METHODS OF ENHANCING TRANSLATION ABILITY OF RNA MOLECULES, TREATMENTS, AND KITS
20200199601 ยท 2020-06-25
Inventors
Cpc classification
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
International classification
C12N15/67
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
Abstract
The present invention relates to methods and a kit for enhancing the translation ability of an RNA molecule. The methods involve the use of an RNA molecule comprising a methylated adenosine residue in a 5 untranslated region (UTR). Also disclosed are methods for eIF4E-independent translation of an RNA molecule and treatment methods.
Claims
1. An mRNA molecule comprising: a methylated adenosine residue in a 5 untranslated region (UTR) and a 5 cap.
2. The mRNA molecule according to claim 1 further comprising: an internal ribosome entry site (IRES) motif.
3. The mRNA molecule according to claim 1, wherein the mRNA molecule encodes for a full-length protein.
4. The mRNA molecule according to claim 1, wherein the 5 cap is heterologous to the mRNA molecule.
5. The mRNA molecule according to claim 1, comprising more than one methylated adenosine residue in the 5 untranslated region (UTR).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION OF THE INVENTION
[0032] The present invention relates to RNA molecules that can effect eIF4E-independent translation to enhance the translation of an encoded protein or polypeptide, and to methods and kits for enhancing translation of RNA molecules and providing treatment.
[0033] One aspect of the present invention relates to a method of enhancing the translation ability of an RNA molecule. This method involves providing a cell-free composition comprising an RNA molecule to be translated, where the RNA molecule lacks a methylated adenosine residues in a 5 untranslated region (UTR) and introducing a methylated adenosine residue in a 5 untranslated region (UTR) of the RNA molecule, where said introducing enhances translation ability of the RNA molecule relative to the RNA molecule lacking a methylated adenosine residue in the 5 untranslated region (UTR).
[0034] As used herein, the term cell-free composition refers to a composition substantially free of intact cells. An exemplary cell-free composition comprises a cell lysate or extract. The term cell lysate refers to a fluid containing the contents of lysed cells. Cell lysates may be crude (i.e., unpurified) or partially purified (e.g., to remove cellular debris/particulate such as damaged outer cell membranes). Methods of forming cell lysates are well-known in the art and include, without limitation, sonication, homogenization, enzymatic lysis using lysozyme, freezing, grinding, and high pressure lysis. Cell-free compositions may comprise, for example, ribosomes, amino acids, tRNAs, aminoacyl synthetases, elongation factors and initiation factors. The cell-free composition may be derived from eukaryotic cells or prokaryotic cells and include, for example, E. coli cell lysates or extracts. A cell-free composition may also include an in vitro reaction medium for carrying out the well-known steps and reactions of protein synthesis.
[0035] A person of ordinary skill in the art will appreciate that there are many types of RNA molecules, including coding RNA (i.e., RNA that is translated into a protein, e.g., mRNA) and non-coding RNA. According to one embodiment, in the present invention, the RNA molecule referred to is a mRNA molecule.
[0036] The RNA molecule may be a synthetic RNA molecule or a naturally-occurring RNA molecule. As used herein, the term synthetic RNA molecule means an engineered or non-naturally-occurring RNA molecule (e.g., an RNA molecule comprising a heterologous sequence, synthetic nucleotides, a mixture of nucleotides and other chemical moieties, or nucleotide modifications). Synthetic RNA molecules include RNA molecules synthesized using any in vitro method known in the art. For example, synthetic RNA molecules may be produced using in vitro transcription reactions or by using an RNA synthesizer. Synthetic RNA molecules may contain one or more modified ribonucleotides or other nucleotides, for example and without limitation, 2-O-methylated nucleotides, deoxy nucleotides, or 2-fluoro nucleotides. A naturally-occurring RNA molecule means an RNA molecule consisting of a sequence that occurs in nature.
[0037] According to one embodiment of the present invention, the RNA molecule has a 5 untranslated region. As used herein, the terms 5 untranslated region or 5 UTR refer to an untranslated nucleotide segment in an RNA molecule immediately preceding an AUG start codon. The 5 untranslated region may be located at the 5 end of an RNA molecule or at an internal position of an mRNA sequence.
[0038] In carrying out this aspect of the present invention, an RNA molecule is provided, preferably in a medium in which it does not naturally occur. The RNA molecule may have a 5 untranslated region, but lacks a methylated adenosine residue in the 5 untranslated region. According to the method of the present invention, a methylated adenosine residue is introduced into the 5 untranslated region to enhance the translation ability of the RNA molecule, e.g., relative to the RNA molecule before the methylated adenosine residue was introduced into the 5 untranslated region.
[0039] By enhancing the translation ability of the RNA molecule, it is meant that the RNA molecule is more likely to be translated, is more efficiently translated, is translated at a higher rate, is translated under more challenging conditions than what normally exist in nature, or is translated under conditions that require fewer reagents than the same RNA molecule that lacks the methylated adenosine residue in the 5 untranslated region.
[0040] Various methylated adenosine residues are known in the art and are exemplified in Table 1 below.
TABLE-US-00001 TABLE 1 List of Adenosine Base Modifications Abbreviation Chemical name m.sup.1A 1-methyladenosine m.sup.1Am 1,2-0-dimethyladenosine m.sup.2A 2-methyladenosine ms.sup.2io.sup.6A 2-methylthio-N.sup.6-(cis-hydroxyisopentenyl) adenosine ms.sup.2hn.sup.6A 2-methylthio-N.sup.6-hydroxynorvalyl carbamoyladenosine ms.sup.2i.sup.6A 2-methylthio-N.sup.6-isopentenyladenosine ms.sup.2m.sup.6A 2-methylthio-N.sup.6-methyladenosine ms.sup.2t.sup.6A 2-methylthio-N.sup.6-threonyl carbamoyladenosine Am 2-O-methyladenosine m.sup.6t.sup.6A N.sup.6-methyl-N.sup.6-threonylcarbamoyladenosine m.sup.6A N.sup.6-methyladenosine m.sup.6Am N.sup.6,2-O-dimethyladenosine m.sup.6.sub.2A N.sup.6,N.sup.6-dimethyladenosine m.sup.6.sub.2Am N.sup.6,N.sup.6,2-O-trimethyladenosine
[0041] In one embodiment, the methylated adenosine residue introduced into the 5 untranslated region (UTR) is N.sup.6-methyladenosine (m.sup.6A). As described above, m.sup.6A is a reversible base modification seen in the 5 UTR of many eukaryotic mRNAs. m.sup.6A residues in the 5 UTR enable eIF4E-indepdent (i.e., cap-independent) translation of an RNA molecule by preferential binding of eIF3.
[0042] Many eukaryotic cellular mRNAs are blocked at their 5-ends with the 7-methyl-guanosine five-prime cap structure, m.sup.7GpppX (where X is any nucleotide). This structure is involved in several cellular processes including enhanced translational efficiency, splicing, mRNA stability, and RNA nuclear export. The eukaryotic 5 cap is recognized by the cap-binding protein eIF4E.
[0043] In carrying out this method of the present invention, the RNA molecule may have an m.sup.7G 5 cap, an m.sup.7G cap analog, or various non-canonical structures, which are well known in the art. Exemplary RNA cap analogs include, but are not limited to, 3-O -Me-m.sup.7G(5)ppp(5)G, m.sup.7G(5)ppp(5)G, G(5)ppp(5)G, m.sup.7G(5)ppp(5)A, and G(5)ppp(5)A. The following provide a discussion of non-natural cap analogs: Rydzik et at., Synthetic Dinucleotide mRNA Cap Analogs with Tetraphosphate 5,5 Bridge Containing Methylenebis(Phosphonate) Modification, Org. Biomol. Chem. 7(22):4763-76 (2009); Kowalska et al., Synthesis and Characterization of mRNA Cap Analogs Containing Phosphorothioate Substitutions that Bind Tightly to eIF4E and are Resistant to the Decapping Pyrophosphatase DcpS, RNA 14(6):1119-31 (2008); and Ziemniak et al., Potential Therapeutic Applications of RNA Cap Analogs, Future Med. Chem. 5(10):1141-72 (2013), which are hereby incorporated by reference in their entirety.
[0044] eIF4E is a eukaryotic translation initiation factor involved in directing ribosomes to the cap structure of mRNAs. It is a 24-kD polypeptide that exists as both a free form and as part of the eIF4F pre-initiation complex. Almost all cellular mRNA require eIF4E in order to be translated into protein. The eIF4E polypeptide is the rate-limiting component of the eukaryotic translation apparatus and is involved in the mRNA-ribosome binding step of eukaryotic protein synthesis.
[0045] eIF3 is a large multiprotein complex comprising 13 subunits that controls the assembly of the 40s ribosomal subunit on mRNA to promote assembly of the preinitiation complex. eIF3 recognizes m.sup.6A residues in the 5 UTR as well as internal ribosome entry sites (IRES) that may be present in an mRNA molecule.
[0046] As used herein, an internal ribosome entry site or IRES refers to a non-m.sup.6a internal site of mRNA sequence which recruits the ribosome or other translation initiation machinery to enable translation initiation. IRES elements may be present in the 5 UTR of viral and eukaryotic mRNA. Various viral IRES elements are known in the art and include, for example, Picornavirus IRES, Aphthovirus IRES, Hepatitis A IRES, Hepatitis C IRES, and Pestivirus IRES. Exemplary IRES elements present in eukaryotic mRNA include, but are not limited to, fibroblast growth factor (FGF-1 IRES and FGF-2 IRES), platelet-derived growth factor B (PDGF/c-sis IRES), vascular endothelial growth factor (VEGF IRES), insulin-like growth factor 2 (IGF-II IRES), c-myc (c-myc IRES), L-myc (L-myc IRES), immunoglobulin heavy chain binding protein (BiP IRES), and heat shock protein 70 (HSP70 IRES).
[0047] In carrying out this and other methods of the present invention, the RNA molecule may lack (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii). Alternatively, the RNA molecule may possess (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii).
[0048] The RNA molecule may further comprise a polyA tail. As used herein, the term polyA tail refers to a consecutive sequence of adenylic acids that are normally present at the 3 terminal of eukaryotic mRNA. The polyA tail is involved in stabilization, translation, and transport of mRNA from nucleus to cytoplasm.
[0049] Introducing a methylated adenosine residue in a 5 untranslated region of an RNA molecule may be carried out by various means. In one embodiment, introducing a methylated adenosine residue in a 5 untranslated region (UTR) of the RNA molecule is carried out by ligating an RNA molecule comprising a methylated adenosine residue in a 5 untranslated region (UTR) to the RNA molecule to be translated. As used herein, the term ligating refers to an enzymatic reaction which catalyzes the joining of two nucleic acid molecules by forming a new chemical bond. An exemplary method of introducing a methylated adenosine residue in a 5 untranslated region (UTR) of an RNA molecule involves ligating an RNA molecule having an m.sup.6A residue to the 5 untranslated region (UTR) of the RNA molecule lacking a methylated adenosine residue in a 5 untranslated region (UTR). This method may involve using a T4 DNA ligase and a bridging DNA oligonucleotide complementary to the RNAs, where the T4 DNA ligase is effective to join the RNA molecules to each other when they are in an RNA:DNA hybrid.
[0050] Alternatively, introducing a methylated adenosine residue into a 5 untranslated region (UTR) of an RNA molecule may be carried out by enzymatic methylation. Enzymatic methylation includes the use of a methyltransferase. As used herein, the term methyltransferase refers to transferase class enzymes that are able to transfer a methyl group from a donor molecule to an acceptor molecule, e.g., an adenine base of an RNA molecule. This includes, for example and without limitation, methylation enzymes that are engineered or which are fusions of naturally occurring methylation enzymes and their binding partners. Methyltransferases typically use a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. In some embodiments, a methyltransferase described herein is an m.sup.6A methyltransferase. An exemplary m.sup.6A methyltransferase is METTL3 (i.e., MT-A70), which preferentially methylates RNA oligonucleotides containing GGACU and related ribonucleotide sequences. Another example is METTL14, which similarly facilitates methylation at GGACU and related sequences.
[0051] Another aspect of the present invention relates to a method for eIF4E-independent translation of an RNA molecule. This method involves providing an RNA molecule to be translated, where the RNA molecule comprises a methylated adenosine residue in a 5 untranslated region (UTR) and a heterologous 5 cap and translating the RNA molecule.
[0052] Cellular translation of eukaryotic mRNA involves both cap-dependent and cap-independent mechanisms. Cap-dependent translation requires the binding of an initiation factor, eIF4E, to the cap structure. As described above, eIF4E-independent translation may be mediated by the direct recognition of an m.sup.6A residue in the 5 untranslated region (UTR) of an RNA molecule by the eukaryotic translation initiation factor eIF3. eIF4E-independent translation can also be mediated by IRES structures which may be present in the 5 untranslated region (UTR) of viral or eukaryotic RNA and/or in an internal region of an RNA molecule.
[0053] According to one embodiment of this aspect of the invention, the RNA molecule further comprises an internal ribosomal entry site (IRES). In some embodiments, the RNA molecule of the present invention comprises an IRES and is effective to enable the translation of multiple proteins or peptide sequences from a single RNA molecule.
[0054] According to an alternative embodiment, the RNA molecule lacks an internal ribosomal entry site (IRES).
[0055] In another embodiment, the methylated adenosine residue is m.sup.6A. m.sup.6A residues may be present throughout an RNA molecule. For example, an RNA molecule according to the present invention may further comprise m.sup.6A residues (i) in the coding region of the RNA molecule, (ii) in the 3 untranslated region (UTR) of the RNA molecule, or in both (i) and (ii).
[0056] Methods of translating RNA molecules include the use of cell-based (i.e., in vivo) and cell-free (i.e., in vitro) expression systems. Translation or expression of a protein can be carried out by introducing a nucleic acid molecule encoding a protein or protein fragment into an expression system of choice using conventional recombinant technology. Generally, this involves inserting the nucleic acid molecule into an expression system to which the molecule is heterologous (i.e., not normally present). The introduction of a particular foreign or native gene into a mammalian host is facilitated by first introducing the gene sequence into a suitable nucleic acid vector. Vector is used herein to mean any genetic element, such as a plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which is capable of replication when associated with the proper control elements and which is capable of transferring gene sequences between cells. Thus, the term includes cloning and expression vectors, as well as viral vectors. The heterologous nucleic acid molecule is inserted into the expression system or vector in proper sense (5.fwdarw.3) orientation and correct reading frame. The vector contains the necessary elements for the transcription and translation of the inserted protein coding sequences.
[0057] U.S. Pat. No. 4,237,224 to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.
[0058] A variety of host-vector systems may be utilized to express a protein encoding sequence in a cell. Primarily, the vector system must be compatible with the host cell used. Host-vector systems include, but are not limited to, the following: microorganisms such as yeast containing yeast expression vectors; mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); and plant cells infected by bacteria. The expression elements of these vectors vary in their strength and specificities. Depending upon the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used.
[0059] Different genetic signals and processing events control many levels of gene expression (e.g., DNA transcription and messenger RNA (mRNA) translation).
[0060] Transcription of DNA is dependent upon the presence of a promoter which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. Promoters vary in their strength (i.e., their ability to promote transcription). For the purposes of expressing a cloned gene, it is desirable to use strong promoters in order to obtain a high level of transcription and, hence, expression of the gene. Depending upon the host cell system utilized, any one of a number of suitable promoters may be used.
[0061] Depending on the vector system and host utilized, any number of suitable transcription and/or translation elements, including constitutive, inducible, and repressible promoters, as well as minimal 5 promoter elements may be used.
[0062] The protein-encoding nucleic acid, a promoter molecule of choice, a suitable 3 regulatory region, and if desired, polyadenylation signals and/or a reporter gene, are incorporated into a vector-expression system of choice to prepare a nucleic acid construct using standard cloning procedures known in the art, such as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor: Cold Spring Harbor Laboratory Press, New York (2001), which is hereby incorporated by reference in its entirety.
[0063] The nucleic acid molecule encoding a protein is inserted into a vector in the sense (i.e., 5.fwdarw.3) direction, such that the open reading frame is properly oriented for the expression of the encoded protein under the control of a promoter of choice. Single or multiple nucleic acids may be ligated into an appropriate vector in this way, under the control of a suitable promoter, to prepare a nucleic acid construct.
[0064] Once the isolated nucleic acid molecule encoding the protein has been inserted into an expression vector, it is ready to be incorporated into a host cell. Recombinant molecules can be introduced into cells via transformation, particularly transduction, conjugation, lipofection, protoplast fusion, mobilization, particle bombardment, or electroporation. The DNA sequences are incorporated into the host cell using standard cloning procedures known in the art, as described by Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Springs Laboratory, Cold Springs Harbor, New York (1989), which is hereby incorporated by reference in its entirety. Suitable hosts include, but are not limited to, yeast, fungi, mammalian cells, insect cells, plant cells, and the like.
[0065] Typically, an antibiotic or other compound useful for selective growth of the transformed cells only is added as a supplement to the media. The compound to be used will be dictated by the selectable marker element present in the plasmid with which the host cell was transformed. Suitable genes are those which confer resistance to gentamycin, G418, hygromycin, puromycin, streptomycin, spectinomycin, tetracycline, chloramphenicol, and the like. Similarly, reporter genes which encode enzymes providing for production of an identifiable compound, or other markers which indicate relevant information regarding the outcome of gene delivery, are suitable. For example, various luminescent or phosphorescent reporter genes are also appropriate, such that the presence of the heterologous gene may be ascertained visually.
[0066] In some embodiments, translating the RNA molecule is carried out in a cell-free system. Cell-free expression allows for fast synthesis of recombinant proteins and enables protein labeling with modified amino acids, as well as expression of proteins that undergo rapid proteolytic degradation by intracellular proteases. As described above, exemplary cell-free systems comprise cell-free compositions, including cell lysates and extracts. Whole cell extracts may comprise all the macromolecule components needed for translation and post-translational modifications of eukaryotic proteins. As described above, these components include, but are not limited to, regulatory protein factors, ribosomes, and tRNA.
[0067] The RNA molecules according to this aspect of the invention may further comprise a sequence motif or aptamer sequence that binds and recruits proteins capable of methylating RNA such that an m.sup.6A is formed in the 5 UTR.
[0068] As used herein, the term sequence motif refers to a certain nucleotide sequence of at least 2 nucleotides in a larger oligonucleotide sequence. A sequence motif may occur once in an oligonucleotide sequence, or it may occur any number of times. An exemplary sequence motif is an adenosine methylation motif that falls under the general motif DRACH, where D=A, U; R=G; A; H=A, C, U. A broader list is provided in Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods. 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety. Additional motifs such as U-rich motifs may also facilitate the methylation of DRACH motifs in RNA that are expressed in living cells. In one embodiment, the RNA molecule comprises multiple sequence motifs. Each sequence motif may be effective to target an adenosine residue in the 5 UTR of an RNA molecule for methylation by a methyltransferase.
[0069] As used herein, the term aptamer refers to a nucleic acid molecule that binds specifically to a target. Nucleic acid aptamers are single-stranded, partially single-stranded, partially double-stranded, or double-stranded nucleotide sequences, advantageously a replicatable nucleotide sequence, capable of specifically recognizing a selected non-oligonucleotide molecule or group of molecules by a mechanism other than Watson-Crick base pairing or triplex formation. Aptamers include, without limitation, defined sequence segments and sequences comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides, and nucleotides comprising backbone modifications, branchpoints, and non-nucleotide residues, groups, or bridges. Nucleic acid aptamers include partially and fully single-stranded and double-stranded nucleotide molecules and sequences; synthetic RNA, DNA, and chimeric nucleotides; hybrids; duplexes; heteroduplexes; and any ribonucleotide, deoxyribonucleotide, or chimeric counterpart thereof and/or corresponding complementary sequence, promoter, or primer-annealing sequence needed to amplify, transcribe, or replicate all or part of the aptamer molecule or sequence.
[0070] The nucleic acid aptamer according to this aspect of the invention may be located in 5 UTR of the RNA molecule and includes a domain for binding to a component of cellular methylation machinery. The aptamer may comprise a plurality of aptamer domains separated by linker regions of suitable length that are effective to prevent steric or folding interference between each domain, allowing each to properly fold and bind to their respective targets. Upon binding between the aptamer and domain to a component of the cellular methylation machinery, the target RNA molecule is effectively methylated at the targeted adenosine residue in the 5 UTR of the RNA molecule.
[0071] A further aspect of the present invention relates to a treatment method. This method involves contacting a cell with an RNA molecule comprising a methylated adenosine residue in a 5 untranslated region (UTR) under conditions effective to effect translation of the RNA molecule to treat the cell.
[0072] According to one embodiment, this and other treatment methods described herein are effective to treat a cell under a stress or disease condition. Exemplary cell stress conditions may include, without limitation, exposure to a toxin; exposure to chemotherapeutic agents, irradiation, or environmental genotoxic agents such as polycyclic hydrocarbons or ultraviolet (UV) light; exposure of cells to conditions such as glucose starvation, inhibition of protein glycosylation, disturbance of Ca.sup.2+ homeostasis and oxygen; exposure to elevated temperatures, oxidative stress, or heavy metals; and exposures to a pathological disease state (e.g., diabetes, Parkinson's disease, cardiovascular disease (e.g., myocardial infarction, end-stage heart failure, arrhythmogenic right ventricular dysplasia, and Adriamycin-induced cardiomyopathy), and various cancers (Fulda et al., Cellular Stress Responses: Cell Survival and Cell Death, Int. J. Cell Biol. (2010), which is hereby incorporated by reference in its entirety).
[0073] Additional exemplary stress or disease conditions include those of a cell undergoing a viral infection. By impairing cap-dependent ribosome recruitment to host mRNAs, many viruses globally interfere with host mRNA translation, crippling host antiviral responses, and favoring viral protein synthesis. Some viruses directly target degradation of cellular translation factors to prevent ribosome recruitment by host mRNAs. For example, poliovirus (an enterovirus), feline calicivirus, and retroviruses each encode proteases that cleave eIF4G, separating its (amino-terminal) eIF4E-interacting domain from its eIF4A- and eIF3-binding segment, thereby inhibiting cap-dependent protein synthesis in a eukaryotic cell. Vesicular stomatitis virus (VSV), influenza virus, and adenovirus (Ad) decrease eIF4E phosphorylation, resulting in the accumulation of unphosphorylated eIF4E. Other viruses, including encephalomyocarditis virus (EMCV), poliovirus, cricket paralysis virus (CrPV), VSV, Sindbis virus (SINV), Dengue virus (DENV), and reovirus, as well as small DNA viruses such as SV40, impact initiation factors indirectly by, for example, inducing the accumulation of proteins which sequester the cap-binding subunit eIF4E and preventing eIF4F assembly.
[0074] In one embodiment of this and other aspects of the present invention, the cell is in a stress or disease condition, where an active amount of eIF4E (i.e., phosphorylated eIF4E) is reduced or absent in the cell compared to the cell in an unstressed or disease-free state.
[0075] Various embodiments of the RNA molecules of the present invention are described above and apply in carrying out this and other treatment methods described herein. For example, in one embodiment the methylated adenosine residue is m.sup.6A. In another embodiment the RNA molecules lacks (i) a 5 cap, (ii) an internal ribosomal entry site (IRES), or both (i) and (ii). Alternatively, the RNA molecule may further comprise (i) a 5 cap, (ii) an internal ribosomal entry site (IRES), or both (i) and (ii).
[0076] In some embodiments, contacting a cell with an RNA molecule involves introducing an RNA molecule into a cell. Suitable methods of introducing RNA molecules into cells are well known in the art and include, but are not limited to, the use of transfection reagents, electroporation, microinjection, or via RNA viruses.
[0077] The cell may be a eukaryotic cell. Exemplary eukaryotic cells include a yeast cell, an insect cell, a fungal cell, a plant cell, and an animal cell (e.g., a mammalian cell). Suitable mammalian cells include, for example without limitation, human, non-human primate, cat, dog, sheep, goat, cow, horse, pig, rabbit, and rodent cells.
[0078] In certain embodiments of the treatment methods of the present invention, the RNA molecule encodes a therapeutic protein or peptide sequence. The therapeutic protein may be endogenous or heterologous to the cell. The therapeutic protein may be down-regulated in a disease state, a stress state, or during a pathogen infection of a cell.
[0079] Treating cells also includes treating the organism in which the cells reside. Thus, by this and the other treatment methods of the present invention, it is contemplated that treatment of a cell includes treatment of a subject in which the cell resides.
[0080] Another aspect of the present invention relates to a treatment method. This method involves contacting a cell with a DNA molecule encoding an RNA molecule comprising an adenosine methylation motif in a 5 untranslated region (UTR) under conditions effective for the DNA molecule to be transcribed to produce an RNA molecule comprising an adenosine methylation motif in a 5 untranslated region (UTR) such that the RNA molecule is methylated at the adenosine methylation motif and is translated to treat the cell.
[0081] In one embodiment of carrying out this method of the present invention, the DNA molecule encodes an RNA molecule which encodes a therapeutic protein or peptide sequence. The therapeutic protein may be endogenous or heterologous to the cell. The therapeutic protein may be down-regulated in a disease state, a stress state, or during a pathogen infection in a cell. The DNA molecule may be a synthetic DNA molecule or a naturally-occurring DNA molecule.
[0082] As used herein, the term synthetic DNA molecule refers to an engineered or non-naturally-occurring DNA molecule (e.g., a DNA molecule comprising a heterologous sequence or modification). In one embodiment, the DNA molecule is a plasmid. The plasmid may encode one or more methylation motifs in the 5 untranslated region (UTR) of the transcribed RNA molecule. A naturally-occurring DNA molecule refers to a DNA molecule consisting of a sequence that occurs in nature.
[0083] In one embodiment, the DNA molecule does not encode (i) a 5 cap, (ii) an internal ribosomal entry site (IRES), or both (i) and (ii). Alternatively, the DNA molecule may encode (i) a 5 cap, (ii) an internal ribosomal entry site (IRES), or both (i) and (ii).
[0084] In some embodiments, the methylated adenosine is m.sup.6A. As described above, m.sup.6A residues in the 5 untranslated (UTR) region of RNA are effective to mediate eIF4E-independent translation of an RNA molecule.
[0085] A further aspect of the present invention relates to a treatment method. This method involves contacting a cell with an agent capable of recruiting methylation machinery to an RNA molecule comprising an adenosine residue in a 5 untranslated region (UTR) under conditions effective to methylate the adenosine residue such that the RNA molecule is translated to treat the cell.
[0086] As described above, cell may include a eukaryotic cell, including but not limited to human, non-human primate, cat, dog, sheep, goat, cow, horse, pig, rabbit, and rodent cells.
[0087] In one embodiment of this aspect of the present invention, the agent is an aptamer. As described above, the term aptamer refers to a nucleic acid molecule that binds specifically to a target. The nucleic acid aptamer according to this aspect of the invention may include a domain for binding to a component of cellular methylation machinery and/or a domain for binding to an RNA molecule at or near the 5 UTR. The aptamer may bind specifically to a target RNA molecule by hybridization (e.g., Watson-Crick base-pairing). Thus, the aptamer may comprise a nucleotide sequence that is sufficiently complementary to the target RNA molecule so as to hybridize under appropriate conditions with a target RNA molecule that is physiologically found within a cell or within a biological sample. Upon hybridization between the aptamer and the target RNA and the binding of the first domain to a component of the cellular methylation machinery, the target RNA molecule is effectively methylated at the adenosine residue.
[0088] In some embodiments, the agent is a sequence element. For example, the sequence element may be an RNA sequence element that recruits an artificial or naturally-occurring fusion protein that induces methylation. Suitable sequence elements include an adenosine methylation motif. The sequence element can be the MS2 hairpin sequence or the BoxB hairpin sequence that recruits proteins tagged with the MS2 coat protein (MCP) or the lamdaN peptide, respectively. These proteins are recruited to the sequence element to methylate adenosine residues in a suitable sequence motif.
[0089] The RNA molecules according to this aspect of the invention may lack (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii). Alternatively, the RNA molecules may include (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii).
[0090] Another aspect of the present invention relates to a method of enhancing translation ability of an RNA molecule in a cell. This method involves identifying a cell comprising an RNA molecule that could benefit from eIF4E-independent translation and contacting the cell with an agent capable of forming a methylated adenosine residue in a 5 untranslated region (UTR) of the RNA molecule to enhance translation ability of the RNA molecule in the cell.
[0091] In carrying out this method of the present invention, the cell may be identified as being under stress or subject to disease. Or, the cell may be identified as a cell where translation mediated by eIF4E is reduced, e.g., below a normal or expected level. Various cellular stress and disease conditions are described in detail above.
[0092] The RNA molecule may be endogenous to the cell or heterologous to the cell. Similarly, the RNA molecule may encode an endogenous protein that is not expressed or undergoes decreased expression when the cell is under stress or subject to disease or where translation mediated by eIF4E is reduced. Alternatively, the RNA molecule may encode a chimeric or heterologous protein that may be effective to treat the cell.
[0093] As described above, the RNA molecule may be synthetic.
[0094] In on embodiment, the methylated adenosine residue is m.sup.6A.
[0095] The RNA molecules according to this aspect of the invention may lack (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii). Alternatively, the RNA molecules of the present invention may further comprise (i) a 5 cap, (ii) an internal ribosome entry site (IRES), or both (i) and (ii).
[0096] As described above, the agent may be a sequence element or an aptamer.
[0097] In some embodiments, the agent is a guide RNA. As used herein the term guide RNA means a specific RNA moiety which recruits and directs the nuclease activity of a Cas9 nuclease. The guide RNA may recruit Cas9, Cas9-fusion proteins, and related proteins to specific sites in a target RNA. In one embodiment, the agent is a guide RNA which is effective to direct the modification of a 5 UTR to include an adenosine methylation recognition sequence.
[0098] A further aspect of the present invention relates to a kit. The kit includes a DNA molecule encoding an RNA molecule comprising an adenosine methylation motif in a 5 untranslated region (UTR); reagents for transcribing the RNA molecule; and reagents for methylating the RNA molecule.
[0099] Another aspect of the present invention relates to a kit that includes a DNA molecule encoding an RNA molecule, reagents for transcribing the molecule, and m.sup.6A nucleotides in a form suitable for incorporation into synthesized RNA.
[0100] According to one embodiment, this kit is used to carry out a method of making an RNA molecule comprising one or more m.sup.6A residues (in the 5 UTR). Specifically, in vitro transcription reactions in a medium containing CTP, GTP, UTP, and a mix of m.sup.6ATP and ATP (or all m.sup.6ATP) permit transcription of RNA that has m.sup.6A throughout its sequence, including in the 5 UTR. Such a molecule then becomes very competent to translate in an eIF4E-independent way, or can allow a new mode of translation on top of the translation modes that it already has, e.g., cap-mediated; IRES mediated; or m.sup.6A mediated.
[0101] A further aspect of the present invention relates to an mRNA molecule comprising a methylated adenosine residue in a 5 untranslated region (UTR) and a 5 cap.
[0102] According to one embodiment, the mRNA molecule further comprises an internal ribosome entry site (IRES) motif
[0103] The mRNA molecule according to this aspect of the present invention may encode for a full-length protein or a protein fragment.
[0104] In one embodiment of the mRNA molecule, the 5 cap is heterologous to the mRNA molecule. In other words, the 5 cap is not normally associated with the mRNA molecule in nature.
[0105] The mRNA molecule according to this aspect of the present invention may have one or more than one methylated adenosine residues in the 5 untranslated region (UTR). For example, the mRNA molecule may have 1, 2, 3, 4, 5, 6, 7, or more methylated adenosine residues in the 5 untranslated region (UTR).
[0106] These aspects of the present invention are further illustrated by the examples below.
EXAMPLES
[0107] The following examples are provided to illustrate embodiments of the present invention, but they are by no means intended to limit its scope.
Materials and Methods for Examples 1-8
In Vitro Translation
[0108] In vitro translation assays were performed using HeLa cell extracts (One-Step Human IVT Kit, Thermo Scientific). Equal amounts of RNA were used for each reaction (100 ng RNA per reaction, approximately 30 nM per reaction), and all reactions within each experiment were performed in equal volumes. Multiple different batches of HeLa extracts and mRNA preparations were used to ensure that the translation-promoting effect of m.sup.6A is not due to a specific lot of extract or batch of synthesized mRNA. However, this also contributes to inter-experiment variability. Reactions were performed at 30 C. for 30 minutes and were stopped by the addition of 200 M cycloheximide and placed on ice. 1 l of each reaction was then used for luminescence analysis (see below). The remaining reaction volume was used for RNA isolation with TRIzol (Invitrogen) or Qiagen RNeasy kits according to the manufacturer's instructions. cDNA synthesis was then performed using Superscript III reverse transcriptase (Invitrogen) and random hexamers. Following treatment with RNase H, cDNA was then used for RT-qPCR analysis to ensure that differences in mRNA levels across samples did not account for the observed changes in protein production. Statistical analysis of luciferase activity measurements was performed using Student's t-test and a p-value threshold of 0.01.
Luciferase Activity Measurements
[0109] Luciferase expression was measured using the One-Glo luciferase assay kit (Promega) according to the manufacturer's instructions. Luminescence measurements were performed on a Molecular Devices Spectramax L microplate reader using the SoftMax Pro software program.
eIF3a PAR-iCLIP
[0110] eIF3a PAR-iCLIP was performed using HEK293T cells as described previously (Huppertz et al., iCLIP: Protein-RNA Interactions at Nucleotide Resolution, Methods 65:274- 287 (2014), which is hereby incorporated by reference in its entirety) with some adjustments. 10 million cells were incubated with 100 mM 4SU for 8 hours. Media was then discarded, and cells were placed on ice and irradiated with 365 nm UV light using a Stratalinker UV crosslinker (Stratagene) with 150 mJ/cm.sup.2. Cells were scraped in ice-cold 1 PBS and collected by centrifugation at 200g for 10 min at 4 C. Cell pellets were suspended in 200 l of 1% SDS, 10 mM DTT and 1 protease inhibitors (cOmplete mini EDTA-free, Roche). The lysate was then passed through an 18G needle 10 times to improve cell lysis and shearing of DNA. SDS was neutralized by diluting the lysate to 2 ml using RIPA buffer without SDS. The remainder of the protocol was performed as described (Huppertz et al., iCLIP: Protein-RNA Interactions at Nucleotide Resolution, Methods 65:274-287 (2014), which is hereby incorporated by reference in its entirety) using rabbit anti-eIF3a (Abcam).
Cell Lines and Antibodies
[0111] HeLa cells, HEK293T cells, and MEF cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS). Antibodies used for western blot analysis were as follows: HSP70 (SPA-810) was purchased from Stressgen; anti-FTO (597-Fto) from Phosphosolutions or Abcam; RPS6 from Genetex; goat anti-GFP from Santa Cruz Biotechnology; mouse anti--actin from Genscript; rabbit anti-GAPDH, Rabbit anti-YTHDF1 (Ptglabs 17479-1-AP), Rabbit anti-YTHDF2 (Ptglabs 24744-1-AP), Rabbit anti-YTHDF3 (Ptglabs 25537-1-AP), Rabbit anti-YTHDC1 (Ptglabs 14392-1-AP), and Rabbit anti-YTHDC2 (Novus 17479-1-AP) from Abcam. Rabbit anti-m.sup.6A was from Synaptic Systems.
Assembly and Analysis of Ribosomal Complexes
[0112] Expression vectors for eIF1 and eIF1A (Pestova et al., Eukaryotic Ribosomes Require Initiation Factors 1 and 1A to Locate Initiation Codons, Nature 394:854-859 (1998), which is hereby incorporated by reference in its entirety), eIF4A and eIF4B (Pestova et al., Canonical Eukaryotic Initiation Factors Determine Initiation of Translation by Internal Ribosomal Entry, Mol. Cell Biol. 16:6859-6869 (1996), which is hereby incorporated by reference in its entirety), eIF4E (Volpon et al., Cap-Free Structure of eIF4E Suggests a Basis for Conformational Regulation by its Ligands, EMBO J. 25:5138-5149 (2006), which is hereby incorporated by reference in its entirety), and E. coli methionyl tRNA synthetase (Lomakin et al., The Fidelity of Translation Initiation; Reciprocal Activities of eIF1, IF3 and YciH, EMBO J. 25:196-210 (2006), which is hereby incorporated by reference in its entirety), as well as transcription vectors for MVHC-STOP mRNA (comprising the 54 nt-long 5 UTR of rabbit -globin mRNA starting with two extra Gs, the coding sequence for an MVHC tetrapeptide, a UAA stop codon, and an approximatelyl50 nucleotide 3UTR consisting of the natural -globin coding sequence) (Skabkin et al., Reinitiation and Other Unconventional Posttermination Events During Eukaryotic Translation, Mol. Cell 51:249-264 (2013), which is hereby incorporated by reference in its entirety) and tRNA.sub.i.sup.Met (Pestova et al., Preparation and Activity of Synthetic Unmodified Mammalian tRNAi(Met) in Initiation of Translation In Vitro, RNA 7:1496-1505 (2001), which is hereby incorporated by reference in its entirety) have been described. The transcription vector for -globin-2AUG mRNA was made by inserting an appropriate DNA fragment flanked by a T7 promoter and a HindIII restriction site into pUC57 (GenScript Corp.). Native 40S and 60S ribosomal subunits eIF2, eIF3, eIF4F, eIF5B, eEF1H, eEF2, and total aa-tRNA synthetases, and recombinant eIF1, eIF1A, eIF4A, eIF4B, eIF5, and E. coli methionyl tRNA synthetase were purified as described (Lomakin et al., The Fidelity of Translation Initiation; Reciprocal Activities of eIF1, IF3 and YciH, EMBO J. 25:196-210 (2006) and Pisarev et al., Assembly and Analysis of Eukaryotic Translation Initiation Complexes, Methods Enzymol. 430:147-177 (2007), which are hereby incorporated by reference in their entirety). mRNAs and tRNA.sub.i.sup.Met were transcribed using T7 RNA polymerase. Transcribed mRNAs were capped using the T7 mScript Standard mRNA Production System (Cellscript, Madison, Wis., USA). In vitro transcribed tRNA.sub.i.sup.Met and elongator tRNAs were aminoacylated using E. coli methionyl tRNA synthetase and native total tRNA synthetases, respectively, as described (Pisarev et al., Assembly and Analysis of Eukaryotic Translation Initiation Complexes, Methods Enzymol. 430:147-177 (2007), which is hereby incorporated by reference in its entirety).
[0113] 48S initiation complexes were assembled and analyzed by toe-printing essentially as described (Pisarev et al., Assembly and Analysis of Eukaryotic Translation Initiation Complexes, Methods Enzymol. 430:147-177 (2007), which is hereby incorporated by reference in its entirety). Briefly, 60 nM mRNA was incubated with 40S subunits (90 nM), Met-tRNA.sub.i.sup.Met (150 nM), and different combinations of eIF1 (450 nM), eIF1A (450 nM), eIF2 (160 nM), eIF3 (150 nM), eIF4A (350 nM), eIF4B(350 nM), and eIF4F (150 nM) in 20 l reaction mixtures containing buffer (20 mM Tris-HCl [pH 7.5], 100 mM KAc, 2.5 mM MgCl.sub.2, 0.25 mM spermidine and 2 mM DTT) supplemented with 0.8 mM ATP and 0.4 mM GTP for 15 min at 37 C. Assembled 48S complexes were then incubated with 120 nM 60S subunits, 300 nM eIF5 and 150 nM eIF5B for 10 min at 37 C. to allow formation of 80S initiation complexes. To form pre-termination complexes, 80S complexes were supplemented with 150 nM eEF1H, 150 nM eEF2 and appropriately aminoacylated native total tRNA (200 nM each) and incubated for 10 min at 37 C. After incubation, the assembled complexes were analyzed by primer extension using AMV reverse transcriptase and a [.sup.32P]-labeled primer complementary to nucleotides 197-214 of wt -globin mRNA. The resulting cDNAs were resolved by electrophoresis on a 6% acrylamide sequencing gel followed by autoradiography. The toe-print positions were determined by comparison with a DNA sequence obtained with the same primer.
Translation Efficiency (TE) Analysis
[0114] Ribosome profiling data from METTL3-depleted cells and Mett13 knockout cells was previously described (Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which is hereby incorporated by reference in its entirety). TE measurements were analyzed for mRNAs containing m.sup.6A within various regions of the transcript as identified by single nucleotide-resolution m.sup.6A mapping (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety). Cumulative distribution plots were generated for data visualization, and statistical analysis was done using the Mann-Whitney U test with a P-value cutoff of 0.05.
Heat Shock Induction of Hsp70
[0115] MEF cells with Fto knockdown or overexpression were incubated overnight and were 90% confluent prior to heat shock treatment. After incubation in a 42 C. water bath for 1 hour, cells recovered in an incubator at 37 C. and collected at the indicated time points.
Polysome Profiling
[0116] Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl.sub.2, 100 g/m1 of cycloheximide). A 15-45% (w/v) sucrose density gradients were prepared in SW41 ultracentrifuge tubes (Fisher) using a BioComp Gradient Master (BioComp Instruments). Cells with or without heat shock stress were treated with cycloheximide (100 g/ml) for 3 minutes at 37 C. and lysed in an ice-cold polysome buffer containing 2% Triton X-100. 500 l supernatant of the cell lysate was loaded onto gradients, followed by centrifugation at 38,000 rpm at 4 C. in a SW41 rotor for 2 h 28 min. Gradients were fractionated through Isco fractionation system and absorbance values at 254 nm were continually monitored.
Real-Time Quantitative PCR
[0117] Total RNA from whole cell lysate was isolated using TRIzol reagent (Invitrogen). RNA from fractions with spiked-in luciferase mRNA was extracted by TRIzol LS reagent (Invitrogen). Reverse transcription was performed using High Capacity cDNA Reverse Transcription Kit (Invitrogen). For HSP70-related experiments, Real-time PCR analysis was conducted with Power SYBR Green PCR Master Mix (Applied Biosystems). The reaction was performed on a LightCycler 480 Real-Time PCR System (Roche Applied Science). For luciferase in vitro translation and eIF3 pull-down experiments, qPCR was done using iQ SYBR Green Supermix (Bio-Rad) and an Eppendorf Mastercycler ep realplex thermocycler. Quantification for eIF3 target RNA immunoprecipitation was performed by calculating the Ct values of target RNAs in input and IP samples relative to GAPDH Ct values. Then IP/Input was computed for these values for each sample to determine target RNA enrichment in the IP samples. Primers used to amplify each target are as follows:
TABLE-US-00002 Gapdh: Fwd (SEQIDNO:14) 5-CAAGGAGTAAGAAACCCTGGAC-3, Rev (SEQIDNO:15) 5-GGATGGAAATTGTGAGGGAGAT-3, Hsp70: Fwd (SEQIDNO:16) 5-TGGTGCAGTCCGACATGAAG-3, Rev (SEQIDNO:17) 5-GCTGAGAGTCGTTGAAGTAGGC-3, Fluc: Fwd (SEQIDNO:18) 5-ATCCGGAAGCGACCAACGCC-3, Rev (SEQIDNO:19) 5-GTCGGGAAGACCTGCCACGC-3, pGL4.34Luc: Fwd (SEQIDNO:20) 5-TTCGTGAGCAAGAAAGGGCT-3, Rev (SEQIDNO:21) 5-AGTCGTACTCGTTGAAGCCG-3, GAPDH: Fwd (SEQIDNO:22) 5-AAATCAAGTGGGGCGATGCT-3, Rev (SEQIDNO:23) 5-CAAATGAGCCCCAGCCTTCT-3, SETD1A: Fwd (SEQIDNO:24) 5-AGCGGGCTATTCTCTCACTTG-3, Rev (SEQIDNO:25) 5-GCTTTGCTTCTCTTCCCCGT-3, ITPRIPL2: Fwd (SEQIDNO:26) 5-AACACTTGAGCTGGGAGAGG-3, Rev (SEQIDNO:27) 5-GAAGACGCGTAGATTGAGGGT-3, PNMA1: Fwd (SEQIDNO:28) 5-CTGGCTAGTCTCCCAAACGG-3, Rev (SEQIDNO:29) 5-CATCTTGCGTCTGGGTCTGG-3, BMP6: Fwd (SEQIDNO:30) 5-GAGGGCCAGGAAGGGGAA-3, Rev (SEQIDNO:31) 5-CGTGGAGCGGCGGAG-3,
In Vitro Transcription
[0118] In vitro transcription was performed using either the T7 Flash or Durascribe transcription kit (Epicentre) for making uncapped mRNAs or the mMessage mMachine SP6 transcription kit (Ambion) for making capped mRNAs. The luciferase mRNA sequence used for in vitro translation assays was amplified from the pGL4.34 [luc2P/SRF-RE/Hygro] vector (Promega). Unless otherwise specified, mRNAs were synthesized to contain 50% m.sup.6A using N.sup.6-methyladenosine 5 triphosphate. Synthesis of mRNAs with other modifications was performed by the addition of 50% of the indicated modified nucleotide: N.sup.1-methyladenosine 5 triphosphate (TriLink), 2-O-methyladenosine 5 triphosphate (TriLink), N.sup.6-propargyladenosine 5 triphosphate (Jena Biosciences), 5-methyladenosine 5 triphosphate (TriLink), pseudouridine triphosphate (TriLink). In vitro transcription was stopped by addition of DNasel and incubation for 20 minutes at 37 C. mRNAs were then purified using a Bio-Spin RNA purification column (BioRad). For mRNAs with a single 5 end A or m.sup.6A, in vitro transcription was carried out using 20 mM adenosine 5-monophosphate or N.sup.6-methyladenosine 5-monophosphate and 0.5 mM ATP, and using the T7 phi 2.5 promoter sequence (5-TAATACGACTCACTATTA-3 (SEQ ID NO:32)) (Huang et al., Systemic and Integrative Analysis of Large Gene Lists Using DAVID Bioinformatics Resources, Nat. Protoc. 4:44-57 (2009), which is hereby incorporated by reference in its entirety). Of note, the T7 promoter incorporates both methylated (m.sup.6AMP) and unmethylated (ATP) adenosines at the 5 ends of transcripts when using this promoter sequence; thus, the m.sup.6A-containing reporter mRNA synthesized with this method (
5 UTR Sequences
[0119] The various 5UTR sequences of the mRNAs used for in vitro translation assays are listed below. Although different 5UTRs showed variability in the degree of cap-dependent translation for both methylated and unmethylated mRNAs, the presence of m.sup.6A did not have a consistent enhancing or suppressing effect on this mode of translation. Conversely, the effect of m.sup.6A was consistent and robust on cap-independent translation, regardless of the 5 UTR sequence used.
TABLE-US-00003 pGL4.345UTR(FIGS.2A,2C): (SEQIDNO:33) 5-GGAAGCUCGACUUCCAGCUUGGCAAUCCGGUACUGUUGGUAAAG CCACC-3 -globin(FIGS.2B,2D,S1,andFIG.3D): (SEQIDNO:34) 5-GACACUUGCUUUUGACACAACUGUGUUUACUUGCAAUCCCCCAA AACAGACAGA-3 -globin3As(FIG.2D): (SEQIDNO:35) 5-GACUCUUGCUUUUGCCUCUUCUGUGUUGCUUGACUUCCCCCUUG UUGAC-3 -globin1A5end(FIG.2D): (SEQIDNO:36) 5-GACUCUUGCUUUUGCCUCUUCUGUGUUGCUUGCCUUCCCCCUUG UCUGC-3 -globin1Amid(FIG.2D,FIG.S2F): (SEQIDNO:37) 5-GGCUCUUGCUUUUGCCUCUUCUGUGUGACUUGCCUUCCCCCUUG UCUGC-3 -globin1A3end(FIG.2D): (SEQIDNO:38) 5-GGCUCUUGCUUUUGCCUCUUCUGUGUUGCUUGCCUUCCCCCUUG UUGAC-3 -globin0As(FIG.2D): (SEQIDNO:39) 5-GGCUCUUGCUUUUGCCUCUUCUGUGUUGCUUGCCUUCCCCCUUG UCUGC-3 HIST2H2BE(FIG.2E): (SEQIDNO:40) 5-ACUUCUUUUCUUGGCUAAGCCGCGUUUGUACUGUGUCUUACC-3 -globinhairpin(FIG.3D): (SEQIDNO:41) 5-GGGCCCCGCCCGGUGUCGGGCGGGGCCCGACACUUGCUUUUGAC ACAACUGUGUUUACUUGCAAUCCCCCAAAACAGACAGA-3 -globin1AmidUAC(FIG.S2F): (SEQIDNO:42) 5-GGCUCUUGCUUUUGCCUCUUCUGUGUUACUUGCCUUCCCCCUUG UCUGC-3 -globin1AmidCAGFIG.S2F): (SEQIDNO:43) 5-GGCUCUUGCUUUUGCCUCUUCUGUGUCAGUUGCCUUCCCCCUUG UCUGC-3 The5UTRsequencesuseforinvitroribosome complexassemblyareasfollows: -globin2AUG(FIG.3A): (SEQIDNO:44) 5-GACACUUGCUUUUAGAAUGGACAACUGUGUUUACUUGCAAUCCC CCAAAACAGACUGCAUCUGUCCAGUGAGGAGAAGUCUGCGGAGAAUG G-3 -globin(FIG.1A-C): (SEQIDNO:45) 5-GGACACUUGCUUUUGACACAACUGUGUUUACUUGCAAUCCCCCA AAACAGACAGA-3
RNA Decay Analysis in HeLa Lysates
[0120] [.sup.32P]-CTP-labeled mRNAs encoding a short FLAG peptide were synthesized by in vitro transcription using the Epicentre T7 Flash kit and either 100% ATP or 50% ATP/50% N.sup.6-meATP. mRNAs were purified using Bio-spin columns (Bio-Rad), and one microliter of mRNA was added to HeLa cell extracts (One-Step Human IVT Kit, Promega) and incubated at 30 C. for 30 minutes, followed by Trizol extraction. mRNAs were then separated on a 10% TBE-Urea gel and transferred to a nylon membrane. Radioactively labeled mRNA was detected with a phosphor screen and quantified using a Phospholmager.
Hsp70 Pulldown and m.SUP.6 .A Immunoblotting
[0121] To isolate endogenous Hsp70 mRNA, 400 pmol of biotin-labeled probe (5-TTCATAACATATCTCTGTCTCTT-3 (SEQ ID NO:46)) was incubated with 1 ml of M-280 Streptavidin Dynabeads (Life Technologies) in 1 B & W buffer (5 mM Tris-HCL pH 7.5, 0.5 mM EDTA and 1 M NaCl) at 4 C. for 1 hour. 2 mg total RNA was denatured at 75 C. for 2 minutes and added to the pre-treated Dynabeads for a further 2 hour incubation in 1 B & W buffer at 4 C. Captured RNA was eluted by heating beads 2 minutes at 90 C. in 10 mM EDTA with 95% formamide followed by Trizol LS isolation. Isolated RNA was quantified using NanoDrop ND-1000 UV-Vis Spectrophotometer and equal amounts were mixed with 2 RNA Loading Dye (Thermo Scientific) and denatured for 3 minutes at 70 C. In vitro transcribed mRNA containing 50% N.sup.6-methyladenosine or 100% adenosine was used as positive and negative controls, respectively. These mRNAs were the corresponding 5UTR sequence of mouse Hsp70. Samples were then run on a formaldehyde denaturing agarose gel and transferred to a positively charged nylon membrane by siphonage in transfer buffer (10 mM NaOH, 3 M NaCl) overnight at room temperature. After transfer, the membrane was washed 5 min in 2 SSC buffer and RNA was UV crosslinked to the membrane. Membrane was blocked for 1 hour in PBST containing 5% non-fat milk and 0.1% Tween-20, followed by incubation with anti-m.sup.6A antibody (1:1000 dilution) overnight at 4 C. After extensive washing with 0.1% PBST 3 times, the membrane was incubated with HRP-conjugated anti-rabbit IgG (1:5000 dilution) for 1 hour. Membrane was visualized using enhanced chemiluminescence (ECL Plus, GE Healthcare).
Lentivirus Knockdown and Establishment of Stable Cell Lines
[0122] The Fto knockdown cell line was established using the Lenti-X shRNA Expression System. The Fto target sequence (5-GCTGAGGCAGTTCTGGTTTCA-3 (SEQ ID NO:47)) and scramble control (5-CCTAAGGTTAAGTCGCCCTCG-3 (SEQ ID NO:48)) were inserted into the pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro empty vector (Cellecta, Calif.). shRNA lentivirus was packaged by Lenti-X 293T cells according to the manufacturer's instructions. MEF cells were infected by the shRNA lentivirus for 48 hours before selection by puromycin at a dose of 1 g/ml. Because the lentiviral-based overexpression often leads to a slightly stressed cellular state compared to stable cell selection, slight increases in Hsp70 levels were often observed following massive protein overexpression. Thus, there is a mild increase in the basal translation rate of Hsp70 following GFP overexpression compared to stable cells expressing a scramble control shRNA (
UV Crosslinking of RNA Probes
[0123] .sup.32P-CTP labeled RNA probes were synthesized by in vitro transcription using MAXlscript T7 Kit (Life Technologies). Probe sequences used were as follows: 5-GGGACU.sub.(14)-3 (SEQ ID NO:49), 5-GGUACU.sub.(14)-3 (SEQ ID NO:50), 5-GGCAGU.sub.(15)-3 (SEQ ID NO:51), 5-GGGACU.sub.(13)-3 (SEQ ID NO:52), and 5-GU.sub.(5)GGACU.sub.(7)-3 (SEQ ID NO:53). Probes were purified using RNA Clean & Concentrator5 columns (Zymo Research), and A- and m.sup.6A-containing probes were ensured to have the same specific activity before performing the crosslinking assays. For identification of m.sup.6A RNA binding proteins, protein was first preincubated in 1 Binding buffer (10 mM HEPES pH 7.4, 140 mM KCl, 10 mM NaCl, 1 mM MgCl.sub.2, 0.01% NP-40, 5% Glycerol and poly-uridylic acid (100 nM, average size 150 nucleotides)) for 15 minutes at 25 C. and then with either m.sup.6A- or A-radiolabeled RNA probes (105 cpm, 1 nM) for another 15 minutes at 25 C. Equal amounts of protein were used for m.sup.6A- or A-containing RNA reactions. Binding reactions were then irradiated twice with UV at 254 nm (150 kJ/cm.sup.2) on a prechilled parafilm sheet on ice. Unbound RNA was digested with 50 Units of RNase If (NEB) at 37 C. for 30 minutes. Samples were then mixed with NuPAGE LDS Sample Buffer (4), heated at 95 C. for 5 minutes, and electrophoresed on 4-12% NuPAGE Novex Bis-Tris Protein Gels in 1 MES-SDS buffer. To visualize proteins, gel was stained with silver using Silver stain kit (Pierce) and documented on a Biorad gel imager. Radioactive signal from protein-linked, RNase-protected RNA was captured on a phosphor screen and documented using a phosphor imager.
eIF3 Protein/RNA Immunoprecipitation
[0124] HEK293T cells were transfected with plasmids expressing GFP or FLAG-tagged Fto using FuGene HD (Promega). 24 hours later, cells were washed once with ice cold 1 X PBS and UV crosslinked in a Stratalinker at 254 nm (150 kJ/cm.sup.2). Cells were then collected and spun down 500g, 2.5 minutes, 4 C. Pellets were collected and cells were lysed by addition of lysis buffer (50 mM Tris HCl, pH 7.4, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, Roche Protease Inhibitor added fresh) and then passed through a 21G needle ten times while maintaining the lysates on ice. 2 l of Turbo DNase and 10 l of RNase I (1:500 dilution in PBS) were then added, and lysates were incubated 3 minutes at 37 C. while shaking. Lysates were then placed back on ice and passed ten more times through a 21G needle and incubated 10 min on ice. Finally, lysates were clarified by centrifugation at 21,000g for 10 minutes. 10% of each supernatant was saved for RNA isolation from the input sample and the remainder was used for eIF3 immunoprecipitation.
[0125] For immunoprecipitation, 5 g of rabbit anti-eIF3A antibody (Abcam) was incubated with 25 l of Protein A/G magnetic beads (Pierce Biotechnology) for 45 minutes at room temperature, rotating. Beads were then washed 3 times in lysis buffer and lysates were added. Immunoprecipitation was performed for 1 hour at room temperature and 1 hour at 4 C. or overnight at 4 C. Beads were then washed 5 times in high salt buffer (50 mM Tris HCl, pH 7.4, 1 M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate) and RNA was eluted following 20 min incubation with Proteinase K at 37 C. and subsequent addition of Trizol LS for isolation of RNA. cDNA synthesis from IP and input RNA samples was performed using random hexamers and Superscript III reverse transcriptase according to the manufacturer's instructions (Life Technologies).
RNA Crosslinking and Immunoprecipitation
[0126] 400 g of Hela lysate (One-Step Human IVT Kit, Thermo Scientific) was crosslinked in 1 Binding buffer to A or m.sup.6A RNA probes (5-GGGACU.sub.(14)-3 (SEQ ID NO:54), 3*10.sup.5 cpm) in a 40 l crosslinking reaction as above. Crosslinking reactions were diluted to 500 l with ice-cold 1 PBS containing EDTA-free protease inhibitor (Roche). 2g of IgG control or anti-eIF3a, 3b, and ABCF1 were added and incubated at 4 C. for 12 hours on a shaker. Antigen-antibody complexes were bound to Protein AG beads (Thermo Scientific) and washed 3 times with WB500 buffer (20 mM HEPES pH 7.4, 500 mM NaCl, 0.1% NP-40) and 2 times with WB150 buffer (20 mM HEPES pH 7.4, 150 mM NaCl, 0.1% NP-40) at room temperature. Beads were suspended in 1 Binding buffer and subjected to RNase I digestion. Samples were denatured with NuPAGE LDS Sample Buffer (4), heated at 95 C. for 5 minutes, and electrophoresed on 4-12% NuPAGE Novex Bis-Tris Protein Gels in 1 MES-SDS buffer. Proteins were transferred to pure nitrocellulose membrane in 1 transfer buffer containing 20% methanol by wet-transfer method. Membrane was washed twice in 1 TB S-T and exposed to a phosphor screen. Radioactive signal from protein-linked, RNase-protected RNA was captured on a phosphor screen and documented using a phosphor imager. Western blot analysis was performed on the same membrane for different components of the eIF3 complex and ABCF1. Antibodies used for IP and/or western blotting were: goat IgG (sc-2028, Santacruz Biotechnology), rabbit IgG (sc-2027, Santacruz Biotechnology), rabbit anti-ABCF1 (ab190798, Abcam), goat anti-eIF3a (sc-22375, Santacruz Biotechnology), goat anti-eIF3b (sc-16377, Santacruz Biotechnology), mouse anti-eIF3k (sc-393234, Santa Cruz Biotechnology). To visualize proteins, the membrane was stained with Amido black.
eIF3a/m.sup.6A Overlap Analysis
[0127] eIF3a PAR-iCLIP site clusters were identified with Pyicoclip (Althammer et al., A Versatile Toolkit for the Analysis of High-Throughput Sequencing Data, Bioinformatics 27:3333-3340 (2011) and Raj et al., A Global Regulatory Mechanism for Activating an Exon Network Required for Neurogenesis, Mol. Cell 56:90-103 (2014), which are hereby incorporated by reference in their entirety) and pooled for replicate samples. Overlap between eIF3a PAR-iCLIP site clusters within 5UTRs and m.sup.6A sites within 5UTRs was computed using a non-parametric test based on 100 random shufflings of eIF3a clusters. These random shufflings were performed within the same 5UTR regions (as annotated using RefSeq genes) where the eIF3a PAR-iCLIP site clusters occur, so as to avoid any bias introduced by shuffling in regions outside of 5UTRs. Single-nucleotide m.sup.6A sites were obtained from Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015) (which is hereby incorporated by reference in its entirety).
Distance Analysis of eIF3a and m.sup.6A Sites
[0128] For eIF3A binding site and m.sup.6A site distance plots, genomic coordinates (hg19) of single-nucleotide m.sup.6A sites in 5UTRs were expanded upstream and downstream by 200 nucleotides and then divided into 10 nucleotide bins. For each bin, a mean eIF3a read count was obtained which was derived from the eIF3a PAR-iCLIP clusters common to the two iCLIP biological replicates (clusters were called individually first for each replicate using pyicoclip (p<0.0001), and an intersection of the called clusters, representing high-confidence eIF3A RNA binding regions, was then used). The sum of mean read counts for each bin was then plotted. For the control (random As) dataset, a python script was used to generate the same number of random genomic coordinates as m.sup.6A sites. These random coordinates were obtained from the same 5UTR sequences that the m.sup.6A sites were derived from. Bed files were processed using Bedtools, and the plot was plotted in R using R Studio. Enrichment of mean read counts at 0+/10 nucleotide distance from m.sup.6A sites was compared to the average of mean read counts generated from the randomly generated A sites (100 iterations) using a one sample t-test. Read coverage around one set of the randomly generated A sites is shown in the graph.
Comparison of eIF3 PAR-CLIP/iCLIP Replicates and Datasets
[0129] Correlation of mapped unique reads between the two eIF3A PAR-iCLIP replicates was determined for 25,000 randomly chosen genomic bins in 100 nucleotide windows across the human genome. Mean read counts in RPM (reads per million uniquely mapped reads) for each window were plotted on a scatterplot for each replicate. Association between replicates was tested using Pearson's correlation test in R. Analysis of the correlation between replicates 2 and 3 (SRR1761289 and SRR1761290, respectively) of the eIF3 PAR-CLIP dataset published by Lee et al.,eIF3 Targets Cell-Proliferation Messenger RNAs for Translational Activation or Repression, Nature 522:111-114 (2015) (which is hereby incorporated by reference in its entirety) was performed similarly, with 100 nt windowed bins including only those with RPM>1 in order to analyze RNAs present in both replicates. Comparison of eIF3a PAR-iCLIP data to eIF3 PAR-CLIP data (Lee et al., eIF3 Targets Cell-Proliferation Messenger RNAs for Translational Activation or Repression, Nature 522:111-114 (2015), which is hereby incorporated by reference in its entirety) was performed in the same manner as the comparison between the eIF3 PAR-CLIP replicates.
m.SUP.6.A Profiling and Analysis
[0130] m.sup.6A profiling was performed as described to detect m.sup.6A sites at single nucleotide-resolution (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety). Analysis of m.sup.6A profiling datasets from Dominissini et al., Topology of the Human and Mouse m.sup.6A RNA Methylomes Revealed by m.sup.6A-Seq., Nature 485:201-206 (2012), which is hereby incorporated by reference in its entirety, was done using the MACS peak calling software. Annotation of bed files and metagene profiling was performed as described in Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015) (which is hereby incorporated by reference in its entirety).
Gene Ontology (GO) Analysis
[0131] GO functional annotation was performed using DAVID Bioinformatics Resources (Huang et al., Systemic and Integrative Analysis of Large Gene Lists Using DAVID Bioinformatics Resources, Nat. Protoc. 4:44-57 (2009), which is hereby incorporated by reference in its entirety) with a p-value threshold of 0.01. All m.sup.6A-containing mRNAs were used as the background gene list.
Example 1
Ribosomal Initiation Complexes Assemble on m.SUP.6.A-Containing mRNAs Independently of the Cap-Binding Protein eIF4E
[0132] Although m.sup.6A is predominantly localized near stop codons and in 3UTRs in several thousand mRNAs, hundreds of cellular mRNAs contain m.sup.6A within their 5UTR (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015) and Meyer et al., Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3 UTRs and Near Stop Codons, Cell 149:1635-1646 (2012), which are hereby incorporated by reference in their entirety), and the function of these m.sup.6A residues is unknown. Since the 5 UTR is important in regulating translation initiation, the possibility that 5 UTR -localized m.sup.6As might influence this process was considered. On most eukaryotic mRNAs, translation begins with assembly of a 43S preinitiation complex, comprising a 40S ribosomal subunit, a eukaryotic initiation factor 2 (eIF2)-GTP/Met-tRNA.sub.i.sup.Met ternary complex, and elFs 3, 1 and 1A (Jackson et al., The Mechanism of Eukaryotic Translation Initiation and Principles of its Regulation, Nat. Rev. Mol. Cell Biol. 11:113-127 (2010), which is hereby incorporated by reference in its entirety). 43S complexes are typically recruited to mRNA by a cap-binding complex, eIF4F. eIF4F has three subunits: eIF4E, which binds the m.sup.7G 5 cap; eIF4A, an RNA helicase; and eIF4G a scaffold that also binds eIF3, thereby recruiting the 43S complex. After attachment, 43S complexes scan to the initiation codon where they form 48S initiation complexes (Jackson et al., The Mechanism of Eukaryotic Translation Initiation and Principles of its Regulation, Nat. Rev. Mol. Cell Biol. 11:113-127 (2010), which is hereby incorporated by reference in its entirety).
[0133] To investigate the effect of m.sup.6A on translation initiation, a 48S in vitro reconstitution approach was used, in which ribosomal complexes are assembled on mRNA 5UTRs using purified translational components (40S subunits, initiation factors and Met-tRNA.sub.i.sup.Met) (Pestova et al., The Roles of Individual Eukaryotic Translation Initiation Factors in Ribosomal Scanning and Initiation Codon Selection, Genes Dev. 16:2906-2922 (2002), which is hereby incorporated by reference in its entirety). Formation of the 48S complex at the start codon is then monitored by reverse transcriptase-mediated extension of a [.sup.32P]-labeled primer annealed to ribosome-bound mRNA. cDNA synthesis is arrested by the 40S ribosome subunit, yielding characteristic toe-prints at its leading edge, +15-17 nucleotides downstream of the initiation codon. This assay can identify the initiation factors and sequence features of 5UTRs which are required for initiation and has been used in mechanistic studies of viral internal ribosome entry sites (IRESs) (Pestova et al., Translation Elongation after Assembly of Ribosomes on the Cricket Paralysis Virus Internal Ribosomal Entry Site Without Initiation Factors or Initiator tRNA, Genes Dev. 17:181-186 (2003), which is hereby incorporated by reference in its entirety).
[0134] To test the role of m.sup.6A in 48S complex formation, toe-printing with 5-capped mRNAs comprising the 54 nucleotide-long -globin 5 UTR followed by a short coding sequence, stop codon, and 3UTR was performed. Consistent with previous studies (Pestova et al., The Roles of Individual Eukaryotic Translation Initiation Factors in Ribosomal Scanning and Initiation Codon Selection, Genes Dev. 16:2906-2922 (2002), which is hereby incorporated by reference in its entirety), 48S initiation complexes were detected at the start codon of A-containing mRNA in the presence of the complete set of elFs (1, 1A, 2, 3, 4A, 4B, 4F), and omission of group 4 elFs nearly abrogated 48S complex formation (
[0135] When mRNAs in vitro transcribed to contain 50% m.sup.6A were used, it was found that 48S complexes readily assembled after addition of the complete set of elFs, as was seen with unmethylated mRNA. However, unlike the unmethylated mRNA, 48S complexes formed on m.sup.6A-containing mRNA even in the absence of group 4 elFs (
[0136] To further establish the factor requirements for initiation on m.sup.6A-containing mRNA, each initiation factor was selectively omitted prior to performing toe-printing. These experiments show that efficient initiation on m.sup.6A-containing mRNA only requires the presence of elFs1, 1A, 2, 3, and the 40S subunit (
Example 2
m.SUP.6.A Enables Translation in a 5 Cap-Independent Manner in Cell-Free Extracts
[0137] It was next asked if m.sup.6A induces eIF4E-independent translation in cell-free extracts. To investigate this, HeLa extract which has low eIF4E activity (Mikami et al., An Efficient Mammalian Cell-Free Translation System Supplemented with Translation Factors, Protein Expr. Purif. 46:348-357 (2006), which is hereby incorporated by reference in its entirety) (
[0138] HeLa extracts were next used to determine if transcripts containing m.sup.6A require eIF4E. In contrast to the mRNA containing exclusively A, 5-capped mRNA containing 50% m.sup.6A was readily translated even in the absence of added eIF4E (
Example 3
A Single m.SUP.6.A is Sufficient to Induce Cap-Independent Translation
[0139] Since the mRNAs used in the in vitro translation assays have m.sup.6A throughout the transcript, it is unclear if the translational effects are due to m.sup.6A in the 5UTR or elsewhere in the mRNA. To determine the contributions of specific m.sup.6A residues to cap-independent translation, mRNAs that only contain m.sup.6A in the coding sequence were examined. Uncapped, luciferase-encoding mRNAs which contained zero m.sup.6A residues within the 5 UTR showed no translation, indicating that m.sup.6A residues in the coding sequence are unable to induce cap-independent translation (
[0140] To determine if a single 5 UTR m.sup.6A residue can promote cap-independent translation, uncapped luciferase-encoding mRNAs which contain m.sup.6A as the first transcribed nucleotide was used. This mRNA contains a single m.sup.6A residue in the 5 UTR, and the remainder of the A's within the transcript are unmethylated. For mRNAs lacking m.sup.6A, negligible luciferase synthesis were detected (
[0141] To determine whether m.sup.6A-mediated cap-independent translation is a specific effect caused by the presence of m.sup.6A, uncapped luciferase transcripts containing A, m.sup.6A, or other modified nucleotides, such as N.sup.1-methyladenosine, 2-O-methyladenosine, pseudouridine, and 5-methylcytosine were synthesized. In each case, there was negligible luciferase synthesis unless m.sup.6A was present (
[0142] The effect of m.sup.6A reflects impaired base pairing caused by modification of the N.sup.6 position (Roost et al., Structure and Thermodynamics of N(6)-Methyladenosine in RNA: A Spring-Loaded Base Modification, J. Am. Chem. Soc. 137:2107-2115 (2015), which is hereby incorporated by reference in its entirety) was next evaluated. However, mRNA containing N.sup.6-propargyladenosine, which contains a slightly larger modification compared to a methyl group at the 1V.sup.6 position, failed to undergo cap-independent translation (
Example 4
m.SUP.6.A-Induced Translation Initiation Occurs Through a 5 End-Dependent Mechanism
[0143] Results described herein indicate that m.sup.6A residues within the 5 UTR are capable of promoting cap-independent translation. However, the majority of m.sup.6A residues are found in the coding sequence and 3UTR (Meyer et al., Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3 UTRs and Near Stop Codons, Cell 149:1635-1646 (2012), which is hereby incorporated by reference in its entirety). Therefore, it was investigated whether these internal m.sup.6A residues can induce internal ribosome entry. To test this, an m.sup.6A-containing -globin mRNA in which the wild-type AUG initiation codon was removed and two new AUG triplets were introduced upstream and downstream of the native position (
[0144] Next, HeLa cell lysates were used to in vitro translate a GFP reporter mRNA containing an internal near-Kozak AUG in addition to the natural AUG encoding full-length GFP. However, m.sup.6A-mediated translation of the 17 kDa product produced from the internal AUG was not observed, and instead robust translation of the full-length protein produced from the first AUG was observed (
[0145] The selective use of the first AUG for translation initiation suggests a model of m.sup.6A-mediated initiation that involves a 5 end-dependent scanning mechanism as opposed to internal ribosomal entry. A similar mode of initiation, which is also cap-independent but shows 5-end dependence, was recently described for mRNA containing in its 5 UTR an eIF4G-binding viral IRES-domain (Terenin et al., A Novel Mechanism of Eukaryotic Translation Initiation that is Neither m7G-cap-, nor IRES-Dependent, Nucleic Acids Res. 41:1807-1816 (2013), which is hereby incorporated by reference in its entirety). Additionally, cap-independent 5 end-dependent mechanisms of translation initiation have previously been observed in assays using rabbit reticulocyte lysates (De Gregorio et al., Translational Activation of Uncapped mRNAs by the Central Part of Human eIF4G is 5 End-Dependent, RNA 4(7):828-36 (1998), which is hereby incorporated by reference in its entirety). To test directly whether m.sup.6A promotes entry through the 5 end, an uncapped, luciferase-encoding mRNA that contains a stable hairpin at the extreme 5 end of the mRNA to block 5 end-dependent ribosome entry was used. The presence of this hairpin markedly reduced the robust translation of m.sup.6A-containing mRNA which is normally observed (
Example 5
eIF3 Selectively Binds m.SUP.6.A-Containing RNA
[0146] How m.sup.6A is recognized to induce translation of mRNAs was next investigated. The in vitro 48S reconstitution assays showed that recruitment of the 43S preinitiation complex to m.sup.6A-containing mRNA only requires elFs 1, 1A, 2, and 3, and the 40S subunit. Thus, one of these components binds m.sup.6A.
[0147] To test which of these factors interacts with m.sup.6A, applicants used an m.sup.6A crosslinking assay in which a [.sup.32P]-labeled RNA probe containing a single A or m.sup.6A in its naturally-occurring GAC context was UV-crosslinked to each translational component. Crosslinked proteins were then detected by SDS-PAGE and autoradiography.
[0148] elFs 1, 1A, 2 and the 40S subunit showed equal levels of crosslinking to the A- and m.sup.6A-containing probes (
[0149] The preferential binding of eIF3 to m.sup.6A was not affected by changing the position of the m.sup.6A together with its context nucleotides within the probe (
[0150] eIF3 is a large multiprotein complex comprising 13 subunits (a-m) (des Georges et al., Structure of Mammalian eIF3 in the Context of the 43S Preinitiation Complex, Nature 525:491-495 (2015), which is hereby incorporated by reference in its entirety) that interacts with mRNA in 48S complexes (Pisarev et al., Ribosomal Position and Contacts of mRNA in Eukaryotic Translation Initiation Complexes, EMBO 1 27:1609-1621 (2008), which is hereby incorporated by reference in its entirety). UV-crosslinking studies showed that the interaction between eIF3 and RNA occurs at a multi-subunit interface (Lee et al.,eIF3 Targets Cell-Proliferation Messenger RNAs for Translational Activation or Repression, Nature 522:111-114 (2015), which is hereby incorporated by reference in its entirety). Similarly, in crosslinking assays, the m.sup.6A-containing probe induced strong labeling of several protein bands, ranging in molecular weight from 60 to 160 kDa (
[0151] To further explore the binding of m.sup.6A-containing RNA to eIF3, HeLa cellular lysates were used. Crosslinking using a radioactive m.sup.6A-containing RNA probe resulted in the labeling of specific protein bands that were increased relative to the A-containing probe (
[0152] The m.sup.6A binding protein, YTHDF1, interacts with a diverse set of proteins, including eIF3 (Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which is hereby incorporated by reference in its entirety). Thus, the possibility that recruitment of eIF3 to m.sup.6A-containing RNA in the in vitro translation and crosslinking assays is mediated by a YTH-family m.sup.6A-binding protein was considered. However, silver staining of all the initiation factors used in the toe-printing assays failed to show protein bands in the 60-64 kD range of these proteins (
[0153] To determine whether eIF3 binds m.sup.6A in cells, PAR-iCLIP was performed to identify zero-distance binding sites of eIF3 in cellular mRNAs. eIF3a binding sites were primarily localized to 5 UTRs of mRNAs and showed a high degree of overlap with eIF3 binding sites reported previously (Lee et al.,eIF3 Targets Cell-Proliferation Messenger RNAs for Translational Activation or Repression, Nature 522:111-114 (2015), which is hereby incorporated by reference in its entirety) (
[0154] To determine whether eIF3a binds to sites of m.sup.6A in 5 UTRs, the overlap of eIF3a binding sites with m.sup.6A residues mapped at single nucleotide-resolution in 5 UTRs was evaluated (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety). To test this, a permutation-based approach in which eIF3a binding sites were randomized while preserving the distribution and positional bias of eIF3a PAR-iCLIP tags in 5 UTRs was used. Multiple permutations (n>100) were used, and the statistical significance of overlap between eIF3 PAR-iCLIP sites and m.sup.6A residues was evaluated. A statistically significant overlap between m.sup.6A residues and eIF3 binding sites in 5 UTRs was found, with 35% of 5 UTR m.sup.6A residues overlapping with eIF3 sites (
[0155] To further test the physiological association of eIF3 and m.sup.6A predicted by the PAR-iCLIP analysis, eIF3 protein/RNA immunoprecipitation from HEK293 cells expressing the m.sup.6A-demethylating enzyme was performed (Jia et al., N6-Methyladenosine in Nuclear RNA is a Major Substrate of the Obesity-Associated FTO, Nat. Chem. Biol. 7(12):885-7 (2011), which is hereby incorporated by reference in its entirety). The abundance of target mRNA 5 UTRs in the eIF3-bound fraction was then measured using RT-qPCR with primers that amplify the 5 UTR regions containing the residue. mRNAs that contain a high stoichiometry m.sup.6A site within their 5 UTR (Meyer et al., Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3 UTRs and Near Stop Codons, Cell 149:1635-1646 (2012), which is hereby incorporated by reference in its entirety), were substantially depleted in the eIF3-bound fraction following Fto overexpression (
Example 6
m.SUP.6.A Within the 5 UTR Promotes Translation of Cellular mRNAs
[0156] To address whether mRNAs that contain 5 UTR m.sup.6A residues possess enhanced translation in cells, ribosome profiling-based measurements of mRNA TE in HeLa cells depleted of the m.sup.6A methyltransferase enzyme, METTL3, which results in depletion of all m.sup.6A residues in cells (Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which is hereby incorporated by reference in its entirety) were examined. The TE of mRNAs based on the location of their m.sup.6A residues identified by single nucleotide-resolution m.sup.6A mapping was examined (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety). Compared to mRNAs that lack m.sup.6A, transcripts which contain m.sup.6A residues within the coding sequence or 3 UTR were found to show no significant change in TE in METTL3-depleted cells (
Example 7
Heat Shock-Induced Translation of Hsp70 is Mediated by 5 UTR m.SUP.6A
[0157] The role of m.sup.6A in promoting cap-independent translation in cells was next investigated. Since cellular translation involves both cap-dependent and cap-independent mechanisms, heat shock, was taken advantage of which induces a stress response that suppresses most cap-dependent translation (Holcik et al., Translational Control in Stress and Apoptosis, Nat. Rev. Mol. Cell. Biol. 6:318-327 (2005), which is hereby incorporated by reference in its entirety). Heat-shock protein 70 (HSP70) is a stress response mRNA known to undergo increased transcription and cap-independent translation following heat shock (Lindquist et al., The Heat-Shock Proteins, Annu. Rev. Genet. 22:631-677 (1988), which is hereby incorporated by reference in its entirety). Previous studies demonstrated that HSP70 contains an m.sup.6A site within its 5 UTR (Schwartz et al., Perturbation of m6A Writers Reveals Two Distinct Classes of mRNA Methylation at Internal and 5 Sites, Cell Rep. 8:284-296 (2014), which is hereby incorporated by reference in its entirety), and that methylation of the HSP70 5 UTR is increased following heat shock (Dominissini et al., Topology of the Human and Mouse m6A RNA Methylomes Revealed by m6A-Seq., Nature 485:201-206 (2012), which is hereby incorporated by reference in its entirety). However, the role of m.sup.6A in cap-independent translation of HSP70 is not understood.
[0158] To test the effect of m.sup.6A in HSP70 translation, altered expression of Fto was used to influence m.sup.6A levels within the Hsp70 5 UTR. Knockdown of Fto resulted in a 60% increase in m.sup.6A levels in Hsp70 mRNA in heat-shocked cells (
[0159] Consistent with the effects of Fto knockdown on Hsp70 levels, Fto overexpression caused significantly reduced Hsp70 protein production 4 and 6 hours after heat shock (
Example 8
Transcriptome-Wide Redistribution of m.SUP.6.A Following Cellular Stress
[0160] It was next sought to further understand the importance of 5 UTR m.sup.6A residues in response to cellular stress. Based on findings with Hsp70 mRNA, the possibility that heat shock may alter the transcriptome-wide distribution of m.sup.6A was considered. Under basal conditions, most m.sup.6A residues are located in mRNAs near the stop codon, with markedly fewer m.sup.6A residues in 5 UTRs. To determine if cellular stress alters the characteristic distribution of m.sup.6A, cells were subjected to heat shock and mapped m.sup.6A residues using miCLIP, a method for single-nucleotide resolution detection of m.sup.6A sites (Linder et al., Single-Nucleotide-Resolution Mapping of m.sup.6A and m.sup.6Am Throughout the Transcriptome, Nat. Methods 12(8):767-72 (2015), which is hereby incorporated by reference in its entirety). Remarkably, the metagene analysis showed a marked enrichment of m.sup.6A in the 5 UTR in heat-shocked cells compared to control cells (
[0161] To further examine this phenomenon, existing transcriptome-wide m.sup.6A mapping datasets that were performed in stressed cells and control cells were examined. These include HepG2 cells treated with UV, interferon-y, and heat shock (Dominissini et al., Topology of the Human and Mouse m6A RNA Methylomes Revealed by m6A-Seq., Nature 485:201-206 (2012), which is hereby incorporated by reference in its entirety). Metagene analyses showed prominent increases in the level of 5 UTR m.sup.6A in both the UV-treated and heat shocked cells (
[0162] Intriguingly, both heat shock and UV caused increased 5 UTR methylation in mRNAs that belong to common functional pathways, including phosphorylation and cell cycle regulation. Collectively, these results indicate that activation of some stress-response pathways causes a global reshaping of the cellular mRNA methylome and suggest that increased 5 UTR methylation may be a general component of the response to select cellular stresses.
Discussion of Examples 1-8
[0163] Eukaryotic mRNAs can be translated in both cap-dependent and cap-independent modes, although the mechanisms of translation initiation that do not require the 5 cap and eIF4E have been poorly understood. Examples 1-8 show that m.sup.6A residues within the 5 UTR can act as an m.sup.6A-induced ribosome engagement site, or MIRES, which promotes cap-independent translation of mRNA. A single m.sup.6A in the 5 UTR of mRNAs is sufficient to promote MIRES activity in cell-free extracts, whereas m.sup.6A residues outside the 5 UTR fail to show this effect. The significance of 5 UTR m.sup.6A residues is further seen in both ribosome profiling data sets and in individual cellular mRNAs in conditions where cap-dependent translation is suppressed. These results point to 5 UTR m.sup.6A as a mechanism for mRNAs to bypass the cap requirement for translation and suggest a potential role for this class of m.sup.6A residues in mediating translational responses induced in diverse cellular stress states.
[0164] A role for m.sup.6A in promoting translation initiation is supported by the finding that METTL3 depletion leads to a large reduction in translation efficiency of mRNAs containing 5 UTR m.sup.6A residues compared to mRNAs which contain m.sup.6As elsewhere. Although cap-independent translation of cellular mRNAs may also be mediated by m.sup.6A-independent pathways, including direct recruitment of ribosomes to internal 5 sequence or structural elements (Xue et al., RNA Regulons in Hox 5 UTRs Confer Ribosome Specificity to Gene Regulation, Nature 517:33-38 (2015), which is hereby incorporated by reference in its entirety), these studies suggest that an eIF4E-independent mode of translation initiation can be switched on or off by reversible methylation of adenosine residues in the 5 UTR of mRNAs.
[0165] These studies show that cap-independent translation mediated by m.sup.6A requires a novel m.sup.6A reader, eIF3, and that many eIF3-binding sites in the transcriptome occur at m.sup.6A sites in 5 UTRs. The identification of eIF3 was originally suggested by the finding that the 48S complex can be assembled on m.sup.6A-containing RNA using only eIF1, eIF1A, eIF2, eIF3 and the 40S subunit. Of these components, eIF3 shows selective interaction with m.sup.6A both in vitro and in cells. By binding eIF3, 5 UTR m.sup.6A residues can stimulate translation initiation by directly recruiting the 43S preinitiation complex to the 5 UTR of mRNAs.
[0166] m.sup.6A has diverse effects on mRNAs, including mRNA destabilization and translational enhancement, although these effects are mediated by m.sup.6A near stop codons or in 3UTRs (Wang et al., N6-Methyladenosine-Dependent Regulation of Messenger RNA Stability, Nature 505:117-120 (2014a) and Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which are hereby incorporated by reference in their entirety). In the case of m.sup.6A near stop codons or in 3 UTRs, translational enhancement is mediated by YTHDF1, which binds to select transcripts at m.sup.6A sites in their 3 UTRs (Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which is hereby incorporated by reference in its entirety). YTHDF1 binds numerous proteins, including eIF3 and other ribosome-associated proteins, which are proposed to be recruited to 3 UTRs to influence cap-dependent translation initiation (Wang et al., N(6)-Methyladenosine Modulates Messenger RNA Translation Efficiency, Cell 161:1388-1399 (2015), which is hereby incorporated by reference in its entirety). This is in contrast to the mechanism of 5 UTR m.sup.6A, which directly recruits eIF3 and assembles translation initiation complexes in the 5 UTR without cap-binding proteins. Analysis of ribosome profiling data from YTHDF1-depleted cells further indicates that 5 UTR m.sup.6A residues promote translation through a YTHDF1-independent mechanism. Thus, m.sup.6A exhibits markedly distinct effects on mRNA based on its location in transcripts.
[0167] A long-standing question is the mechanism by which select cellular mRNAs undergo cap-independent translation during conditions where cap-dependent translation is suppressed (Holcik et al., Translational Control in Stress and Apoptosis, Nat. Rev. Mol. Cell. Biol. 6:318-327 (2005), which is hereby incorporated by reference in its entirety). A prevailing hypothesis has been that these mRNAs contain cellular IRESs that promote cap-independent translation (Komar et al., Cellular IRES-Mediated Translation: The War of ITAFs in Pathophysiological States, Cell Cycle 10:229-240 (2011), which is hereby incorporated by reference in its entirety). However, putative cellular IRESs often lack the complex structural elements seen in viral IRESs (Hellen et al., Internal Ribosome Entry Sites in Eukaryotic mRNA Molecules, Genes Dev. 15:1593-1612 (2001), which is hereby incorporated by reference in its entirety). As a result of this discrepancy, and because of flaws inherent to many assays which test cellular IRES function, the evidence for and against cellular IRESs is a frequent topic of debate (Gilbert et al., Alternative Ways to Think About Cellular Internal Ribosome Entry, J. Biol. Chem. 285:29033-29038 (2010), which is hereby incorporated by reference in its entirety). Given the prevalence of m.sup.6A within 5 UTRs, their translation-promoting activity represents an additional or perhaps alternative mechanism for mediating cap-independent translation.
[0168] The importance of 5 UTR m.sup.6A residues is supported by their selective upregulation in response to specific forms of stress. This m.sup.6A stress response points to the importance of this subset of m.sup.6A residues, which Examples 1-8 show are linked to cap-independent translation. Notably, other forms of stress regulate translation through the integrated stress response (Ron, Translational Control in the Endoplasmic Reticulum Stress Response, J. Clin. Invest. 110:1383-1388 (2002), which is hereby incorporated by reference in its entirety). It will be important to determine if 5 UTR m.sup.6A-mediated translation is an alternative mechanism to orchestrate translational responses to stress.
Materials and Methods for Example 9
Cell Lines and Reagents
[0169] MEF cells tested negative for mycoplasma contamination. Cells were maintained in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum (FBS).
Construction of 5 UTR
[0170] The Fluc reporter with Hsp70 5 UTR has been reported previously (Sun et al., P13K-mTORC1 Attenuates Stress Response by Inhibiting Cap-Independent Hsp70 Translation, J. Biol. Chem. 286:6791-6800 (2011), which is hereby incorporated by reference in its entirety). For Fluc reproters bearing other 5 UTRs, the following primers were used for 5 UTR cloning (Zhou et al., Dynamic m6A mRNA Methylation Directs Translational Control of Heat Shock Response, Nature 526:591-594 (2015), which is hereby incorporated by reference in its entirety).
TABLE-US-00004 Hsc70(HSPA8): Forward: (SEQIDNO:55) 5-CCCAAGCTTGGTCTCATTGAACGCGG-3 Reverse: (SEQIDNO:56) 5-CGGGATCCCCTTAGACATGGTTGCTT-3 Tubulin(TUBG2): Forward: (SEQIDNO:57) 5-GGCAAGCTTTGCGCCTGTGCTGAATTCCAGCTGC-3 Reverse: (SEQIDNO:58) 5-GGCGGATCCGCATCGCCGATCAGACCTAG-3.
In Vitro Transcription
[0171] Plasmids containing the corresponding 5 UTR sequences of mouse HSPA1A and full-length firefly luciferase were used as templates. Transcripts with normal m.sup.7G cap were generated using the mMessage mMachine T7 Ultra kit (Ambion) and transcripts with non-functional cap analogue GpppA were synthesized using MEGAscript T7 Transcription Kit (Ambion). To obtain mRNAs with the adenosine replaced with m.sup.6A, in vitro transcription was conducted in a reaction in which 5% of the adenosine was replaced with N.sup.6-Methyladenosine. All mRNA products were purified using the MEGAclear kit (Ambion) according to the manufacturer's instructions.
In Vitro Translation
[0172] In vitro translation was performed using the Rabbit Reticulocyte Lysate System (Promega) according to the manufacturer's instructions. Luciferase activity was measured using a luciferase reporter assay system (Promega) on a Synergy HT Multi-detection Microplate Reader (BioTek Instruments).
Real-Time Luciferase Assay
[0173] Cells grown in 35-mm dishes were transfected with in vitro-synthesized mRNA containing the luciferase gene. Luciferase substrate D-luciferin (1 mM, Regis Tech) was added into the culture medium immediately after transfection. Luciferase activity was monitored and recorded using Kronos Dio Luminometer (Atto).
RNA Splint Ligation
[0174] The ligation method was optimized from previous reports (Kershaw et al., Splint Ligation of RNA with T4 DNA Ligase, Methods Mol. Biol. 941:257-269 (2012); Stark et al., An RNA Ligase-Mediated Method for the Efficient Creation of Large, Synthetic RNAs, RNA 12:2014-2019 (2006); and Maroney et al., Direct Detection of Small RNAs Using Splinted Ligation, Nature Protocols 3:279-287 (2008), which are hereby incorporated by reference in their entirety). The RNA oligonucleotide covering the 82-117 nucleotide region of HSPA1A was synthesized by Thermo Scientific, whereas RNA fragments corresponding to other regions were generated by in vitro transcription. For sequential splint ligation, two DNA bridging oligonucleotides were designed (Zhou et al., Dynamic m.sup.6A mRNA Methylation Directs Translational Control of Heat Shock Response, Nature 526:591-594 (2015), which is hereby incorporated by reference in its entirety):
[0175] 18733639
[0176] DNA Bridge 1: 5-GGTCCTGGCCGAGGATCGGGAACGCGCCGCTCGCTC-3 (SEQ ID NO:59);
[0177] DNA Bridge 2: 5-CTCCGCGGCAGGGATGCTCTGGGGAAGGCTGGTCCT-3 (SEQ ID NO:60). For 3 RNA oligonucleotide (donor) phosphorylation, 1 l of 10 PNK buffer, 6 l of ATP (10 mM), 0.5 l of RNasin (20 units) and 1l of T4 PNK (5 units). The reaction mixture was incubated at 37 C. for 30 minutes followed by inactivation of T4 PNK at 65 C. for 20 minutes. Next, the DNA bridge oligonucleotide was hybridized with the 3 RNA oligonucleotide and the 5 RNA oligonucleotide (acceptor) at a 1:1.5:2 ratio (5 RNA bridge: 3 RNA). Oligonucleotides were annealed (95 C. for 1 minute followed by 65 C. for 2 minutes and 37 C. for 10 minutes) in the presence of 1 T4 DNA dilution buffer. To ligate the 5 and 3 RNA together, T4 DNA ligase and the T4 DNA ligation buffer were added and the reaction mixture was incubated at 37 C. for 1 hour. The ligation was stopped by adding 1 l of 0.5 M EDTA followed by phenol-chloroform extraction and ethanol precipitation. Ligation products were analyzed by 10% TBE-Urea gels or formaldehyde gels. The expected RNA ligation products in TBE-Urea gels were eluted in RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, and 0.1 U l.sup.1 SUPERase In) followed by ethanol precipitation. The final products in formaldehyde gels were isolated by Zymoclean Gel RNA Recovery Kit (Zymo Research).
Example 9
Selective 5 UTR m6A Modification Mediates Cap-independent Translation
[0178] It is commonly believed that the 5 UTR of Hsp70 mRNA recruits the translational machinery via an internal ribosome entry site (IRES) (McGarry et al., The Preferential Translation of Drosophila Hsp70 mRNA Requires Sequence in the Untranslated Leader, Cell 42:903-911 (1985); Klemenz et al., Selective Translation of Heat Shock mRNA in Drosophila melanogaster Depends on Sequence Information in the Leader, EMBO J. 4:2053-2060 (1985); Rubsova et al., Distinctive Properties of the 5-Untranslated Region of human Hsp70 mRNA, J. Biol. Chem. 278:22350-22356 (2003); and Sun et al., P13K-mTORC1 Attenuates Stress Response by Inhibiting Cap-Independent Hsp70 Translation, J. Biol. Chem. 286:6791-6800 (2011), which are hereby incorporated by reference in their entirety). However, conflicting results exist and the exact cap-independent translation-promoting determinants remain elusive (Sun et al., P13K-mTORC1 Attenuates Stress Response by Inhibiting Cap-Independent Hsp70 Translation, J. Biol. Chem. 286:6791-6800 (2011) and Zhang et al., Translational Control of the Cytosolic Stress Response by Mitochondrial Ribosomal Protein L18, Nature Struct. Mol. Biol. 22:404-410 (2015), which are hereby incorporated by reference in their entirety). Given the fact that the normal 5 end cap structure is a methylated purine (N.sup.7-methylguanosine, m.sup.7G), it was hypothesized that the stress-induced m.sup.6A in the 5 UTR enables selective translation by acting as a functional cap substitute. To test this hypothesis, a firefly luciferase (Fluc) reporter assay was performed in MEF cells by transfecting mRNAs synthesized in the absence or presence of m.sup.6A (
[0179] The 5 UTR contains multiple A's, although not all of them are methylated. On the basis of the predicted m.sup.6A sequence motif, the A residue at the 103 position of Hsp70 mRNA is likely to be methylated. Using a single-nucleotide m.sup.6A detection method (Harcourt et al., Identification of a Selective Polymerase Enables Detection of N.sup.6-Methyladenosine in RNA, J. Am. Chem. Soc. 135:19079-19082 (2013), which is hereby incorporated by reference in its entirety), it was confirmed that the methylation event at this position upon heat shock stress (
Discussion of Example 9
[0180] Much of the current understanding of cap-independent translation is limited to the IRES mechanism (Pelletier et al., Internal Initiation of Translation of Eukaryotic mRNA Directed by a Sequence Derived from Poliovirus RNA, Nature 334:320-325 (1988) and Hellen et al., Internal Ribosome Entry Sites in Eukaryotic mRNA Molecules, Genes Dev. 15:1593-1612 (2011), which are hereby incorporated by reference in their entirety). However, beyond a few examples, many cellular genes capable of cap-independent translation do not seem to contain any IRES elements. The results presented here demonstrate a surprising role of m.sup.6A in mediating mRNA translation initiation independent of the normal m.sup.7G cap.
[0181] In contrast to the wide belief that m.sup.6A modification is static on mRNAs, it was found that 5 UTR methylation in the form of m.sup.6A is dynamic. Methylation often serves as a mark to distinguish self and foreign DNAs or parental and daughter DNA strands (Kunkel et al., DNA Mismatch Repair, Annu. Rev. Biochem. 74:681-710 (2005), which is hereby incorporated by reference in its entirety). The stress-inducible mRNA 5 UTR methylation permits ribosomes to distinguish nascent transcripts from pre-existing messages, thereby achieving selective mRNA translation (