Immunostimulatory plasmids

10851379 ยท 2020-12-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to immunomodulator compositions and methods of use as well as methods of making. The immunomodulator compositions comprise immunostimulatory plasmids, or DNA sequence, capable of eliciting an immune response in a recipient subject. Further, the immunostimulatory plasmids, or DNA sequence, do not contain antibiotic resistance coding sequence to help reduce the potential of horizontal transfer of antibiotic resistance in a population.

Claims

1. A method of stimulating an immune response in a subject comprising administering to the subject an immunostimulatory composition comprising: a. a nucleic acid molecule having at least 84% sequence homology with the sequence of SEQ ID NO: 4 and at least 200 CpG dinucleotides; and b. a cationic liposome delivery vehicle, wherein an immune response is stimulated in the subject.

2. The method of claim 1, wherein the liposome delivery vehicle comprises lipids selected from the group consisting of multilamellar vesicle lipids and extruded lipids.

3. The method of claim 1, wherein the liposome delivery vehicle comprises pairs of lipids selected from the group consisting of N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.

4. The method of claim 1, wherein administration is intravenously, intramuscularly, intradermally, intraperitoneally, subcutaneously, by spray, by aerosol, in ovo, orally, intraocularly, intratracheally, or intranasally.

5. The method of claim 1, wherein the immunostimulatory composition further comprises a biological agent.

6. The method of claim 5, wherein the biological agent is an immune enhancer protein, immunogen, vaccine, antimicrobial, or any combination thereof.

7. The method of claim 1, wherein the administration is before exposure to an infectious agent.

8. The method of claim 1, wherein the administration is after exposure to an infectious agent.

9. The method of claim 8, wherein the immune response stimulated is selected from the group consisting of a non-antigen specific immune response, an antigen specific immune response, an innate immune response, an adaptive immune response, a humoral immune response, a cell-mediated immune response, or a combination thereof.

10. The method of claim 1, wherein the subject is a mammalian species, aquaculture species, or avian species.

11. The method of claim 1, wherein the nucleic acid molecule does not code for an immunogen.

12. The method of claim 11, wherein the nucleic acid molecule has at least 90% sequence homology with the sequence of SEQ ID NO: 4.

13. The method of claim 11, wherein the nucleic acid molecule comprises SEQ ID NO: 4.

14. The method of claim 11, wherein the nucleic molecule has at least 260 CpG dinucleotides.

15. The method of claim 11, wherein the nucleic acid molecule has at least 280 CpG dinucleotides.

16. The method of claim 11, wherein the nucleic acid molecule has 283 CpG dinucleotides.

17. The method of claim 11, wherein the nucleic acid molecule further comprises a selectable marker.

18. The method of claim 17, wherein the selectable marker is LacZ.

19. The method of claim 1, wherein the nucleic acid molecule has at least 91% sequence homology with the sequence of SEQ ID NO: 4.

20. The method of claim 11, wherein the liposome delivery vehicle comprises pairs of lipids selected from the group consisting of N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol; N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol; 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM) and cholesterol; and dimethyldioctadecylammonium bromide (DDAB) and cholesterol.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

(2) FIG. 1 shows a map of the pMB75.6 plasmid;

(3) FIG. 2 shows a map of the pGCMB75.6 plasmid;

(4) FIG. 3 shows a map of the pLacZ75.6 plasmid; and,

(5) FIG. 4A and FIG. 4B each graphically illustrates that immunomodulator compositions described herein increase the survivability of recipient subjects challenged with a pathogenic virus.

DETAILED DESCRIPTION OF THE INVENTION

(6) In accordance with the present invention, a composition that is capable of eliciting an immune response in a recipient subject, as well as methods of use, have been discovered. In particular, the present invention relates to novel nucleic acid compositions, or immunomodulator compositions, and uses thereof. It has been discovered that such immunomodulator compositions may include DNA sequences described herein with enhanced GC content, CpG motifs, and propagated without including antibiotic resistance genes or coding sequence. The nucleic acid sequences of the invention may be used to stimulate or enhance an immune response in a subject to prevent or treat infectious disease with significantly enhanced safety over other methods of prevention and treatment known in the art. The invention is particularly useful in the treatment and prevention of infectious diseases caused by microorganisms, such as, without limitation, viruses, bacteria, mold, fungus, yeast, parasites and other microbes known in the art. The compositions and methods of using the immunomodulator compositions are discussed in more detail below.

(7) I. Compositions

(8) Compositions useful in this invention, such as those described herein, are generally able to be used as a prophylactic therapy, metaphylactic therapy, or treatment therapy for infectious diseases. Such compositions are referred to herein as immunomodulator compositions. The immunomodulator compositions include at least a immunostimulatory plasmid or immunostimulatory DNA sequence, capable of eliciting an immune response in a recipient subject. In some aspects, the immunomodulator compositions may also include a liposome delivery vehicle.

(9) A. Nucleic Acids

(10) In some aspects the present invention relates to nucleic acid molecules useful for the treatment or prevention of infectious disease causing agents. The nucleic acid molecules described herein may be included in an immunostimulatory plasmid, as linear double stranded or single stranded DNA, amino acid sequence, ribonucleic acid (RNA), or combinations thereof. In some aspects, the present invention relates to nucleic acid molecules, vectors, and host cells (in vitro, in vivo, or ex vivo) which contain the immunostimulatory plasmid or immunostimulatory DNA sequence.

(11) In some aspects, the present invention relates to immunostimulatory plasmids, or DNA sequences, that do not comprise an antibiotic resistance gene. The plasmids may be devoid of any selectable or screenable marker genes. For example, the pGCMB75.6 plasmid described herein does not comprise any full-length or functional selectable or screenable marker genes. The sequence of pGCMB75.6 is provided in SEQ ID NO: 1.

(12) In some aspects, the immunostimulatory plasmids described herein preferably do not comprise a nucleic acid sequence coding for a full-length or functional selectable or screenable marker. In some aspects, the immunostimulatory plasmids do not comprise an antibiotic resistance gene. For example, the plasmids do not comprise a kanamycin resistance gene. In some aspects, the plasmids described herein preferably do not encode an immunogen.

(13) In some aspects, the immunostimulatory plasmids may comprise a nucleic acid sequence coding for a selectable or screenable marker gene that is not an antibiotic resistance gene. For example, the pLacZMB75.6 plasmid described herein comprises a LacZ gene as a screenable marker. A map of pLacZMB75.6 is provided in FIG. 3 and the nucleotide sequence of pLacZMB75.6 is provided as SEQ ID NO: 4. As shown in FIG. 3, pLacZMB75.6 is similar to pGCMB75.6, but contains a LacZ screenable marker.

(14) It will be appreciated that the nucleotide sequences of the pGCMB75.6 or pLacZMB75.6 plasmids may be varied to a certain extent without significantly adversely affecting their immunostimulatory properties. In some aspects, the present invention relates to an immunostimulatory plasmid comprising a nucleic acid sequence having at least 89% sequence identity with the sequence of pGCMB75.6 (SEQ ID NO: 1). The immunostimulatory plasmid preferably comprises a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence of pGCMB75.6 (SEQ ID NO: 1). In some aspects, the immunostimulatory plasmid more preferably comprises the sequence of pGCMB75.6 (SEQ ID NO: 1).

(15) In some aspects, the present invention relates to an immunostimulatory plasmid comprising a nucleic acid sequence having at least 84% sequence identity with the sequence of pLacZMB75.6 (SEQ ID NO: 4). The immunostimulatory plasmid preferably comprises a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence of pLacZMB75.6 (SEQ ID NO: 4). In some aspects, the immunostimulatory plasmid more preferably comprises the sequence of pLacZMB75.6 (SEQ ID NO: 4).

(16) In some aspects, the present invention relates to an immunostimulatory plasmid consisting of a nucleic acid sequence having at least 89% sequence identity with the sequence of pGCMB75.6 (SEQ ID NO: 1). The immunostimulatory plasmid preferably consists of a nucleic acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence of pGCMB75.6 (SEQ ID NO: 1). In some aspects, the immunostimulatory plasmid more preferably consists of the sequence of pGCMB75.6 (SEQ ID NO: 1).

(17) In some aspects, the present invention relates to an immunostimulatory plasmid consisting of a nucleic acid sequence having at least 84% sequence identity with the sequence of pLacZMB75.6 (SEQ ID NO: 4). The immunostimulatory plasmid preferably consists of a nucleic acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the sequence of pLacZMB75.6 (SEQ ID NO: 4). In some aspects, the immunostimulatory plasmid more preferably consists of the sequence of pLacZMB75.6 (SEQ ID NO: 4).

(18) Another important aspect of this invention provides for immunostimulatory DNA sequences or immunostimulatory plasmids capable of stimulating an immune response including nucleic acid sequences that hybridize under high stringency conditions to SEQ ID NO: 1 or SEQ ID NO: 4. Suitable nucleic acid sequences include those that are homologous, substantially similar, or identical to the nucleic acids of the present invention. In some aspects, homologous nucleic acid sequences will have a sequence similarity of at least about 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to SEQ ID NO: 1 or the respective complementary sequence. In other aspects, homologous nucleic acid sequences will have a sequence similarity of at least about 84%, 85%, 86%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to SEQ ID NO: 4 or the respective complementary sequence. Sequence similarity may be calculated using a number of algorithms known in the art, such as BLAST, described in Altschul, S. F., et al., J. Mol. Biol. 215:403-10, 1990. The nucleic acids may differ in sequence from the above-described nucleic acids due to the degeneracy of the genetic code. In general, a reference sequence will be 18 nucleotides, more usually 30 or more nucleotides, and may comprise the entire nucleic acid sequence of the composition for comparison purposes.

(19) Nucleotide sequences that can hybridize to SEQ ID NO: 1 or SEQ ID NO: 4 are contemplated herein. Stringent hybridization conditions include conditions such as hybridization at 50 C. or higher and 0.1SSC (15 mM sodium chloride/1.5 mM sodium citrate). Another example is overnight incubation at 42 C. in a solution of 50% formamide, 5SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing in 0.1SSC at about 65 C. Exemplary stringent hybridization conditions are hybridization conditions that are at least about 80%, 85%, 90%, or 95% as stringent as the above specific conditions. Other stringent hybridization conditions are known in the art and may also be employed to identify homologs of the nucleic acids of the invention (Current Protocols in Molecular Biology, Unit 6, pub. John Wiley & Sons, N.Y. 1989).

(20) Mutant nucleotides of the DNA molecules described herein may be used, so long as mutants include nucleic acid sequences maintain the ability to stimulating an immune response as described herein. The DNA sequence of such a mutation will usually differ by one or more nucleotides or amino acids. The sequence changes may be substitutions, insertions, deletions, or a combination thereof. Techniques for mutagenesis of cloned genes are known in the art. Methods for site specific mutagenesis may be found in Gustin et al., Biotechniques 14:22, 1993; Barany, Gene 37:111-23, 1985; Colicelli et al., Mol. Gen. Genet. 199:537-9, 1985; and Sambrook et al., Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp. 15.3-15.108 and all incorporated herein by reference. In summary, the invention relates to nucleic acid sequences capable of stimulating an immune response in a subject and variants or mutants thereof. Also, the invention encompasses the intermediatary RNAs encoded by the described nucleic acid sequences, as well as any resultant amino acid sequences encoded.

(21) Where the nucleotide sequence of the immunostimulatory plasmid varies from the sequences provided in SEQ ID NOs. 1 and 4 the CpG dinucleotides in the plasmid are preferably left intact. Alternatively, if the nucleotide sequence of the plasmid is altered such that a CpG dinucleotide is eliminated, the sequence of the plasmid may be altered at another location such that the total number of CpG dinucleotides in the plasmid remains the same. Further CpG dinucleotides in addition to those already present in the nucleotide sequences of pGCMB75.6 or pLacZMB75.6 may also be introduced into the plasmid. Thus, for example, the immunostimulatory plasmids described herein preferably comprise at least about 200, at least about 220, at least about 240, at least about 260, at least about 270, at least about 275, at least about 280, at least about 283, at least about 285, or at least about 288 CpG dinucleotides. For example, the immunostimulatory plasmid can comprise 283 CpG dinucleotides.

(22) In particular, the present invention relates to pharmaceutical formulations comprising any of the immunostimulatory plasmids or DNA sequences described herein and a pharmaceutically acceptable carrier.

(23) B. Immunomodulator

(24) Suitable immunomodulator compositions for use with the immunostimulatory plasmids described herein are described in U.S. Patent Application Publications Nos. 2012/0064151 A1 (avian species) and 2013/0295167 A1 (bovine species), the contents of both of which are hereby incorporated by reference in their entirety.

(25) The immunomodulator composition comprises a liposome delivery vehicle and at least one of the immunostimulatory plasmids, or DNA sequences, described herein.

(26) A suitable liposome delivery vehicle comprises a lipid composition that is capable of delivering nucleic acid molecules to the tissues of the treated subject. A liposome delivery vehicle is preferably capable of remaining stable in a subject for a sufficient amount of time to deliver a nucleic acid molecule and/or a biological agent. For example, the liposome delivery vehicle is stable in the recipient subject for at least about five minutes, for at least about 1 hour, or for at least about 24 hours.

(27) A liposome delivery vehicle of the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of a cell to deliver a nucleic acid molecule into a cell. When the nucleic acid molecule encodes one or more proteins, the nucleic acid:liposome complex preferably has a transfection efficiency of at least about 1 picogram (pg) of protein expressed per milligram (mg) of total tissue protein per microgram (g) of nucleic acid delivered. For example, the transfection efficiency of a nucleic acid: liposome complex can be at least about 10 pg of protein expressed per mg of total tissue protein per g of nucleic acid delivered; or at least about 50 pg of protein expressed per mg of total tissue protein per g of nucleic acid delivered. The transfection efficiency of the complex may be as low as 1 femtogram (fg) of protein expressed per mg of total tissue protein per g of nucleic acid delivered, with the above amounts being more preferred.

(28) A preferred liposome delivery vehicle of the present invention is between about 100 and 500 nanometers (nm) in diameter. For example, the liposome delivery vehicle can be between about 150 and 450 nm or between about 200 and 400 nm in diameter.

(29) Suitable liposomes include any liposome, such as those commonly used in, for example, gene delivery methods known to those of skill in the art. Preferred liposome delivery vehicles comprise multilamellar vesicle (MLV) lipids and extruded lipids. Methods for preparation of MLVs are well known in the art. More preferred liposome delivery vehicles comprise liposomes having a polycationic lipid composition (i.e., cationic liposomes) and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Exemplary cationic liposome compositions include, but are not limited to, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and cholesterol, N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) and cholesterol, 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)-imidazolinium chloride (DOTIM) and cholesterol, dimethyldioctadecylammonium bromide (DDAB) and cholesterol, and combinations thereof. A most preferred liposome composition for use as a delivery vehicle includes DOTIM and cholesterol.

(30) A suitable nucleic acid molecule includes any of the immunostimulatory plasmids described herein. Coding nucleic acid sequences encode at least a portion of a protein or peptide, while non-coding sequence does not encode any portion of a protein or peptide. According to the present invention, non-coding nucleic acids can include regulatory regions of a transcription unit, such as a promoter region. The term, empty vector can be used interchangeably with the term non-coding, and particularly refers to a nucleic acid sequence in the absence of a protein coding portion, such as a plasmid vector without a gene insert. Expression of a protein encoded by the plasmids described herein is not required for elicitation of a non-antigen-specific immune response; therefore the plasmids need not contain any coding sequences operatively linked to a transcription control sequence. However, further advantages may be obtained (i.e., antigen-specific and enhanced immunity) by including in the composition nucleic acid sequence (DNA or RNA) which encodes an immunogen and/or a cytokine. Such a nucleic acid sequence encoding an immunogen and/or a cytokine can be included in the immunostimulatory plasmids described herein, or can be included in a separate nucleic acid (e.g., a separate plasmid) in the composition.

(31) Complexing a liposome with the immunostimulatory plasmids described herein may be achieved using methods standard in the art or as described in U.S. Pat. No. 6,693,086, the contents of which are hereby incorporated by reference in their entirety. A suitable concentration of a plasmid to add to a liposome includes a concentration effective for delivering a sufficient amount of the plasmid into a subject such that a systemic immune response is elicited. For example, from about 0.1 g to about 10 g of plasmid can be combined with about 8 nmol liposomes, from about 0.5 g to about 5 g of plasmid can be combined with about 8 nmol liposomes, or about 1.0 g of plasmid can be combined with about 8 nmol liposomes. The ratio of plasmid to lipid (g plasmid:nmol lipid) in a composition can be at least about 1:1 plasmid:lipid by weight (e.g., 1 g plasmid:1 nmol lipid). For example, the ratio of plasmid to lipids can be at least about 1:5, at least about 1:10, or at least about 1:20. Ratios expressed herein are based on the amount of cationic lipid in the composition, and not on the total amount of lipid in the composition. The ratio of plasmid to lipids in a composition of the invention is suitably from about 1:1 to about 1:80 plasmid:lipid by weight; from about 1:2 to about 1:40 plasmid:lipid by weight; from about 1:3 to about 1:30 plasmid:lipid by weight; or from about 1:6 to about 1:15 plasmid:lipid by weight.

(32) C. Biological Agent

(33) Any of the immunomodulator compositions described herein can further comprise at least one biological agent, in addition to the liposome delivery vehicle and at least one of the plasmids described herein.

(34) Suitable biological agents are agents that are effective in preventing or treating avian or bovine diseases. Such biological agents include immune enhancer proteins, immunogens, vaccines, antimicrobials or any combination thereof. Suitable immune enhancer proteins are those proteins known to enhance immunity. By way of a non-limiting example, a cytokine, which includes a family of proteins, is a known immunity enhancing protein family. Suitable immunogens are proteins which elicit a humoral and/or cellular immune response such that administration of the immunogen to a subject mounts an immunogen-specific immune response against the same or similar proteins that are encountered within the tissues of the subject. An immunogen may include a pathogenic antigen expressed by a bacterium, a virus, a parasite or a fungus. Preferred antigens include antigens derived from organisms which cause an infectious disease in a subject. According to the present invention, an immunogen may be any portion of a protein, naturally occurring or synthetically derived, which elicits a humoral and/or cellular immune response. As such, the size of an antigen or immunogen may be as small as about 5-12 amino acids and as large as a full length protein, including any sizes in between. The antigen may be a multimer protein or fusion protein. The antigen may be a purified antigen. Alternatively, the immune enhancer protein or immunogen can be encoded by the immunostimulatory plasmid or by another nucleic acid included in the immunomodulator composition. Where the immune enhancer protein or immunogen is encoded by a nucleic acid molecule in the immunomodulator composition, the nucleic acid sequence encoding the immune enhancer protein or immunogen is operatively linked to a transcription control sequence, such that the immunogen is expressed in a tissue of a subject, thereby eliciting an immunogen-specific immune response in the subject, in addition to the non-specific immune response. Techniques to screen for immunogenicity, such as pathogen antigen immunogenicity or cytokine activity are known to those of skill in the art and include a variety of in vitro and in vivo assays.

(35) Where the biological agent is a vaccine, the vaccine may include a live, infectious, viral, bacterial, or parasite vaccine or a killed, inactivated, viral, bacterial, or parasite vaccine. One or more vaccines, live or killed viral vaccines, may be used in combination with the immunomodulator composition of the present invention. Suitable vaccines include those known in the art for avian or bovine species.

(36) Exemplary vaccines for avian species include, without limitation, those used in the art for protection against Marek's disease virus (MDV), New Castle disease virus (NDV), chick anemia virus (CAV), infectious bursal disease virus (IBDV), infectious bronchitis virus (IBV), turkey herpesvirus (HVT), infectious laryngotracheitis virus (ILTV), avian encephalomyelitis virus (AEV), fowlpox virus (FPV), fowl cholera, avian influenza virus (AIV), reovirus, avian leucosis virus (ALV), reticuloendotheliosis virus (REV), avian adenovirus and hemorrhagic enteritis virus (HEV), coccidia, and other diseases known in the art. In another example, the vaccine may be a vaccine as described by U.S. Pat. Nos. 5,427,791, 6,048,535, and 6,406,702. For example, a vaccine for protection against Marek's disease may be used in combination with the immunomodulator composition of the present invention.

(37) Exemplary vaccine for bovine species include, without limitation, those used in the art for protection against infectious bovine rhinotracheitis (IBR) (Type 1 bovine herpes virus (BHV1)), parainfluenza virus type 3 (PI3), bovine respiratory syncytial virus (BRSV), bovine viral diarrhea virus (BVDV Type 1 and 2), Histophilus somni, Mycoplasma bovis, and other diseases known in the art. For example, a vaccine for the protection against Mannheimia haemolytica may be used in combination with the immunomodulator composition of the present invention.

(38) The biological agent can be an antimicrobial. Suitable antimicrobials include: quinolones, preferably fluoroquinolones, -lactams, and macrolide-lincosamide-streptogramin (MLS) antibiotics.

(39) Suitable quinolones include benofloxacin, binfloxacin, cinoxacin, ciprofloxacin, clinafloxacin, danofloxacin, difloxacin, enoxacin, enrofloxacin, fleroxacin, gemifloxacin, ibafloxacin, levofloxacin, lomefloxacin, marbofloxacin, moxifloxacin, norfloxacin, ofloxacin, orbifloxacin, pazufloxacin, pradofloxacin, perfloxacin, sarafloxacin, sparfloxacin, temafloxacin, and tosufloxacin. Preferred fluoroquinolones include ciprofloxacin, danofloxacin, enrofloxacin, moxifloxacin, and pradofloxacin. Suitable naphthyridones include nalidixic acid.

(40) Suitable -lactams include penicillins (e.g., amoxicillin, ampicillin, azlocillin, benzathine penicillin, benzylpenicillin, carbenicillin, cloxacillin, co-amoxiclav [i.e. amoxicillin/clavulanic acid], dicloxacillin, flucloxacillin, methicillin, mezlocillin, nafcillin, oxacillin, phenoxymethylpenicillin, piperacillin, procaine penicillin, temocillin, and ticarcillin); cephalosporins (e.g., cefaclor, cefalonium, cefamandole, cefapririn, cefazolin, cefepime, cefixime, cefotaxime, cefoxitin, cefpirome, cefpodoxime, cefquinome, ceftazidime, ceftiofur, ceftriaxone, cefuroxime, cephalexin, cephalothin, and defotetan); carbapenems and penems (e.g., doripenem, ertapenem, faropenem, imipenem, and meropenem); monobactams (e.g., aztreonam, nocardicin A, tabtoxinine--lactam, and tigemonam); and -lactamase inhibitors (e.g., clavulanic acid, sulbactam, and tazobactam). Preferred -lactams include cephalosporins, in particular, cefazolin.

(41) Suitable MLS antibiotics include clindamycin, lincomycin, pirlimycin, and any macrolide antibiotic. A preferred lincosamide antibiotic is pirlimycin.

(42) Other antimicrobials include aminoglycosides, clopidol, dimetridazoles, erythromycin, framycetin, furazolidone, halofuginone, 2-pyridones, robenidine, sulfonamides, tetracyclines, trimethoprim, various pleuromutilins (e.g., tiamulin and valnemulin), and various streptomycin (e.g., monensin, narasin, and salinomycin).

(43) II. Methods

(44) An object of the present invention is to provide immunomodulator compositions, immunostimulatory plasmids (or DNA sequence), and methods that elicit protective immunity to uninfected subjects, protective immunity to infected subjects, enhanced immunity to uninfected subjects, enhanced immunity to infected subjects, therapeutic immunity to infected subjects, or combinations thereof. As such, the compositions of the invention may be used to prophylactically immunize a subject or be used to treat a subject. The methods described herein include administrating an immunostimulatory plasmid, or DNA sequence, described herein to a subject.

(45) A. Methods of Immune Stimulation

(46) The present invention is related to methods of eliciting an immune response in a recipient subject. The methods comprise administering to a subject an effective amount of an immunomodulator composition to elicit an immune response. In some aspects, the immunomodulator composition elicits a non-antigen-specific immune response that is effective alone. In some aspects, the immunomodulator composition enhances the operation of at least one biological agent such as a vaccine, when administered prior to such a vaccine, co-administered with a vaccine, administered post vaccination, or mixed with the vaccine. In some aspects, the methods provide new treatment strategies for protecting recipient subjects from infectious diseases and treating populations having infectious disease. In some aspects, the methods provide a more rapid, a longer and better protection against a disease when the immunomodulator is used in combination with a vaccine, compared to use of the vaccine without the immunomodulator composition.

(47) An immune response can be elicited in a recipient subject by administering an effective amount of an immunomodulator composition, which includes any of the liposome delivery vehicles described herein, any of the immunostimulatory plasmids (for DNA sequences) described herein, and any of the biological agents described herein. It is contemplated that the biological agent may be mixed with or co-administered with the immunomodulator or independently thereof. Independent administration may be prior to or after administration of the immunomodulator. It is also contemplated that more than one administration of the immunomodulator or biological agent may be used to extend enhanced immunity. Furthermore, more than one biological agent may be co-administered with the immunomodulator, administered prior to the immunomodulator, administered after administration of the immunomodulator, or concurrently with the immunomodulator.

(48) An effective amount of any of the immunomodulator compositions described herein may be administered to a subject. The effective amount is sufficient to elicit an immune response in the recipient subject. Such effective amount is any amount that causes an immune response in a recipient subject. Methods of measuring an immune response are well known in the art. Also, a skilled artisan will recognize that the effective amount will depend upon age weight, stage of infection, as well as other factors known in the art. Suitable effective amounts may range from about 0.1 g to 1,000 g per subject. In some aspects, the effective amount may range from about 0.1 g to about 10 g, from about 0.1 g to about 5 g, from about 0.5 g to about 5 g, from about 0.25 g to about 5 g, from about 0.05 g to about 10 g, from about 5 g to about 15 g, from about 10 g to about 15 g, from about 10 g to about 20 g, from about 20 g to about 30 g, from about 30 g to about 40 g, from about 40 g to about 50 g, from about 50 g to about 70 g, from about 70 g to about 90 g, from about 50 g to about 100 g, from about 100 g to about 150 g, from about 150 g to about 200 g, from about 200 g to about 250 g, from about 250 g to about 300 g, from about 300 g to about 350 g, from about 350 g to about 400 g, from about 400 g to about 450 g, from about 450 g, to about 500 g, from about 500 g to about 550 g, from about 550 g to about 600 g, from about 600 g to about 650 g, from about 650 g to about 700 g, from about 700 g to about 750 g, from about 750 g to about 800 g, from about 800 g to about 850 g, from about 850 g to about 900 g, from about 900 g to about 950 g, from about 950 g to about 1000 g. Preferably, in some aspects, the effective amount ranges from about 0.5 g to about 10 g. Yet, preferably in other aspects the effective amount ranges from about 50 g to about 100 g. And, preferably in other aspects, the effective amount ranges from about 40 g to about 70 g.

(49) In some aspects, an immune response can be elicited in a member of the avian species by administering an effective amount of any of the immunomodulator compositions described herein to the member of the avian species. The effective amount is sufficient to elicit an immune response in the member of the avian species. For example, the effective amount of the immunomodulator for an avian species may be from about 0.05 g to about 10 g, from about 0.1 g to about 5 g, from about 0.5 g to about 1.5 g, or from about 1.0 g to about 10 g. By way of example, suitable effective amounts for a subject that is of the avian species may be about 0.1 g, 0.2 g, 0.3 g, 0.4 g, 0.5 g, 0.6 g, 0.7 g, 0.8 g, 0.9 g, 1.0 g, 1.2 g, 1.4 g, 1.6 g, 1.8 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, 5.0 g, 5.5 g, 6.0 g, 6.5 g, 7.0 g, 7.5 g, 8.0 g, 8.5 g, 9.0 g, 9.5 g, 10.0 g, 9.5 g, 10.0 g, 10.5 g, 11.0 g, 12 g, 13 g, 14 g, or 15 g.

(50) In some aspects, an immune response can be elicited in a member of the bovine species by administering an effective amount of any of the immunomodulator compositions described herein to the member of the bovine species. The effective amount is sufficient to elicit an immune response in the member of the bovine species. For example, the effective amount of the immunomodulator for a bovine species can be from about 1 g to about 1000 g per animal, from about 5 g to about 500 g per animal, from about 10 g to about 100 g per animal, from about 10 g to about 50 g per animal, or from about 40 g to about 60 g per animal. By way of example, suitable effective amounts for a subject that is of the bovine species may be about 30 g, 35 g, 40 g, 45 g, 50 g, 55 g, 60 g, 65 g, 70 g, 75 g, 80 g, 85 g, 90 g, 95 g, 100 g, 110 g, 120 g, 130 g, 140 g, 150 g, 160 g, 170 g, 180 g, 190 g, 200 g or up to 500 g, or up to 1000 g.

(51) B. Conditions for Use

(52) The methods of the invention elicit an immune response in a subject such that the subject is protected from a disease that is amenable to elicitation of an immune response. As used herein, the phrase protected from a disease refers to reducing the symptoms of the disease; reducing the occurrence of the disease; reducing the clinical or pathologic severity of the disease; or reducing shedding of a pathogen causing a disease. Protecting a subject can refer to the ability of a therapeutic composition of the present invention, when administered to a subject, to prevent a disease from occurring, cure, and/or alleviate or reduce disease symptoms, clinical signs, pathology, or causes. For example, without limitation, clinical signs of Bovine Respiratory Disease (BRD) include lung lesions, increased temperature, depression (e.g. anorexia, reduced responsiveness to external stimuli, droopy ears), nasal discharge, and respiratory character (e.g. respiratory rate, respiratory effort). The immunomodulator compositions described herein may be administered to cattle that are suspected of being exposed to BRD to prevent or reduce the severity of the above-described clinical signs of BRD. By way of further example, without limitation, clinical signs of Marek's disease in avian subjects includes reduced hatchability and bird survivability. The immunomodulator compositions described herein may be administered to avian subjects that are suspected of being exposed to Marek's disease virus to prevent or reduce the severity of the above-described clinical signs of Marek's disease.

(53) As such, protecting a subject from a disease encompasses both preventing disease occurrence (prophylactic treatment) and treating a subject that has a disease (therapeutic treatment). In particular, protecting a subject from a disease is accomplished by eliciting an immune response in the subject by inducing a beneficial or protective immune response which may, in some instances, additionally suppress, reduce, inhibit, or block an overactive or harmful immune response. The term disease refers to any deviation from the normal health of a subject and includes a state when disease symptoms are present, as well as conditions in which a deviation (e.g., infection, gene mutation, genetic defect, etc.) has occurred, but symptoms are not yet manifested.

(54) Methods of the invention may be used for the prevention of disease, stimulation of effector cell immunity against disease, elimination of disease, alleviation of disease, and prevention of a secondary disease resulting from the occurrence of a primary disease.

(55) In some aspects, methods described herein may be used to improve the acquired immune response of the subject when co-administered with a vaccine versus administration of the vaccine by itself. Generally a vaccine once administered does not immediately protect the subject as it takes time to stimulate acquired immunity. The term improve refers, in the present invention, to elicitation of an innate immune response in the subject until the vaccine starts to protect the subject and/or to prolong the period of protection, via acquired immunity, given by the vaccine.

(56) In some aspects, methods of the invention include administering the composition to protect against infection of a wide variety of pathogens. The composition administered may or may not include a specific antigen to elicit a specific response. It is contemplated that the methods of the invention will protect the recipient subject from disease resulting from infectious microbial agents including, without limitation, viruses, bacteria, fungi, and parasites. A skilled artisan will recognize and appreciate that a immunomodulator composition, as described herein, is effective against numerous infectious agents, which are too numerous to list. The infectious agents provided herein are provided for exemplary purposes and are provided without limitation of the scope of use.

(57) Exemplary viral infectious diseases in avian species include, without limitation, those resulting from infection with chicken infectious anemia virus (CIAV), Marek's disease virus (MDV), herpesvirus chicken (HCV), herpesvirus turkey (HTV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), infectious bronchitis virus (IBV), infectious laryngotracheitis virus (ILTV), paramyxovirus type 3, avian encephalomyelitis (AEV), fowlpox virus (FPV), fowl cholera, avian influenza virus (AIV), reovirus, avian leucosis virus (ALV), reticuloendotheliosis virus (REV), avian adenovirus, hemorrhagic enteritis virus (HEV), pneumovirus, pigeon pox virus, recombinants thereof, and other viruses known in the art.

(58) Exemplary bacterial infections in avian species include, without limitation, those resulting from infection with gram positive bacteria, gram negative bacteria, or fungi such as Bordetella spp., Campylobacter jejuni, Clostridium botulinum, Clostridium colinum, Clostridium perfringens, Erysipelothrix insidiosa, Escherichia coli, Hemophilus gallinarum, Mycoplasma gallisepticum, Mycoplasma meleagridis, Mycoplasma synoviae, Pasteurella multocida, Riemerella anatipestifer, Salmonella spp., Salmonella enteritidis, Salmonella gallinarum, Salmonella pullorum, and other bacteria known in the art.

(59) Exemplary fungi or mold infections in avian species include, without limitation, those resulting from infection with Aspergillus flavus, Aspergillus fumigates, Candida albicans, and other infectious fungi or mold known in the art. Exemplary disease conditions include, without limitation, those resulting from toxins from gram positive bacteria, gram negative bacteria, or fungi such as Clostridium botulinum toxin, Clostridium perfringens toxins, Escherichia coli enterotoxin, Fusarium mycotoxins Pasteurella leukotoxin, Staphylococcus toxins, and other toxins known in the art.

(60) Exemplary parasites in avian species include, without limitation, Ascaridia galli, Capillaria annulata, Capillaria contorta, Capillaria obsignata, coccidia spp., Eimeria meleagridis, Heterakis gallinae, Syngamus trachea, and other parasites known in the art.

(61) Exemplary viral infectious diseases in bovine species include, without limitation, those resulting from infection with bluetongue virus, bovine adenovirus, bovine calicivirus, bovine coronavirus (BCV), bovine enterovirus, bovine herpesvirus Type 1 (BHV1), bovine herpesvirus Type 4 (BHV4), bovine leukemia virus, bovine parvovirus, bovine reovirus, bovine respiratory syncytial virus (BRSV), bovine rhinovirus, bovine viral diarrhea virus Type 1 (BVDV1), bovine viral diarrhea virus Type 2 (BVDV2), infectious bovine rhinotracheitis (IBR), malignant catarrhal fever virus, parainfluenza virus type 3 (PIV3), rabies virus, vesicular stomatitis virus (VSV), recombinants thereof, and other viruses known in the art.

(62) Exemplary bacterial infections in bovine species include, without limitation, those resulting from infection with gram positive bacteria, gram negative bacteria, or mycobacteria such as Arcanobacterium pyogenes, Bacillus anthracis, Bacillus anthrax, Brucella abortus, Campylobacter fetus, Campylobacter jejuni, Clostridium botulinum, Clostridium chauveoi, Clostridium colinum, Clostridium hemolyticum, Clostridium novyi, Clostridium perfringens, Clostridium septicum, Clostridium tetani, Corynebacterium, Escherichia coli, Fusobacterium necrophorum, Fusobacterium spp., Histophilus somni, Histophilus spp., Leptospira spp., Mannheimia haemolytica, Moraxella spp., Muellerius spp., Mycobacterium paratuberculosis, Mycobacterium spp., Mycoplasma bovirhinis, Mycoplasma bovis, Mycoplasma dispar, Mycoplasma spp., Pasteurella multocida, Salmonella spp., Treponema spp., Ureaplasma diversum, and other bacteria known in the art.

(63) Exemplary fungi or mold infections in bovine species includes, without limitation, those resulting from infection with Actinobacterim spp., Aspergillus spp., and Histomonas spp., and other infectious fungi or mold known in the art.

(64) Exemplary parasites in bovine species include, without limitation, Anaplasma spp., Anaplasma marginale, Babesia spp., Chorioptes spp., Cooperia, Cysticercus spp., Damalinia bovis, Dermatophilus spp., Dictylocaulus spp., Eimeria spp., Eperythrozoon spp., Fascioloides spp., Haemonchus spp., Melophagus spp., Muellerius spp., Nematodirus spp., Neospora spp., Oestrus spp., Ostertagia spp., Psoroptes spp., Sarcoptes spp., Serpens spp., Strongyloides spp., Toxoplasma spp., Trichophyton spp., Trichostrongylus, Trichuris spp., and Tritrichomonas spp., and other parasites known in the art.

(65) Exemplary infectious disease agents in bovine species also include those agents causing mastitis, metritis, cryptosporidiosis, and any other infectious disease the bovine species is susceptible to.

(66) C. Administration

(67) A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular biological agents selected, the age and general health status of the subject, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention may be practiced using any mode of administration that produces effective levels of an immune response without causing clinically unacceptable adverse effects. The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art.

(68) The immunomodulator composition may be administered intravenously, intramuscularly, intradermally, intraperitoneally, subcutaneously, by spray, in ovo by feather follicle method, orally, intraocularly, intratracheally, intranasally, or by other methods known in the art. In one aspect, the immunomodulator is administered subcutaneously. In another aspect, the immunomodulator may be administered intramuscularly. In another aspect, the immunomodulator is administered as a spray. In another aspect, the immunomodulator may be administered orally.

(69) In one respect, the immunomodulator may be administered by itself to the subject prior to challenge (or infection). In another aspect, the immunomodulator may be administered by itself to the subject post challenge (or infection). In another aspect, the immunomodulator may be administered by itself to the subject at the same time as challenge (or infection).

(70) In some aspects, the immunomodulator composition may be co-administered at the same time as the vaccination prior to challenge. In some aspects, the immunomodulator composition may be co-administered at the same time as the vaccination at the same time as challenge (or infection). In some aspects, the co-administration may include administering the vaccine and immunomodulator in the same general location on the subject at two different sites next to each other (i.e., injections next to each other at the neck of the subject), on opposing sides of the subject at the same general location (i.e., one on each side of the neck), or on different locations of the same subject. In some aspects, the immunomodulator composition can be administered prior to vaccination and challenge. In some aspects, the immunomodulator composition may be administered after vaccination but prior to challenge. The immunomodulator composition can be administered after challenge to a subject that has been vaccinated prior to challenge (or infection).

(71) A skilled artisan will recognize that administration routes may vary depending upon the subject and the health or state of the subject. The administration routes provided for avian and bovine species are for exemplary purposes and are provided without limitation.

(72) Vaccination of avian species may be performed at any age. Vaccinations may be administered to 18 day old embryos (in ovo) and above for a live microorganism and 3 weeks and older for an inactivated microorganism or other type of vaccine. For in ovo vaccination, vaccination may be administered in the last quarter of development. The vaccine may be administered subcutaneously, by the feather follicle method, by spray, orally, intraocularly, intratracheally, intranasally, in ovo, or by other methods know in the art. Oral vaccines may be administered in drinking water. Further, it is contemplated that the methods of the invention may be used based on routine vaccination schedules.

(73) The immunomodulator composition may also be administered to an avian species subcutaneously, by the feather follicle method, by spray, intraocularly, intratracheally, intranasally, in ovo, or by other methods known in the art. For example, the immunomodulator composition can be administered in ovo. Alternatively, the immunomodulator composition can be administered as a spray.

(74) The immunomodulator composition can be administered in ovo to an avian embryo in the last quarter of its development. For example, the immunomodulator composition can be administered in ovo to a 18-day-old or 19-day-old embryo. The administration to the egg may be prior to challenge (or infection) or post challenge.

(75) The immunomodulator can be administered to an animal of the avian or bovine species from about 1 to about 14 days prior to challenge or from about 1 to about 14 days post challenge. For example, the immunomodulator can be administered from about 1 to about 7 days prior to challenge or from about 1 to about 7 days post challenge. The immunomodulator is suitably administered 1, 2, 3, 4, 5, 6, 7 days prior to challenge or 1, 2, 3, 4, 5, 6, 7 days post challenge.

(76) Vaccination of bovine species may be performed at any age. The vaccine may be administered intravenously, intramuscularly, intradermally, intraperitoneally, subcutaneously, by spray, orally, intraocularly, intratracheally, intranasally, or by other methods known in the art. Further, it is contemplated that the methods described herein may be used based on routine vaccination schedules.

(77) Other delivery systems may include time-release, delayed release, or sustained release delivery systems. Such systems can avoid repeated administrations of the compositions therefore increasing convenience. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109.

(78) Delivery systems also include non-polymer systems that are lipids including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di-, and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to, erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974, and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

(79) As various changes could be made in the above composition, products, and methods without departing from the scope of the invention, it is intended that all matter contained in the above description and in the examples given below shall be interpreted as illustrative and not in a limiting sense.

DEFINITIONS

(80) The term effective amount refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of immunomodulator for treating or preventing an infectious disease is that amount necessary to cause the development of an immune response upon exposure to the microbe, thus causing a reduction in the amount of microbe within the subject and preferably the eradication of the microbe. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of immunomodulator without necessitating undue experimentation.

(81) The term cytokine refers to an immune enhancing protein family. The cytokine family includes hematopoietic growth factor, interleukins, interferons, immunoglobulin superfamily molecules, tumor necrosis factor family molecules and chemokines (i.e. proteins that regulate the migration and activation of cells, particularly phagocytic cells). Exemplary cytokines include, without limitation, interleukin-2 (IL-2), interleukin-12 (IL-12), interleukin-15 (IL-15), interleukin-18 (IL-18), interferon- (IFN), and interferon- (IFN).

(82) The term elicit can be used interchangeably with the terms activate, stimulate, generate or upregulate.

(83) The term eliciting an immune response in a subject refers to specifically controlling or influencing the activity of the immune response, and can include activating an immune response, upregulating an immune response, enhancing an immune response and/or altering an immune response (such as by eliciting a type of immune response which in turn changes the prevalent type of immune response in a subject from one which is harmful or ineffective to one which is beneficial or protective).

(84) The term operatively linked refers to linking a nucleic acid molecule to a transcription control sequence in a manner such that the molecule is able to be expressed when transfected (i.e., transformed, transduced or transfected) into a host cell. Transcriptional control sequences are sequences which control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those which control transcription initiation, such as promoter, enhancer, operator and repressor sequences. A variety of such transcription control sequences are known to those skilled in the art. Preferred transcription control sequences include those which function in avian, fish, mammalian, bacteria, viral, plant, and insect cells. While any transcriptional control sequences may be used with the invention, the sequences may include naturally occurring transcription control sequences naturally associated with a sequence encoding an immunogen or immune stimulating protein.

(85) The terms nucleic acid molecule and nucleic acid sequence can be used interchangeably and include DNA, RNA, or derivatives of either DNA or RNA. The terms also include oligonucleotides and larger sequences such as plasmids, such as the immunostimulatory plasmids described herein, and including both nucleic acid molecules that encode a protein or a fragment thereof, and nucleic acid molecules that comprise regulatory regions, introns, or other non-coding DNA or RNA. Typically, an oligonucleotide has a nucleic acid sequence from about 1 to about 500 nucleotides, and more typically, is at least about 5 nucleotides in length. The nucleic acid molecule can be derived from any source, including mammalian, fish, bacterial, insect, viral, plant, synthetic sources or combinations thereof. A nucleic acid molecule can be produced by methods commonly known in the art such as recombinant DNA technology (e.g., polymerase chain reaction (PCR), amplification, cloning) or chemical synthesis. Nucleic acid molecules include natural nucleic acid molecules and homologues thereof, including, but not limited to, natural allelic variants and modified nucleic acid molecules in which nucleotides have been inserted, deleted, substituted, or inverted in such a manner that such modifications do not substantially interfere with the nucleic acid molecule's ability to elicit an immune response useful in the methods of the present invention. A nucleic acid homologue may be produced using a number of methods known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Labs Press, 1989), which is incorporated herein by reference.

(86) The terms selectable marker and selectable marker gene refer to a gene that encodes a product that protects the organism in which the gene is expressed from a selective agent (e.g., an antibiotic) or a condition that would normally kill the organism or inhibit its growth. Selectable marker genes are most commonly antibiotic resistance genes (e.g., kanamycin resistance genes, ampicillin resistance genes, chloramphenicol resistance genes, tetracycline resistance genes, etc.). Thus, for example, when E. coli cells are subjected to a transformation procedure to introduce a plasmid encoding a kanamycin resistance gene and then grown on or in media containing kanamycin, only the E. coli cells that have successfully taken up the plasmid and expressed the kanamycin resistance gene will survive. The terms selectable marker and selectable marker gene also include genes that code for enzymes involved in the synthesis of a compound that is essential for the growth of an organism. When introduced into an auxotrophic organism that is unable to synthesize the essential compound, such genes allow the organism to grow in a medium that has been supplemented with the essential compound. For example, bacterial cells that are auxotrophic for the amino acid lysine due to a mutation in or the absence of an enzyme involved in lysine biosynthesis normally are unable to grown on media that has not been supplemented with lysine. When such bacteria are subjected to a transformation procedure to introduce a plasmid encoding the enzyme involved in lysine biosynthesis, the bacteria that have successfully taken up the plasmid and expressed the enzyme will survive when grown on media that has not been supplemented with lysine. The terms selectable marker and selectable marker gene further include genes that allow for poison/antidote selection. For example, the ccdB gene encodes a protein that binds to DNA gyrase, an essential enzyme for cell division. Upon binding to DNA gyrase, the ccdB gene product impairs gene replication and induces cell death. Thus, bacterial expressing the ccdB gene product cannot survive. The ccdA gene encodes a protein (the antidote) that acts as a natural inhibitor of the ccdB gene product. Thus, when bacteria having the ccdB gene in their bacterial genome are subjected to a transformation procedure to introduce a plasmid encoding the ccdA gene product, only the cells that successfully take up the plasmid and express the ccdA gene will survive.

(87) The terms screenable marker and screenable marker gene refer to a gene that encodes a product that allows an observer to distinguish between cells expressing the screenable marker gene and cells that are not expressing the screenable marker gene. Screenable marker gene systems are well known in the art and include, for example, lacZ genes and genes encoding fluorescent proteins such as green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), or cyan fluorescent protein (CFP).

(88) As used herein, the term subject refers to a living organism having a central nervous system. In particular, subjects include, but are not limited to, human subjects or patients and companion animals. Exemplary companion animals may include domesticated mammals (e.g., dogs, cats, horses), mammals with significant commercial value (e.g., avian species, bovine species, dairy cows, beef cattle, sporting animals), mammals with significant scientific values (e.g., captive or free specimens of endangered species), or mammals which otherwise have value. Suitable subjects also include: mice, rats, dogs, cats, ungulates such as cattle, swine, sheep, horses, and goats, lagomorphs such as rabbits and hares, other rodents, and primates such as monkeys, chimps, and apes. Subjects may be any member of the avian species, whether domestic or wild, and may be commercially reared for breeding, meat or egg production. Exemplary avian species include, without limitation, chickens, turkeys, geese, ducks, pheasants, quail, pigeons, ostriches, caged birds, birds in zoological collections and aviaries and the like. Subjects may be any member of the bovine species, whether domestic or wild, and may be commercially reared for breeding, meat or mil production. Exemplary bovine species include, without limitation, antelopes, buffalos, yaks, cattle, bison, and the like. Species of cattle include, without limitation, cows, bulls, steers, heifer, ox, beef cattle, dairy cattle, and the like. Subjects may be any member of an aquaculture species, including without limitation, any species of fish, crustaceans, molluscs, living in freshwater or saltwater. In some aspects, subjects may be diagnosed with an infectious disease, may be at risk for an infectious disease, or may be experiencing an infectious disease. Subjects may be of any age including in utero, new born, adolescence, adult, middle age, or elderly.

EXAMPLES

(89) The following non-limiting examples are provided to further illustrate the present invention.

Example 1: Preparation of the pGCMB75.6 Plasmid

(90) A map of pGCMB75.6 is shown in FIG. 2. In pGCMB75.6, the kanamycin-resistance gene of pMB75.6 (see FIG. 1) has been replaced by non-coding sequence from E. coli K-12. To generate the pGCMB75.6 plasmid, an AscI single cutter restriction site was introduced into pMB75.6 at a site 5 of the kanamycin resistance gene to generate pMB75.6_AscI (SEQ ID NO: 3). To introduce the AscI restriction site, an adenine present in the sequence of pGCMB75.6 was mutated to a guanine, thereby changing the sequence AGCGCGCC in the pGCMB75.6 plasmid to GGCGCGCC. This modification was accomplished using a mutagenesis-based approach by ligation during amplification. A single primer was used, which carried the AscI restriction site in its middle.

(91) A 1779 nt long AscI (GGCGCGCC)/XhoI (CTCGAG) fragment was synthesized by Life Technologies GmbH (Darmstadt, Germany). This fragment contained five regions comprising non-coding sequence from E. coli K-12 (exchanges 1-5, abbreviated as exc. 1, exc. 2, etc. in FIG. 2), an F1 origin of replication, and a truncated lacZ gene (see FIG. 2). In the case of exchange 4, the E. coli sequence was manually changed at several positions in order to increase the GC-content of the plasmid. In addition, in exchange 2, a single nucleotide was changed to delete a DraI restriction site, so that there would only be a single DraI site in the plasmid.

(92) As shown in FIG. 2, pGCMB75.6 contains several regulatory elements (an F1 origin of replication, a CMV promoter, and a pUC origin of replication) and a multiple cloning site. pGCMB75.6 also contains a truncated lacZ gene. However, pGCMB75.6 does not comprise any full-length or functional selectable or screenable marker genes. pGCMB75.6 is 4242 bp in length and contains 283 CpG dinucleotides.

(93) One positive clone, carrying the new introduced AscI site (pMB75.6_AscI) was digested with AscI (GGCGCGCC)/XhoI (CTCGAG) to generate a 2463 fragment containing the CMV promoter, multiple cloning site, and pUC origin of replication (see FIG. 2). The 1779 nt AscI (GGCGCGCC)/XhoI (CTCGAG) synthesized fragment was digested with AscI/XhoI as well.

(94) Both fragments (the 2463 nt vector fragment and the 1779 nt insert fragment) were gel eluted from a 1% agarose gel by using the QIAquick Gel Extraction Kit from Qiagen. A ligation was performed using 600 ng of the 1779 nt fragment and 400 ng of the 2463 nt pMB75.6_AscI vector fragment in a total volume of 20 l, overnight at 16 C. The 20 l was then dialyzed for 2 h against 20 ml H.sub.2O on ice, and then mixed with 5 l electro-competent DH5a E. coli cells and 40 l H.sub.2O (Invitrogen F-f80lacZM15 (lacZYA-argF) U169 recA1 endA1 hsdR17 (rk, mk+) gal-phoA supE44 -thi-1 gyrA96 re1A1; Lot no. 1376481, Part no. 44-0097). Following transformation and 1 h regeneration in SOC media, the cells were plated on LB plates without kanamycin at a 10.sup.4 dilution. This dilution allowed for isolation of individual clones.

(95) Colony PCR was performed on individual clones using the following primers listed in Table 1.

(96) TABLE-US-00001 TABLE1 PCRprimers. AH-13rev GTGCGCGGAACCCCTATTTG (SEQIDNO:5) AH-22for GCGTACCCGCCGTTCTCATC (SEQIDNO:6)

(97) The locations of the AH-13 rev and AH-22 for primers are shown in FIG. 2. A premix containing Taq polymerase was used. PCR reactions were loaded onto a 1% agarose gel containing ethidium bromide. Positive clones which carried the correct plasmid (pGCMB75.6) showed a product of 606 bp.

(98) A total of more than 10,000 clones were screened to identify three positive clones. The three positive clones were immediately transferred to fresh LB plates and were used to create 3 Research Cell Banks (RCB; Sys 3733, Sys 3734 and Sys 3735).

(99) In parallel, medium was inoculated with these three clones and plasmid DNA was generated. Complete sequence certification of each of the three subclones was done using the following primers listed in Table 2.

(100) TABLE-US-00002 TABLE2 PCRforsequencecertification. AH-12for GTCTGACGCTCAGTGGAACG (SEQIDNO:7) AH-13rev GTGCGCGGAACCCCTATTTG (SEQIDNO:5) AH-15 GTTCCAGTTTGGAACAAGAGTC (SEQIDNO:8) AH-16 GGCAATTAGCCATATTAGTC (SEQIDNO:9) AH-17 GCAGAGCTCGTTTAGTGAACCG (SEQIDNO:10) AH-18 GATCATAATCAGCCATACCAC (SEQIDNO:11) AH-19 CGTCTTGAGTCCAACCCGGTAAGACAC (SEQIDNO:12) AH-20 CCACAGGTGTCCACTCCCAGGTTC (SEQIDNO:13) AH-21rev CTAGTCAAGGCACTATACATC (SEQIDNO:14) AH-22for GCGTACCCGCCGTTCTCATC (SEQIDNO:6) AH-23 TCCACAGAATCAGGGGATAACG (SEQIDNO:15)

Example 2: Generation of the pLacZMB75.6 Plasmid

(101) To generate the pLacZMB75.6 plasmid (FIG. 3; SEQ ID NO: 4), a 1307 nt XhoI (CTCGAG)/DraI (TTTAAA) fragment was synthesized by Life Technologies GmbH (Darmstadt, Germany) This 1307 nt fragment contained a portion of the lacZ gene (265 nt). Thus, when ligated into pGCMB75.6, this fragment elongates the truncated LacZ gene located upstream of the XhoI restriction site and allows the LacZ gene to be expressed (compare FIG. 2 and FIG. 3). In addition 91 nt of the multiple cloning site were exchanged with E. coli non coding sequence, in order to eliminate sequence homology with the newly introduced LacZ gene region and avoid recombination. In addition, the 5 region of the CMV promoter was deleted (265 nt) in order to generate a plasmid of the same size as plasmid pGCMB75.6.

(102) pGCMB75.6 and the 1311 nt synthesized fragment were both digested with XhoI and DraI. Both fragments were gel eluted from a 1% agarose gel by using the QIAquick Gel Extraction Kit from Qiagen.

(103) A ligation was performed using 240 ng of the 1311 nt fragment and 240 ng of the vector fragment in a total volume of 20 l, overnight at 16 C. 3 l were mixed with 10 l electro-competent DH5 E. coli cells (Invitrogen F-f80lacZM15 (lacZYA-argF) U169 recA1 endA1 hsdR17 (rk, mk+) gal-phoA supE44 -thi-1 gyrA96 re1A1; Lot no. 1376481, Part no. 44-0097) and 40 l 10% Glycerin solution. Following transformation and 1 h regeneration in SOC media, the cells were plated on LB X-Gal/IPTG plates without kanamycin at a 10.sup.2 and 10.sup.4 dilution. This dilution allowed for isolation of individual clones.

(104) Identification of colonies with plasmid was performed via blue/white selection and colony PCR was performed to confirm using the following primers listed in Table 3.

(105) TABLE-US-00003 TABLE3 PCRprimersforcolonyconfirmation. AH-15 GTTCCAGTTTGGAACAAGAGTC (SEQIDNO:8) AH-39 GCTCACTCATTAGGCACCCCAGG (SEQIDNO:16)

(106) The locations of the AH-15 and AH-39 primers are shown in FIG. 3. A premix containing Taq polymerase was used. PCR reactions were loaded onto a 1% agarose gel containing ethidium bromide. Positive clones which carried the correct plasmid (pLacZMB75.6) showed a product of 777 bp.

(107) Four positive clones were identified and immediately transferred to fresh LB plates and were used to create Research Cell Banks (RCB; Sys 3736, Sys 3737, Sys 3738 and Sys 3739).

(108) In parallel, medium was inoculated with these four clones and plasmid DNA was generated. Complete sequence certification of each of the four subclones was done using the same primers as for pGCMB75.6 but instead of using primer AH-16 (SEQ ID NO: 10) primer AH-24 was used (See Table 4).

(109) TABLE-US-00004 TABLE4 PCRprimerforAH-24. AH-24 CGCGTAATACGACTCACTATAG (SEQIDNO.17)

Example 3: Immunomodulator Composition

(110) The immunomodulator is a composition comprising a cationic lipid and non-coding DNA sequence described herein. The synthetic immunomodulator lipid components [1-[2-[9-(Z)-octadecenoyloxy]]-2-[8](Z)-heptadecenyl]-3-[hydroxyethyl]imidazolinium chloride (DOTIM) and a synthetic neutral lipid cholesterol are formulated to produce liposomes approximately 200 nm in diameter (See, U.S. Pat. No. 6,693,086). The DNA component is pGCMB75.6 or pLacZMB75.6. Being negatively charged, the plasmid DNA associates with the positively-charged (cationic) liposomes (See, U.S. Pat. No. 6,693,086).

Example 4: Immunomodulator Composition Administration to Mammal Model Increased Survivability in Virus Challenge

(111) The efficacy of the immunomodulator compositions described herein was evaluated in a mammal model challenged with pathogen. Mice were administered the immunomodulator composition, containing pGCMB75.6 DNA and cationic liposomes, via intraperitoneal injection. The immunomodulator composition was administered at 0.01 g, 0.02 g, 0.04 g, and 1.00 g concentrations. Control mice were administered 0.9% NaCl solution via intraperitoneal injection. Twenty-four hours post-immunomodulator administration, all animals were challenged with viral application via intraperitoneal injection (0.2 ml 10.sup.34 KID.sub.50/ml). The challenge virus was Pseudorabies (PR). The survivability rates are depicted in FIG. 4. Mice receiving an immunomodulator composition described herein had higher dose dependent survivability rates than control mice.

Example 5: Immunomodulator Composition Administration to Avian Model Increased Hatchability and Survivability in Pathogen Challenge

(112) The efficacy of the immunomodulator compositions described herein was evaluated in an avian model challenged with pathogen by spray on day E19 (embryonic day 19). Chicken eggs were administered an immunomodulator composition, containing pGCMB75.6 DNA and cationic liposomes, via in ovo administration on day E18 (embryonic day 18). Control eggs received a placebo control diluent (D5W) (in ovo). BHI broth (spray) was used as mock challenge (T1). The details of the study treatment groups are provided in Table 5 below.

(113) TABLE-US-00005 TABLE 5 Avian Immunomodulator composition treatment descriptions. Challenge Number of Number of In ovo description Hatching Treatment eggs on study administration spray Number Trays/sub- Number of Group at E18.sup.1 (Day E18) (Day E19) of Flats.sup.2 trays.sup.3 pens.sup.4 T1 896 Placebo BHI broth 56 7/14 14 Control Diluent (mock) (D5W) T2 896 Placebo APEC.sup.5 56 7/14 14 Control Diluent (D5W) T3 896 1.0 mcg JV- APEC.sup.5 56 7/14 14 77/egg T4 896 0.1 mcgJV- APEC.sup.5 56 7/14 14 77/egg T5 896 1.0 mcg Lot APEC.sup.5 56 7/14 14 X5872/egg T6 896 0.1 mcg Lot APEC.sup.5 56 7/14 14 X5972/egg T7 896 1.0 mcg Lot APEC.sup.5 56 7/14 14 X5928/egg T8 896 0.1 mcg Lot APEC.sup.5 56 7/14 14 X5928/egg .sup.1Day 18 of egg incubation; .sup.216 eggs per flat; .sup.364 eggs per sub-tray (partitioned to accommodate two groups per tray); .sup.4The chicks hatched from each section of the tray were transferred to one pen; .sup.5Avian pathogenic Escherichia coli (APEC).

(114) The DNA component of the immunomodulator composition included one of three clones isolated of pGCMB75.6 DNA (i.e. Jv77, X5872, or X5928). As can be observed from the results summarized in Table 6 below, both the average hatchability and average survivability were improved when an immunomodulator composition described herein was administered compared to eggs receiving control treatment.

(115) TABLE-US-00006 TABLE 6 Avian hatchability and survivability rates.* Mortality Mortality Overall at Hatch Mortality Post-hatch Mortality Mortality (Diff. from Post- (Diff. from Overall (Diff. from Treatment at Hatch Control- hatch Control- Mortality Control- Group N (avg.) Chall.) (avg.) Chall.) (avg.) Chall.) 01-Control no 14 12.5% 0.7% 13.2% challenge 02-Control 14 22.5% 27.8% 43.5% Challenge (Chall) 03-Jv77: 1.0 g 14 20.2% 2.3% 26.5% 1.3% 40.6% 2.9% Chall 04-Jv77: 0.1 g 14 20.8% 1.7% 22.4% 5.4% 38.6% 4.9% Chall (p = 0.0368) 05-X5872: 1.0 g 14 17.6% 4.9% 22.1% 5.7% 36.3% 7.2% Chall (p = 0.0110) (p = 0.0023) 06-X5872: 0.1 g 14 23.0% 0.5% 24.6% 3.2% 42.0% 1.5% Chall 07-X5928: 1.0 g 14 15.5% 7.0% 22.3% 5.5% 33.9% 9.6% Chall (p = 0.0003) (p<0.0001) 08-X5928: 0.1 g 14 21.2% 1.3% 27.7% 0.1% 43.0% 0.5% Chall *All validation tests passed (comparison between two control groups). Significant difference compared with the Control Chall group.

(116) When introducing elements of the present invention or the preferred embodiments(s) thereof, the articles a, an, the and said are intended to mean that there are one or more of the elements. The terms comprising, including and having are intended to be inclusive and mean that there may be additional elements other than the listed elements.

(117) In view of the above, it will be seen that the several objects of the invention are achieved and other advantageous results attained.

(118) As various changes could be made in the above products, compositions, and methods without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.