PROCESS FOR OBTAINING OMPHALOTIN IN A HOST CELL COMPRISING POLYNUCLEOTIDES ENCODING FOR POLYPEPTIDES INVOLVED IN THE OMPHALOTIN BIOSYNTHESIS

Abstract

The proposed solution refers to a host cell for the heterologous synthesis of at least one omphalotin compound comprising polynucleotides encoding for polypeptides involved in the omphalotin biosynthesis, an expression vector comprising said polynucleotides and a process for obtaining at least one omphalotin compound from said host cell.

Claims

1. A host cell for the heterologous synthesis of at least one omphalotin compound comprising the following recombinant polynucleotides: a first polynucleotide encoding for a polypeptide with N-methyltransferase activity and omphalotin precursor peptide activity, consisting essentially of Seq ID No. 1 or 2 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto; a second polynucleotide encoding for a polypeptide with prolyloligopeptidase activity, consisting essentially of Seq ID No. 6 or 7 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto, and expression-controlling elements operably linked with said polynucleotides to drive expression thereof in the host cell.

2. The host cell according to claim 1, wherein the host cell is selected from yeast, in particular from Pichia or Saccharomyces, or from a fungi, in particular Aspergillus.

3. The host cell according to claim 1, wherein the host cell is selected from Pichia pastoris.

4. The host cell according to claim 1, further comprising a polynucleotide encoding for a polypeptide with monooxygenase activity, consisting essentially of Seq ID No. 8 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto.

5. The host cell according to claim 1, further comprising a polynucleotide encoding for a polypeptide, in particular with monooxygenase activity, consisting essentially of Seq ID No. 9 or 10 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto.

6. The host cell according to claim 1, further comprising a polynucleotide encoding for a polypeptide with acetyltransferase activity, consisting essentially of Seq ID No. 11 or 12 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto.

7. The host cell according to claim 1, further comprising a polynucleotide encoding for polypeptides with activity for omphalotin synthesis comprising at least one of the Seq ID No. 1-12, and consisting essentially of Seq ID No. 13 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto.

8. The host cell according to claim 1, wherein the recombinant polynucleotides are integrated into the chromosome of the host cell.

9. The host cell according to claim 1, wherein an expression vector comprising at least one of the recombinant polynucleotides is integrated into the chromosome of the host cell.

10. The host cell according to claim 1, wherein at least one of the recombinant polynucleotides is part of a self-replicating vector.

11. An expression vector comprising at least one of the following recombinant polynucleotides: a polynucleotide encoding for a polypeptide with N-methyltransferase activity and omphalotin precursor peptide activity, consisting essentially of Seq ID No. 1 or 2 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto; a polynucleotide encoding for a polypeptide with prolyloligopeptidase activity, consisting essentially of Seq ID No. 6 or 7 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto, a polynucleotide encoding for a polypeptide with monooxygenase activity, consisting essentially of Seq ID No. 8 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto, polynucleotide encoding for a polypeptide with monooxygenase activity, consisting essentially of Seq ID No. 9 or 10 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto, a polynucleotide encoding for a polypeptide with acetyltransferase activity, consisting essentially of Seq ID No. 11 or 12 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto, or a polynucleotide encoding for polypeptides with activity for omphalotin synthesis comprising at least one of the Seq ID No. 1, 2, 6-12, and consisting essentially of Seq ID No. 13 or a polynucleotide with at least 70%, preferably at least 90%, more preferably at least 95% identity thereto.

12. The expression vector according to claim 11 for heterologous expression of at least one of the polynucleotides in yeast, in particular in Pichia or Saccharomyces, or in fungi, in particular in Aspergillus.

13. The expression vector according to claim 11 for heterologous expression of at least one of the polynucleotides in the yeast Pichia pastoris.

14. The expression vector according to claim 11, wherein the vector is integrated into the chromosome of the yeast or fungi.

15. The expression vector according to claim 11, wherein the vector is a self-replicating vector.

16. A process for producing at least one omphalotin compound comprising the step of culturing the host cell of claim 1 under conditions suitable for the biosynthesis of the at least one omphalotin compound.

17. The process according to claim 16, wherein the biosynthesis of the at least one omphalotin compound is induced by adding at least one suitable inducer to the culture medium.

18. The process according to claim 16, further including the step of removing and isolating the at least one omphalotin compound from the culture medium.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The proposed solution is further explained in detail by means of the following examples with reference to the figures.

[0073] FIG. 1 shows a general overview of the gene cluster involved in the omphalotin biosynthesis.

[0074] FIG. 2 shows ion chromatograms of omphalotin A produced in O. olearius.

[0075] FIG. 3 shows ion chromatograms of omphalotin A intermediate stages produced in P. pastoris.

[0076] FIG. 4 shows an MSMS chromatogram of omphalotin A produced by P. pastoris.

[0077] FIG. 5 shows an MSMS chromatogram of linear omphalotin A produced by P. pastoris.

[0078] FIG. 6 shows Total-ion chromatogram (TIC) and extracted-ion chromatogram (EIC) of cyclized omphalotin A and linear omphalotin A produced by P. pastoris measured by ESI-Orbitrap-MS.

DETAILED DESCRIPTION

[0079] The scheme of FIG. 1 illustrates the gene cluster involved in omphalotin biosynthesis.

[0080] The two enzymes, OphMA and OphP, are required to reconstitute the biosynthesis of omphalotin A. Specifically, am automethylation of methyltransferase OphMA is followed by processing of the prolyl oligopeptidase OphP. Subsequent steps introduce hydroxylations (OphM1 and OphM2 as P450 monooxygenases) and acylations by an acetyltransferase (OphC), rendering e.g. omphalotin C and D.

[0081] Higher multiply methylated linear omphalotin precursor peptides may also be detected and may be interpreted as the occurrence of shunt products, which may have hydrolyzed from an overwrought or a partially incorrectly folded cyclizing protease OphP. Nevertheless, multiple methylations appear to be a precondition for the action of OphP, which likely forms a peptidylester upon removal of the follower peptide which is then macrocyclized with the N-terminus of the modified core peptide.

[0082] The proposed solution represents an initial steps of the omphaplotin biosynthesis, which is characterized by some unusual features: firstly, the striking structural similarity between omphalotin and cyclosporine initially let assume a non-ribosomal peptide assembly. Secondly, multiple N-methylations of the peptide backbone thus far have only been described for NRPS. Thirdly, the key-enzyme OphMA appears to be an automodifying methyltransferase, which requires the subsequent processing by a protease (OphP), a biosynthesis mechanism, which is unprecedented in RiPPs.

Example 1: Materials and Equipment

[0083] All chemicals and antibiotics were purchased from Carl Roth GmbH & Co or Sigma Aldrich and used without further purification unless otherwise specified. Messenger RNA was extracted from Omphalotus olearius strain DSM-3398 (DMSZDeutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Leibniz-Institut, Braunschweig, Germany) using TRIzol reagent and translated into cDNA with the First Strand cDNA Kit from Thermo Fisher Scientific. Escherichia coli cells DH5, the overexpression host Pichia pastoris GS115, DNA modifying enzymes (for PCR amplification, restriction digest and ligation) were obtained from Thermo Fisher Scientific as well as the pPIC3.5K vector. The vector pPICHOLI-2 was purchased from MoBiTec. All primers were ordered from Thermo Fisher Scientific and the DNA sequencing was carried out by Eurof ins Genomics (Munich, Germany).

Example 2: Preparation and Purification of DNA and RNA

[0084] mRNA Extraction and cDNA Synthesis

[0085] Genes encoding OphMA and OphP were amplified from complementary DNA (cDNA). Therefore messenger RNA (mRNA) from omphalotin producing Omphalotus olearius submerse cultures was extracted. A culture of O. olearius was grown for 7 days (28 C.; 80 rpm) on MEA-medium (30 g malt extract and 3 g soya peptone per liter). Grown colonies were crushed in a mortar and transferred into YMG-medium (10 g malt extract, 4 g yeast extract and 4 g glucose per liter). After an additional incubation of 10 days (28 C.; 80 rpm) O. olearius started to produce Omphalotin. As control for the production of Omphalotin the dodecapeptide was isolated from the supernatant.

[0086] Detection of omphalotin was performed by means of HPLC-Orbitrap mass spectrometry (MS) (see S3.2). For the extraction of mRNA with the TRIzol reagent (Thermo Fisher Scientific) a highly omphalotin producing culture (judged by MS detection) was used and executed according to the manufacturer's instructions. The mRNA was translated into cDNA with the First Strand cDNA Kit (Thermo Fisher Scientific) according the manufacturer's instructions and used as a template for the PCR amplification of ophMA and ophP.

Cloning of ophMA and ophP for Pichia Pastoris

[0087] Genes encoding OphMA (methyltransferase+precursor peptide) and OphP (prolyloligopeptidase) of the basidiomycete O. olearius were first amplified by means of PCR from cDNA (0.sub.5 polymerase, NEB) and cloned into the vectors pET28a(+) (ophMA) and pET-trx-1b (ophP). These plasmids were used as template for the amplification and cloning into the vector pPICHOLI-2 (MoBiTech) (ophMA) and vector pPIC3.5K (Thermo Fischer Scientific) (ophP).

[0088] Used primers are listed in table S1. For ophP two sets of primers were used in two different

[0089] PCR reactions to remove a Sall restriction site (silent mutation). Each PCR reaction (50 L total volume) consisted of 35 L sterile ddH.sub.2O, 10 L 5Q.sub.5 reaction buffer, 1 L of 10 M dNTP solution, 1 L of each primer (forward and reverse) at 10 M, 1 L template and 1 L of Q.sub.5 polymerase. The PCR reaction was carried out using a T Gradient thermocycler (Biometra). Lid temperature was set to 100 C. and the initial denaturation was at 98 C. for 1 min. The amplification included a 10 s denaturation at 98 C., primer annealing at 68 C. for 10 s and an elongation step at 72 C. for 2 min. The last three steps were repeated 35 times and a final elongation at 72 C. for 5 min followed.

[0090] The resulting PCR products were purified with an agarose gel electrophoresis and PCR products were excised and purified using a Gel extraction Kit (Thermo Fisher Scientific) according to manufacturer's instructions. Then the PCR product containing ophMA was digested with SgrDI and NotI, pPICHOLI-2 was digested with SaII and NotI, pPIC3.5K was digested with Sall. Subsequently both plasmids as well as the digested PCR product were purified as described for the PCR products. Both fragments of ophP were cloned into the pPIC3.5K vector using Gibson Assembly Master Mix (NEB) according the manufacturer's instructions. The gene containing ophMA was cloned with T4 ligase into the pPICHIOLI-2 vector. Thus generated plasmids were used to transform E. coli DH5a cells (Thermo Fischer Scientific) according the manufacturer's instructions. Cells were spread on LB-Agar plates (per liter: 5 g yeast extract, 10 g tryptone, 5 NaCl and 15 g Agar) supplemented with respective antibiotics and incubated over night at 37 C. Single colonies were picked and used to inoculate 20 ml LB medium (per liter: 5 g yeast extract, 10 g tryptone and 5 NaCl) supplemented with respective antibiotics. Cells were cultured overnight at 37 C. and 180 rpm supplemented with respective antibiotics.

[0091] Plasmids were isolated using the Plasmid Extraction Kit (Thermo Fischer Scientific) according the manufacturer's instructions. The correct insertion of inserts and DNA sequences was verified by sequencing (Eurofins Genomics). For generation of the heterologous Pichia producer, P. pastoris GS115 cells were first transformed with pPIC3.5K (Thermo Fisher Scientific) bearing ophP according to manufacturer's instructions and in a second step with pPICHOLI-2 (MoBiTech) bearing ophMA according to manufacturer's instructions.

TABLE-US-00001 TABLE1 UsedOligonucleotidesandGeneSequences name Sequence5.fwdarw.3 Usage ophMAfw CGTCGACGAGAACTTGTATTTCCAGGAGA ophMA CTTCCACTCAGACC ophMArev GCGGCCGCATTATTCCGTGCTCATGACTG ophMA ATCC ophPfw CTAATTATTCGAAGGATCCTACATGAGCG first ATAAAATTATTCA fragment ophP Sallrev AGAACGAAAATATCGTTATCCTGCCGTCG first TCCTGATACCA fragment ophP Sallfw TGGTATCAGGACGACGGCAGGATAACGAT second ATTTTCGTTCT fragment ophP ophPrev GGCCGCCCTAGGGAATTCTACTCAAACTG second TTACGCAGGACC fragment ophP

Example 3: Purification and Analytical Characterization of Omphalotin

[0092] Omphalotin Extraction from Submerse Cultures of O. Olearius and P. Pastoris

Omphalotus Olearius

[0093] For isolation and detection of omphalotin from O. olearius 2 mL supernatant of an omphalotin producing submerse culture (see S2.1) were vigorously mixed for 1 min with the same volume ethyl acetate. The organic phase was separated and vaporized. The resulting pellet was re-suspended in 37% methanol to a final concentration of 0.1 mg /ml and 5 l were used for HPLC-Orbitrap-MS analysis (see S3.2).

Pichia Pastoris

[0094] For isolation and detection of omphalotin from P. pastoris GS115 a strain carrying ophP integrated into the genome which also carries the pPICHOLI-2 plasmid containing ophMA was used (see S2.2). P. pastoris GS115 cells were pre-cultured overnight at 30 C. in 40 ml YPD-medium (per liter: 20 g peptone, 10 g yeast extract and 20 g glucose) at 160 rpm. The main culture was inoculated with an OD.sub.600 0.25 in 500 ml BMMY-medium (per liter: 10 g yeast extract, 10 g trypton, 13.4 g YNB and 100 ml 1 M potassium phosphate buffer adjusted to pH 6.0) and further cultivated at 30 C. and 160 rpm to OD.sub.600 1.0 after which gene expression was induced by addition of 0.5% (v/v) methanol. Cells were further incubated at 30 C. and 160 rpm for 72 h and after 24 h and 48 h 0.5% (v/v) methanol was added.

[0095] Cells and supernatant (500 ml culture) was separated by centrifugation (30 min, 4 C., 10,000 g). Supernatant was strongly mixed for 1 h with the same volume hexanes. The pellet was re-suspended in 40 ml buffer (300 mM NaCl and 50 mM Tris adjusted to pH 8.0) and disrupted with a French press (TS-series 0.75 kW, Constant systems) at 40 kPsi. Cells debris was centrifuged (60 min, 4 C., 75,000 g) and the supernatant was strongly mixed for 1 h with the same volume of hexanes.

[0096] The organic phase was separated and vaporized. The resulting pellets were re-suspended in aqueous methanol (37%) to a final concentration of 0.1 mg /ml and 5 l were used for HPLC-Orbitrap-MS (see S3.2).

HPLC-ESI-MS Detection of Omphalotin from Submerse Cultures of O. Olearius and P. Pastoris

[0097] Detection of omphalotin was conducted using an ESI-Orbitrap-MS (Exactive, Thermo Fisher Scientific) coupled to a HPLC system 1200 (Agilent Technologies). Chromatographic separation were performed using a Poroshell 120 EC.C18 2.7 m column (502.1 mm, Agilent Technologies) with a linear mobile phase gradient consisting of solvent A (0.1% (v/v) formic acid in water and solvent B (0.1% (v/v) formic acid in acetonitrile). The gradient was 37-100% B over 11 min. Data was analyzed using the Thermo Xcalibur 2.2 software.

[0098] The production of omphalotin A in O. olearius was analyzed by ion chromatography (see FIG.

[0099] 2). Total-ion chromatogram (TIC) and extracted-ion chromatogram (EIC) of the cyclized peptide [M+H].sup.+=1318.88 Da and [M+Na].sup.+=1340.87 Da measured by ESI-Orbitrap-MS.

[0100] The production of omphalotin A intermediate stages in P. pastoris was also analyzed by ion chromatography (see FIG. 3). Total-ion chromatogram (TIC) and extracted-ion chromatogram (EIC) of the linear core peptide 8 methylated [linear-peptide +8Me+H].sup.+=1322.88 Da and the linear core peptide 7 methylated [linear peptide+7 Me+H].sup.+=1308.87 Da measured by ESI-Orbitrap-MS.

HPLC-ESI-MS/MS Detection of Omphalotin from Submerse Cultures of O. Olearius and P. Pastoris

[0101] All HPLC-ESI-MS/MS analyses were conducted using an ESI-Triple-Quadropol-MS (6460 Series, Agilent Technologies) coupled to a HPLC system 1200 (Agilent Technologies). Chromatographic separations were performed using Grom-Sil 300 Octyl-6MB 2.3 m columns (502.3 mm, Grace) with a linear mobile phase gradient consisting of solvent A (0.1% (v/v) formic acid in water and solvent B (0.1% (v/v) formic acid in acetonitrile). The gradient was 37-100% B over 6 min. Data was analyzed using the MassHunter Qualitative Analysis B.07.00 software.

[0102] FIG. 4 and Table 2 shows the characteristic and diagnostic fragments of omphalotin A produced by P. pastoris by tandem MS measurements.

TABLE-US-00002 TABLE 2 Observed and identified fragments of omphalotin A after tandem MS measurements observed mass expected mass 142.0 no match found 226.9 227.3 425.3 425.3 453.1 453.3 597.3 597.4 609.3 609.4 722.3 722.5 837.5 837.6 1318.8 1318.9

[0103] FIG. 5 and Table 3 show the structural characterization of linear omphalotin A produced by P. pastoris by tandem MS measurements.

TABLE-US-00003 TABLE S3 Observed and identified fragments of linearomphalotin A after tandem MS measurements observed mass expected mass 113.9 114.1 142.0 no match found 227.1 227.2 300.2 300.2 340.1 340.3 413.1 413.3 425.2 425.3 453.1 453.3 526.3 526.4 639.4 639.4 823.3 823.5 950.3 950.6 1247.7 124.9 1336.8 1336.9

[0104] In FIG. 6 the total-ion chromatogram (TIC) and extracted-ion chromatogram (EIC) of cyclized omphalotin A and linear omphalotin A produced by P. pastoris measured by ESI-Orbitrap-MS is another proof of the successful synthesis.