methods of the invention may be carried out under conditions suitable for one or more of: tRNA expression, decoding, and translation.
[0079] Methods to prepare multiple different proteins from the same DNA are possible because different suppressor tRNA molecules of the invention result in different translated protein products. In a non-limiting example, a method of the invention may include preparing a DNA sequence that includes a quadruplet codon encoding one or more amino acids, decoding the quadruplet codon with a suppressor tRNA of the invention, for example, a tRNA encoded by a sequence set forth as any one of SEQ ID NOs: 1-21, 28-67, 88-97, and 131-145. Following the decoding, the DNA sequence is translated to produce a protein comprising the encoded amino acids. In some embodiments, the protein product that is produced includes both triplet and quadruplet codons, and in certain embodiments of methods of the invention, the protein translation is an all-quadruplet protein translation.
[0080] In another non-limiting example, a method of the invention includes translating a single DNA sequence into one or more distinct protein products. In such methods, if one suppressor tRNA of the invention is used, the single DNA sequence will be translated into one distinct protein product. If a plurality of suppressor tRNAs of the invention are used to translate a single DNA sequence, the single DNA sequence may be translated into a plurality of protein products. Examples of suppressor tRNAs that may be used in methods of the invention include, but are not limited to suppressor tRNAs encoded by one of SEQ ID NOs: 1-21, 28-68, 88-97, and 131-145. The specific suppressor tRNA(s) expressed determine the amino acids sequence of proteins produced by translating the DNA sequence.
[0081] It will be understood that methods of the invention that include expressing tRNAs, decoding DNA sequences, and translating DNA sequences are performed under suitable conditions for the expression, decoding, and translation, respectively. Conditions suitable for expression, decoding, and translation are described herein and additional art-known conditions may be used. In some embodiments of the invention, the decoding is performed in a cell, which may be, for example, though not intended to be limiting, a bacterial cell, an invertebrate cell, a plant cell, a yeast cell, a vertebrate cell, or other suitable cell type. It will be understood that in some embodiments the decoding is performed in a non-natural, or engineered cell. Certain methods of the invention also include assessing a protein produced for characteristics such as, but not limited to: function of the protein produced and the structure of the protein product produced. Means to assess protein characteristics, non-limiting examples of which are: structure, function, stability, etc. are well known and routinely practiced in the art, and can be used to assess proteins produced using methods of the invention. In some embodiments of methods of the invention for translating a DNA sequence, the protein product includes both triplet and quadruplet codons, and in certain embodiments of methods of the invention, the protein product is an all-quadruplet protein translation.
EXAMPLES
Example 1-8
[0082] Examples 1-8 describe experiments and studies performed to produce and test engineered tRNAs that support quadruplet codon translation. From the studies sequences encoding suppressors were generated and tested, and included sequences set forth herein as: SEQ ID NOs: 1-21, for sequences see
General Materials and Methods for Examples 1-8.
Materials
[0083] Antibiotics (Gold Biotechnology) were used at the following working concentrations: carbenicillin, 50 g/mL; spectinomycin, 100 g/mL; chloramphenicol, 40 g/mL; kanamycin, 30 g/mL; tetracycline, 10 g/mL; streptomycin, 50 g/mL. Water was purified using a MilliQ puri cation system (Millipore). Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific) was used for all PCRs. Plasmids and bacteriophage were cloned by USER assembly. tRNA genes were amplified directly from E. coli genomic DNA. Plasmids were cloned and amplified using either Mach1 (Thermo Fisher Scientific) or Turbo (New England BioLabs) cells. Unless otherwise noted, plasmid or bacteriophage DNA was amplified using the Illustra TempliPhi 100 Amplification Kit (GE Healthcare Life Sciences) before Sanger sequencing. Information is provided in
Preparation and Transformation of Chemically Competent Cells
[0084] Strain S2060 was used in all luciferase, phage propagation, and plaque assays, as well as in all PACE experiments. To prepare competent cells, an overnight culture was diluted 1,000-fold into 50 mL of 2XYT media (United States Biologicals) supplemented with appropriate antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.4-0.6. Cells were pelleted by centrifugation at 6,000 g for 10 min at 4 C. The cell pellet was then resuspended by gentle stirring in 5 mL of TSS (LB media supplemented with 5% v/v DMSO, 10% w/v PEG 3350, and 20 mM MgCl.sub.2). The cell suspension was stirred to mix completely, aliquoted and frozen on dry ice, and stored at 80 C. until use. To transform cells, 100 L of competent cells thawed on ice. To this, plasmid (2 L each; up to two plasmids per transformation) and 100 L KCM solution (100 mM KCl, 30 mM CaCl.sub.2, and 50 mM MgCl.sub.2 in H.sub.2O) were added and stirred gently with a pipette tip. The mixture was incubated on ice for 10 min and heat shocked at 42 C. for 90 s before 850 L of 2XYT media was added. Cells were allowed to recover at 37 C. with shaking at 230 r.p.m. for 0.75 h, streaked on 2XYT media+1.5% agar (United States Biologicals) plates containing the appropriate antibiotics, and incubated at 37 C. for 16-18 h.
Kinetic Luminescence Assay
[0085] S2060 cells were transformed with the luciferase-based activity reporter and tRNA expression plasmids of interest as described above. Overnight cultures of single colonies grown in DRM media supplemented with maintenance antibiotics were diluted 500-fold into DRM media with maintenance antibiotics in a 96-well deep well plate, with or without IPTG inducer. The plate was sealed with a porous sealing film and grown at 37 C. with shaking at 230 r.p.m. for 1 h. 175 L of cells were transferred to a 96-well black-walled clear-bottom plate (Costar), and then 600 nm absorbance and luminescence were read using an ClarioSTAR (BMG Labtech) over the course of 8 h, during which the cultures were incubated at 37 C. Calculation of % WT occurs as follows. Begin with three values, the luminescence at OD=0.3 of the WT luciferase positive control (P), the induced tRNA (i), and the suppressed tRNA (s). % WT=(Ps)/(is).
Phage Cloning.
[0086] To clone bacteriophage, PCR fragments were assembled as usual using USER assembly. The annealed fragments are transformed into competent E. coli S2060 cells that already bear a plasmid containing pIII under control of the phage shock promoter, pJC175e. Transformants were recovered overnight, centrifuged at 8,000 g for 2 min and supernatant filtered through a 0.22 m PVDF Ultrafree centrifugal filter (Millipore). The filtered supernatant containing phage was plagued, and clonal plaques were expanded overnight and Sanger sequenced.
Phage Plaque Assays
[0087] S2060 cells were transformed with the phage activity reporters of interest as described above. Overnight cultures of single colonies grown in 2XYT media supplemented with maintenance antibiotics were diluted 1,000-fold into fresh 2XYT media with maintenance antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.6-0.8 before use. Bacteriophage were serially diluted 100-fold (4 dilutions total) in H2O. 100 L of cells were added to 100 pt of each phage dilution, and to this 0.85 mL of liquid (70 C.) top agar (2XYT media+0.6% agar) supplemented with 2% Bluo-gal (Gold Biotechnology) was added and mixed by pipetting up and down once. This mixture was then immediately pipetted onto one quadrant of a quartered Petri dish already containing 2 mL of solidified bottom agar (2xYT media+1.5% agar, no antibiotics). After solidification of the top agar, plates were incubated at 37 C. for 16-18 h.
Phage Enrichment Assays
[0088] S2060 cells were transformed with the phage activity reporters of interest as described above herein. Overnight cultures of single colonies grown in 2XYT media supplemented with maintenance antibiotics were diluted 1,000-fold into DRM media with maintenance antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.4-0.6. Cells were then infected with bacteriophage at a starting titer of 10.sup.5 pfu/mL. Cells were incubated for another 16-18 h at 37 C. with shaking at 230 r.p.m., then centrifuged at 8,000 g for 2 min and filtered through a 0.22 m PVDF Ultrafree centrifugal filter (Millipore). The filtered supernatant containing phage was removed and stored at 4 C. The phage titer of these samples was measured in an activity-independent manner using a plaque assay containing E. coli bearing pJC175e.
Continuous Flow PACE
[0089] Unless otherwise noted, PACE apparatus, including host cell strains, lagoons, chemostats, and media, were all used as previously described. Chemically competent S2060s were transformed with the phage propagation reporter and MP6 as described above, plated on 2XYT media+1.5% agar supplemented with 25 mM glucose (to prevent induction of mutagenesis) in addition to maintenance antibiotics, and grown at 37 C. for 18-20 h. Four colonies were picked into 1 mL DRM each in a 96-well deep-well plate, and this was diluted five-fold eight times serially into DRM. The plate was sealed with a porous sealing film and grown at 37 C. with shaking at 230 r.p.m. for 16-18 h. Dilutions with OD600 0.4-0.8 were then used to inoculate a turbidostat containing 300 mL DRM. The turbidostat maintains the growing culture at OD600 0.7-0.8.
[0090] Prior to bacteriophage infection, lagoons were continuously diluted with culture from the turbidostat at 1 lagoon vol/h and pre-induced with 10 mM arabinose for at least 45 minutes. Samples (500 L) of the SP population were taken at indicated times from lagoon waste lines. These were centrifuged at 8,000 g for 2 min, and the supernatant was passed through a 0.22 m PVDF Ultrafree centrifugal filter (Millipore) and stored at 4 C. Lagoon titers were determined by plaque assays using S2060 cells transformed with pJC175e.
Example 1
[0091] Suppressor tRNA Sequences (See Materials and Methods Above Herein)
[0092] Procedures were carried out to engineer quadruplet decoding tRNA variants for every E. coli tRNA. To identify starting points, suppressor tRNAs reported in the literature were tested. Also tested were rationally engineered suppressors using two different codon reassignment strategies, and a library-based selection method was also developed and used. Functional suppressor tRNAs were identified, and further steps were carried out to increase their function.
[0093] To improve upon the identified functional quadruplet decoding tRNAs, rapid continuous directed evolution was used and successfully evolved suppressors with improved quadruplet decoding efficiency for five different tRNA scaffolds and two different quadruplet codons. In every case, tRNA variants arose that exhibited substantial improvements in quadruplet decoding. The most efficient evolved suppressor is capable of efficiently translating a protein that contains four frameshifts, breaking the existing three-frameshift record.
[0094] The resulting catalog of 21 novel suppressors constitute the most comprehensive effort to engineer quadruplet decoding tRNAs to date, reveal that the anticodon loop sides frequently contribute to improved quadruplet decoding, and demonstrate the extent to which codon size is controlled at the tRNA level. The ready access to higher activity variants that decode quadruplet codons in multiple contexts reveals inherent three-versus four-base promiscuity in translation machinery that offers a tractable strategy for genetic code expansion.
Suppressor tRNAs
[0095] A number of suppressor tRNAs were developed, engineered, and tested. Sequences that encode certain of the identified suppressor tRNAs were identified and their nucleic acid sequences are set forth herein as SEQ ID NOs: 1-21, (see
[0096] Thirty-four suppressor tRNA-encoding sequences that were assessed for toxicity and function were determined to be non-functional, toxic, or extremely toxic when tested, see Table 1, and
TABLE-US-00002 TABLE 1 Non-functional, toxic, and extremely toxic suppressor tRNAs Non-functional Toxic Extremely toxic D-TAGA E-AGGC D-GACC A-GCCC I-TAGA Y-CAAG E-GAAA C-TGCC K-TAGA Y-CCAT H-CACC L-TAGA Y-CATG M-ATGG N-TAGA Y-CCCT V-GTCC P-TAGA Y-CCTC W-TGGG T-TAGA Y-CCCC Y-TACC V-TAGA Y-AAGC F-TTCC Y-CTGC I-ATCC Y-CCAG K-AAAA D-CACC L-TTGG H-CAAC N-AACC
Example 2
AssaysLuciferase Reporter: Design and Validation Studies
(See Materials and Methods Above Herein)
[0097] A luminescent assay system was prepared and tested. Experiments performed included preparing constructs for a two-plasmid luminescence reporter system of quadruplet decoding.
(a) As illustrated in
(b) Successful decoding of the quadruplet codon resulted in translation of full-length luciferase and thereby luminescence. Failure to decode the quadruplet codon resulted in a frameshift, premature termination, and a truncated, non-functional luciferase. A schematic diagram of the reporter process is shown in
(c) This reporter was validated using two previously reported engineered quadruplet decoding tRNAs, Ser-AGGG and Ser-AGGA, [Magliery, T. et al., (2001) J. Bol. Vol. 307:755-769, the content of which is incorporated herein in its entirety by reference].
(d) Additional experiments were performed to measure quadruplet decoding tRNAs reported in the literature. Several had no measurable activity in this assay, or resulted in high toxicity. Results are show in
(e) Measurements were taken of quadruplet decoding tRNAs that decode TAGA. Results shown in
(f) Measurements were taken of quadruplet decoding tRNAs that decode XYZZ, where XYZ was the original codon corresponding to each tRNA scaffold. Results shown in
(g) Together, these approaches revealed at least one naive quadruplet decoding tRNA with detectable activity for 13/20 canonical amino acids. These naive tRNAs can be used as starting points for directed evolution. General results are show in
Example 3
[0098] Evolving Suppressor tRNAs(See Materials and Methods Above Herein)
[0099] A major challenge in any directed evolution campaign is identifying starting components with sufficient initial activity to begin evolution. For simplicity of the resulting system, the initial experiments were focused on suppressor tRNAs that could be charged endogenously in E. coli. A first step was to measure the efficiency of known quadruplet decoding tRNAs using the luciferase reporter (see Example 3). Seven naturally occurring suppressor tRNAs have previously been reported in bacteria: sufD (incorporates Gly, GGGG anticodon) [Riddle, D. L. & Carbon, J. Nat. New Biol. 242, 230-234 (1973); Yourno, J. & Tanemura, S. Nature 225, 422-426 (1970).], hopR (Val, GUNA) [O'Connor, M., et al., EMBO J. 8, 4315-4323 (1989)], sufB (Pro, CCCC) [Sroga, G. E., et al., Nucleic Acids Res. 20, 3463-3469 (1992)], sufJ (Thr, ACCN) [Bossi, L. & Smith, D. M. Proc. Natl. Acad. Sci. U S. A. 81, 6105-6109 (1984)], suf16 (Gly, GGGG) [Gaber, R. F. & Culbertson, M. R. Gene 19, 163-172 (1982)], sufG (Gln, CAAA) [O'Connor, M. Nucleic Acids Res. 30, 1985-1990 (2002)], su6 (Leu, UAGG) [Moore, B., et al., J. Mol. Biol. 298, 195-209 (2000)], and su7 (Gln, UAGG) [Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987)]. These seven suppressor tRNAs were measured in S2060 E. coli using the luciferase reporter (
[0100] To expand the catalog of minimally functional suppressor tRNAs to more comprehensively cover the canonical amino acids, studies were performed using rational engineering. A straightforward approach to converting a naturally occurring triplet-decoding tRNA into a quadruplet decoding one is as simple as replacing the anticodon. Two strategies for codon reassignment were tested.
[0101] Previous efforts to engineer a complete set of amber suppressor tRNAs were largely successful [Magliery, T. J., et al., Edited by M. Gottesman. J. Mol. Biol. 307, 755-769 (2001) and Lee, B. S., et al., Biochim. Biophys. Acta 1861, 3016-3023 (2017)]. TAGA, a quadruplet codon that begins with the amber stop codon, has been used successfully several times previously. TAGA suppressors compete with the amber stop codon TAG, the lowest-usage codon in E. coli's genome [Zhang, S. P., et al., Gene 105, 61-72 (1991)], potentially explaining TAGA suppressor efficiency. Experiments were performed and a complete set of 20 E. coli TAGA suppressors were engineered by replacing the anticodon in each tRNA with 5-TCTA-3. The efficiency and toxicity of these suppressors was measured using the luciferase reporter (
[0102] It was observed that duplication of the third base of the codon is a common motif in naturally occurring quadruplet decoding tRNAs (if XYZ is the original codon, XYZZ is the quadruplet codon) [Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987); Riddle, D. L. & Carbon, J. Nat. New Biol. 242, 230-234 (1973); Yourno, J. & Tanemura, S. Nature 225, 422-426 (1970); Sroga, G. E., et al., Nucleic Acids Res. 20, 3463-3469 (1992); Gaber, R. F. & Culbertson, M. R. Gene 19, 163-172 (1982); O'Connor, M. Nucleic Acids Res. 30, 1985-1990 (2002); and Moore, B., et al., J. Mol. Biol. 298, 195-209 (2000)]. 18/20 synthetases must charge tRNAs that decode codons with different third bases [Sonneborn, T. M. In Evolving Genes and Proteins (eds. Bryson, V. & Vogel, H. J.) 377-397 (Academic Press, 1965)], potentially explaining plasticity in this area of tRNA identity elements. Given that this strategy for codon reassignment minimally disrupts the anticodon, a complete set of XYZZ suppressors were engineered. 6/20 XYZZ showed detectable efficiency with the luciferase reporter (
[0103] It was also identified that not all quadruplet codons could be successfully integrated into all tRNA scaffolds. This rational engineering approach required the user to guess-and-check individual tRNA scaffold/quadruplet codon pairs to discover successful codon reassignments. In addition, these mutated tRNAs might no longer have been specifically charged with a single amino acid. Overall, the methods to rationally engineer suppressors resulted in 12/20 starting points for directed evolution (
[0104] It was observed that certain attempts to perform codon reassignment resulted in a nonfunctional or toxic suppressor for several potential reasons: (1) 17/20 AARSs identify their tRNA by recognizing bases in the anticodon loop 45 and may be unable to recognize or charge a tRNA with a quadruplet anticodon; (2) the new anticodon must be compatible with the bases in the tRNA scaffold [Kleina, L. G., et al., J. Mol. Biol. 213, 705-717 (1990) and Yarus, M. Science 218, 646-652 (1982)]; (3) mutated tRNAs may act as a competitive inhibitor for endogenous tRNAs for AARSs; (4) functional frameshift suppressor tRNAs may disrupt translation of the host proteome and thereby exhibit high toxicity; and (5) EF-Tu checks anticodon/AA before allowing translation [Shepherd, J. & Ibba, M. FEMS Microbiol. Rev. 39, 280-300 (2015), the contents of which is incorporated herein by reference in its entirety]. Studies were performed to determine whether any one of these effects were correlated with trends in the success or failure of the suppressor engineering. Based on the results of studies performed, the following observations were made:
[0105] (a) E. coli AARSs for alanine and leucine do not interact with the anticodon loop [Gieg, R., et al., Nucleic Acids Res. 26, 5017-5035 (1998); the contents of which is incorporated herein by reference in its entirety]. However, functional suppressors were not able to be obtained for these amino acids. Additionally, the attempts did not generate toxic tRNAs. This indicated that item (1) (above) was not the only factor limiting discovery of suppressor tRNAs based on diverse scaffolds
[0106] (b) Tests were performed to assess codon reassignment strategies.
[0107] All the suppressors discovered to this point are referred to as nave suppressors. It is possible that the remaining seven canonical amino acids are not amenable to being charged endogenously, and will require evolution of the E. coli AARS, or that a tRNA/AARS pair be imported from another organism.
Example 4
[0108] Directed Evolution of Suppressor tRNAsM13 Phage Propagation Reporter
(See Materials and Methods Above Herein).
[0109] (a) A construct was designed for phage propagation reporter. The reporter plasmid was prepared that encoded pIII, an essential phage protein, which was encoded with one or more quadruplet codons at permissive residue(s) 29 or 34. The quadruplet decoding tRNA was encoded on an M13 phage from which pIII deleted. (See
[0110] (b) When challenged to infect E. coli bearing the reporter plasmid, the Selection Phage entered the cell. Successful decoding of the quadruplet codon resulted in translation of full-length pIII and thereby infectious phage progeny. Failure to decode the quadruplet codon resulted in a frameshift, premature termination, and a truncated, non-functional pIII. (See
[0111] (c) This reporter was validated using two highly active quadruplet decoding tRNAs that had been identified: R-CGTT-naive and R-TAGA-naive. Phage bearing both these suppressors were capable of forming plaques when challenged to infect E. coli bearing a phage propagation reporter with a matching quadruplet codon, but not with a non-matching quadruplet codon. Both phage could plaque in E. coli that supply pIII in response to phage infection (PSP-pIII). M13 phage from which pIII had not be deleted could form plaques regardless of phage propagation reporter. (See
[0112] (d) To determine the relationship between the luciferase and phage propagation reporter results, nine functional TAGA suppressors were tested with a TAGA phage propagation reporter. Suppressors that measured at least 1% wild type (WT) activity in the luminescence assay reliably supported phage propagation at levels sufficient for directed evolution. (See
Results
[0113] To evolve the identified minimally functional quadruplet decoding tRNAs studies were performed using an M13-bacteriophage based directed evolution technique [Esvelt, K. M., et al., Nature 472, 499-503 (2011)]. First, a phage propagation reporter was prepared that tied successful quadruplet decoding to M13 phage propagation. In this system, an essential phage protein pIII was encoded with one or more quadruplet codons. A quadruplet decoding tRNA was encoded on an M13 phage from which pIII has been deleted (
Example 5
[0114] Continuous Directed Evolution of Quadruplet Decoding tRNAs
(See Materials and Methods Above Herein)
[0115] (a) Five tRNA suppressors were evolved in continuous culture.
[0116] (b) To determine the results of evolution, initial and final tRNA variants were compared against a ladder of phage activity reporters of increasing difficulty. Phage were initially capable of efficiently producing infectious progeny that require production of pIII that contains 1 quadruplet codon; in contrast, the evolved phage are capable of relying on a pIII that requires 3 quadruplet codons. Results of some studies are shown in
[0117] (c) Sequences of evolved tRNA variants. Of the 5 variants, 4 of them involved mutations to the sides of the anticodon loop. These set include deletions (Q-TAGA-Evo2), insertion (Q-CAGG-Evo1), and recoding of base-paired regions (R-TAGA-Evo2). Results of some studies are shown in
[0118] (d) To measure the properties of these tRNA variants independent of potential changes in the phage backbone, the tRNA variants were subcloned into the inducible tRNA expression plasmid and measured using the luminescence reporter. Efficiency of the evolved variants were measured relative to their naive evolutionary starting points. The efficiency of each evolved suppressor was higher than the original, showing generally about an order of magnitude improvement. (Results certain studies are shown in
Results
[0119] The existing catalog of naive quadruplet decoding tRNAs span a wide range of suppression efficiencies, from 0.1% to 20% of WT. The stringency of the phage propagation reporter was manipulated by changing the copy number of the plasmid [Peterson, J. & Phillips et al., Plasmid 59, 193-201 (2008)], the strength of the promoter [Davis, J. H., et al., Nucleic Acids Res. 39, 1131-1141 (2011)], and the number of frameshifts (SI: phage propagation); together, these modifications allowed reporters to be generated that challenged suppressors at a wide range of efficiencies. To establish a comparison between luminescence and phage propagation reporters, activity-dependent phage enrichment and plaquing was tested for the nine most efficient naive TAGA suppressors (
[0120] To evolve the quadruplet decoding tRNA, procedures were carried out to repeatedly enrich populations of phage for functional variants using the phage propagation reporter. As the phage genome replicates, mutations arise, some of which may be in the quadruplet decoding tRNA. The studies employed an inducible mutagenesis plasmid [Badran, A. H. & Liu, D. R. Nat. Commun. 6, 8425 (2015)] to elevate this mutation rate to levels that rival that of traditional in vitro mutagenesis used in directed evolution. Thus, repeated enrichment of phage in E. coli carrying a phage propagation reporter construct resulted in directed evolution of the tRNA. This technique, known as Phage Assisted Continuous Evolution (PACE) [Esvelt, K. M., et al., Nature 472, 499-503 (2011)], has been used to evolve protease substrate specificity [Packer, M. S., et al., Nat. Commun. 8, 956 (2017) and Dickinson, B. C., et al., Nat. Commun. 5, 5352 (2014)], aminoacyl tRNA synthetases [Bryson, D. I., et al., (2017). Nat. Chem. Biol. December; 13(12):1253-1260], antibody solubility [Wang, T., Badran, et al., Nat. Chem. Biol. 14, 972-980 (2018)], biosensors [Pu, J., Zinkus-Boltz, J. & Dickinson, B. C. Nat. Chem. Biol. 13, 432-438 (2017)], and broad-PAM specificity Cas9 variants [Hu, J. H., et al., (2018). Nature April 5; 556(7699):57-63], amongst other applications. PACE biologically automates the traditional directed evolution workflow, compressing the multi-day process of library creation and screening into the rapid 20-minute lifecycle of a bacteriophage. (The content of each reference recited in this paragraph is incorporated herein by reference in its entirety.)
[0121] Studies performed included culturing phage bearing a Q-NNNN suppressor library continuous flow, challenging the population to propagate in bacteria bearing the MP6 mutagenesis plasmid and a phage propagation reporter containing pIII-29-CAGG. The expectation was that the Q-CAGG-naive suppressor, a member of the inoculating library, would be enriched. Additionally, evolved variants of Q-CAGG-naive might also emerge. Indeed, both events occurred after 45 hours of continuous evolution. A one-mutant of Q-CAGG-naive, Q-CAGG-Evo1, overtook the population (
[0122] Studies were performed to assess frameshift suppression.
Example 6
[0123] Continuous Directed Evolution of S-UAGA tRNA
(See Materials and Methods Above Herein)
[0124] (a) Studies were performed in which the Serine-UAGA tRNA was evolved in continuous culture, challenging it to decode one quadruplet codon for the first 24 hours and then to decode three quadruplet codons for the final 30 hours. Results show in
[0125] (b) Studies were performed to compare the initial and final tRNA variants against a ladder of phage activity reporters of increasing difficulty. Evolved phage are capable of relying on a pIII that requires 4 quadruplet codons (see
[0126] (c) Sequences of evolved variants of the SerU-UAGA tRNA. Evolved 3 contains a stem-re-coding mutation (see
[0127] (d) These tRNA variants were subcloned into the inducible tRNA expression backbone and measured using the luminescence reporter. The efficiency of evolved suppressors has improved, as demonstrated by a kinetic luminesce assay. The most evolved suppressor variants are on-par with the Mj-Tyr tRNA/AARS pair in decoding UAG codons (see
[0128] (e) Crosstalk between evolved variants and fourth-base mismatch codons, or the amber suppressor was measured. The evolved suppressor showed significant preference for decoding four-base codons with the matching fourth base. It showed measurable crosstalk with the three base codon TAG. As quadruplet decoding tRNAs are known to crosstalk with four-base codons with a mismatched fourth base [Gaber, R. F. & Culbertson, M. R. Mol. Cell. Biol. 4, 2052-2061 (1984); Anderson, J. C., Magliery, T. J. & Schultz, P. G. Chem. Biol. 9, 237-244 (2002); Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987); and Fagan, C. E., et al., RNA 20, 1944-1954 (2014)], tests for this crosstalk were performed (
Results
[0129] Studies were performed to determine whether the success of this technique was dependent on the CAGG codon, and to obtain results for a different quadruplet codon. Five of the most functional TAGA suppressors were evolved in continuous flow using a lenient TAGA phage reporter. Two independent experiments were performed, one each for Q and R, in both case one experiment was seeding with phage bearing the NNNN library, in the other with a clonal TAGA-naive suppressor (
[0130] Studies were performed to determine whether higher efficiency variants could be produced through further evolution on a more difficult evolutionary goal. Additionally, the phage activity reporters used so far for evolution all contain a single frameshift at pIII-29, and tests were performed to determine if the evolved suppressors were specific for that transcript context. These tests included evolving S-TAGA-Evo1 on a substantially more challenging three-frameshift phage propagation reporter. Over the course of an additional 30 hours of evolution, two additional sweeping variants arose in the two parallel experiments, S-TAGA-Evo2, S-TAGA-Evo3 (
Example 7
Reporter Development Method
(See Materials and Methods Above Herein)
[0131] In order to make this reporter usable for all the canonical amino acids, two permissive residues in luxAB were identified: 161 and 357 (residue positions in polypeptide encoded by SEQ ID NO: 26, by generating mutants with dissimilar amino acids and confirming that luminescence was not abolished. Results show in
[0132] Two inducible promoters, P .sub.rha [Tate, C. G., et al., J. Biol. Chem. 267, 6923-6932 (1992)] and P .sub.trc [Amann, E. & Brosius, J. Gene 40, 183-190 (1985)] were tested but a new promoter, PproK-lacO was designed and used for IPTG induction because of its improved characteristics of low background and high dynamic range (SI).
[0133] It was observed that residues 164 and 357 of luxAB have different propensity for frameshifting (SI); consistent with frameshift suppression being dependent on sequence context [Salser, W. Mol. Gen. Genet. 105, 125-130 (1969); Fluck, M. M., et al., Mol. Gen. Genet. 151, 137-149 (1977); Salser, W., et al., Cold Spring Harb. Symp. Quant. Biol. 34, 513-520 (1969); Yahata, H., et al., Mol. Gen. Genet. 106, 208-212 (1970); Akaboshi, E., et al, Mol. Gen. Genet. 149, 1-4 (1976); Feinstein, S. I. & Altman, S. I Mol. Biol. 112, 453-470 (1977); Colby, D. S., et al., Cell November; 9(3):449-63 (1976); Feinstein, S. I. & Altman, S. Genetics 88, 201-219 (1978); and Fluck, M. M. & Epstein, R. H. Mol. Gen. Genet. 177, 615-627 (1980); the content of each of which is incorporated herein in its entirety by reference.]
[0134] Experiments confirmed that a luciferase encoded with quadruplet codons at both residues 161 and 357 acts as a more stringent reporter.
[0135] Performance of this reporter to a GFP-based fluorescence reporter and a chloramphenicol acetyl transferase-based [Wang, K., et al., Nat. Biotechnol. 25, 770-777 (2007), the content of which is incorporated herein in its entirety by reference] antibiotic reporter (SI), and found that the suppressor tRNAs showed identical trends, but the luciferase-based reporter had lower background and higher dynamic range. (The content of each reference recited in Example 8 is incorporated herein by reference in its entirety.)
Example 8
PproK-lacO Promoter
[0136] A promoter sequence was designed and validated using certain methods provided in previous examples herein. The promoter, referred to herein as a PproK-lacO promoter, integrates the conventionally used PproK promoter for tRNA production. Use of the PproK-lacO promoter sequence was determined to further improve the utility of the conventional PproK promoter due at least in part to the inclusion of lacO sequence. Studies carried out using the PproK-lacO promoter demonstrated that the PproK-lacO promoter ensured lacI/IPTG-dependent tRNA transcription. The nucleic acid sequence of the PproK-lacO promoter is set forth herein as SEQ ID NO: 25.
Examples 9-14
[0137] Examples 9-14 describe experiments and studies performed to produce and test engineered tRNAs that support quadruplet codon translation. From the studies sequences encoding suppressors were generated and tested, and included sequences set forth herein as: SEQ ID NOs: 28-97 and 131-145, for sequences see
General Materials and Methods for Examples 9-14, See Also Example 8.
Materials
[0138] Antibiotics (Gold Biotechnology) were used at the following working concentrations: carbenicillin, 50 g/mL; spectinomycin, 100 g/mL; chloramphenicol, 40 g/mL; kanamycin, 30 g/mL; tetracycline, 10 g/mL; streptomycin, 50 g/mL. Water was purified using a MilliQ purification system (Millipore). Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific) was used for all PCRs. Plasmids and bacteriophage were cloned by USER assembly [Geu-Flores et al., (2007) Nucleic Acids Research 35, e55-e55]. tRNA genes were amplified directly from E. coli genomic DNA. Plasmids were cloned and amplified using either Mach1 (Thermo Fisher Scientific) or Turbo (New England BioLabs) cells. Unless otherwise noted, plasmid or bacteriophage DNA was amplified using the Illustra TempliPhi 100 Amplification Kit (GE Healthcare Life Sciences) before Sanger sequencing.
Preparation and Transformation of Chemically Competent Cells
[0139] Strain S2060 was used in all luciferase, phage propagation, and plaque assays, as well as in all PACE experiments. To prepare competent cells, an overnight culture was diluted 1,000-fold into 50 mL of 2XYT media (United States Biologicals) supplemented with appropriate antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.4-0.6. Cells were pelleted by centrifugation at 6,000 g for 10 min at 4 C. The cell pellet was then resuspended by gentle stirring in 5 mL of TSS (LB media supplemented with 5% v/v DMSO, 10% w/v PEG 3350, and 20 mM MgCl.sub.2). The cell suspension was stirred to mix completely, aliquoted and frozen on dry ice, and stored at 80 C. until use. To transform cells, 100 l of competent cells were thawed on ice. To this, plasmid (2 l each of miniprep-quality plasmid prep; up to two plasmids per transformation) and 100 L KCM solution (100 mM KCl, 30 mM CaCl.sub.2), and 50 mM MgCl.sub.2 in H.sub.2O) were added and stirred gently with a pipette tip. The mixture was incubated on ice for 10 min and heat shocked at 42 C. for 90 s before 850 l of 2XYT media was added. Cells were allowed to recover at 37 C. with shaking at 230 r.p.m. for 0.75 h, streaked on 2XYT media+1.5% agar (United States Biologicals) plates containing the appropriate antibiotics, and incubated at 37 C. for 16-18 h.
Kinetic Luminescence Assay
[0140] S2060 cells were transformed with the luciferase-based activity reporter and tRNA expression plasmids interest as described above. Overnight cultures of single colonies grown in David Rich Medium (DRM) [Bryson, D. I., et al., (2017). Nat. Chem. Biol. December; 13(12):1253-1260] supplemented with maintenance antibiotics were diluted 500-fold into DRM media with maintenance antibiotics in a 96-well 2 mL deep well plate, with or without IPTG inducer. The plate was sealed with a porous sealing film and grown at 37 C. with shaking at 230 r.p.m. for 1 h. 175 l of cells were transferred to a 96-well black-walled clear-bottom plate (Costar), and then 600 nm absorbance and luminescence were read using an ClarioSTAR (BMG Labtech) over the course of 8 h, during which the cultures were incubated at 37 C.
Calculation of % WT ().
[0141] Begin with three values, the luminescence at OD=0.3 of the WT luciferase positive control (P), the induced tRNA (i), and the suppressed tRNA (s). =(is)/(Ps).
[0142] M13 Selection Assay
[0143] Grow an overnight culture of the bacteria containing the AP. The next day, dilute culture 1:1000 in 2XYT and aliquot 500 uL each into a deep well 96-well plate. Inoculate each with 10 5 pfu/mL of phage containing the tRNA with randomized anticodon loops. Grow overnight. Filter phage supernatant and plaque activity-independent using pJC175e. Rank selections from lowest ending phage titer to highest ending phage titer. Pick selections for Sanger sequencing including all selections that enrich over 10, or additional selections as desired. Sanger sequence two plaques for each selection.
Phage Cloning
[0144] To clone bacteriophage, PCR fragments were assembled as usual using USER assembly. The annealed fragments are transformed into competent E. coli S2060 cells that already bear a plasmid containing pIII under control of the phage shock promoter, pJC175e. Transformants are recovered overnight, centrifuged at 8,000 g for 2 min and supernatant filtered through a 0.22 m centrifugal filter (Thomas Scientific or Corning). The filtered supernatant containing phage is plagued, and clonal plaques are expanded overnight and Sanger sequenced.
Manual Phage Plaque Assays
[0145] S2060 cells were transformed with the phage activity reporters of interest as described above. Overnight cultures of single colonies grown in 2XYT media supplemented with maintenance antibiotics were diluted 1,000-fold into fresh 2XYT media with maintenance antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.6-0.8 before use. Bacteriophage were serially diluted 100-fold (4 dilutions total) in H.sub.2O. 100 l of cells were added to 100 l of each phage dilution, and to this 0.85 mL of liquid (70 C.) top agar (2XYT media+0.6% agar) supplemented with 2% Bluo-gal (Gold Biotechnology) was added and mixed by pipetting up and down once. This mixture was then immediately pipetted onto one quadrant of a quartered Petri dish already containing 2 mL of solidified bottom agar (2XYT media+1.5% agar, no antibiotics). After solidification of the top agar, plates were incubated at 37 C. for 16-18 h.
Robotics-Accelerated Phage Plaque Assays
[0146] Follow the same procedure as above, except for plating of the plaque assays is done by a liquid handling robot by plating 20 l of bacterial culture and 100 l of phage dilution with 200 l of soft agar onto a well of a 24-well plate already containing 235 l of hard agar per well. To prevent premature cooling of soft agar, place the soft agar on the deck in a 70 C. heat block.
Phage Enrichment Assays
[0147] S2060 cells were transformed with the phage activity reporters of interest as described above. Overnight cultures of single colonies grown in 2XYT media supplemented with maintenance antibiotics were diluted 1,000-fold into DRM media with maintenance antibiotics and grown at 37 C. with shaking at 230 r.p.m. to OD600 0.4-0.6. Cells were then infected with bacteriophage at a starting titer of 10.sup.5 pfu/mL. Cells were incubated for another 16-18 h at 37 C. with shaking at 230 r.p.m., then centrifuged at 8,000 g for 2 min and filtered through a 0.22 m PVDF Ultrafree centrifugal filter (Millipore). The filtered supernatant containing phage was removed and stored at 4 C. The phage titer of these samples is measured in an activity-independent using a plaque assay containing E. coli bearing pJC175e.
Continuous Flow PACE
[0148] Unless otherwise noted, PACE apparatus, including host cell strains, lagoons, chemostats, and media, were all used as previously described [Dickinson, B. C., et al., Nat. Commun. 5, 5352 (2014)]. Chemically competent S2060 s were transformed with the phage propagation reporter and MP6 as described above, plated on 2XYT media+1.5% agar supplemented with 25 mM glucose (to prevent induction of mutagenesis) in addition to maintenance antibiotics, and grown at 37 C. for 18-20 h. Four colonies were picked into 1 mL DRM each in a 96-well deep-well plate, and this was diluted five-fold eight times serially into DRM. The plate was sealed with a porous sealing film and grown at 37 C. with shaking at 230 r.p.m. for 16-18 h. Dilutions with OD600 0.4-0.8 were then used to inoculate a turbidostat containing 80 mL DRM. The turbidostat maintains the growing culture at OD600 0.7-0.8. Prior to bacteriophage infection, lagoons were continuously diluted with culture from the turbidostat at 1 lagoon vol/h and pre-induced with 10 mM arabinose for at least 45 minutes. Samples (500 L) of the SP population were taken at indicated times from lagoon waste lines. These were centrifuged at 8,000 g for 2 min, and the supernatant was passed through a 0.22 m PVDF Ultrafree centrifugal filter (Millipore) and stored at 4 C. Lagoon titers were determined by plaque assays using S2060 cells transformed with pJC175e.
Quantification of qtRNA Charging
[0149] Each qtRNA was co-expressed with C-terminal 6xHis-tagged GFP-151-TAGA in S2060 cells. Four mL cultures were grown for 28 hours at 37 C. in DRM and purified using a Ni-NTA spin column (Qiagen). The resulting product was run on a 12% Bis-Tris PAGE gel (Invitrogen).
Sample Preparation for Mass Spectrometry
[0150] Silver stained SDS-PAGE gel lanes were subdivided into 7 regions and cut into 2 mm squares. These were washed overnight in 50% methanol/water. These were washed once more with 47.5/47.5/5% methanol/water/acetic acid for 2 hours, dehydrated with acetonitrile and dried in a speed-vac. Reduction and alkylation of disulfide bonds was then carried out by the addition of 30 l 10 mM dithiothreitol (DTT) in 100 mM ammonium bicarbonate for 30 minutes to reduce disulfide bonds. The resulting free cysteine residues were subjected to an alkylation reaction by removal of the DTT solution and the addition of 100 mM iodoacetamide in 100 mM ammonium bicarbonate for 30 minutes to form carbamidomethyl cysteine. These were then sequentially washed with aliquots of acetonitrile, 100 mM ammonium bicarbonate and acetonitrile and dried in a speed-vac. The bands were enzymatically digested by the addition of 300 ng of trypsin (or chymotrypsin for R or K qtRNAs) in 50 mM ammonium bicarbonate to the dried gel pieces for 10 minutes on ice. Depending on the volume of acrylamide, excess ammonium bicarbonate was removed or enough was added to rehydrate the gel pieces. These were allowed to digest overnight at 37 degrees Celsius with gentle shaking. The resulting peptides were extracted by the addition of 50 l (or more if needed to produce supernatant) of 50 mM ammonium bicarbonate with gentle shaking for 10 minutes. The supernatant from this was collected in a 0.5 ml conical autosampler vial. Two subsequent additions of 47.5/47/5/5 acetonitrile/water/formic acid with gentle shaking for 10 minutes were performed with the supernatant added to the 0.5 ml autosampler vial. Organic solvent was removed and the volumes were reduced to 15 l using a speed vac for subsequent analyses.
Chromatographic Separations
[0151] The digestion extracts were analyzed by reversed phase high performance liquid chromatography (HPLC) using Waters NanoAcquity pumps and autosampler and a ThermoFisher Orbitrap Elite mass spectrometer using a nano flow configuration. A 20 mm180 micron column packed with 5 micron Symmetry C18 material (Waters) using a flow rate of 15 l per minute for three minutes was used to trap and wash peptides. These were then eluted onto the analytical column which was a self-packed with 3.6 micron Aeris C18 material (Phenomenex) in a fritted 20 cm75 micron fused silica tubing pulled to a 5 micron tip. The gradient was isocratic 1% A Buffer for 1 minute 250 nl min 1 with increasing B buffer concentrations to 15% B at 20.5 minutes, 27% B at 31 minutes and 40% B at minutes. The column was washed with high percent B and re-equilibrated between analytical runs for a total cycle time of approximately 53 minutes. Buffer A consisted of 1% formic acid in water and buffer B consisted of 1% formic acid in acetonitrile.
Mass Spectrometry
[0152] The mass spectrometer was operated in a dependent data acquisition mode where the 10 most abundant peptides detected in the Orbitrap Elite (ThermoFisher) using full scan mode with a resolution of 240,000 were subjected to daughter ion fragmentation in the linear ion trap. A running list of parent ions was tabulated to an exclusion list to increase the number of peptides analyzed throughout the chromatographic run. The resulting fragmentation spectra were correlated against custom databases using PEAKS Studio X (Bioinformatics Solutions). Calculation of Limit of Detection and relative abundance. The results were matched to a library of GFP variants with each of the 20 canonical amino acids at residue 151. Abundance of each species was quantified by calculating the area under the curve of the ion chromatogram for each peptide precursor. The limit of detection is 10.sup.4 [AU], the lower limit for area under the curve for a peptide on this instrument.
R2R for generating tRNA diagrams R2R was used to generate tRNA diagrams. R2R is free software available from www.bioinf.uni-leipzig.de/zasha/R2R/.
Example 9
[0153] Rational Engineering of qtRNAs (See Methods Above Herein)
[0154] To compare qtRNA translation efficiency, a reporter for quadruplet codon translation was prepared by integrating a single quadruplet codon within the bacterial luciferase luxAB. Failure to decode this quadruplet codon leads to premature termination, whereas successful four base decoding results in full-length luxAB decoding and luminescence. To create a reporter of quadruplet decoding, a quadruplet codon was integrated at permissive residue 357 of a bacterial luciferase, luxAB. In the absence of a functional qtRNA, translation of the luciferase prematurely terminates due to the quadruplet codon generated by the quadruplet codon (top translation). In the presence of a functional qtRNA, full-length luciferase and thereby luminescence is generated (bottom translation) (
[0155] The approach was validated by measuring the quadruplet decoding efficiency of a threonine-ACCA qtRNA reported in the literature. Luminescence was only generated in the presence of the qtRNA and in the presence of a codon-matching reporter. To quantify these data, the increase in luminescence upon induction of the qtRNA was measured, and reported as a fraction of luminescence generated by a wild-type luxAB plasmid, see
[0156] Studies were performed using the luciferase reporter to measure the efficiency of known qtRNAs. qtRNAs throughout will be named as AA identity of tRNA scaffold-codon; for example a serine tRNA with the 5-TCTA-3 anticodon is referred to as 5-TAGA. There are seven qtRNAs that have previously been reported in bacteria (Table 2) as well as engineered serine variants (Magliery, T. J., et al., (Edited by M. Gottesman). J. Mol. Biol. 307, 755-769 (2001).
TABLE-US-00003 TABLE 2 qtRNAs previously reported in bacteria Gene qtRNA Citation sufD G-GGGG Riddle, D. L. & Carbon, J. Nat. New Biol. 242,, 230-234 (1973); Yourno, J. & Tanemura, S. Nature 225, 422-426 (1970) hop R V-GTNA O'Connor, M., et al., EMBO J. 8, 4315-4323 (1989) sufB P-CCCC Sroga, G. E., et al., Nucleic Acids Res. 20, 3463- 3469 (1992) sufJ T-ACCN Bossi and Smith, PNAS Sci. U.S.A. 81, 6105- 6109 (1984) sufl 6 G-GGGG Gaber, R. F. & Culbertson, M. R. Gene 19, 163- 172 (1982) sufG Q-CAAA O'Connor, M. Nucleic Acids Res. 30, 1985-1990 (2002) su6 L-TAGG Moore, B., et al., J. Mol. Biol. 298, 195-209 (2000)) su7 Q-TAGG Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987)
[0157] Experiments were performed to measure three of these qtRNAs in S2060 E. coli [Hubbard, B. P., et al., (2015) Nat. Methods 12, 939-942], a K12 derivative optimized for directed evolution, using luciferase reporters (
[0158] To expand the catalog of some known qtRNAs to more comprehensively cover canonical amino acid scaffolds, experiments were conducted using rational engineering. Twenty-one representative tRNA scaffolds from the E. coli genome were selected, one for each of the 20 canonical amino acids as well as an initiator methionine (Table 3), and techniques were used to convert these tRNAs into functional qtRNAs.
TABLE-US-00004 TABLE 3 Table of tRNA scaffolds A Scaffold A A Alanine tRNA (GGC) 2 C Cystine (GCA) 1 D Aspartic Acid (GTC) 1 E Glu (TTC) 1 F Phenyalanine (GAA) 1 G Glycine tRNA (CCC) 1 H Histidine (GTG) 1 I Isoleucine (GAT) 1 K LysQ: Lysine tRNA (UUU) L LeuX: Leucine tRNA (UAA) 5 M (initiator) fMet (CAT) 1 M (elongation) tRNA82 Met N Asparagine (GTT) 1 P ProL: Proline tRNA (GGG) 2 Q Glutamine tRNA (CTG) 1 R Arginine (ACG) 1 S SerU: Serine tRNA (CGA) 2 T ThrT: Threonine tRNA (GGU) 3 V Val (GAC) 1 W Trp (CAA) 1 Y Tyr (GTA) 1
[0159] Although numerous types of mutations can cause tRNAs to disrupt triplet reading frame maintenance [Atkins, J. F. (2018). Proc. Natl. Acad. Sci. U.S.A. 115, 11121-11123], one common motif amongst qtRNAs is an expansion from a 7-base to an 8-base anticodon loop, in which the middle four bases are the new quadruplet anticodon. Two strategies for selecting a new quadruplet codon to replace the triplet codon in qtRNAs of this format were tested.
[0160] It was believed that TAGA would be a widely functional and efficient quadruplet codon because TAGA-decoding qtRNAs compete with the low-usage triplet stop codon TAG. A complete set of 21 E. coli TAGA-decoding qtRNAs was tested by replacing the anticodon in each native tRNA scaffold with 5-TCTA-3, the reverse complement of TAGA. (
[0161]
[0162] As a second strategy for codon reassignment, it was observed that duplication of the third base of the codon is a common motif in previously discovered qtRNAs (if XYZ is the original codon, XYZZ is the quadruplet codon) [Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987)]; Gaber, R. F. & Culbertson, M. R. Gene 19, 163-172 (1982); Moore, B., et al., J. Mol. Biol. 298, 195-209 (2000); O'Connor, M. Nucleic Acids Res. 30, 1985-1990 (2002); Riddle, D. L. & Carbon, J. Nat. New Biol. 242, 230-234 (1973); Sroga, G. E., et al., Nucleic Acids Res. 20, 3463-3469 (1992); Yourno, J. & Tanemura, S. Nature 225, 422-426 (1970). 18/21 synthetases must charge tRNAs that decode codons with different third bases [Sonneborn, T. M. In Evolving Genes and Proteins (eds. Bryson, V. & Vogel, H. J.) 377-397 (Academic Press, 1965)], potentially explaining plasticity in this area of tRNA identity elements. This strategy for codon reassignment minimally disrupts the anticodon because the modification is a point-insertion of a base that already occurs in that area of the tRNA. It was determined that this strategy might minimally disrupt tRNA-AARS recognition making it likely to produce charged qtRNAs. A complete set of XYZZ qtRNAs was tested against luciferase reporters bearing the corresponding codon at residue 357 (
[0163] These results showed that not all quadruplet codons could be successfully integrated into all tRNA scaffolds. One potential source of codon-scaffold incompatibility was that these qtRNA rely on host AARSs for aminoacylation, or charging, the process of attaching an amino acid to the 3 end of the tRNA. All the bacterial AARSs except for L, A, and S rely on identity elements in the anticodon loop to recognize their tRNA, and may be unable to recognize a tRNA with a modified anticodon [Gieg, R., et al., Nucleic Acids Res. 26, 5017-5035 (1998)]. If aminoacylation was the only barrier to creation of a functional qtRNA, then all the L, A, and S qtRNAs would be functional. They are not: A-TAGA, L-TAGA, A-GCCC, and L-TTCC are all nonfunctional. This indicated that interaction with the AARS was not the only barrier to creation of a functional qtRNA. Indeed, adherence to AARS identity elements was not a dominant requirement for qtRNA functionality: the TAGA qtRNAs involved changes to many or all of the bases in the anticodon that were predicted as likely to be very disruptive to tRNA recognition, yet still resulted in functional qtRNAs. Together, there are no clear predictive trends that describe which codons are compatible with which scaffolds, or indeed whether the remaining 9 scaffolds are capable of supporting quadruplet codon translation at all. However, as described in studies set forth herein, testing 42 rationally engineered qtRNAs, resulted in the successful identification of functional qtRNAs based on 12 of the 21 target scaffolds.
[0164]
Example 10
[0165] Identifying and Testing Additional Suppressor tRNA Sequencesa pIII-Based Library Selection for Functional qtRNAs (See Methods Above Herein)
[0166] Procedures were carried out to engineer quadruplet decoding tRNA variants for every E. coli tRNA. To identify starting points, suppressor tRNAs reported in the literature were tested. Also tested were rationally engineered suppressors using two different codon reassignment strategies, and a library-based selection method was also developed and used. Functional suppressor tRNAs were identified, and further steps were carried out to increase their function.
Overview
[0167] Steps in the identification and testing process are shown in
[0168] The reporter was validated using two highly active qtRNAs that had been identified: R-CGTT and R-TAGA. Phage bearing both these qtRNAs are capable of forming plaques when challenged to infect E. coli bearing a phage propagation reporter with a matching quadruplet codon; control experiments with mismatched quadruplet anticodons or lacking the qtRNA confirmed the requirements for cognate nine codon/anticodon interactions for phage propagation. Controls included: pIII reporter positive controlE. coli that supply pIII in response to phage infection using pIII encoded under control of the phage shock promoter; pIII reporter negative controlS2060 E. coli lacking any plasmid bearing pIII; M13 phage positive controla M13 phage that retains pIII on its genome; M13 negative controlM13 pIII. See
[0169] Fold enrichment of clonal phage bearing the nine most efficient TAGA qtRNAs clonal phage was compared to the efficiency of each qtRNA in a luciferase assay. It was determined that translation efficiency trended with phage enrichment. See
[0170] Each of eight different clonal pIII reporters were crossed separately against each of 20 different 256-tRNA libraries, for a total of 160 separate library selections. See
[0171] Example results for the AGGG reporter are shown in
General MethodsAlso See Methods Above Herein
[0172] A number of suppressor tRNAs were developed, engineered, and tested. Sequences that encode functional suppressor tRNAs were identified and are set forth herein as SEQ ID NOs: 28-67. Each of SEQ ID NOs: 28-67 was tested as described above herein for toxicity and function, and all were determined to be functional.
[0173] With 20 different tRNA scaffolds and 256 possible quadruplet codons, there are 5120 possible scaffold-codon pairs. A major limitation of the rational engineering approach is that it requires a guess-and-check approach to individual scaffold-codon assignments, many of which are nonfunctional. To more efficiently navigate the space of possible codon reassignments, studies were performed using a library-based approach in which functional qtRNAs were selected using a quadruplet-dependent reporter from 20 different qtRNA-NNNN libraries, each containing a degenerate anticodon pool. This approach allowed rapid assessment of the efficiency of numerous scaffold-codon pairs.
[0174] For the studies pIII, the tail fiber of the M13 bacteriophage, was chosen as the basis for the reporter. A single quadruplet codon was integrated at permissive residue pIII-P29 [Bryson, D. I., et al., (2017). Nat. Chem. Biol. December; 13(12):1253-1260], which created a reporter that tied quadruplet codon translation to M13 phage propagation (
[0175]
[0176] To further validate this approach, studies were performed using the nine most efficient TAGA qtRNAs to confirm that efficiency measured by the luminescence reporter correlated with phage enrichment (
[0177] This reporter was used in studies to identify functional codon-scaffold pairs by using it to enrich functional qtRNAs from a library. Eight quadruplet codons were selected for testing, each of which corresponds to a functional XYZZ qtRNA, which was expected to be re-discovered as a positive control. For each codon, each of 20 qtRNA-NNNN phage libraries was enriched against the pIII reporter, effectively surveying 820=160 codon reassignments (
[0178] Clonal phage from both high and low titer enrichments were Sanger sequenced. It was determined that high titer enrichments generally contained qtRNAs bearing anticodons that corresponded to the reporter while low titer enrichments were populated with the remnants of phage from the input library, with random anticodons (
[0179]
[0180] Studies were performed to check whether this approach had successfully re-identified known qtRNAs from previous approaches. Each of the eight codons elected corresponded to a known XYZZ qtRNA. 6/8 of these qtRNAs were re-identified. Re-discovery of S-TCGG was occluded by more potent enrichment of S-GCAT. The remaining qtRNA, T-ACGG, was the lowest efficiency of the eight at 0.3% of WT efficiency. These data indicate that there may be functional qtRNAs at or below the 0.3% threshold that this assay cannot reliably identify, but above this threshold it reliably identifies functional qtRNAs. Two qtRNAs discovered in this method are toxic when expressed from a plasmid; this is because M13 selections favor variants that promote phage propagation, not cell viability. It was found that AGGG-decoding qtRNAs were more efficient than the other qtRNAs that were discovered, at up to 7% of WT. In general, this approach was an effective way to rapidly identify the most functional qtRNAs from 160 unique reassignment choices, and the efforts to this point yielded functional qtRNAs based on 18 of the 21 target scaffolds.
The only three scaffolds for which a qtRNA had not been identified were asparagine (N), aspartic acid (D), and elongation methionine (M). It was found that AGGG created a functional aspartic acid and elongation methionine qtRNAs (
[0181] Experiments described herein resulted in the identification of 63 functional novel suppressors and their encoding sequences and also the identification of toxic and/or non-functional suppressors.
Example 11
[0182] Directed Evolution of qtRNAs(See Methods Above Herein)
[0183] The majority of the qtRNAs engineered in these studies exhibited very low translation efficiency, at 11=3% or less when compared to a single triplet codon. Translating a peptide of length N entirely encoded with quadruplet codons should scale with N, compounding this inefficiency exponentially and making it currently infeasible to use these qtRNAs in an exclusive quadruplet codon setting. For example, to translate a 70 residue protein using only quadruplet codons with 10% the yield of normal triplet translation should require 11=96.8%.
[0184] To address this issue directed evolution of the qtRNAs was used to improve translation efficiency either by optimizing the scaffold for compatibility with the new anticodon in cis Kleina, L. G., et al., J. Mol. Biol. 213, 705-717 (1990); Yarus, M. (1982). Science 218, 646-652, or improving charging efficiency by one or more AARSs in trans [Salazar, J. C., et al., (2003) Proc. Natl. Acad. Sci. U.S.A. 100, 13863-13868]. To investigate these possibilities, a directed evolution platform was created for optimizing translation components for quadruplet decoding and applied it to qtRNAs.
[0185] To evolve a qtRNA, the pIII reporter was used to repeatedly enrich populations of phage for functional variants (
[0186] During phage infection and replication, mutations arise in the phage genome, some of which may occur in the qtRNA. Studies included use of an inducible mutagenesis plasmid [Badran, A. H. & Liu, D. R. Nat. Commun. 6, 8425 (2015)] to elevate this mutation rate to levels that rival that of traditional in vitro mutagenesis. Thus, repeated enrichment of phage in E. coli carrying a pIII reporter construct resulted in directed evolution of the qtRNA. This technique, known as Phage Assisted Continuous Evolution (PACE) [Esvelt, K. M., et al., Nature 472, 499-503 (2011)], has been used previously to evolve a wide variety of biomolecule activities including aminoacyl tRNA synthetases [Bryson, D. I., et al., (2017). Nat. Chem. Biol. December; 13(12):1253-1260], biosensors [Pu, J., Zinkus-Boltz, J. & Dickinson, B. C. Nat. Chem. Biol. 13, 432-438 (2017)], antibody solubility [Wang, T., et al., (2018) Nat. Chem. Biol. 14, 972-980], broad-PAM specificity Cas9 variants [Hu, J. H., et al., (2018). Nature April 5; 556(7699):57-63], and base editors [Thuronyi, B. W., et al., (2019) Nat. Biotechnol. September; 37(9):1070-1079]. PACE uses a biological process to automate the traditional directed evolution workflow, compressing the multi-day process of library creation and screening into the rapid 20-minute lifecycle of a bacteriophage.
Methods (See Additional Method Details Above Herein)
[0187] Phage bearing a Q-NNNN 256-qtRNA library was cultured in continuous flow and the population was challenged to propagate in bacteria bearing the MP6 mutagenesis plasmid [Badran, A. H. & Liu, D. R. Nat. Commun. 6, 8425 (2015)] and a pIII reporter containing one CAGG quadruplet codon at permissive residue pIII-29. It was expected that the functional Q-CAGG qtRNA, a member of the inoculating library, would be enriched. Additionally, it was possible that evolved variants of Q-CAGG might also emerge. After 45 hours of continuous culture (
[0188] The starting and ending fitness of the phage were compared using enrichment assays, and it was found that the evolved phage bearing Q-CAGG-Evo1 exhibited a substantially improved ability to decode quadruplet codons and was now capable of supporting phage propagation using a copy of pIII containing three quadruplet codons (
[0189] However, sequencing revealed that Q-CAGG-Evo1 acquired a point insertion at the 5 side of the anticodon loop (
[0190] Evolution of toxic biomolecules is a known failure mode of PACE, because selection favors variants that promote phage propagation, not cell viability. From these results, it was conclude that the directed evolution approach is capable of generating qtRNAs with higher efficiency; however full-qtRNA optimization may result in evolved variants that disrupt frame maintenance through diverse mechanisms or exhibit other undesired properties such as high toxicity.
[0191] Next, studies were performed to evolve the five most efficient TAGA qtRNAs in continuous flow using the MP6 mutagenesis plasmid and a pIII reporter containing pIII-29-TAGA (
Interestingly, four of the five scaffolds resulted in mutations to the sides of the anticodon loop, however these mutations were not convergent. The evolved S-TAGA variant, S-TAGA-Evo1, replicates the anticodon loop side mutations described in previous engineering of serine-based qtRNAs [Magliery, T. J., et al., (Edited by M. Gottesman). J. Mol. Biol. 307, 755-769 (2001)]. Another evolved variant, Y-TAGA-Evo, exhibits a mutation to the highly conserved U33 base just 5 of the anticodon [Salman Ashraf, S., et al., (1999) RNA 5, 503-511], but continues to functionally decode quadruplet codons. The quadruplet decoding efficiency of each evolved qtRNA was compared to its pre-evolution equivalent using the luminescence reporter. Results indicated that evolved variants generally showed about an order of magnitude improvement in quadruplet decoding efficiency (
Studies were performed to determine whether even higher efficiency could be achieved through further evolution on a more difficult evolutionary goal. This was examined by evolving S-TAGA-Evo1 on a substantially more challenging phage pIII reporter in which S16, S29, and S34 were all replaced with TAGA codons. S-TAGA-Evo1 was evolved in continuous flow for 30 hours in the two parallel experiments. Interestingly, it was observed that UAG codons evolved in the phage backbone within the highly expressed phage protein pVIII, suggesting that these qtRNAs crosstalk with the triplet UAG codon. In addition, two sweeping variants arose, S-TAGA-Evo2, S-TAGA-Evo3 (
[0192] Historically, translation efficiency of qtRNAs has been broadly lower than TAG-suppression, motivating the field to focus on stop codon suppression [Dumas, A., et al., (2015). Chem. Sci. 6, 50-69]. However, analysis of these variants using the luminescence reporter showed that the most evolved qtRNA variant decodes the TAGA quadruplet codon at the same efficiency that the commonly used M. jannaschii Y-TAG tRNA [Link, A. J., et al., (2003) Curr. Opin. Biotechnol. 14, 603-609] decodes the triplet TAG codon (
[0193] From the results of these studies it was concluded that directed evolution of the tRNAs themselves can substantially improve activity in some cases. In particular, although qtRNAs with modified anticodons alone are generally inefficient, translating at <3% the efficiency of a triplet codon, their evolved variants can translate at 30% efficiency. Although =30% still represents a severe translation efficiency penalty relative to triplet codons, it also corresponds to an exponential improvement when using these evolved qtRNAs in an exclusively quadruplet-codon setting. These efficiency improvements may make it feasible to translate peptides entirely using quadruplet codons that can be meaningfully tied to selection in directed evolution campaigns.
[0194] Studies that included additional evolution on a harder goal were performed and results showed further improvement in the further evolved qtRNA.
Example 12
[0195] Analysis of qtRNA Charging(See Methods Above Herein).
[0196] Studies were performed to investigate the mechanism by which the observed qtRNA mutations confer improved translation efficiency. One hypothesis was that these mutations allow qtRNAs to be charged promiscuously by adopting identity elements of non-cognate AARSs. To investigate this possibility, the charging of each pre- and post-evolution qtRNA was characterized. To do so, a protein with a TAGA codon at permissive residue 151 was translated in sfGFP [Young, D. D., et al., (2011) Biochemistry 50, 42 1894-1900] in the presence of each qtRNA of interest and the resulting amino acid occupancy of residue 151 was measured using mass spectrometry (
TABLE-US-00005 TABLE 4 Charging of qtRNAs Measured sfGFP-151 qtRNA Limit of detection occupancy S-TAGA Pre-evolution 1.47% 100% S S-TAGA-Evo1 0.03% 99.7% S; 0.34% D S-TAGA-Evo2 0.07% 99.7% S; 0.3% D R-TAGAPre- 2.14% 100% R R-TAGA-Evo1 0.12% 100% R R-TAGA-Evo2 0.002% 99.7% R; 0.35% Q Y-TAGA-Pre- 0.08% 100% Y Y-TAGA-Evo1 0.01% 100% Y Q-TAGA-Pre- 8.76% 100% Q Q-TAGA-Evo1 0.05% 100% Q Q-TAGA-Evo2 0.76% 100% Q W-TAGA Pre- 0.29% 82% Q; 12% W; 6% Y W-TAGA-Evo1 0.001% 99.7% Q; 0.03% Y
[0197] These results indicated that evolution of mischarging is not the evolutionary mechanism for these qtRNAs. For R and S qtRNAs, some trace mis-incorporation of Q or D, respectively, was detected at a rate of 0.3% in the evolved qtRNAs. Because a charging improvement of 0.3% would not be large enough to explain the 10 improvement in translation efficiency, this data indicated that evolution of mischarging was not the dominant evolutionary mechanism for R or S qtRNAs.
[0198] In contrast, the pre-evolution W-TAGA qtRNA was predominantly mis-charged by glutamine, while the evolved variant shows increased specificity for incorporation of glutamine (
[0199] To eliminate the possibility of evolved mis-charging in the future, studies were carried out to create an amino acid specific selection. Extensive screening was carried out for amino-acid-specific residues in pIII by testing mutants of residues that were buried or whose side-chains formed close contacts [Holliger, P., et al. (1999) J. Mol. Biol. Vol. 288, 649-657; Lubkowski, et al., (1998) Nat. Struct. Biol. 5, 140-147; and Lubkowski, J., et al., (1999) Structure 7, 711-722]. However, the only highly amino-acid-specific residues identified were cysteines that participate in disulfide bridges. Studies were performed to assess the residue specificity of pIII, which tested for plaquing of pIII M13 phage against a plasmid bearing either WT pIII or a one-mutant of pIII. Lack of plaques indicated non-functional pIII. Only C25 and C372 were determined to always abolish plaquing.
Example 13
Crosstalk Analysis (See Methods Above Herein)
[0200] An essential feature of canonical tRNAs is their specificity for decoding only the cognate codon or specific wobble codons. Studies were performed to determine the extent to which qtRNAs prefer the expected four-base codon over other, similar codons. To do so, the crosstalk of the evolved qtRNAs was characterized (
[0201] As previously reported, it was determined that qtRNAs crosstalk with four-base codons containing a mismatched fourth base, corroborating results of additional studies including those described herein and the literature (Anderson, J. C., Magliery, T. J. & Schultz, P. G. Chem. Biol. 9, 237-244 (2002); Curran, J. F. & Yarus, M. Science 238, 1545-1550 (1987); Fagan et al., 2014; Gaber, R. F. & Culbertson, M. R. Mol. Cell. Biol. 4, 2052-2061 (1984). This crosstalk depends on the identity of the fourth base, and similar trends in the fourth-base crosstalk pattern were observed among the three qtRNAs that were tested. In contrast, none of these qtRNAs exhibited any translation when the mismatch occurred at the third base of the codon. Studies were also performed to characterize crosstalk of TAGA-qtRNAs with translating the three-base TAG codon, a type of crosstalk that could occur from phage backbone evolution during stringent PACE selection (
Given these results, it was determined that qtRNAs that recognize unique sequences in the first three bases of their quadruplet codons should generally be compatible, and suitable for use together as the basis for an expanded genetic code. Five of the most efficient XYZZ qtRNAs were selected to create a set whose codons obeyed this property. Luciferase reporters were used to measure the crosstalk within this set. As expected, results indicated that these qtRNAs were highly orthogonal (
Example 14
[0202] Assessment of qtRNAs for Synthetic Biology Applications (See Methods Above Herein)
[0203] With these results in hand, studies were performed to assess the prospective feasibility of creating an exclusively quadruplet-codon translation system. That all the tRNA scaffolds tested could be converted into corresponding qtRNAs (
[0204] To determine whether quadruplet translation can be processive, studies were carried out and the results confirmed that the evolved S-TAGA-Evo2 could translate a linker of more than 5 adjacent quadruplet codons (
[0205] To determine whether an orthogonal ribosome can be used to translate a transcript containing quadruplet codons, an orthogonal RBS/anti-RBS pair was used, the pair had previously been used to establish a population of synthetic rRNAs in E. coli [Carlson, E. D., et al., (2019) Nat. Commun. 10, 3920; Rackham, 0. & Chin, J. Nat Chem Biol 1, 159-166 (2005)]. In the studies, the synthetic rRNA, bearing the modified anti-oRBS, was expressed from a plasmid, and the luciferase reporter transcript was directed to this ribosome via the corresponding orthogonal ribosomal binding site (oRBS) (
EQUIVALENTS
[0206] It is to be understood that the methods and compositions that have been described above are merely illustrative applications of the principles of the invention. Numerous modifications may be made by those skilled in the art without departing from the scope of the invention.
[0207] Although the invention has been described in detail for the purpose of illustration, it is understood that such detail is solely for that purpose and variations can be made by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.
[0208] The contents of all literature references, publications, patents, and published patent applications cited throughout this application are incorporated herein by reference in their entirety.