Reliable, comprehensive, and rapid sexual health assessment

10794911 ยท 2020-10-06

Assignee

Inventors

Cpc classification

International classification

Abstract

A system and method for detecting status of a health condition in a single-step process includes: a signal output device including a) a loading zone; b) a reaction zone fluidly coupled to the loading zone and including one or more reaction substances conjugated to labels, configured to enable detection of target material associated with the health condition; c) a testing zone fluidly coupled to the reaction zone and including one or more testing substances corresponding to the target material; and d) a control zone including a control substance retained at the control zone. The system and methods can be adapted for assessment of sexual health of one or more subjects, in relation to pregnancy, fertility, and/or sexually transmitted infections caused by one or more agents including, Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, human immunodeficiency virus, human papillomavirus infection, Hepatitis B, and herpes simplex virus.

Claims

1. A system for detection of a sexually transmitted infection, the system comprising: a sampling kit comprising: a sample collecting tool for collecting a biological sample; a container for receiving the sample collecting tool; a buffer for being held within the container and for extracting, from the sample on the sample collecting tool, a target material associated with the sexually transmitted infection, the target material comprising a biomarker of a pathogen that causes the sexually transmitted infection, wherein the buffer comprises one or more of: phosphate buffered saline, Tris-buffered saline, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffered saline, and an extraction substance comprising one or more of: 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate, a protein extraction reagent, octylthioglucoside, sodium hydroxide, Triton X-100, and octyl glucoside; a signal output device, wherein the signal output device comprises: a loading zone at a proximal end of the signal output device, the loading zone insertable into the container such that the loading zone receives the target material extracted in the buffer upon insertion of the loading zone into the container, a reaction zone in fluid communication with the loading zone such that the received target material is able to pass from the loading zone to the reaction zone, the reaction zone comprising a first reaction substance conjugated to a first label, wherein the first reaction substance is capable of preferentially coupling to a first target of the received target material, a testing zone in fluid communication with the reaction zone such that the first reaction substance and the first target material are able to pass from the reaction zone to the testing zone, the testing zone comprising a first testing substance retained at a first region of the testing zone, wherein the first testing substance is capable of preferentially coupling to the first target of the received target material such that the testing zone is able to visually display an indication of the detection of the sexually transmitted infection when the sexually transmitted infection is present; and a control zone in fluid communication with the reaction zone such that the first reaction substance and the first target are able to pass through the testing zone to the control zone, the control zone comprising a control substance retained at the control zone, wherein the control substance is not capable of preferentially coupling to the target material; wherein the sexual transmitted infection is an infection associated with at least one of: Chlamydia trachomatis, Neisseria gonorrhoeae, or Trichomonas vaginalis; and wherein the first reaction substance and the first testing substance each comprise at least one of the following aptamers: SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, or SEQ ID NO 16, or at least one of the following antibodies: M4020310, M2103128, M61872, M61871, M4020311, HM215, HM031, 9L102, B351M, CL13-256.2.1, CT 6703 SP-5, CT 6701 SP-5, CT 6709 SP-5, CL21-335.2.3, 027-10347, M2110186, M1709NG1, M1709NG2, 386/418, M86954, 20-NR08, 15B441, 17E95, M1011403, A19G, Q65G, BDI675, B985M, B986M, 15B485, 12K238, M1011401, M1011404, or 15B483.

2. The system of claim 1, wherein the sexually transmitted infection is an infection associated with Chlamydia trachomatis.

3. The system of claim 2, wherein the first reaction substance and the first testing substance each comprise at least one of the following aptamers: SEQ ID NO 12, SEQ ID NO 13, and SEQ ID NO 14, or at least one of the following antibodies: M4020310, M2103128, M61872, M61871, M4020311, HM215, HM031, 9L102, B351M, CL13-256.2.1, CT 6703 SP-5, CT 6701 SP-5, CT 6709 SP-5, CL21-335.2.3 and 027-10347.

4. The system of claim 1, wherein the sexually transmitted infection is an infection associated with Neisseria gonorrhoeae.

5. The system of claim 4, wherein the first reaction substance and the first testing substance each comprise at least one of the following aptamers: SEQ ID NO 15 and SEQ ID NO 16, or at least one of the following antibodies: M2110186, M1709NG1, M1709NG2, 386/418, M86954, 20-NR08, 15B441, and 17E95.

6. The system of claim 1, wherein the sexually transmitted infection is an infection associated with Trichomonas vaginalis.

7. The system of claim 6, wherein the first reaction substance and the first testing substance each comprise at least one of the following aptamers: SEQ ID NO 9, SEQ ID NO 10, and SEQ ID NO 11, or at least one of the following antibodies: M1011403, A19G, Q65G, BDI675, B985M, B986M, 15B485, 12K238, M1011401, M1011404, and 15B483.

8. The system of claim 1, wherein the loading zone is inserted insertable into the container, and a sample generated upon extraction of an agent by the buffer flows against gravity through the loading zone, the reaction zone, the testing zone, and the control zone.

9. The system of claim 1, wherein the system further comprises a recessed surface of a housing of the sampling kit, the recessed surface capable of retaining the container in a retained orientation.

10. The system of claim 1, wherein the biological sample is a urine or blood sample.

11. The system of claim 1, wherein the biological sample is vaginal discharge or penile discharge.

12. The system of claim 1, wherein the biological sample is obtained from contacting an ulcer in a genital area.

13. The system of claim 1, wherein the sample collecting tool is a vaginal swab, a cervical swab, or an endocervical swab.

14. The system of claim 1, wherein the first label comprises one or more of: gold nanoparticles, colored latex beads, magnetic particles, cellulose nanobeads, carbon nanoparticles, selenium nanoparticles, silver nanoparticles, quantum dots, up converting phosphors, europium, organic fluorophores, textile dyes, enzymes, and liposomes.

15. The system of claim 1, wherein the container contains the buffer for extracting the target material from the biological sample on the sample collecting tool in one or more steps, the buffer comprising of one or more of: phosphate buffered saline, Tris-buffered saline, HEPES buffered saline, and an extraction substance comprising one or more of: hydrochloric acid, 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate, a protein extraction reagent, 3-([3-Cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate octylthioglucoside, sodium hydroxide, Triton X-100, and octyl glucoside.

16. The system of claim 1, wherein the first target comprises material from a first biomarker of a first sexually transmitted infection.

17. The system of claim 1, wherein the buffer is capable of extracting target material associated with a set of sexually transmitted infections associated with a set of infectious agents.

18. The system of claim 17, wherein the first target comprises material from a first infectious agent associated with a first sexual sexually transmitted infection of the set of sexually transmitted infections.

19. The system of claim 1, wherein the first region of the testing zone is defined in a first pathway and wherein a second region of the testing zone is fluidly isolated from the first pathway.

20. The system of claim 1, wherein the reaction zone of the signal output device further comprises a second reaction substance conjugated to a second label, wherein the second reaction substance is capable of preferentially coupling to a second target of the target material, and wherein the testing zone of the signal output device further comprises a second testing substance retained at a second region of the testing zone, wherein the second testing substance is capable of preferentially coupling to the second target of the target material.

21. The system of claim 1, wherein the signal output device is a test strip, and wherein the sampling kit is a multiplex assay with more than one test line on the test strip to test for more than one sexually transmitted infection.

22. The system of claim 21, wherein the multiplex assay tests for two or more of the following on the test strip: Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, pregnancy status, and fertility status.

23. The system of claim 21, wherein the multiplex assay tests for three or more of the following on the test strip: Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, pregnancy status, and fertility status.

24. The system of claim 1, wherein the first reaction substance is a protein or nucleic acid conjugated to the first label and capable of binding a specific region of the target material when it passes through the reaction zone to form a target material/reaction substance complex.

25. The system of claim 24, wherein the testing substance is an immobilized protein or nucleic acid capable of binding the first target of the target material in the target material/reaction substance complex when it passes through the testing zone.

26. The system of claim 25, wherein the reaction substance and the testing substance each comprise: at least one of the following aptamers: SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, and SEQ ID NO 16, or at least one of the following antibodies: M4020310, M2103128, M61872, M61871, M4020311, HM215, HM031, 9L102, B351M, CL13-256.2.1, CT 6703 SP-5, CT 6701 SP-5, CT 6709 SP-5, CL21-335.2.3, 027-10347, M2110186, M1709NG1, M1709NG2, 386/418, M86954, 20-NR08, 15B441, 17E95, M1011403, A19G, Q65G, BDI675, B985M, B986M, 15B485, 12K238, M1011401, M1011404, and 15B483.

27. The system of claim 1, wherein the first reaction substance or the first testing substance comprise at least one of the following aptamers: SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12, SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15, and SEQ ID NO 16.

28. The system of claim 1, wherein the first reaction substance or the first testing substance comprise at least one of at least one of the following antibodies: M4020310, M2103128, M61872, M61871, M4020311, HM215, HM031, 9L102, B351M, CL13-256.2.1, CT 6703 SP-5, CT 6701 SP-5, CT 6709 SP-5, CL21-335.2.3, 027-10347, M2110186, M1709NG1, M1709NG2, 386/418, M86954, 20-NR08, 15B441, 17E95, M1011403, A19G, Q65G, BDI675, B985M, B986M, 15B485, 12K238, M1011401, M1011404, and 15B483.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A depicts a system environment for assessing health of a subject, in accordance with one or more embodiments.

(2) FIG. 1B depicts an expanded schematic of system components shown in FIG. 1A.

(3) FIG. 2 depicts signal output device portions in accordance with one or more embodiments.

(4) FIG. 3A depicts a schematic of a first embodiment of a signal output device for multiplexed analyses.

(5) FIG. 3B depicts a schematic of a second embodiment of a signal output device for multiplexed analyses.

(6) FIG. 3C depicts a schematic of a second embodiment of a signal output device for multiplexed analyses.

(7) FIG. 4 depicts an embodiment of kit components configured to adjust sample extraction and processing parameters.

(8) FIG. 5 depicts a flowchart of a method for assessing health of a subject, in accordance with one or more embodiments.

(9) FIG. 6 depicts a schematic of a method for providing and processing a sample, in accordance with one or more embodiments.

(10) FIG. 7A depicts a phase of usage of system components, in accordance with the methods shown in FIGS. 5 and 6.

(11) FIG. 7B depicts another phase of usage of system components, in accordance with the method shown in FIGS. 5 and 6.

(12) FIG. 7C depicts a phase of usage of an alternative embodiment of system components, in accordance with the methods shown in FIGS. 5 and 6.

(13) FIG. 7D depicts another phase of usage of an alternative embodiment of system components, in accordance with the method shown in FIGS. 5 and 6.

(14) The figures depict various embodiments of the present invention for purposes of illustration only. One skilled in the art will readily recognize from the following discussion that alternative embodiments of the structures and methods illustrated herein may be employed without departing from the principles of the invention described herein.

DETAILED DESCRIPTION

(15) 1. System

(16) FIG. 1A depicts a system environment for assessing health of a subject, in accordance with one or more embodiments. The system 100 shown in FIG. 1A includes: a sampling kit 110 including an extraction container 120 containing an extraction buffer 125 for extracting a target material associated with the health condition; a recessed surface 130 (e.g., of a portion of the sampling kit 110) defining a retained orientation 121 for the extraction container 120; and a signal output device 140, where the signal output device 140 includes: a loading zone 145 insertable into the extraction container 120; a reaction zone 150 fluidly coupled to the loading zone 145 and including at least one reaction substance that preferentially couples to the target material; a testing zone 160 fluidly coupled to the reaction zone and including at least one testing substance retained at the testing zone, where the testing substance(s) preferentially couple(s) to the target material; and a control zone 170 including a control substance retained at the control zone, where the control substance does not preferentially couple to the target material.

(17) The system 100 provides one or more consumer test device and kit components that can be used to detect, in a uni-plexed and/or multiplexed manner, the presence of one or more infections caused by one or more agents (e.g., sexually transmitted pathogens), optionally in conjunction with characterization of other sexual health conditions (e.g., pregnancy, fertility, etc.). In embodiments, the agent(s) can include one or more of (or strains of): Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, Candida Albicans, Mycoplasma genitalium, human immunodeficiency virus, human papillomavirus infection, Hepatitis B, and herpes simplex virus. Other embodiments can additionally or alternatively target other agents (e.g., non-viral agents, viral agents) in relation to detection of other health conditions states.

(18) FIG. 1B depicts an expanded schematic of system components shown in FIG. 1A. As shown in the process flow of FIG. 1B, individual regions of the sampling kit 110 are configured to enable different phases of sample processing in order to provide one or more output signals that can be used to reliably and rapidly characterize health statuses of the subject. In relation to the extraction container 120 and the extraction buffer 125, the extraction buffer 125, upon contacting a sample from the subject, is configured to extract target material (e.g., target materials 101a and 101b) associated with the health condition(s) of interest. Target materials 101a and 101b can be associated with different regions of the same or different agents (e.g., infectious agents). When received into the loading zone 145 of the signal output device 140, the target material flows to the reaction zone 150, where the reaction zone 150 includes a first reaction substance 102a conjugated to a first label 103a, wherein the first reaction substance 102a preferentially couples to a first target of target material 101a. The reaction zone 150 can optionally include a second reaction substance 102b conjugated to a second label 103b, where the second reaction substance 102b preferentially couples to a second target of target material 101b. In an embodiment, the first reaction substance 102a and the second reaction substance 102b are not immobilized within the reaction zone 150. In embodiments, the reaction zone 150 can include more than two reaction substances conjugated to respective labels, in relation to assays performed on different types of target material (e.g., related to different health conditions).

(19) As shown in the process flow of FIG. 1B, target material-reaction substance complexes flow from the reaction zone 150 to the testing zone 160, where the testing zone 160 includes a first testing substance 104a retained at a first region of the testing zone 160, where the first testing substance 104a preferentially couples to the first target of target material 101a. The testing zone 160 can optionally include a second testing substance 104b retained at a second region of the testing zone 160, where the second testing substance 104b preferentially couples to the second target of target material 101b. In an embodiment, the first testing substance 104a and the second testing substance 104b are thus immobilized within the reaction zone 150, and the first and the second regions, as shown in FIG. 1B, are test lines within the testing zone 160. However, the first and the second regions can alternatively be defined in another manner (e.g., as dots, as areas, as patterns, etc.) within the testing zone 160. Furthermore, in embodiments, the testing zone 160 can include more than two testing substances, in relation to assays performed on different types of target material (e.g., related to different health conditions).

(20) As shown in the process flow of FIG. 1B, sample material including the target material and/or other material flows from the testing zone 160 to the control zone 170, which includes a control substance 105 retained at the control zone 170, where the control substance 105 does not preferentially couple to the target material and/or binds to any substance (e.g., binds non-specifically to different materials). As such, the control substance 105 is immobilized at the control zone 170 and can be immobilized along a line of the control zone 170 or in another manner (e.g., as a dot, as an area, as a pattern).

(21) As shown in FIGS. 1A and 1B, the loading zone 145, the reaction zone 150, the testing zone 160, and the control zone 170 are fluidly coupled. In embodiments, adjacent zones can overlap; however, in other embodiments, one or more adjacent zones of the signal output device 140 may not overlap. Furthermore, as shown in FIGS. 1A and 1B, the sampling kit 110 includes a process mode 122 where, in the process mode 122, the extraction container 120 is retained at the surface 130 in the retained orientation 121, the loading zone 145 is inserted into the extraction container 120, and a sample generated upon extraction of an agent by the extraction buffer 125 flows against gravity through the loading zone 145, the reaction zone 150, the testing zone 160, and the control zone 170. The retained orientation 121 thus positions the extraction container vertically, such that the sample flows against gravity; however, in alternative embodiments, the retained orientation 121 can be a non-vertical orientation.

(22) In more detail, the recessed surface 130 can be a recessed surface of a portion of a component (e.g., housing, packaging, additional element, etc.) of the sampling kit 110, where the recessed surface 130 is complementary to an exterior surface of the extraction container 120. As such, the recessed surface 130 is configured to receive the extraction container 120 with the extraction buffer 125, and to hold it in place so that a user can easily place the signal output device 140 in the extraction container 120 during testing in a consumer environment. The recessed surface 130 thus provides the retained orientation 121 of the sampling kit, by retaining the extraction container 120 in position while it is in contact with the signal output device 140 during testing. The recessed surface 130 can thus be semi-spherical or of another morphology (if the corresponding region of the extraction container 120 is semi-spherical or of another morphology). Additional embodiments of systems including a recessed surface are described in more detail below in relation to FIGS. 6 and 7A.

(23) 1.1 SystemApplications to Specific STIs

(24) 1.1.1 Chlamydia trachomatis

(25) In one embodiment, the system 100 is configured to detect presence of Chlamydia trachomatis from a sample acquired from the subject, such that the target material (e.g., embodiments of target material 101a and 101b) includes one or more specific regions of biological material (e.g., tissue content, cellular content, protein content, amino acid content, nucleic acid content, etc.) of Chlamydia trachomatis, the reaction substances (e.g., embodiments of reaction substances 102a and 102b) are configured to bind to specific regions of Chlamydia trachomatis, and/or the testing substances (e.g., embodiments of testing substances 104a and 104b) are configured to bind to specific regions of Chlamydia trachomatis.

(26) In specific examples of this embodiment, the target material of Chlamydia trachomatis includes individual proteins (and homologs) or a cocktails of proteins (and homologs) including one or more of: Uniprot ID numbers: P26623 (SEQ ID NO 1), A0A0E9CJA7 (SEQ ID NO 2), PODJI1 (SEQ ID NO 3), O84760 (SEQ ID NO 4), P06597 (SEQ ID NO 5), P0C0Z8 (SEQ ID NO 6), A0A0E9CNK8 (SEQ ID NO 7), A0A0E9FM59 (SEQ ID NO 8), B0B7W6 (SEQ ID NO 19), B0B7N4 (SEQ ID NO 20), G4NM26 (SEQ ID NO 21), and P23603 (SEQ ID NO 22). Additionally or alternatively, in specific examples, the target material of Chlamydia trachomatis includes lipoglycans or lipopolysaccharides of the Chlamydia trachomatis species.

(27) In specific examples of this embodiment, the reaction substances and/or testing substances configured for detection of Chlamydia trachomatis include individual or a cocktail of deoxyribonucleic acid (DNA)-based aptamers or any permutation of the sequences listed in TABLE 1 and/or individual or a cocktail of antibody clones listed in TABLE 1.

(28) TABLE-US-00001 TABLE1 AptamersandAntibodiesforChlamydiatrachomatis Type Sequence/Identifier Aptamer AGGGGGCAGGGGGGTTGACTTTACCTTATGCTTAAA GGGGGTGGGCTCGGGAAGAT(SEQIDNO12) Aptamer AGGGGGAGAACGGGGGGGCTTGGGTTGGGGATGGAT GTGGGAGGCCGGTCGAGAT(SEQIDNO13) Aptamer TGGCGCGGACGTACTGGCGAATTGGTGAGCCTCGGG CTGGGTGGGGGGTTAGGGAGAT(SEQIDNO14) AntibodyClone M4020310 AntibodyClone M2103128 AntibodyClone M61872 AntibodyClone M61871 AntibodyClone M4020311 AntibodyClone HM215 AntibodyClone HM031 AntibodyClone 9L102 AntibodyClone B351M.CL13-256.2.1 AntibodyClone CT6703SP-5 AntibodyClone CT6701SP-5 AntibodyClone CT6709SP-5 AntibodyClone CL21-335.2.3 AntibodyClone 027-10347

(29) In related embodiments, aptamers (e.g., aptamers listed in TABLE 1) for detection of Chlamydia trachomatis are modified by a biotin or SH group or any other modification at the 5 and/or 3 terminal of the aptamer.

(30) 1.1.2 Neisseria gonorrhoeae

(31) In one embodiment, the system 100 is configured to detect presence of Neisseria gonorrhoeae from a sample acquired from the subject, such that the target material (e.g., embodiments of target material 101a and 101b) includes one or more specific regions of biological material (e.g., tissue content, cellular content, protein content, amino acid content, nucleic acid content, etc.) of Neisseria gonorrhoeae, the reaction substances (e.g., embodiments of reaction substances 102a and 102b) are configured to bind to specific regions of Neisseria gonorrhoeae, and/or the testing substances (e.g., embodiments of testing substances 104a and 104b) are configured to bind to specific regions of Neisseria gonorrhoeae.

(32) In specific examples of this embodiment, the target material of Neisseria gonorrhoeae includes individual proteins (and homologs) or a cocktails of proteins (and homologs) including one or more of: Uniprot ID numbers: P95359 (SEQ ID NO 23), A0A1D3HF49 (SEQ ID NO 24), P05430 (SEQ ID NO 25), Q02219 (SEQ ID NO 26), Q51006 (SEQ ID NO 27), Q5F942 (SEQ ID NO 28), B4RQH9 (SEQ ID NO 29), Q5F6W5 (SEQ ID NO 30), P29842 (SEQ ID NO 31), Q5F542 (SEQ ID NO 32), B4RLT9 (SEQ ID NO 33), D6H5Z3 (SEQ ID NO 34), and Q5F651 (SEQ ID NO 35); and GenBank/NCBI Accession Numbers: YP_208979.1 (SEQ ID NO 75), KXI24787.1 (SEQ ID NO 76), SCW17313.1 (SEQ ID NO 77), YP_209073.1 (SEQ ID NO 78), and YP_209148.1 (SEQ ID NO 79). In some embodiments, the target material of Neisseria gonorrhoeae includes lipoglycans or lipopolysaccharides of the Neisseria gonorrhoeae species.

(33) In specific examples of this embodiment, the reaction substances and/or testing substances configured for detection of Neisseria gonorrhoeae include individual or a cocktail of deoxyribonucleic acid (DNA)-based aptamers or any permutation of the sequences listed in TABLE 2 and/or individual or a cocktail of antibody clones listed in TABLE 2.

(34) TABLE-US-00002 TABLE2 AptamersandAntibodiesforNeisseriagonorrhoeae Type SequenceorIdentifier Aptamer CTCACACTATTTTTTGGCATAGGTGTCGAGGGTGGA CGGGGCGGGGCGGTGAGAT(SEQIDNO15) Aptamer GAGTTAAGTTTGAGTGTTGTCGAGGGTGGACGGGGT GGGGCAAGCTAGTGTGAGAT(SEQIDNO16) AntibodyClone M2110186 AntibodyClone M1709NG1 AntibodyClone M1709NG2 AntibodyClone 386/418 AntibodyClone M86954 AntibodyClone 20-NR08 AntibodyClone 15B441 AntibodyClone 17E95

(35) In related embodiments, aptamers (e.g., aptamers listed in TABLE 2) for detection of Neisseria Gonorrhoeae are modified by a biotin or SH group or any other modification at the 5 and/or 3 terminal of the aptamer.

(36) 1.1.3 Trichomonas vaginalis

(37) In one embodiment, the system 100 is configured to detect presence of Trichomonas vaginalis from a sample acquired from the subject, such that the target material (e.g., embodiments of target material 101a and 101b) includes one or more specific regions of biological material (e.g., tissue content, cellular content, protein content, amino acid content, nucleic acid content, etc.) of Trichomonas vaginalis, the reaction substances (e.g., embodiments of reaction substances 102a and 102b) are configured to bind to specific regions of Trichomonas vaginalis, and/or the testing substances (e.g., embodiments of testing substances 104a and 104b) are configured to bind to specific regions of Trichomonas vaginalis.

(38) In specific examples of this embodiment, the target material of Trichomonas vaginalis includes individual proteins (and homologs) or a cocktails of proteins (and homologs) including one or more of: NCBI/GenBank Accession numbers: EAX87747.1 (SEQ ID NO 41), EAY21310.1 (SEQ ID NO 42), EAX96596.1 (SEQ ID NO 43), EAY19137.1 (SEQ ID NO 44), EAY01676.1 (SEQ ID NO 45), EAX86868.1 (SEQ ID NO 46), EAX98121.1 (SEQ ID NO 47), EAY18961.1 (SEQ ID NO 48), AAA91133.1 (SEQ ID NO 49), AAC48339.1 (SEQ ID NO 50), and AAC72899.1 (SEQ ID NO 51). In some embodiments, the target material of Trichomonas vaginalis includes lipoglycans or lipopolysaccharides of the Trichomonas vaginalis species.

(39) In specific examples of this embodiment, the reaction substances and/or testing substances configured for detection of Trichomonas vaginalis include individual or a cocktail of deoxyribonucleic acid (DNA)-based aptamers or any permutation of the sequences listed in TABLE 3 and/or individual or a cocktail of antibody clones listed in TABLE 3.

(40) TABLE-US-00003 TABLE3 AptamersandAntibodiesforTrichomonasvaginalis Type SequenceorIdentifier Aptamer TTTATGAGTATATTTCACAATATTTAGTCAGCCAT GACCGGTGCAGTGTGTTCAGAGA (SEQIDNO9) Aptamer ATTCACTCGTCGGGAAACTATGGGCGTACGGTGCT CGGTTTCCTTCTCTCTGAGTAGA (SEQIDNO10) Aptamer ATTGGGGGCGGGAGGGGGATGGCGGAGGTTTGTT GTCTGTTCGGGGAGCTGTGTAAGA (SEQIDNO11) AntibodyClone M1011403 AntibodyClone A19G AntibodyClone Q65G AntibodyClone BDI675 AntibodyClone B985M AntibodyClone B986M AntibodyClone 15B485 AntibodyClone 12K238 AntibodyClone M1011401 AntibodyClone M1011404 AntibodyClone 15B483
In related embodiments, aptamers (e.g., aptamers listed in TABLE 3) for detection of Trichomonas vaginalis are modified by a biotin or SH group or any other modification at the 5 and/or 3 terminal of the aptamer.
1.2 SystemUniplexed and Multiplexed Variations

(41) FIG. 2 depicts signal output device portions in accordance with one or more embodiments of the system shown in FIGS. 1A and 1B. As shown in FIG. 2, the system can be configured to indicate statuses of different health conditions in a uni-plexed or a multiplex manner. For each of a set of health conditions (e.g., sexual health conditions), the system can be configured to test a sample for presence of different agents associated with the different health conditions. For instance, for a first health condition, the system can include a signal output device 240 including a first reaction zone 250a with at least one reaction substance that preferentially couples to target material associated with the first health condition; a first testing zone 260a fluidly coupled to the first reaction zone 250a and including at least one testing substance retained at the first testing zone 260a, where the testing substance(s) preferentially couple(s) to the target material; and a control zone 270 including a control substance retained at the control zone 270, where the control substance does not preferentially couple to the target material. The first testing zone 260a includes multiple regions including a first region 265a, a second region 265b, and a third region 265c. The first region 265a, second region 265b, and third region 265c can include the same or different testing substances (e.g., such as the testing substances described in each of TABLES 1-3), to produce output signals that provide for improved characterization of status of the first health condition (e.g., in relation to sensitivity and specificity of an assay). For instance, in relation to the first health condition, if the sample includes target substances of interest associated with the first health condition, the first, second, and third regions 265a, 265b, and 265c of the first testing zone 260a can be configured to indicate a positive test result (e.g., with optical detection of a signal generated at respective regions of the control and testing zones), with greater sensitivity and specificity than if the first testing zone 260a had a single region. However, in alternative embodiments, the first testing zone 260a can additionally or alternatively include fewer or more than three regions.

(42) Also shown in FIG. 2, for a second health condition, the system can include a second reaction zone 250b with at least one reaction substance that preferentially couples to target material associated with the second health condition; and a second testing zone 260b fluidly coupled to the second reaction zone 250b and including at least one testing substance retained at the second testing zone 260a, where the testing substance(s) preferentially couple(s) to the target material associated with the second health condition. Similarly, for an nth health condition, the system can include an nth reaction zone 250n with at least one reaction substance that preferentially couples to target material associated with the nth health condition; and an nth testing zone 260n fluidly coupled to the nth reaction zone 250n and including at least one testing substance retained at the nth testing zone 260n, where the testing substance(s) preferentially couple(s) to the target material associated with the nth health condition.

(43) In various applications, and as described above, the set of health conditions can be associated with STIs associated with one or more of: Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, Candida Albicans, Mycoplasma genitalium, human immunodeficiency virus, human papillomavirus infection, Hepatitis B, and herpes simplex virus. The set of health conditions can also include non-infection-related health conditions associated with sexual health, such as fertility states and pregnancy states, as detected with appropriate biomarkers. Additionally or alternatively, the set of health conditions can include health conditions not related to sexual health.

(44) 1.2.1 Multiplexed Embodiments

(45) FIG. 3A depicts a schematic of an embodiment of a signal output device for multiplexed analyses. As shown in FIG. 3A, the system can include a single signal output device 340a that includes multiple substrates, each of the substrates configured for characterization of an individual health condition. As shown in FIG. 3A, substrate 341a is configured for assessment of a first health condition, substrate 341b is configured for assessment of a second health condition, and substrate 341c is configured for assessment of a third health condition, where the substrates 341a-341c process sample material in parallel and individually output signals for characterizing statuses of their respective health conditions. As such, reaction zones and testing zones corresponding to each health condition can be fluidly isolated from each other in different pathways. For instance, substrates 341a and 341b and be configured to detect different STIs, and substrate 341c can be configured to characterize a state of pregnancy. In more detail, using substrate 341c, substrate 341c includes a reaction zone 350a with at least one reaction substance that preferentially couples to target material associated with the third health condition; a testing zone 360a fluidly coupled to the reaction zone 350a and including at least one testing substance retained at the testing zone 360a, where the testing substance(s) preferentially couple(s) to the target material associated with the third health condition; and a control zone 370a including a control substance retained at the control zone 370a, where the control substance does not preferentially couple to the target material associated with the third health condition. Substrate 341a and substrate 341b also include similar reaction zones and testing zones configured for their respective health conditions, where health condition statuses, during use of the signal output device 340a, are indicated individually from the testing zone and the control zone for each substrate. In embodiments related to the embodiment shown in FIG. 3A, given that the extraction buffer composition (described in more detail in Section 1.3 below) operates to extract target material associated with many health conditions in a single-step mode of operation (e.g., upon contacting a biological sample from a subject), the embodiment of the signal output device 340a shown in FIG. 3A can include a shared loading zone 345 fluidly coupled to the reaction zones of each substrate (i.e., substrates 341a, 341b, and 341c). During sample processing, target material associated with each health condition is extracted using the same extraction buffer, and the extracted target material flows through the shared loading zone 345 to individual reaction zones of each substrate. However, as shown in FIG. 3A, each substrate (i.e., substrates 341a, 341b, and 341c) can include a loading zone that is distinct from the loading zones of the other substrates.

(46) FIG. 3B depicts a schematic of another embodiment of a signal output device 340b for multiplexed analyses. As shown in FIG. 3B, the signal output device 340b includes a loading zone 345b and a reaction zone 350b fluidly coupled to the loading zone 345b, where the reaction zone 350b includes reaction substances that preferentially couple to target material associated with each of a first health condition, a second health condition, and a third health condition. For instance, the signal output device 340b includes reaction substances that can each bind to one or more specific regions of target material of different pathogens or biomarkers (e.g., of sexual health). In examples, the reaction zone 350b can include non-immobilized aptamers and/or antibodies listed in TABLES 1-3, such that a sample that has undergone extraction can flow through the reaction zone 350b and individual units of target material associated with each health condition can bind with their respective reaction substances before flowing to the testing zone 360b. The testing zone 360b shown in FIG. 3B includes a first region associated with the first health condition, a second region associated with the second health condition, and a third region associated with the third health condition. In order to provide detectable results, testing substances associated with the first health condition are immobilized at the first region, testing substances associated with the second health condition are immobilized at the second region, and testing substances associated with the third health condition are immobilized at the third region, such that test results (e.g., positive or negative test results) can be observed using the testing zone 360b in a manner that differentiates results for each health condition. As such, reaction zones and testing zones corresponding to each health condition can be fluidly coupled to each other. The signal output device 340b shown in FIG. 3B also includes a control zone 370b including a control substance retained at the control zone 370b, where the control substance does not preferentially couple to and is non-specific to target material associated with any of the health conditions. In related embodiments, given that the extraction buffer composition (described in more detail in Section 1.3 below) operates to extract target material associated with many health conditions in a single-step mode of operation (e.g., upon contacting a biological sample from a subject), and given that the reaction and testing substances used in relation to the system of FIG. 3B are configured to not cross-react, assessments of multiple health conditions can be performed using a single substrate of a signal output device 340b.

(47) FIG. 3C depicts a schematic of another embodiment of a signal output device 340c for multiplexed analyses. As shown in FIG. 3C, the signal output device 340c includes a first side (e.g., front side) and a second side (e.g., back side), where each side is associated with a different health condition (e.g., a first health condition and a second health condition). The signal output device 340c includes a a loading zone 345c and reaction zones (not shown) fluidly coupled to the loading zone 345c, where the reaction zones individually include reaction substances that preferentially couple to target material associated with each of a first health condition and a second health condition. The reaction zone associated with the first health condition can be located at the first side of the signal output device 340c (e.g., within an internal cavity of a housing of the signal output device 340c), and the reaction zone associated with the second health condition can be located at the second side of the signal output device 340c (e.g., within an internal cavity of a housing of the signal output device 340c). In examples, the reaction zone 350b can include non-immobilized aptamers and/or antibodies listed in TABLES 1-3, such that a sample that has undergone extraction can flow through the reaction zone 350b and individual units of target material associated with each health condition can bind with their respective reaction substances before flowing to the testing zone 360c. The testing zone 360c shown in FIG. 3C includes a first side associated with the first health condition and a second side associated with the second health condition. In order to provide detectable results, testing substances associated with the first health condition are immobilized at the first side and testing substances associated with the second health condition are immobilized at the second side, such that test results (e.g., positive or negative test results) can be observed using the testing zone 360c in a manner that differentiates results for each health condition. Each side includes a window (e.g., windows 380a and 380b) that enables observation of test results associated with each side of the testing zone 360c, as relevant to analyses of statuses of each of the first health condition and the second health condition. In related embodiments, given that the extraction buffer composition (described in more detail in Section 1.3 below) operates to extract target material associated with many health conditions in a single-step mode of operation (e.g., upon contacting a biological sample from a subject), and given that the reaction and testing substances used in relation to the system of FIG. 3C are configured to not cross-react, assessments of multiple health conditions can be performed within a single signal output device 340c, for instance, using different sides of a single substrate housed within the signal output device 340c.

(48) 1.2.2 Examples of Multiplexed Configurations with Specific Health Conditions

(49) In relation to of multiplexed configurations, examples of configurations for simultaneously assessing multiple health conditions (e.g., sexual health conditions) are described below:

(50) In one example, an embodiment of a signal output device can indicate presence of Chlamydia trachomatis in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Chlamydia trachomatis infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 1 for detection of Chlamydia trachomatis material. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(51) In another example, an embodiment of a signal output device can indicate presence of Neisseria gonorrhoeae in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Neisseria gonorrhoeae infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 2 for detection of Neisseria gonorrhoeae material. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(52) In another example, an embodiment of a signal output device can indicate presence of Trichomonas vaginalis in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Trichomonas vaginalis infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 3 for detection of Trichomonas vaginalis material. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(53) In another example, an embodiment of a signal output device can indicate presence of a target pathogen infection in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate the target pathogen infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected based on specific binding to material of the target pathogen. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers. In some embodiments, the target pathogen is selected from Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, Candida Albicans, Mycoplasma genitalium, human immunodeficiency virus (HIV), human papillomavirus infection (HPV), Hepatitis B virus (HBV) and herpes simplex virus (HSV).

(54) In another example, an embodiment of a signal output device can indicate presence of Chlamydia trachomatis and Neisseria gonorrhoeae in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Chlamydia trachomatis infection status, and Neisseria gonorrhoeae infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 1 for detection of Chlamydia trachomatis material and TABLE 2 for detection of Neisseria gonorrhoeae material, where the material(s) from TABLE 1 and TABLE 2 are distinct from each other at respective reaction zones and testing zones. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(55) In another example, an embodiment of a signal output device can indicate presence of Chlamydia trachomatis and Trichomonas vaginalis in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Chlamydia trachomatis infection status, and Trichomonas vaginalis infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 1 for detection of Chlamydia trachomatis material and TABLE 3 for detection of Trichomonas vaginalis material, where the material(s) from TABLE 1 and TABLE 3 are distinct from each other at respective reaction zones and testing zones. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(56) In another example, an embodiment of a signal output device can indicate presence of Neisseria gonorrhoeae and Trichomonas vaginalis in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Neisseria gonorrhoeae infection status, and Trichomonas vaginalis infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 2 for detection of Neisseria gonorrhoeae material and TABLE 3 for detection of Trichomonas vaginalis material, where the material(s) from TABLE 2 and TABLE 3 are distinct from each other at respective reaction zones and testing zones. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(57) In another example, an embodiment of a signal output device can indicate presence of Chlamydia trachomatis, Neisseria gonorrhoeae, and Trichomonas vaginalis in conjunction with the presence of pregnancy, using a single or multiple substrates of a signal output device to indicate Chlamydia trachomatis infection status, Neisseria gonorrhoeae infection status, and Trichomonas vaginalis infection status independently of pregnancy status. In this example, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can be selected from TABLE 1 for detection of Chlamydia trachomatis material, TABLE 2 for detection of Neisseria gonorrhoeae material, and TABLE 3 for detection of Trichomonas vaginalis material, where the material(s) from TABLE 1, TABLE 2, and TABLE 3 are distinct from each other at respective reaction zones and testing zones. Similarly, reaction substances of a reaction zone and testing substances immobilized at a testing zone of the signal output device can include substances for detection of pregnancy biomarkers.

(58) 1.3 SystemMaterials and Additional Components

(59) 1.3.1 SystemMicrofluidic and Sample Driving Variations

(60) In relation to embodiments of the system described above, embodiments of the sampling kit (such as sampling kit 110) and/or signal output device (such as signal output device 140) can include a capillary driven microfluidic device (e.g., a lateral flow assay (LFA) based device). Alternatively, embodiments of the sampling kit (such as sampling kit 110) and/or signal output device (such as signal output device 140) can include a microfluidic device that is not capillary driven. In some embodiments, sample flow can be driven by pressure (e.g., in embodiments where the system includes a pump), centrifugal forces, electrokinetic forces, or acoustic forces.

(61) In some embodiments, the system is configured for providing one-step or lateral flow detection of an agent or biomarker in solubilized extract from a sample acquired from a subject. In particular, after target material of the agent or biomarker has been extracted from the sample, it will be necessary only to apply a volume of the extract to the loading zone of the signal output device, wait for a predetermined time, and thereafter read the assay results without performing any additional steps.

(62) 1.3.2 SystemSamples and Collecting Tool

(63) The samples described herein include any sample that can be obtained from an individual. In some embodiments, the sample can be obtained by an individual without the help of a health care professional, using embodiments of the kit described. In some embodiments, the sample can be obtained under the guidance of a health care professional.

(64) Non-limiting examples of a sample of this invention can include vaginal fluid, vaginal tissue, vaginal wash, vaginal swab, vaginal discharge, cervical swab, cervical tissue urethral swab, urethral discharge, rectal swab, rectal material, rectal wash, urine, blood, serum, plasma, saliva, tears, skin swab, semen, seminal fluid, sputum, bronchial fluid, bronchial wash, peritoneal fluid, peritoneal wash, pleural fluid, pleural wash, cerebrospinal fluid, eye fluid and/or tissue, fluid and/or tissue from lung, liver, heart, brain, kidney, spleen or muscle and any combination thereof. In some embodiments, the sample is a blood sample. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a vaginal discharge or a penile discharge. In some embodiments, the sample is obtained from contacting an ulcer in genital area.

(65) In some embodiments, a sample is collected in a collection unit. In some embodiments, a sample collection unit is configured to receive a volume of the bodily fluid sample. In an instance, the sample collection unit is configured to receive a volume of the bodily fluid sample equivalent to a single drop of blood.

(66) In some embodiments, a sample collection unit includes a sample collecting tool, where the sample collecting tool includes a swab. In some embodiments, the swab is a vaginal swab or urethral swab. In some embodiments, the swab is an endocervical swab. In some embodiments, the sample collecting tool comprises a fluid collecting container. In some embodiments, the fluid collecting container comprises a tube. In some embodiments, the tube is serum tube or a plasma tube. As described below in relation to FIGS. 6 and 7C through 7D, in some embodiments, the sample collecting tool (e.g., swab or other collecting tool) can be integrated with the signal output device. For instance, a swab can be attached to the signal output device in a manner that couples the swab to the sample loading zone (and/or reaction zone) of the signal output device, such that a user can provide a sample to the swab and the swab, integrated with the signal output device, can be transmitted into the extraction container for further sample processing.

(67) In some embodiments, the biological sample of this invention to be used in the methods of this invention can be diluted 1:2, 1:5, 1:10, 1:100, 1:200, 1:300, 1:400, 1:500, 1:600, 1:700, 1:800, 1:900, 1:1000, 1:1500, 1:2000, 1:3000, 1:4000, 1:5000, 1:6000, 1:7000, 1:8000, 1:9000, 1:10,000, 1:20,000, 1:30,000, 1:40,000, 1:50,000, 1:100,000, etc. Such a dilution can be carried out according to protocols well known in the art. In some embodiments, a specific dilution can be used to increase the specificity and/or sensitivity of the method or device as described herein.

(68) 1.3.3 SystemPathogens and Target Substances

(69) The methods, devices and kits of the present application are intended for diagnosing an infection of a sexually transmitted pathogen including all of the bacteria, viruses and parasites that can be transmitted through sexual contact. Exemplary pathogens discussed herein are Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, Mycoplasma Genitalium, Candida Albicans (yeast infection), Human immunodeficiency virus (HIV), Human papillomavirus (HPV), Hepatitis C virus (HCV), Hepatitis B virus (HBV), Herpes simplex virus (HSV).

(70) Chlamydia trachomatis (Chlamydia trachomatis) serovars A, B, Ba and C are associated with endemic trachoma, which is the most common preventable form of blindness in certain parts of the Mediterranean and Middle East. Serovars L1, L2 and L3 are associated with lymphogranuloma venereum (LGV) in tropical settings. Serovars D through K cause nongonococcal urethritis and epididymitis in men, Reiter's syndrome or proctitis, conjunctivitis in both men and women, and cervicitis, urethritis, endometritis, salpingitis and perihepatitis in women. Between one-half and two-thirds of chlamydial infections in men and women may be asymptomatic and remain undiagnosed and untreated. In women, this may lead to late sequelae such as endometritis, salpingitis, pelvic inflammatory disease, ectopic pregnancy or tubal factor infertility. Chlamydia trachomatis in the cervix may be transmitted to a neonate during vaginal delivery, resulting in conjunctivitis and neonatal pneumonia.

(71) In some embodiments, the target material of Chlamydia trachomatis is expressed on all strains. In some embodiments, the target substance is expressed on one or more specific strains. In some embodiments, the target substance is a major outer membrane protein of Chlamydia trachomatis. In some embodiments, the target substance is evenly distributed on Chlamydia trachomatis. In some embodiments, the target substance is unevenly distributed on Chlamydia trachomatis.

(72) Neisseria gonorrhoeae is an obligate human pathogen and is the etiological agent of gonorrhea. Neisseria gonorrhoeae is a Gram-negative coffee bean-shaped diplococci bacteria. Syndromes include cervicitis in women, and urethritis, pharyngitis and proctitis in both sexes. If untreated, women may experience severe sequelae of pelvic inflammatory disease, chronic pelvic pain, ectopic pregnancy and tubal infertility, while men may develop epididymitis, prostatitis and urethral stricture. Occasionally, some individuals may develop disseminated infections with systemic complications, while others may have asymptomatic infections and transmit gonococci unknowingly. Oropharyngeal and anorectal gonococcal infections may be acquired by persons practicing receptive oral or anal intercourse or by contamination from cervical secretions. Occasionally, adults may present with conjunctivitis. In some embodiments, the target material of Neisseria gonorrhoeae includes a peptide or protein comprising any portion or the whole of a sequence selected from the sequences described herein.

(73) Trichomonas vaginalis (TV) is likely the most common non-viral sexually transmitted infection (STI) in the world. It is as an important source of reproductive morbidity, a facilitator of HIV transmission and acquisition, and thus it is an important public health problem. Despite its importance in human reproductive health and HIV transmission, it is not a reportable disease and surveillance is not generally done. This is problematic since most persons infected with TV are asymptomatic. In some embodiments, the target material of Trichomonas vaginalis include a peptide or protein comprising any portion or the whole of a sequence selected from the sequences described herein.

(74) The target material of an agent or biomarker can be anything that is specifically expressed by the agent/biomarker or any component of the agent/biomarker. In some embodiments, the target substance is a polynucleotide. In some embodiments, the target substance is an RNA. In some embodiments, the target substance is an MicroRNA. In some embodiments, the target substance is a DNA. In some embodiments, the target substance is a peptide or protein. In some embodiments, the target substance comprises a peptide or protein comprising any portion or the whole of a sequence selected from the sequences described herein in Section X. In some embodiments, the target substance is a lipid. In some embodiments, the target substance is a polysaccharide. In some embodiments, the target substance is a lipopolysaccharide.

(75) 1.3.4 SystemExtraction Buffer

(76) In some embodiments, as described above, the extraction buffer is configured for single-step extraction of target material from one or more agents associated with health conditions. In some embodiments, the extraction buffer comprises: 1-100% PBS (phosphate buffered saline), 1-100% TBS (Tris buffered saline), 1-100% HBS (HEPES buffered saline) and extraction substance. The extraction substance is selected from one or more substances in this group: 0.01%-100% 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate, 0.1%-100% BugBuster, 0.01%-100% octylthioglucoside, 5-5000 mM sodium hydroxide, 0.01%-100% Triton X-100, 0.01%-100% octyl glucoside. In embodiments, the extraction buffer is used at concentration between 0.001% and 100%; however, in alternative embodiments, the extraction buffer can be used at another concentration.

(77) 1.3.5 SystemSubstrate Materials

(78) In relation to embodiments of the system described above, embodiments of the loading zone (such as loading zone 145) can include or be composed of cellulose and/or glass fiber. In some embodiments, the loading zone is capable of transporting the sample to other parts of the device (e.g., by way of fluid coupling). In some embodiments, the transportation of the sample through different zones from the loading zone is in a continuous and/or homogenous manner. In some embodiments, the loading zone includes materials or reagents that pretreat the sample before its transportation. In some embodiments, the loading zone includes pretreating materials/reagents configured for one or more of: separation of sample components, removal of interfering materials, and/or adjustment of pH.

(79) In relation to embodiments of the system described above, the system can include substrate materials and/or structures that provide for lateral flow of a sample from a loading zone to a testing zone (such as testing zone 160). In some instances, the devices include a bibulous material or member that readily absorbs liquid and provides for liquid flow through the member. Examples of bibulous materials include: organic or inorganic polymers and natural and synthetic polymers. More specific examples of suitable solid supports include, without limitation, glass fiber, cellulose, nylon, cross-linked dextran, various chromatographic papers and nitrocellulose. In some embodiments, the bibulous member includes a membrane, and in a specific example, the membrane is a nitrocellulose membrane. In some embodiments, the membrane is located in testing zone and/or control line zone, described in more detail below.

(80) While the bibulous member and overall configuration of a lateral flow assay device implemented in embodiments of the system may vary, in certain embodiments the bibulous member can have a strip configuration, some embodiments of which are described in relation to FIGS. 1A-1B, 2, and 3A-3C above. Where the bibulous material is configured as a strip, the bibulous member can have a length that is longer than its width. In some examples, the length is longer than the width by 1.5 fold or more, such as 2-fold or more, e.g., 10 fold or more, including 20-fold or more. In some examples, the length of the bibulous member ranges from 0.5 to 20 cm, such as 1.0 to 15 cm, e.g., 2.0 to 10 cm, while the width ranges 0.1 to 10.0 cm, such as 0.5 to 2.5 cm, e.g., 1 to 2 cm. The thickness of the bibulous member may also vary, ranging in some instances from 0.01 to 0.05 cm, such as 0.1 to 0.4 cm, e.g., 0.1 to 0.25 cm.

(81) Optionally, the signal output device of the system can include an absorbent pad downstream from the reaction zone and any control region, e.g., at the end distal from the sample loading zone, where the absorbent pad is configured to absorb fluid and reagents present therein that have flowed through the bibulous member. While the configuration of the absorbent pad may vary, in some instances it is configured to absorb a volume of liquid that is substantially the same as the volume of sample that is applied to the sample loading zone during use.

(82) 1.3.6 SystemConfiguration of Loading Zone

(83) As such, embodiments of the loading zone can include a terminal zone (e.g., a most upstream zone) of the bibulous member, e.g., positioned closer to one end of the bibulous member. Alternatively, embodiments of the loading zone may be distinct from the bibulous member, but configured to provide for fluid communication of sample into the bibulous member upon application of sample to the sample loading zone. The loading zone may be configured to receive samples of varying volumes, where in some instances the sample zone is configured to receive a sample having a volume ranging from 0.1 ul to 20 ml such as 5 ul to 20 ml.

(84) In some instances, the loading zone may include a metering device configured to meter a specific amount of sample into the bibulous member.

(85) 1.3.7 SystemConfiguration of Reaction Zone

(86) Embodiments of the reaction zone can be positioned at some distance downstream from the loading zone. The distance between the loading zone and the reaction zone may vary. In some embodiments, the distance ranges from 0.1 to 10 cm, such as 0.1 to 3 cm and including 0.5 to 2 cm. In some embodiments, the reaction zone overlaps with the loading zone in a portion or full. In some embodiments, the reaction zone overlaps with the loading zone in about 25%, 50%, 75%, and 100%.

(87) As described above, in some embodiments, the reaction substances implemented for detection are not immobilized at the reaction zone(s). In relation to immobilization, a substance and the bibulous member maintain their position relative to each other in space under the conditions of use, e.g., under the assay conditions. As such, a not immobilized reaction substance is not stably associated with the bibulous member and can migrate under the capillary pressure or other drivers of sample flow. In some embodiments, examples of which are described above, a reaction substance binds to a specific region of a target material of a pathogen or other agent.

(88) In some embodiments (some of which are described above), the reaction zone includes two or more reaction substances that are conjugated to the same or different labels. In some embodiments, the two or more reaction substances are not immobilized. In some embodiments, the two or more substances each bind to the same specific region of the same target material of an agent or biomarker. In some embodiments, the two or more substances each bind to two or more different specific regions of the same target material of an agent or biomarker. In some embodiments, the two or more substances each bind to a specific region of two or more different target materials of an agent or biomarker. In some embodiments, the two or more substances each bind to a specific region of target materials of two or more different agents or biomarkers.

(89) 1.3.7.1 SystemReaction Zone Substances

(90) The reaction substances in the reaction zone that bind to specific agent/biomarker regions of target material of interest can include one or more of: a protein, a peptide or its analogs (e.g., an antibody, antigen, peptoid, D-peptide, beta-peptide), or a nucleic acid (e.g., an aptamer) or its analogs.

(91) Antibodies

(92) In some embodiments, the reaction substances include antibodies. In some embodiments, an antibody used is a monoclonal antibody. In some embodiments, the antibody is a polyclonal antibody. In some embodiments, the antibody is a bispecific antibody that binds to two separate regions of an agent, or two separate regions of two different agents. In some embodiments, the substance is a fragment or a variant of an antibody (e.g., Fab fragment or single chain variable fragment).

(93) In some embodiments, the reaction substances include monoclonal antibodies that bind to a specific region of target substance on an agent (e.g., Chlamydia trachomatis, Neisseria gonorrhoeae, Trichomonas vaginalis, Treponema pallidum, Gardnerella vaginitis, Mycoplasma genitalium, Candida Albicans (yeast infection), Human immunodeficiency virus (HIV), Human papillomavirus (HPV), Hepatitis C virus (HCV), Hepatitis B virus (HBV), Herpes simplex virus (HSV)). Such monoclonal antibodies can be generated using a hybridoma technique. For example, monoclonal antibodies can be produced from a single B-lymphocyte clone involving immunizing a certain species (e.g., a mouse, rat, rabbit, or goat) against the specific region on a target substance and obtaining the B-lymphocytes from the spleen of the species. The B-lymphocytes are then fused (by chemical- or virus-induced methods) with an immortal myeloma cell line lacking the hypoxanthine-guanine-phosphoribosyltransferase (HGPRT) gene and not containing any other immunoglobulin-producing cell. These hybridoma cells are then cultured in vitro in selective medium (i.e. medium containing hypoxanthine-aminopterinthymidine) where only the hybridomas (i.e. the fusion between the primary B-lymphocytes and myeloma cells) survive as they have inherited immortality from the myeloma cells and selective resistance from the primary B-lymphocytes (as the myeloma cells lack HGPRT, they cannot synthesize nucleotides de novo as this is inhibited by aminopterin in the selective medium). The initial culture of hybridomas contains a mixture of antibodies derived from many different primary B-lymphocyte clones, each secreting its own individual specific antibody into the culture medium (i.e. the antibodies are still polyclonal). Each individual clone can be separated by dilution into different culture wells. The cell culture medium can then be screened from many hundreds of different wells for the specific antibody activity required and the desired B-lymphocytes grown from the positive wells and then recloned and retested for activity. The positive hybridomas and monoclonal antibodies generated can then be stored away in liquid nitrogen.

(94) Monoclonal antibodies can also be generated using phage display. This involves isolating B-lymphocytes from the blood of humans and then isolating the mRNA and converting it into cDNA using PCR to amplify all the VH and VL segments. These segments can then be cloned into a vector (usually as scFv) next to the PIII protein of a bacteriophage. This vector is then introduced into E. coli cells in order to generate a library containing approximately 10.sup.10 clones of antibody fragments. E. coli can then secrete the bacteriophage containing the VH and VL segments as part of the bacteriophage coat. Specific VH and VL segments against the target substance can then be selected and used to re-infect E. coli with the bacteriophage. Cells containing the plasmid can then be isolated and sequenced. Its advantages include: once the library is made, the same library can be used to generate new antibodies and does not have to be remade, no immunizations are required as the entire process is done in vitro, antibodies can be obtained much more quickly than the traditional hybridoma technique and the library can be used to generate antibodies to toxic target substances that could not be used to immunize an animal.

(95) In some embodiments, monoclonal antibodies can also be improved in multiple aspects. For example, binding affinity to the target substance can be improved by using phage display libraries to isolate antibodies with strong affinities for the target substance.

(96) In some embodiments, monoclonal antibodies are recovered and/or purified with a process comprising one or more of the following steps: 1) harvest antibodies with centrifugation/filgration thereby removing cells and cell debris; 2) protein A and/or protein G chromatograph which yields highly purified product in a single step; 3) low pH hold to inactivate endogenous/adventitious viruses; 4) additional chromatography steps to further remove impurities and viruses; 5) filtration to further remove endogenous/adventitious viruses; and 6) ultrafiltration/diafiltration.

(97) In some embodiments (some of which are described above), the reaction zone includes reaction substances including antibodies listed in TABLES 1, 2, and 3.

(98) Aptamers

(99) In some embodiments, the reaction substance that binds to a specific region of an agent is an aptamer or aptamers. In some embodiments, the aptamer is generated by an in vitro process known as SELEX (systematic evolution of ligands by exponential enrichment). In some embodiments, the aptamer is an organic molecule.

(100) In some embodiments, the aptamer has a molecular weight of about 50 to 100 Da, 50 to 200 Da, 50 to 500 Da, 50 to 1000 Da, 50 to 2,000 Da, 50 to 3,000 Da, 50 to 4,000 Da, 50 to 5,000 Da, 50 to 6,000 Da, 50 to 7,000 Da, 50 to 8,000 Da, 50 to 9,000 Da, 50 to 10,000 Da, 50 to 11,000 Da, 50 to 12,500 Da, 50 to 15,000 Da, 100 to 200 Da, 100 to 500 Da, 100 to 1000 Da, 100 to 2,000 Da, 100 to 3,000 Da, 100 to 4,000 Da, 100 to 5,000 Da, 100 to 6,000 Da, 100 to 7,000 Da, 100 to 8,000 Da, 100 to 9,000 Da, 100 to 10,000 Da, 100 to 11,000 Da, 100 to 12,500 Da, 100 to 15,000 Da, 200 Da to 500 Da, 200 to 1000 Da, 200 to 2,000 Da, 200 to 3,000 Da, 200 to 4,000 Da, 200 to 5,000 Da, 200 to 6,000 Da, 200 to 7,000 Da, 200 to 8,000 Da, 200 to 9,000 Da, 200 to 10,000 Da, 200 to 11,000 Da, 200 to 12,500 Da, 200 to 15,000 Da, 500 to 1000 Da, 500 to 2,000 Da, 500 to 3,000 Da, 500 to 4,000 Da, 500 to 5,000 Da, 500 to 6,000 Da, 500 to 7,000 Da, 500 to 8,000 Da, 500 to 9,000 Da, 500 to 10,000 Da, 500 to 11,000 Da, 500 to 12,500 Da, 500 to 15,000 Da, 1,000 to 2,000 Da, 1,000 to 3,000 Da, 1,000 to 4,000 Da, 1,000 to 5,000 Da, 1,000 to 6,000 Da, 1,000 to 7,000 Da, 1,000 to 8,000 Da, 1,000 to 9,000 Da, 1,000 to 10,000 Da, 1,000 to 11,000 Da, 1,000 to 12,500 Da, 1,000 to 15,000 Da, 2,000 to 3,000 Da, 2,000 to 4,000 Da, 2,000 to 5,000 Da, 2,000 to 6,000 Da, 2,000 to 7,000 Da, 2,000 to 8,000 Da, 2,000 to 9,000 Da, 2,000 to 10,000 Da, 2,000 to 11,000 Da, 2,000 to 12,500 Da, 2,000 to 15,000 Da, 3,000 Da to 4,000 Da, 3,000 to 5,000 Da, 3,000 to 6,000 Da, 3,000 to 7,000 Da, 3,000 to 8,000 Da, 3,000 to 9,000 Da, 3,000 to 10,000 Da, 3,000 to 11,000 Da, 3,000 to 12,500 Da, 3,000 to 15,000 Da, 4,000 to 5,000 Da, 4,000 to 6,000 Da, 4,000 to 7,000 Da, 4,000 to 8,000 Da, 4,000 to 9,000 Da, 4,000 to 10,000 Da, 4,000 to 11,000 Da, 4,000 to 12,500 Da, 4,000 to 15,000 Da, 5,000 to 6,000 Da, 5,000 to 7,000 Da, 5,000 to 8,000 Da, 5,000 to 9,000 Da, 5,000 to 10,000 Da, 5,000 to 11,000 Da, 5,000 to 12,500 Da, 5,000 to 15,000 Da, 6,000 to 7,000 Da, 6,000 to 8,000 Da, 6,000 to 9,000 Da, 6,000 to 10,000 Da, 6,000 to 11,000 Da, 6,000 to 12,500 Da, 6,000 to 15,000 Da, 7,000 to 8,000 Da, 7,000 to 9,000 Da, 7,000 to 10,000 Da, 7,000 to 11,000 Da, 7,000 to 12,500 Da, 7,000 to 15,000 Da, 8,000 to 9,000 Da, 8,000 to 10,000 Da, 8,000 to 11,000 Da, 8,000 to 12,500 Da, 8,000 to 15,000 Da, 9,000 to 10,000 Da, 9,000 to 11,000 Da, 9,000 to 12,500 Da, 9,000 to 15,000 Da, 10,000 to 11,000 Da, 10,000 to 12,500 Da, 10,000 to 15,000 Da, or 12,000 to 15,000 Da, each inclusive. In some embodiments, the aptamer has a molecular weight of about 100 to 10,000 Da.

(101) In some embodiments (some of which are described above), the reaction zone includes reaction substances including aptamers listed in TABLES 1, 2, and 3.

(102) Molecular Beacons

(103) In some embodiments, the reaction substance that binds to a specific region of an agent includes a molecular beacon or molecular beacons. Molecular beacons are a specific DNA hairpin structure with fluorophore at one end and quencher at the other end. Fluorophore cannot produce fluorescence in the absence of an analyte (e.g., a target substance of a pathogen) because of closely located quencher. When complementary DNA sequence (e.g., a target substance of a pathogen) is present as a target analyte, stem and loop portions of the beacons are opened as a result of a force and fluorescence signal is observed. In some embodiments, the molecular beacon binds to a target substance of a pathogen, wherein the target substance comprises a nucleic acid, a toxin, and/or a protein or peptide. In some embodiments, the molecular beacon comprises a loop region and/or a double stranded stem region. In some embodiments, the loop region is complementary to a target substance (e.g., a DNA, an mRNA, a toxin or a protein of a pathogen).

(104) In some embodiments, the molecular beacon has about 10 to 15, 10 to 20, 10 to 25, 10 to 30, 10 to 35, 10 to 40, 10 to 45, 10 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 35, 15 to 40, 15 to 45, 15 to 50, 20 to 25, 20 to 30, 20 to 35, 20 to 40, 20 to 45, 20 to 50, 25 to 30, 25 to 35, 25 to 40, 25 to 45, 25 to 50, 30 to 35, 30 to 40, 30 to 45, 30 to 50, 35 to 40, 35 to 45, 35 to 50, 40 to 45, 40 to 50 or 45 to 50 base pairs in the loop region, each inclusive, wherein the loop is complimentary to a target substance. In some embodiments, the molecular beacon has about 15 to 30 base pairs in the loop, wherein the loop is complimentary to a target substance.

(105) In some embodiments, the molecular beacon has about 3 to 4, 3 to 5, 3 to 6, 3 to 7, 3 to 8, 3 to 9, 4 to 5, 4 to 6, 4 to 7, 4 to 8, 4 to 9, 5 to 6, 5 to 7, 5 to 8, 5 to 9, 6 to 7, 6 to 8, 6 to 9, 7 to 8, 7 to 9 or 8 to 9 base pairs at the double stranded stem region.

(106) DNA Probes

(107) In some embodiments, the reaction substance that binds to a specific region of a pathogen includes a DNA probe.

(108) Pregnancy and Fertility Biomarkers

(109) In some embodiments (some of which are described above), the reaction zone further includes a substance that binds to a biomarker of pregnancy. In some embodiments, the biomarker(s) include one or more of: human chorionic gonadotropin (hCG), activin A, pregnancy-associated plasma protein-A (PAPP-A), human placental lactogen (hPL), A disintegrin and Metalloprotease-12 (ADAM-12), pregnancy-specific beta glycoprotein 1 (SP-1), placental mRNAs, progestrerone, Inhibin A, Vascular Endothelial Growth Factor (VEGF), Placental-like growth factor (P1GF), Leukemic Inhibitory Factor, Glycodelin, Mucin-1, Adrenomedullin, and other biomarkers.

(110) In some embodiments (some of which are described above), the reaction zone further includes a substance that binds to a biomarker of fertility. In some embodiments, the biomarker(s) include one or more of: oestrone-3-glucuronide (E3G0, luteinizing hormone, follicle stimulating hormone (FSH), estrogen, progesterone, testosterone, dehydroepiandrosterone (DHEA), cortisol, sex hormone binding globulin (SHBG), triiodothyronine (T3), Thyroxine (T4), thyroid stimulating hormone (TSH), thyroid peroxidase antibodies (TPO antibodies), and other biomarkers.

(111) 1.3.7.2 SystemReaction Zone Labels

(112) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include one or more of: gold nanoparticles, colored latex beads, magnetic particles, carbon nanoparticles, cellulose nano beads, selenium nanoparticles, silver nanoparticles, quantum dots, up converting phosphors, organic fluorophores, textile dyes, enzymes, liposomes and labels.

(113) In some embodiments, the conjugation of the substance that binds to a specific region of a pathogen and the label is stable for at least about 1, 3, 5, 7, 10, 12, or 14 or more days. In some embodiments, the conjugation is stable for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks. In some embodiments, the conjugation is stable for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more months. In some embodiments, the conjugation is stable for at least about 1, 2, 3, 4, 5, or more months. The conjugation is stable when at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, 99.5% of the conjugates are functional (e.g., labeling the true positive and/or not labeling the false negative) and/or at most 30%, 25%, 20%, 15%, 10%, 5%, 2.5%, 1% or 0.5% of the conjugates are not functional (e.g., labeling the false positive and/or not labeling the true positive).

(114) In some embodiments, the concentration of the label is at least about 10.sup.12, 10.sup.11, 10.sup.10, 10.sup.9, 10.sup.8, 10.sup.7, or 10.sup.6 M. In some embodiments, the concentration of the label is at most about 10.sup.11, 10.sup.10, 109, 10.sup.8, 10.sup.7, 10.sup.6, 10.sup.5 or 10.sup.4 M. In some embodiments, the concentration of the label is about 10.sup.12, 10.sup.11, 10.sup.10, 10.sup.9, 10.sup.8, 10.sup.7, or 10.sup.6 M.

(115) In some embodiments, the label is capable of generate a direct signal after encountering the analyte (e.g., the specific region that the conjugated substance binds to). In some embodiments, the label generates a signal after an additional step.

(116) In some embodiments, the device comprises more than one label. In some embodiments, the more than one label can be composed of same or different material(s). In some embodiments, the more than one label can generate same or different signals.

(117) Cellulose NanoBeads

(118) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include Cellulose NanoBeads. Cellulose NanoBeads (e.g., NanoAc) are inert and spherical, which have high affinity to biomolecules and can be functionalized. Cellulose nanobeads are highly stable, deeply colored particles that have demonstrated appropriate performance.

(119) Latex Beads

(120) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include latex beads. Latex beads are inert and spherical, which have high affinity to biomolecules and can be functionalized.

(121) Gold Nanoparticles

(122) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include gold nanoparticles. In some embodiments, the gold nanoparticles include colloidal gold. Colloidal gold is inert and spherical, which have high affinity to biomolecules and can be functionalized. In some embodiments, the average diameter of the gold nanoparticles is about 5 to 150 nm. In some embodiments, the average diameter of the gold nanoparticles is no greater than 150 nm or 200 nm. In some embodiments, the average diameter of the gold nanoparticles is about 40 nm. In some embodiments, the average diameter of the gold nanoparticles is about 30 nm. In some embodiments, the average diameter of the gold nanoparticles is about 60 nm. In some embodiments, the average diameter of the gold nanoparticles is about 5 to 25, 5 to 50, 5 to 75, 5 to 100, 5 to 125, 5 to 150, 5 to 175, 5 to 200, 25 to 50, 25 to 75, 25 to 100, 25 to 125, 25 to 150, 25 to 175, 25 to 200, 50 to 75, 50 to 100, 50 to 125, 50 to 150, 50 to 175, 50 to 200, 75 to 100, 75 to 125, 75 to 150, 75 to 175, 75 to 200, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 125 to 150, 125 to 175, 125 to 200, 150 to 175, 150 to 200, or 175 to 200 nm, each inclusive.

(123) Europium Ions

(124) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include Europium ions. In some embodiments, Europium ion is chelated by isothiocyanate. Isothiocyanate can be functionalized and has high affinity to biomolecules. Europium ions are highly fluorescent and have demonstrated appropriate performance over standard labels in lateral flow applications.

(125) Magnetic Particles or Aggregates

(126) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include a magnetic particle or aggregate. In some embodiments, the magnetic particle or aggregate can produce a signal, wherein the signal can be read by an optical strip reader or magnetic assay reader. In some embodiments, the magnetic particle or aggregate comprises one or more iron oxide particle. In some embodiments, the one or more iron particles comprise Fe.sub.3O.sub.4 particles. In some embodiments, the one or more iron oxide particles are modified with polyethylene glycol. In some embodiments, the one or more iron oxide particles are crosslinked with poly-L-lysine.

(127) Fluorescent and/or Luminescent Materials

(128) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include a fluorescent or luminescent material. In some embodiments, the label includes an organic fluorophore (e.g., rhodamine). In some embodiments, the label includes a fluorescent microsphere. In some embodiments, the label includes a nanomaterial. In some embodiments, the nanomaterial includes quantum dots. In some embodiments, the quantum dots are encapsuled into a nanobead, thereby improving the detection sensitivity.

(129) In some embodiments, the labels used include at least two or more different quantum dots, wherein the different quantum dots generate different colors.

(130) In some embodiments, the labels used include upconverting phosphors (UCP). In some embodiments, the UCP are characterized with their excitation in infra-red region and emission in high energy visible region. In some embodiments, the UCP are characterized with the absence of auto fluorescence or the absence a significant level of auto fluorescence. In some embodiments, the average diameter of UCP is about 10 nm to 1 um. In some embodiments, the average diameter of UCP is about 10 to 50, 10 to 100, 10 to 200, 10 to 300, 10 to 400, 10 to 500, 10 to 750, 50 to 100, 50 to 200, 50 to 300, 50 to 400, 50 to 500, 50 to 750, 50 to 1,000, 100 to 200, 100 to 300, 100 to 400, 100 to 500, 100 to 750, 100 to 1,000, 200 to 300, 200 to 400, 200 to 500, 200 to 750, 200 to 1,000, 300 to 400, 300 to 500, 300 to 750, 300 to 1,000, 400 to 500, 400 to 750, 400 to 1,000, 500 to 750, 500 to 1,000, or 750 to 1,000 nm, each inclusive. In some embodiments, the average diameter of UCP is about 40 to 400 nm. In some embodiments, the average diameter of UCP is about 40 nm.

(131) In some embodiments, the labels used include fluorescent europium nanoparticles. In some embodiments, the fluorescent europium nanoparticles comprise europium III nanoparticles. In some embodiments, the average diameter of europium nanoparticles is about 100 to 1,000 nm. In some embodiments, the average diameter of europium nanoparticles is about 400 to 600 nm. In some embodiments, the average diameter of europium nanoparticles is about 500 nm (e.g., 520 nm).

(132) In some embodiments, the labels used include silica nanoparticles. In some embodiments, the label comprises lanthanide chelate-loaded silica nanoparticles.

(133) In some embodiments, the labels used include a fluorescent microsphere.

(134) Enzymes

(135) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include an enzyme. In some embodiments, the enzyme is horse-radish peroxidase (HRP). In some embodiments, the enzyme is alkaline phosphatase (AP). In some embodiments, the enzyme is Glucose oxidase. In some embodiments, the enzyme is Urease. In some embodiments, the amplification of the detectable signal is obtained by reacting the enzyme with one or more substrates or additional enzymes and substrates to produce a detectable reaction product.

(136) Colloidal Carbon

(137) In some embodiments, the labels used (e.g., labels to which reaction substances are conjugated) include colloidal carbon. Unstabilized carbon can be used to produce carbon sols suitable for protein adsorption. Their carbon sols are formed by suspending carbon particles of well-defined particle sizes in distilled water or low ionic strength buffers, sonicated or vigorously agitated, followed by centrifugation. These unstabilized carbon sols were flocculated easily by salt. However, when coated with macromolecules such as antibodies, they were protected from flocculation. In practice, increasing amounts of a macromolecule are incubated with a fixed amount of non-stabilized carbon aqueous sol under defined conditions to determine the minimal protective amount. The optimal pH for adsorption can be determined by one of ordinary skill in the art. Unlike colloidal gold, in which the conjugation of protein to colloidal gold is near instantaneous, adsorption onto colloidal carbon takes a longer time from one to several hours.

(138) Colloidal carbon has appropriate properties in terms of stability and high color contrast on a membrane.

(139) 1.3.8 SystemConfiguration of Testing Zone

(140) In some embodiments (some of which are described above), the system includes a testing zone. The testing zone can be positioned at some distance downstream from the reaction zone. The distance between the reaction zone and the testing zone may vary. In some embodiments, the distance ranges from 0.1 to 10 cm, such as 1 to 5 cm.

(141) As described above, in some embodiments, the testing zone includes one or more immobilized substances. In some embodiments, the immobilized substances bind to specific regions of target material of agents or biomarkers associated with the health condition(s) of interest). In some embodiments, the specific region(s) are the same as the region(s) that the non-immobilized (i.e. capable of migrating downstream) substance in the reaction zone binds to. In some embodiments, the specific region(s) are different from the region(s) that the non-immobilized (i.e. capable of migrating downstream) substance(s) in the reaction zone bind to.

(142) In some embodiments, the testing zone can include two or more testing substances, examples of which are described above. In some embodiments, the two or more testing substances are immobilized. In some embodiments, the testing zone includes two or more immobilized testing substances when the reaction zone includes two or more non-immobilized corresponding reaction substances. In some embodiments, the two or more non-immobilized reaction substances in the reaction region bind to the same target substance of an agent or biomarker, and the two or more immobilized corresponding testing substances in the testing zone each binds to the same target substance of the agent or biomarker (can bind to the same specific region or a different region that the non-immobilized reaction substance binds to). In some embodiments, the two or more non-immobilized reaction substances in the reaction zone bind to two or more different target materials of an agent or biomarker, and the two or more immobilized testing substances in the testing zone each bind to the same two or more target materials of the same agent or biomarker (e.g., can bind to the same specific region or a different region that the non-immobilized reaction substance binds to). In some embodiments, the two or more non-immobilized reaction substances in the reaction zone bind to a specific region of target material of two or more different agents or biomarkers, and the two or more immobilized testing substances in the testing zone each bind to the same target material of the two or more different agents or biomarkers.

(143) In some embodiments, the two or more immobilized testing substances in the testing zone are configured in a non-overlapping manner. In some embodiments, the two or more immobilized testing substances are separated from each other in different regions of the testing zone with of distance of about 0.1 cm to 10 cm. In some embodiments, the two or more immobilized testing substances are separated from each other in different regions of the testing zone with a distance of about at least 0.01-5 cm.

(144) In some embodiments, the two or more immobilized testing substances in the testing zone are configured to be at least partially overlapping. In some embodiments, the two or more immobilized substances completely overlap with each other.

(145) In some embodiments, the affinity between the immobilized or non-immobilized substance(s) and the target material to which the substance(s) specifically bind when they are specifically bound to each other in a binding complex is characterized by a KD (dissociation constant) of 10-5 M or less, 10-6 M or less, such as 10-7 M or less, including 10-8 M or less, e.g., 10-9 M or less, 10-10 M or less, 10-11 M or less, 10-12 M or less, 10-13 M or less, 10-14 M or less, 10-15 M or less, including 10-16 M or less. Affinity refers to the strength of binding, increased binding affinity being correlated with a lower KD.

(146) In some embodiments, the affinity between the immobilized testing substance in the testing zone and the target material of interest from the sample is about equal to or strong than the affinity between the non-immobilized reaction substance in the reaction zone and the same target material. In some embodiments, the affinity between the immobilized testing substance in the testing zone and the target material is at least about 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold than the affinity between the non-immobilized reaction substance in the reaction zone and the same target material.

(147) In some embodiments, the affinity between the immobilized testing substance in the testing zone and the target material of interest from the sample is about equal to or weaker than the affinity between the non-immobilized reaction substance in the reaction zone and the same target material. In some embodiments, the affinity between the immobilized testing substance in the testing zone and the target material is at most about 90%, 80%, 70%, 60%, or 50% of the affinity between the non-immobilized reaction substance in the reaction zone and the same target material.

(148) In some embodiments (some of which are described above), the testing zone further includes a substance that binds to a biomarker of pregnancy. In some embodiments, the biomarker(s) include one or more of: human chorionic gonadotropin (hCG), activin A, pregnancy-associated plasma protein-A (PAPP-A), human placental lactogen (hPL), A disintegrin and Metalloprotease-12 (ADAM-12), pregnancy-specific beta glycoprotein 1 (SP-1), placental mRNAs, progestrerone, Inhibin A, Vascular Endothelial Growth Factor (VEGF), Placental-like growth factor (P1GF), Leukemic Inhibitory Factor, Glycodelin, Mucin-1, Adrenomedullin, and other biomarkers.

(149) In some embodiments (some of which are described above), the testing zone further includes a substance that binds to a biomarker of fertility. In some embodiments, the biomarker(s) include one or more of: oestrone-3-glucuronide (E3G0, luteinizing hormone, follicle stimulating hormone (FSH), estrogen, progesterone, testosterone, dehydroepiandrosterone (DHEA), cortisol, sex hormone binding globulin (SHBG), triiodothyronine (T3), Thyroxine (T4), thyroid stimulating hormone (TSH), thyroid peroxidase antibodies (TPO antibodies), and other biomarkers.

(150) 1.3.9 SystemConfiguration of Testing Zone

(151) In some embodiments (some of which are described above), the system also includes a control zone. When present, the control zone is located downstream from the loading zone. In some embodiments, the control zone is located upstream or downstream from, or overlaps with the reaction zone. In some embodiments, the control zone is located upstream or downstream, or overlaps from the testing zone. In some embodiments, the control zone is located downstream from both the reaction zone and the testing zone.

(152) In some embodiments, the control zone includes a control substance. In some embodiments, the control substance is immobilized. In some embodiments, the control substance binds to any particle. In some embodiments, the substance binds to a mobile control binding agent (a control binding agent that is not immobilized). In some embodiments, the mobile control binding agent is or includes the non-immobilized reaction substance in the reaction zone. In some embodiments, the mobile control binding agent is or includes an agent in the sample or a solution the sample is prepared in. In some embodiments, the control zone includes two or more substances that bind to two or more mobile control binding agents. In some embodiments, the two or more mobile control binding agents are from different sources (e.g., one is from the sample or a solution the sample is prepared in, and another from the non-immobilized substance originally in the reaction zone.)

(153) 1.3.10 SystemSensitivity and Specificity

(154) In some embodiments, the system achieves a sensitivity of detecting the presence of a specific agent or biomarker of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the system detects two or more different agents or biomarkers with a sensitivity for at least two agents/biomarkers being both about or more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the system detects three or more different agents or biomarkers with a sensitivity for at least three agents/biomarkers being both about or more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%.

(155) In some embodiments, the system achieves a specificity of detecting the presence of a specific agent or biomarker of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the system detects two or more different agents or biomarkers with a specificity for at least two agents/biomarkers being both about or more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the system detects three or more different agents or biomarkers with specificity for at least three agents/biomarkers being both about or more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 82.5%, 85%, 90%, 92.5%, 95%, 96%, 97%, 98%, or 99%.

(156) 1.3.11 SystemDetection System

(157) In some embodiments, the system includes, is coupled to, or otherwise communicates with a detection system. In some embodiments, the detection system includes an optical reader (e.g., an optical strip reader). In some embodiments, the optical reader measures the intensity of colors produced at test and control lines. In some embodiments, the intensity of colors is recorded by an imaging software (e.g., an application on a computer, such as a mobile app). In some embodiments, the intensity of colors are recorded by a camera and then processed by an imaging software. In some embodiments, the optical system comprises a source of light. In some embodiments, the source of light comprises a monochromatic light. In some embodiments, the optical system is an automated system. In some embodiments, the optical system is a manual system.

(158) In some embodiments, the detection system includes a fluorescence reader (e.g., a fluorescence strip reader). In some embodiments, the fluorescence reader measures the fluorescence intensity of test and control lines.

(159) In some embodiments, the detection system includes a photoelectric sensor. In some embodiments, the photoelectric sensor measures photoelectrons produced as a result of the colloidal gold being exposed to a light source.

(160) In some embodiments, the detection system includes a magnetic reader (e.g., a magnetic strip reader). In some embodiments, the detection system comprises an electrochemical detector.

(161) In some embodiments, the system does not include an external detection system. In some embodiments, the systems described herein produce a signal that can be assessed by the eye (e.g., with visual observation).

(162) 1.4 SystemComponent Variations

(163) FIG. 4 depicts an embodiment of kit components configured to adjust sample extraction and processing parameters. As shown in FIG. 4, the embodiment of the extraction container 420 includes a tapered end 425 for containing an extraction buffer. Such a configuration reduces sample volume required and increases sample concentration within the extraction buffer. The tapered end 425 of the extraction container 420 is configured to be complementary to the recessed surface 430 of the sampling kit. Similarly, the signal output device 440 includes a loading zone 445 with a tapered end 447 configured to fit within the tapered end 425 of the extraction container 420 and displace fluid within the extraction container 420, in order to facilitate transmission of the extracted target material from the sample to the testing zone 460 of the signal output device 440.

(164) 2. Method

(165) FIG. 5 depicts a flowchart of a method for assessing health of a subject, in accordance with one or more embodiments. The method 500 can be implemented by one or more embodiments of the system(s) described above. As such, as shown in FIG. 5, once a sample is taken from a subject, the extraction container of a sampling kit can generate a first sample phase 510 including a target material associated with the health condition, upon receiving a sample acquired directly from a subject into the extraction container containing an extraction buffer. The sampling kit and signal output device then generates a second sample phase 520 upon receiving a signal output device into the extraction container and flowing the first sample phase through a loading zone of the signal output device. The sampling kit and signal output device then generates a third sample phase 530 upon flowing the second sample phase through a reaction zone fluidly coupled to the loading zone and comprising a first reaction substance conjugated to a first label, where the first reaction substance preferentially couples to the target material. The sampling kit and signal output device then generates a fourth sample phase 540 upon flowing the third sample phase through a testing zone comprising a first testing substance retained at the testing zone, where the first testing substance preferentially couples to the target material. The sampling kit and signal output device then generates a fifth sample phase 550 upon flowing the fourth sample phase through a control zone comprising a control substance immobilized at the control zone, where the control substance does not preferentially couple with the target material. Finally, the sampling kit and signal output device provide an optically detected signal 560 characterizing status of the health condition from the testing zone and the control zone.

(166) The method 500 is configured to operate with embodiments of the extraction containers, extraction buffers, loading zones, reaction zones, testing zones, control zones, substances, and labels described above. The method 500 is configured for detection of one or more health conditions, including sexual health conditions described above.

(167) FIG. 6 depicts a schematic of a method for providing and processing a sample, in accordance with one or more embodiments. As shown in FIG. 6, an entity (e.g., a subject, an entity associated with the subject) opens 601 packaging of a sampling kit of the system, which contains embodiments 602 of an extraction container, sample collecting tool, signal output device, and retention surface, as described above. The collection tool is operated upon 603 and receives 604 a sample from the subject. The sample collecting tool with the sample is then transmitted 605 into the extraction container to interact with an extraction buffer. Then, the signal output device is received 606 into the extraction container, in order to transmit target material through the signal output device (e.g., as in steps 520-560 described above). In a related embodiment, as described in relation to FIGS. 7C and 7D below, the sample collecting tool can be integrated with the signal output device, such that the user can provide a sample to the sample collecting tool (e.g., by swabbing a collection site of the user's body), and then transmit 605 the sample collection tool, which is coupled to the signal output device, into the extraction container.

(168) Non-limiting examples of a sample can include vaginal fluid, vaginal tissue, vaginal washing, vaginal swab, vaginal discharge, cervical swab, cervical tissue urethral swab, urethral discharge, rectal swab, rectal material, rectal washing, urine, blood, serum, plasma, saliva, tears, skin swab, semen, seminal fluid, sputum, bronchial fluid, bronchial washing, peritoneal fluid, peritoneal washing, pleural fluid, pleural washing, cerebrospinal fluid, eye fluid and/or tissue, fluid and/or tissue from lung, liver, heart, brain, kidney, spleen or muscle and any combination thereof. In some embodiments, the sample is a blood sample. In some embodiments, the sample is a urine sample. In some embodiments, the sample is a vaginal discharge or a penile discharge. In some embodiments, the sample is obtained from contacting an ulcer in genital area.

(169) In some embodiments, the sample can be preabsorbed, e.g., to reduce or minimize cross-reactivity and/or background. As nonlimiting examples, in some embodiments, the biological sample can be preabsorbed with a lysate of bacteria expressing glutathione-S-transferase (GST) and/or a lysate of normal (e.g., non-pathogen infected mammalian cells). In some embodiments, absorption of the sample can be with a lysate of pathogen-infected mammalian cells, to remove and/or block chlamydial antigen-specific antibodies from human samples, which can help confirm the specificity of human antibody binding to the test analyte.

(170) In some embodiments, the biological sample is obtained with a sample collecting tool. In some embodiments, the sample collecting tool includes a swab. In some embodiments, the swab is a vaginal swab or urethral swab. In some embodiments, the swab is an endocervical swab. In some embodiments, the sample collecting tool comprises a fluid collecting container. In some embodiments, the fluid collecting container comprises a tube. In some embodiments, the tube is serum tube or a plasma tube.

(171) In some embodiments, the sample is or is recommended to be collected at a specific time or in a specific period of time. In some embodiments, the sample is or is recommended to be collected in the morning. In some embodiments, the sample is or is recommended to be collected within 1, 2, 3, 4, 5, 6, or more hours before urinating. In some embodiments, the sample is or is recommended to be collected at noon. In some embodiments, the sample is or is recommended to be collected in the evening. In some embodiments, the sample is or is recommended to be collected before the shower. In some embodiments, the sample is or is recommended to be collected before the individual having sex. In some embodiments, the sample is or is recommended to be collected after the individual having sex. In some embodiments, the sample is or is recommended to be collected within 1, 2, 3, 4, 5, 6 or more hours before or after the individual having sex. In some embodiments, the sample is or is recommended to be collected at least 4, 5, 6, 7, 8, 9, 10, 12 days after the individual ovulates.

(172) In some embodiments, the biological sample is stable at room temperature for at least 1, 2, 4, 8, 12, 16, 20, 24 hours after obtained. In some embodiments, the sample is or is recommended to be tested within 1, 2, 3, 4, 5, 6 hours after it is obtained. In some embodiments, the sample is or is recommended to be tested shortly after it is obtained (for example, within an hour).

(173) FIG. 7A depicts a phase of usage of system components, in accordance with the methods shown in FIGS. 5 and 6. As shown in FIG. 7A, a specific example of the signal output device is received 706a into an extraction container in a manner analogous to that of step 606 described above, in order to transmit target material through the signal output device (e.g., as in steps 520-560 described above). In the example of FIG. 7A, the packaging of the sampling kit provides a retention surface (similar to that of recessed surface 130 described above) to perform the experiment in a resource limiting space.

(174) FIG. 7B depicts another phase of usage of system components, in accordance with the method shown in FIGS. 5 and 6. As shown in FIG. 7B, the specific example of the signal output device provides 760a an output signal indicative of statuses of one or more health conditions in a manner analogous to that of Step 560 above. In a specific example of Step 760a, a result can be read from the signal output within 5-10 minutes of providing a sample.

(175) FIG. 7C depicts a phase of usage of an alternative embodiment of system components, in accordance with the methods shown in FIGS. 5 and 6. As shown in FIG. 7C, a specific example of the signal output device is received 706b into an extraction container in a manner analogous to that of step 606 described above, in order to transmit target material through the signal output device (e.g., as in steps 520-560 described above). In the example of FIG. 7C, the packaging of the sampling kit provides a retention surface (similar to that of recessed surface 130 described above) to perform the experiment in a resource limiting space. Furthermore, in the example of FIG. 7C, the embodiment of the signal output device includes a sample collecting tool (e.g., swab) 702b integrated with a distal region of the signal output device configured to be inserted into extraction container. As such, the signal output device can include an integrated sample collecting tool described in relation to FIG. 6 above, where, during use, the user can provide a sample with the sample collecting tool end of the signal output device, and transfer the sample collecting tool end of the signal output device into the extraction container for sample processing with the extraction buffer, as described above.

(176) FIG. 7D depicts another phase of usage of an alternative embodiment of system components, in accordance with the method shown in FIGS. 5 and 6. As shown in FIG. 7B, the specific example of the signal output device provides 760b an output signal indicative of statuses of one or more health conditions in a manner analogous to that of Step 560 above. In a specific example of Step 760b, a result can be read from the signal output within 5-10 minutes of providing a sample.

(177) 3. Conclusion

(178) The foregoing description of the embodiments has been presented for the purpose of illustration; it is not intended to be exhaustive or to limit the patent rights to the precise forms disclosed. Persons skilled in the relevant art can appreciate that many modifications and variations are possible in light of the above disclosure.

(179) Any of the steps, operations, or processes described herein may be performed or implemented with one or more hardware or software modules, alone or in combination with other devices.

(180) Embodiments may also relate to an apparatus for performing the operations herein. This apparatus may be specially constructed for the required purposes, and/or it may comprise a general-purpose computing device selectively activated or reconfigured by a computer program stored in the computer. Such a computer program may be stored in a non-transitory, tangible computer readable storage medium, or any type of media suitable for storing electronic instructions, which may be coupled to a computer system bus. Furthermore, any computing systems referred to in the specification may include a single processor or may be architectures employing multiple processor designs for increased computing capability.

(181) Finally, the language used in the specification has been principally selected for readability and instructional purposes, and it may not have been selected to delineate or circumscribe the patent rights. It is therefore intended that the scope of the patent rights be limited not by this detailed description, but rather by any claims that issue on an application based hereon. Accordingly, the disclosure of the embodiments is intended to be illustrative, but not limiting, of the scope of the patent rights, one implementation of which is set forth in the following claims.