Method for increasing the resistance of a plant to a plant RNA virus

10781457 ยท 2020-09-22

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure relates to a method for increasing the resistance of a plant to a plant RNA virus, comprising expressing in said plant a mutant protein-only RNase P enzyme lacking a nuclear localization signal domain or an organelle targeting sequence domain, and related compositions.

Claims

1. A method for increasing the resistance of a plant to a plant RNA virus, said plant RNA virus comprising an aminoacylatable 3 tRNA-like structure, wherein said method comprises expressing in said plant a mutant land plant protein-only RNase P (PRORP) enzyme (hereinafter called CytoRP), and wherein said CytoRP consists of an amino acid sequence selected from the group consisting of SEQ ID NO 121 to 230.

2. The method of claim 1, wherein said CytoRP is a mutant of an endogenous protein-only RNase P enzyme from said plant to which the method is applied.

3. The method of claim 1, wherein said CytoRP is able to cleave the aminoacylatable 3 tRNA-like structure of a plant RNA virus belonging to a genus selected from the group consisting of Tymovirus, Furovirus, Pomovirus, Pecluvirus, Tobamovirus, Bromovirus, Cucumovirus, and Hordeivirus.

4. The method of claim 1, wherein said plant to which the method is applied is selected from the group consisting of rice, corn, wheat, tomato, turnip, papaya, rapeseed, potato, tobacco, millet, sorghum, barley, manioc, cocoa, cucumber, vine, soybean, peach, apple, strawberry, clementine, orange, poplar, eucalyptus, ricinus, alfalfa (lucerne), lotus, carrot, pepper, aubergine, zucchini, melon, bean, spinach, lettuce, onion, celery, beet, squash, and strawberry.

5. An isolated polynucleotide encoding a CytoRP as defined in claim 1.

6. A recombinant expression cassette, wherein said recombinant expression cassette comprises the polynucleotide of claim 5, under control of a promoter functional in a plant cell.

7. A recombinant vector, wherein said recombinant vector contains an expression cassette comprising the polynucleotide of claim 5, under control of a promoter.

8. A host cell, wherein said host cell contains a recombinant expression cassette that comprises the polynucleotide of claim 5 under control of a promoter functional in a plant cell or said host cell contains a recombinant vector with an expression cassette comprising the polynucleotide of claim 5 under control of a promoter.

9. The host cell of claim 8, wherein said host cell is a plant cell.

10. A method for producing a transgenic plant having an increased resistance to a plant RNA virus, wherein said method comprises: providing a plant cell, wherein said plant cell contains a recombinant expression cassette comprising a polynucleotide encoding a CytoRP as defined in claim 1 under control of a promoter functional in a plant cell or said plant cell contains a recombinant vector with an expression cassette comprising the polynucleotide encoding the CytoRP as defined in claim 1 under control of a promoter; regenerating from said plant cell a transgenic plant expressing the CytoRP as defined in claim 1.

11. A transgenic plant obtainable by the method of claim 10, said transgenic plant containing a recombinant expression cassette that comprises a polynucleotide encoding a CytoRP under control of a promoter functional in the plant cell, wherein said CytoRP consists of an amino acid sequence selected from the group consisting of SEQ ID NO 121 to 230.

12. A transgenic plant r an isolated organ or tissue thereof, wherein it comprises, stably integrated in its genome, a recombinant expression cassette comprising a polynucleotide encoding a CytoRP as defined in claim 1.

13. A method of using the polynucleotide of claim 5 for producing a transgenic plant having an increased resistance to a plant RNA virus.

Description

(1) FIG. 1: Features defining PRORP enzymes. Schematic representation of a PRORP enzyme with residues predicted to play an important role highlighted and numbered according to Arabidopsis PRORP2 sequence.

(2) FIG. 2 (A-I) Schematic representation of residue frequency at each position in an alignment of 91 plant PRORP sequences, representing the consensus amino acid sequence of PRORP set forth in SEQ ID NO: 7. The alignment has been obtained with the software LogoBar (Prez-Bercoff et al., 2006).

(3) FIG. 3: The fusion of CytoRP with eYFP observed by confocal microscopy shows the cytosolic localization of CytoRP. This location differs from the nuclear localization of PRORP2/3 and the organellar localization of PRORP1 (Gobert et al., 2010). C shows location controls with the auto-fluorescence of chlorophyll revealing chloroplasts and DAPI staining (for PRORP2/3) revealing DNA in the nucleus. T shows cells in transmitted light.

(4) FIG. 4: Cytosolic localization of CytoRP (mutant AtPRORP2 wherein the NLS domain is deleted) determined by laser scanning confocal microscopy. Four representative experiments are shown where the construct expressing CytoRP-eYFP fusion was transformed into Arabidopsis protoplasts. In each experiment, the respective panels show for each cell, the eYFP signal, the autofluorescence of chlorophyll showing chloroplasts, the transmitted light image of cells and the merged image of the eYFP and the autofluorescence channels.

(5) FIG. 5: Transformed plants encoding CytoRP (mutant AtPRORP2 wherein the NLS domain is deleted) were identified by PCR using total genomic DNA from plant extracts and oligonucleotides P2-5UTR-F (SEQ ID NO: 135) and P2-R (SEQ ID NO: 136) present in AtPRORP2 5 UTR region and in its coding region respectively. Lanes 1, 2, 3 and 4 correspond to PCR reactions performed on plant genomic DNA. Lanes 5 and 6 correspond to PCR reactions performed on cDNA clones representing PRORP2 and PRORP2NLS (CytoRP) respectively, serving as PCR positive controls and size references. M shows the molecular weight marker. DNA fragments were separated on a 1% agarose gel, stained with ethidium bromide and visualised under UV light. 1, 2 and 3 correspond to wild type plants that encode PRORP2, whereas 4, highlighted by an asterisk, corresponds to a CytoRP plant that expresses PRORP2NLS.

(6) FIG. 6: RNase P activity assays of Arabidopsis CytoRP on in vitro synthesized transcripts representing tRNA like structures of plant viruses TYMV, TMV and BMV. () indicate lanes with TLS transcripts alone and (+) indicate lanes where transcripts were incubated with CytoRP proteins resulting in specific cleavage patterns.

(7) FIG. 7: PCR sample of 2 l (from the 50 l) mixed with water (3 l) and 6DNA loading dye (1 l) and charged into a 1% agarose gel. 4.5 l MassRuler (Thermo Scientific) was used for size determination. P=PRORP.

(8) FIG. 8: 1% agarose gel is prepared and 5 l PCR product was loaded. 4.5 l Mass-Ruler was added for size determination. (A) Gel 1 shows for N. tabacum PRORP1 that colonies 1, 2 and 6 have the right size amplification for NtPRORP1, for N. tabacum PRORP2 that none of the colonies have NtPRORP2. (B) Gel 2 shows for N. tabacum PRORP3 that colony 1 has the right size amplification for NtPRORP3, for C. sativus PRORP3 that colonies 1, 2, 3, 5, 6 and 8 have the right size amplification for CsPRORP3. (C) Gel 3 shows for A. cepa PRORP3 that colonies 2, 3, 4, 5, 6, 8, 10, 11, 12 have about the right size amplification for CsPRORP3, for L. sativa PRORP3 that colonies 3 and 7 have the right size amplification for LSPRORP3, for a new transformation of pGEM-T easy:N. tabacum PRORP3 in E. coli TOP10 that colonies 3, 5, 6, 8, 9, 11, 12 have the right size amplification for NtPRORP3, for S. lycopersicum PRORP3 that colonies 1, 4, 6, 7, 8, 10 and 12 have the right size amplification for S1PRORP3.

EXAMPLE I

Experimental Validation of the Use of Cytorp for Increasing the Resistance of a Plant to a Plant Rna Virus

(9) 1. Methods

(10) CytoRP Enzyme

(11) The CytoRP protein (SEQ ID NO: 218), whose construction is described here, derives from the Arabidopsis PRORP2 protein (At2g16650). Its coding sequence corresponds to nucleotides 73 to 1587 of the native PRORP2 cDNA, preceded by an ATG initiation codon. CytoRP is the result of the deletion of the first 24 amino acids of PRORP2 (corresponding to the NLS domain). CytoRP is a protein of 505 amino acids with a molecular weight of 56539.73 Da with an isoelectric point of 7.06.

(12) Localization Experiments

(13) CytoRP cDNA (SEQ ID NO: 233) was inserted into the pART7eYFP vector (Gleave, 1992). Arabidopsis mesophyll protoplasts were isolated and transformed with pART7CytoRPeYFP plasmids as described previously (Abel and Theologis, 1994).

(14) Briefly, plant material was put in Plasmolysis solution containing 0.4 M mannitol, 3% sucrose and 8 mM CaCl.sub.2 and incubated 30 min at room temperature (RT). Cells were spun at 42 g for 10 min at RT, resuspended in Enzyme solution containing 1% (w/v) cellulase and 0.25% (w/v) macerozyme diluted in Plasmolysis solution and incubated in the dark at RT for 1 h and for a further 1 to 2 h on an orbital shaker at 20 rpm. The obtained protoplasts were filtered through a nylon sieve (100 m), washed by adding 30 ml of 0.4 M mannitol in W5 solution (5 mM glucose, 154 mM NaCl, 125 mM CaCl.sub.2, 5 mM KCl and 1.5 mM MES pH 5.6) and spun at 42 g for 10 mM at RT. Protoplasts were then washed twice by adding 10 ml of mannitol/Mg solution (0.4 M mannitol, 0.1% MES and 15 mM MgCl.sub.2) and finally re-suspended in 10 ml of mannitol/Mg solution.

(15) To transform protoplasts, 50 g of plasmid DNA were mixed to 250 g of herring sperm carrier DNA, cleaned by three cycles of phenol/chloroform extractions and ethanol precipitations, re-suspended in 50 l of H.sub.2O and mixed with 25 l of chloroform. This solution was deposited in droplets on a petri dish next to 300 l of protoplast solution (2.10.sup.6 protoplasts) and 350 l of PEG. The protoplasts were mixed to the DNA by gentle swirls to the plate. The PEG was injected at once by fusing the drop of DNA/protoplasts to the drop of PEG. Protoplasts were then diluted with 600 l, 1 ml, 2 ml and 4 ml of 0.4 M mannitol in W5 solution added in droplets every 3 min. The diluted protoplasts were harvested by spinning at 20 g for 5 min at RT. Transformed protoplasts were re-suspended in 2 ml of culture medium (0.4 M sucrose, 1 Murashige and Skoog basal media and 250 mg/l xylose) and cultivated in the dark at 20 C. for 48 h.

(16) Transformed protoplasts were visualised by confocal microscopy. eYFP fluorescence was observed by confocal laser scanning microscopy using a Zeiss LSM510 based on an Axiovert 200M microscope (Zeiss).

(17) Arabidopsis Stable Transformation

(18) A PCR amplified DNA fragment (SEQ ID NO: 234) containing CytoRP cDNA sequence (SEQ ID NO: 233) as well as AtPRORP2 promoter (SEQ ID NO: 231) and terminator (SEQ ID NO: 232) sequences was cloned in the binary vector pGWB13 (Nakagawa et al., 2007). The construct obtained was used to transform Arabidopsis thaliana ecotype col0 plants by the floral dip method (Clough and Bent, 1998).

(19) Briefly, the pGWB13 construct, carrying the CyoRP insert as well as a hygromycin resistance marker gene, was transformed in Agrobacterium tumefaciens strain GV3101 cells. Bacteria were grown at 28 C. in liquid LB medium until OD.sub.600=0.8, centrifuged and resuspended in 5% Sucrose and 0.05% Silwet L-77 solution. Aerial parts of Arabidopsis plants were dipped 3 times in the Agobacterium solution for 3 seconds with gentle agitation. Dipped plants were then placed under cover for 24 hours to maintain high humidity and grown according to standard conditions. Dry seeds were harvested and next generation individual plants analysed to test for their resistance to hygromycin and thus to identify individual transformants.

(20) RNase P Activity Assays

(21) Production of Recombinant PRORP Enzymes

(22) PRORP cDNAs were cloned in pET28-b(+) (Novagen) to obtain C terminal fusions with histidine affinity tags. Proteins were expressed over night at 18 C. in BL21(DE3) E. coli cells induced with 1 mM IPTG. Bacteria were lysed and centrifuged 30 min at 30,000 rpm 4 C. The cleared bacterial lysates were incubated with the Ni NTA resin (Qiagen). The bound proteins were washed with buffers containing 50 mM imidazole, 20 mM MOPS pH 7.8, 150 mM NaCl and 15% (v/v) glycerol and 75 mM imidazole, 20 mM MOPS pH 7.8, 250 mM NaCl and 15% (v/v) glycerol. Proteins were eluted from the column using 200 mM imidazole and 500 mM imidazole buffers.

(23) Production of Transcripts Representing tRNA Like Structures

(24) cDNAs representing TLS containing RNAs were amplified by PCR using 5 oligonucleotides containing T7 promoter sequences. PCR products were cloned in pUC19.

(25) 200 ng of linearized plasmid DNA were transcribed in a volume of 10 l containing 7.5 mM rNTP, 5 U T7 RNA polymerase and buffer as supplied by the manufacturer (RiboMAX, Promega) for 4 h at 37 C. After this, plasmid DNA was digested with 1 U of RQ1 DNase for 15 min at 37 C. and synthesized RNA were purified by phenol chloroform extractions. Transcripts were dephosphorylated with 1 U FastAP Alkaline Phosphatase (Fermentas) for 30 min at 37 C. and 5 radiolabelled with .sup.32P-ATP and polynucleotide kinase (Fermentas).

(26) Cleavage Assays

(27) Reactions were performed essentially as described previously (Gobert et al., 2010) with proteins purified as described (Gobert et al., 2010). Reactions were performed in 10 l with 100 ng proteins and 100 ng 5 radiolabelled RNA, in buffer containing 20 mM Tris-HCl pH 8, 30 mM KCl, 4.5 mM MgCl.sub.2, 20 g/ml BSA and 2 mM DTT, for 15 min at room temperature. RNA molecules were separated on 8% polyacrylamide urea gels and visualized by ethidium bromide staining and/or by autoradiography.

(28) Validation of the Antiviral Strategy

(29) The degree of resistance of transgenic plants expressing CytoRP to model viruses containing a TLS is determined. For this, transgenic plants expressing CytoRP as well as control wild-type plants are infected with preparations of TLS (RNA) viruses. After infection, a comparative quantitative analysis of viral titer is performed over time. Viral titer is followed by immuno-detection using antibodies specific for viral proteins.

(30) 2. Results

(31) To determine the localization of CytoRP in vivo, its cDNA was cloned into the vector pART7eYFP, thus inducing the fusion of CytoRP with the fluorescent protein eYFP (Gleave, 1992). Protoplasts of Arabidopsis cells were transformed transiently with the construct expressing the CytoRP-eYFP fusion. eYFP fluorescence was visualized by confocal laser scanning microscopy using a Zeiss LSM510 microscope. This revealed that the CytoRP protein is indeed localized in vivo in the cytosol of Arabidopsis cells (FIG. 3 and FIG. 4).

(32) As a second step, it was built plants with CytoRP stably encoded in the genome. For this, a DNA fragment was generated where the CytoRP cDNA is inserted between the promoter sequence of AtPRORP2 in vivo (positions 1000 to 1 upstream of the native of AtPRORP2 initiation codon) and the terminator sequence of AtPRORP2 in vivo (positions +1 to +118 downstream of the AtPRORP2 termination codon). Promoter and terminator sequences were amplified from Arabidopsis thaliana genomic DNA. The resulting fragment was cloned in the binary vector pGWB13 (Nakagawa et al., 2007). The construct obtained was used to transform Arabidopsis thaliana ecotype col0 plants by the floral dip method (Clough and Bent, 1998). Transformed plants coding for CytoRP were identified by PCR using total genomic DNA from transformed plants extracts (FIG. 5). The selected plants thus contain all the PRORP genes encoded by the nuclear genome as well as CytoRP, expressed at the same level as AtPRORP2 and located in the cytosol.

(33) Despite the removal of the NLS domain from AtPRORP2, CytoRP retains all the elements necessary for RNase P activity, especially the PPR domain responsible for RNA substrates binding and the NYN domain responsible for the catalytic activity of PRORP.

(34) Transgenic Arabidopsis plants expressing CytoRP, a protein localized in the cytosol and holding RNase P activity, were constructed. This activity leads to the cleavage of tRNA-like structures (TLS) of plant viruses and thus generates plant resistance to TLS containing viruses.

(35) RNase P activity assays of Arabidopsis CytoRP on in vitro synthesized transcripts representing tRNA like structures of plant viruses were carried out. Transcripts representing the 3 termini of TYMV, TMV and BMV genomic RNA tRNA like structures (TLS) were generated by T7 transcription in vitro and put in presence of Arabidopsis CytoRP proteins to test for RNase activity. The results are shown in FIG. 6.

EXAMPLE II

Amplification and Cloning of Cytorp Cdna Sequences of Representative Species of Agronomical Interest

(36) The CytoRP sequences from various agronomic relevant plants were amplified using the primers containing the restriction site NcoI (CCATGG) and XhoI (CTCGAG) for digestion and ligation in the plasmid pET28b. These sequences and primers were as follow:

(37) Tobacco

(38) Nicotiana tabacum CytoRP based on NtPRORP1 cv Samsun NN, genome T (mts deleted): SEQ ID NO: 240.

(39) Primer forward: SEQ ID NO: 241

(40) Primer reverse: SEQ ID NO: 242

(41) The deleted part of NtPRORP1 (genome T) gene is presented in SEQ ID NO: 243. Only the 5 (N-terminus) of the gene (protein) is presented in SEQ ID NO: 243. The 3 (C-terminus) was not changed except the removal of the stop codon to fuse the gene with a 6His tag.

(42) Cucumber

(43) Cucumis sativus CytoRP based on CsPRORP3 (N-terminus nls deleted): SEQ ID NO: 245.

(44) Primer forward: SEQ ID NO: 246

(45) Primer reverse: SEQ ID NO: 247

(46) The deleted part of CsPRORP3 gene is presented in SEQ ID NO: 248. Only the 5 (N-terminus) of the gene (protein) is presented in SEQ ID NO: 248. The start codon was followed by ggc for glycine in order to accommodate the NcoI restriction site. The 3 (C-terminus) was not changed except the removal of the stop codon to fuse the gene with a 6His tag.

(47) Tomato

(48) Solanum lycopersicum CytoRP based on S1PRORP3 (N-terminus nls deleted): SEQ ID NO: 250

(49) Primer forward: SEQ ID NO: 251

(50) Primer reverse: SEQ ID NO: 252

(51) The deleted part of S1PRORP3 gene is presented in SEQ ID NO: 253. Only the 5 (N-terminus) of the gene (protein) is presented in SEQ ID NO: 253. The 3 (C-terminus) was not changed except the removal of the stop codon to fuse the gene with a 6His tag.

(52) Lettuce

(53) Lactica sativa CytoRP based on LsPRORP3 (N- & C-termini nls deleted): SEQ ID NO: 255

(54) Primer forward: SEQ ID NO: 256

(55) Primer reverse: SEQ ID NO: 257

(56) The deleted parts of the LsPRORP3 gene are presented in SEQ ID NO: 258 (N-terminus) and SEQ ID NO 260 (C-terminus). Only the 5 (N-terminus) and 3 (C-terminus) of the gene (protein) are presented SEQ ID NO: 258 and SEQ ID NO 260 respectively. The remaining part of the gene (protein) was not changed.

(57) Onion

(58) Allium cepa CytoRP based on AcPRORP3 (C-terminus nls deleted): SEQ ID NO: 262.

(59) Primer forward: SEQ ID NO: 263

(60) Primer reverse: SEQ ID NO: 264

(61) The deleted part of AcPRORP3 gene is presented in SEQ ID NO: 265. Only the 3 (C-terminus) of the gene (protein) is presented in SEQ ID NO: 265. The 5 (N-terminus) was not changed except the addition of a gcg codon for alanine directly after the start codon of the gene contained in the NcoI restriction site.

EXAMPLE III

Total Rna Extraction From Plants, Dnase Treatment and Reverse Transcription

(62) TRIzol RNA Isolation Reagents (LifeTechnology) was used to extract RNA from plant samples.

(63) Plants material was leaves from each plant.

(64) Mortar and pestle were frozen using liquid nitrogen.

(65) Leaf material (about 3 g) was ground to powder in liquid nitrogen.

(66) Then, TRIzol (3 to 4 ml) was added to the powder. The powder was mixed with the TRIzol by inverting the tube and left 5 minutes on the bench at room temperature. Aliquotes of 1 ml were transferred in 2 ml tubes and 0.2 ml chloroform was added and the tubes were put on vortex thoroughly for 1 min. Then, the tubes were left 5 minutes on the bench at room temperature and centrifuged full speed for 10 min at 4 C. The supernatant (600 l) was transferred in a new RNase free tube. 300 l isopropanol was added, the tube inverted few times and then left 15 minutes on the bench at room temperature. The tubes were centrifuged full speed for 15 min at 4 C. The supernatant was removed, the pellet was washed with 1 ml 75% cold ethanol. The supernatant was removed, the pellet dried and resuspended in 20 l RNase free mQ water.

(67) Total RNA concentration was determined using the nanodrop 2000 (Thermo Scientific).

(68) 15 g or 10 g of total RNA was used for DNase I treatment in order to get rid of residual genomic DNA contamination. 10 l DNase I buffer+MgCl2 10 and 10 l DNase I (1 unit/l) (Thermo Scientific) were added in a total volume of 100 l.

(69) The tubes were incubated 30 min at 37 C.

(70) A RNA phenol/chloroform extraction was then operated. 100 l phenol/chloroform was added to the reaction and vortex thoroughly for 20 sec. The tubes were centrifuge full speed at room temperature for 5 min.

(71) The aqueous supernatant was transferred into a new RNase free tube and the RNA was precipitated with ethanol (10 l 3 M Na Acetate pH5.3 and 250 l absolute ethanol).

(72) The tubes were left 1 hour at 20 C. and then centrifuged full speed for 30 minutes at 4 C.

(73) The supernatant was removed, and 1 ml 75% ethanol was added to wash the pellet.

(74) The tubes were centrifuged full speed for 5 minutes at 4 C. and the supernatant removed.

(75) The pellet was dried and re-suspended in 10 l RNase free mQ water.

(76) 3 to 5 g of total RNA were used for the first strand cDNA synthesis.

(77) Maxima Reverse Transcriptase (Thermo Scientific) at 200 U/l supplied with 5RT buffer were used.

(78) A mix of oligo(dT).sub.18 and random primer was used for the first strand cDNA synthesis.

(79) The reactions were performed with the provider specifications.

(80) Typical first strand cDNA synthesis is as follow:

(81) TABLE-US-00001 1 reaction RNA treated DNase I (5 g) 5 l Oligo(dT).sub.18 (100 M) 0.5 l Random Primers (0.2 g/l) 0.5 l dNTP 1 l H2O 7.5 l

(82) The PCR tube containing the mix is incubated at 65 C. for 5 min then put on ice for 2 min.

(83) After a short spin in a bench-top centrifuge, the following mix is added in the tube:

(84) TABLE-US-00002 Buffer Maxima RT 5x 4 l RNase OUT 40 U/l 0.5 l (Invitrogen) Maxima RT enzyme 1 l

(85) The PCR tube containing the mix is centrifuged shortly and incubated 10 min at 25 C., 45 min at 50 C. and the enzyme is inactivated at 85 C. for 5 min.

(86) The cDNA is then ready for use in PCR reaction.

(87) 1 to 2 l cDNA produced were used to amplify PRORP coding sequences with the primers listed below:

(88) Primers were designed and ordered at Integrated DNA Technologies (IDT) to amplify cDNA of PRORP from tobacco Nicotiana tabacum (Nt), cucumber Cucumis sativus (Cs), lettuce Lactuca sativa (Ls), tomato Solanum lycopersicum (Sl) and onion Allium cepa (Ac).

(89) TABLE-US-00003 NtP1F gtcattcatatccccagcaatg SEQIDNO:267 NtP1R ccctcggagtcgatcaatttat SEQIDNO:268 CsP3F ctacagatacttctggaatggattc SEQIDNO:269 CsP3R ggactcggccacatagcta SEQIDNO:270 LsP3F gcaaggagaacttactcaacaatg SEQIDNO:271 LsP3R tgtgacaaaaaacccaagtttcta SEQIDNO:272 S1P3F gccattactaccggaaaatg SEQIDNO:273 S1P3R gttctggaaaaggtatcaccttc SEQIDNO:274 AcP3F ctcagtcgacccagaaaagtatg SEQIDNO:275 AcP3R caaaactaacgaccacaaaaatgcta SEQIDNO:276

(90) Typical PCR mix is as follow:

(91) Components for 1 PCR reaction (l)

(92) TABLE-US-00004 2x Phusion MasterMix 25 (Thermo Fisher Scientific) Forward primer 2.5 Reverse primer 2.5 cDNA 1 mQ H2O 19 Total volume 50

(93) Typical PCR cycling is as follow:

(94) TABLE-US-00005 Initial denturation 98 C. 30 sec Denaturation 98 C. 10 sec Hybridization 60 C. 10 sec Elongation 72 C. 1 min 30 sec Final elongation 72 C. 5 min

(95) 35 cycles of denaturation, hybridization and elongation were done

(96) A PCR sample of 2 l (from the 50 l) was mixed with water (3 l) and 6DNA loading dye (1 l) and charged into a 1 agarose gel. 4.5 l MassRuler (Thermo Scientific) was used for size determination. Results are shown in FIG. 7.

(97) The DNA from the remaining of the PCR was extracted (kit Macherey-Nagel referred as MN hereafter Nucleospin Gel and PCR cleanup).

(98) The standard protocol of the kit was used and elution was made with 15 l NE (Tris-HCl pH8,5).

(99) The purified DNA was quantified with nanodrop 2000.

(100) The Phusion polymerase producing blunt ends, a A-tailing procedure was done using the protocol of pGEM-T and pGEM-T Easy vector systems manual (Promega).

(101) Typical A-tailing procedure is as follow (in 0.2 ml PCR tubes):

(102) Components for 1 reaction (l):

(103) TABLE-US-00006 H2O mQ 2.8 Tampon Taq 10x with MgCl2 1 dATP (10 mM) 0.2 Cleaned up DNA from PCR 5 GoTaq2 (Promega) 1 Total (l) 10

(104) Incubation at 70C. for 20 min in thermocycler.

(105) The A-tailed product is ligated into the pGEM-T easy vector following the procedure described in the manual of pGEM-T and pGEM-T Easy vector systems.

(106) Typical ligation procedure is as follow (in 0.5 ml tubes):

(107) Component for 1 ligation (l):

(108) TABLE-US-00007 2x rapid ligase buffer 2.5 pGEM-T easy vector 0.5 A-tailed DNA from PCR 1.5 T4 DNA ligase 0.5 Total (l 5

(109) The tubes were incubated for 3 hours or overnight at room temperature.

(110) The ligation mix was used for E. coli TOP10 chemo-competent cells transformation.

(111) Typical transformation procedure is as follow (in 0.5 ml tubes):

(112) 80 C. conserved E. coli TOP10 chemo-competent cells were thawed on ice for 15 min.

(113) 2.5 l of ligation mix is added to the cells in ice and left for 30 min in ice. Heat shock at 42 C. was performed for 45 sec (water bath).

(114) The tubes were then cool down 2 min in ice.

(115) 600 l sterile LB solution was added to the cell transferred into a 13 ml round bottom tube.

(116) The tubes are incubated at 37 C. on a shaker for 1 hour.

(117) 200 l cells are plated on Petri dish containing 25 ml LB agar supplemented with ampicillin and X-gal (in flow hood).

(118) After drying, the plates are incubated at 37 C. for the night.

(119) The next morning, plates are placed in the fridge to increase the blue-white screening of the colonies.

(120) The white colonies (containing an insertion in the LacZ gene) are used for a PCR screening.

(121) Typical PCR reaction is as follow:

(122) Components for 1 reaction (l)

(123) TABLE-US-00008 H2O mQ 13.4 Tampon GoTaq 5x with LD (Promega) 4 MgCl2 (25 mM) (Promega) 1.2 dNTPs (10 mM) 0.4 M13 FW (10 uM) 0.4 M13 RV (10 uM) 0.4 GoTaq 2 enzyme (Promega) 0.2 Bacteria from a single colony bacteria Total volume 20

(124) Master mixes were prepared to screen for 8 to 16 colonies

(125) Typical PCR cycling is as follow:

(126) TABLE-US-00009 Initial denaturation 95 C. 3 min Denaturation 95 C. 30 sec Hybridization 47 C. 30 sec Elongation 72 C. 2 min 30 sec Final elongation 72 C. 5 min

(127) 35 cycles of denaturation, hybridization and elongation were done 1% agarose gel is prepared and 5 l PCR product was loaded. 4.5 l Mass-Ruler was added for size determination. Results are shown in FIG. 8.

(128) Plasmid preparations were performed with 3 ml LB ampicillin cultures inoculated with colonies containing CytoRP (overnight cultures). Kit MN, Nucleospin Plasmid QuickPure (Elutions with 30 l NE).

(129) The concentration of these samples was determined with Nanodrop 2000.

(130) Sequence analysis revealed that no single nucleotide polymorphism for the various sequences that could alter the production of the CytoRP is present. Then, the positive plasmids were diluted to 5 ng/l and were used as PCR templates for the production of the respective CytoRP. For N. tabacum only a PRORP1 clone was used to produce a CytoRP (not PRORP3).

(131) The primers presented in Example II were used to amplify the CytoRP genes in order to clone them in pET28b expression plasmid.

(132) Typical PCR mix is as follow:

(133) Components for 1 PCR reaction (l)

(134) TABLE-US-00010 2x Phusion MasterMix 25 (Thermo Fisher Scientific) Forward primer 2.5 Reverse primer 2.5 Plasmid (5 ng/l) 1 mQ H2O 19 Total volume 50

(135) Typical PCR cycling is as follow:

(136) TABLE-US-00011 Initial denturation 98 C. 30 sec Denaturation 98 C. 10 sec Hybridization 60 C. 10 sec Elongation 72 C. 1 min 30 sec Final elongation 72 C. 5 min

(137) 35 cycles of denaturation, hybridization and elongation were done.

REFERENCES

(138) Abel and Theologis (1994) Plant J 5, 421-427. Altman, S. (2007). Mol Biosyst 3, 604-607. Altschul, S. F., et al., (1990). J Mol Biol 215, 403-410. Barkan, A., et al., (2012). PLoS Genet 8, e1002910. Borghi, L. (2010). Methods Mol Biol 655, 65-75. Clough, S. J., and Bent, A. F. (1998). Plant J 16, 735-743. Crooks, G. E., et al., (2004). Genome Res 14, 1188-1190. Dreher, T. W. (2009). Virus Res 139, 217-229. Dreher, T. W. (2010). Wiley Interdiscip Rev RNA 1, 402-414. Emanuelsson, O., (2000). J Mol Biol 300, 1005-1016. Edgar, R. C. (2004). BMC Bioinformatics 5, 113. FAO, WFP and IFAD. (2012). The state of food insecurity in the world 2012. Economic growth is necessary but not sufficient to accelerate reduction of hunger and malnutrition. Rome, FAO. Gleave, A. P. (1992). Plant Mol Biol 20, 1203-1207. Gobert, A., et al., (2010). Nature struct & molec biology 17, 740-744. Gobert, A., et al., (2013). Nat Commun 4, 1353. Guerrier-Takada, C., et al., (1988). Cell 53, 267-272. Gutmann, B., et al., (2012). Genes Dev 26, 1022-1027. Howard, M. J., et al., (2012). Proc Natl Acad Sci USA 109, 16149-16154. Jopcik M., et al., (2013). Plant Cell, Tissue and Organ Culture (PCTOC) 113, 387-396. Karpenahalli, M. R., et al., (2007). BMC Bioinformatics 8, 2. Kelley, L. A., and Sternberg, M. J. E. (2009). Nature Protocols 4, 363-371. Lurin, C., et al., (2004). Plant Cell 16, 2089-2103. Nakagawa, T., et al., (2007). J Biosci Bioeng 104, 34-41. Needleman, S. B., and Wunsch C. D. (1970). J Mol Biol, 48, 443-453. Nguyen Ba, A. N. (2009). BMC Bioinformatics 10, 202. Perez-Bercoff, A., et al. (2006) Bioinformatics 22, 112-114. Shahmuradov, I. A., (2003). Nucleic Acids Res 31, 114-117. Small, I. D., and Peeters, N. (2000). Trends Biochem Sci 25, 46-47. Small, I., (2004). Proteomics 4, 1581-1590. Yoshida, K., and Shinmyo, A. (2000). J Biosci Bioeng, 90, 353-362.