Duplex stabilizing fluorescence quenchers for nucleic acid probes
10677728 ยท 2020-06-09
Assignee
Inventors
Cpc classification
C08L77/02
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
G01N21/6428
PHYSICS
C12Q2565/107
CHEMISTRY; METALLURGY
C12Q2565/1015
CHEMISTRY; METALLURGY
C12Q2565/1025
CHEMISTRY; METALLURGY
C12Q2565/1025
CHEMISTRY; METALLURGY
C07D403/10
CHEMISTRY; METALLURGY
C12Q2565/107
CHEMISTRY; METALLURGY
International classification
C07D403/10
CHEMISTRY; METALLURGY
C08L77/02
CHEMISTRY; METALLURGY
Abstract
Diaryl-azo derivatives are efficient fluorescence quenchers as well as nucleic acid duplex-stabilizing agents and are useful in oligonucleotide conjugates and probes. The oligonucleotide-quencher conjugates may be used in detection methods for nucleic acid targets.
Claims
1. A quencher reagent for oligonucleotide labeling having the formula: ##STR00117## wherein Ar.sup.1 and Ar.sup.2 are aromatic or hetero-aromatic moieties; X is hydroxyl, a leaving group, a linker with a functional group or a protected functional group, or a linker connected to a synthesis solid support; and n is from 1 to 3.
2. The quencher reagent of claim 1, wherein one or both of Ar.sup.1 and Ar.sup.2 are substituted with a reactive group, a linker with a functional group or a protected functional group, or a linker connected to a synthesis solid support.
3. The quencher reagent of claim 1, having the formula: ##STR00118## wherein Ar.sup.2 is an aromatic or hetero-aromatic ring with an exocyclic amino group.
4. The quencher reagent of claim 3, wherein the exocyclic amino group is substituted with one or two of an alkyl, a linker with a functional group or protected functional group, or a linker connected to a synthesis solid support.
5. The quencher reagent of claim 3, having the formula: ##STR00119## wherein X is hydroxyl, OPFP, or a leaving group.
6. A method for preparing an oligonucleotide conjugate labeled with a quencher, comprising: reacting an oligonucleotide with the quencher reagent of claim 1 to produce an oligonucleotide conjugate labeled with a quencher.
7. A method for preparing an oligonucleotide conjugate labeled with a quencher, comprising: reacting an oligonucleotide with the quencher reagent of claim 3 to produce an oligonucleotide conjugate labeled with a quencher.
8. A method for preparing an oligonucleotide conjugate labeled with a quencher, comprising: reacting an oligonucleotide with the quencher reagent of claim 5 to produce an oligonucleotide conjugate labeled with a quencher.
9. A quencher reagent for oligonucleotide labeling having the formula: ##STR00120## wherein Ar.sup.1 and Ar.sup.2 are aromatic or hetero-aromatic moieties; Y is NH, N-alkyl, N(CO)O-alkyl, NP, O, S, or Se, wherein P is a protecting group; R.sup.1 is H or an alkyl connecting with R.sup.2 to form a five-member ring; R.sup.2, R.sup.3, R.sup.4, and R.sup.5 are H, alkyl, aryl, heteroaryl, O-alkyl, O-aryl, NHR.sup.6, NHC(O)R.sup.6, F, Cl, or Br, wherein R.sup.6 is H, alkyl, aryl, heteroaryl, O-alkyl, O-aryl, F, Cl, or Br; X is hydroxyl, a leaving group, a linker with a functional group or a protected functional group, or a linker connected to a synthesis solid support; and n is from 1 to 3.
10. The quencher reagent of claim 9, wherein one or both of Ar.sup.1 and Ar.sup.2 are substituted with a reactive group, a linker with a functional group or a protected functional group, or a linker connected to a synthesis solid support.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
DETAILED DESCRIPTION
(33) Definitions
(34) The term diaryl-azo compounds or derivatives refers to diazene (HNNH) derivatives wherein both hydrogen atoms substituted with two aryl groups. For the purpose of this specification the term aryl encompasses the definitions of both terms aryl and heteroaryl.
(35) The term aromatic amino acid refers to an aromatic compound comprising an aromatic carboxylic and an aromatic amino group.
(36) The abbreviations MGB, Fl, Q, CPG and ODN refer to minor groove binder, fluorescent label or fluorophore, quencher, controlled pore glass (as an example of a solid support) and oligonucleotide moieties or molecules, respectively, and in a manner which is apparent from context.
(37) The term minor groove binder refers to a moiety that is capable of forming a complex (typically non-covalent) with the minor groove of DNA. The minor groove binders of the invention are oligonucleotide conjugates (or probes) as described in U.S. Pat. Nos. 5,801,155 and 6,312,894, both hereby incorporated by reference. These conjugates form hyper-stabilized duplexes with complementary DNA. In particular, sequence specificity of short minor groove binder probes is excellent for high temperature applications such as PCR. The probes/conjugates of the present disclosure can also have a covalently attached minor groove binder. A variety of suitable minor groove binders have been described in the literature (U.S. Pat. No. 5,801,155; Wemmer, D. E., and Dervan P. B. (1997; Walker et al. (1997), Biopolymers, 44:323-334 (1997); Zimmer, C & Wahnert, U., (1986) and Reddy, et al. (1999), Pharmacol. Therap., 84:1-111 (1999)).
(38) Suitable methods for attaching minor groove binders (as well as reporter groups such as fluorophores and quenchers) through linkers to oligonucleotides have also been described (U.S. Pat. Nos. RE 38,416; 5,512,667; 5,419,966; 5,696,251; 5,585,481; 5,942,610 and 5,736,626).
(39) The term fluorescent label or fluorophore refers to an organic moiety that is capable of absorbing and re-emitting light. Typically, fluorophores absorb light of certain wavelength range (excitation spectrum) and re-emitting it at a longer wavelength range (emission spectrum) with respective excitation and emission maxima. The fluorophores of the invention have excitation and emission maxima between 400 and 900 nm. Examples of these dye classes can be found in Haugland, et al., HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, SIXTH ED., Molecular Probes, Eugene, Oreg. 1996; Krasovitskii and Bolotin, ORGANIC LUMINESCENT MATERIALS, VCH Publishers, N.Y., 1988; Zolliger, COLOR CHEMISTRY, 2nd Edition, VCH Publishers, N.Y., 1991. Still other dyes are provided via online sites such as zeiss.com. Phosphonate dyes are disclosed in co-owned U.S. Pat. Nos. 7,671,218, 7,767,834 and 8,163,910B2
(40) The term quencher refers to an organic moiety that is capable of reducing the efficiency of light re-mission by a fluorophore. Quenchers have been disclosed in U.S. Pat. No. 3,996,345, in co-owned U.S. Pat. Nos. 6,727,356 and 6,790,945, and in Matayoshi et al., 1990.
(41) The term oligonucleotide refers to a fragment of natural or artificial nucleic acid or combination of thereof. Examples of artificial nucleic acids include analogs with modified sugar-phosphate backbone such as 2-OMe nucleic acid, peptide nucleic acid (PNA), locked nucleic acid (LNA), threose nucleic acid (TNA), glycol nucleic acid (GNA) (U.S. Pat. Nos. 5,539,082, 8,293,684 and 9,464,316). Artificial nucleic acid (U.S. Pat. No. 9,169,256) may also comprise modified nucleobases.
(42) The term modified nucleobases or modified bases refers to those bases that differ from the naturally-occurring bases (adenine, cytosine, guanine, thymine, and uracil) by addition or deletion of one or more functional groups, differences in the heterocyclic ring structure (i.e., substitution of carbon for a heteroatom, or vice versa), and/or attachment of one or more linker arm structures to the base. Modified bases include naturally-occurring and synthetic modifications and analogues of the major bases such as, for example, hypoxanthine, 2-aminoadenine, 2-thiouracil, 2-thiothymine, inosine, 5-N.sup.4-ethenocytosine, 4-aminopyrrazolo[3,4-d]pyrimidine and 6-amino-4-hydroxy-[3,4-d]pyrimidine. Any modified nucleotide or nucleotide analogue compatible with hybridization of probe with a nucleic acid conjugate to a target sequence is useful, even if the modified nucleotide or nucleotide analogue itself does not participate in base-pairing, or has altered base-pairing properties compared to naturally-occurring nucleotides. Examples of modified bases are disclosed in U.S. Pat. Nos. 7,045,610; 5,824,796; 6,127,121; 5,912,340; and PCT Publications WO 01/38584 and WO 01/64958, each of which is hereby incorporated herein by reference in its entirety. Preferred modified bases include 5-hydroxybutynyl uridine for uridine; 4-(4,6-Diamino-.sup.1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, 4-amino-.sup.1H-pyrazolo[3,4-d]pyrimidine, and 4-amino-.sup.1H-pyrazolo[3,4-d]pyrimidine for adenine; 5-(4-Hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione for thymine; and 6-amino-.sup.1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one for guanine. Particularly preferred modified bases are Super A: 4-(4,6-Diamino-1H-pyrazolo[3,4-d]pyrimidin-3-yl)-but-3-yn-1-ol, Super G: 4-hydroxy-6-amino pyrazolopyrimidine (elitechgroup.com) and Super T: 5-(4-hydroxy-but-1-ynyl)-1H-pyrimidine-2,4-dione. Super-D: 3-Alkynyl pyrazolopyrimidine analogues as universal bases are disclosed in U.S. Patent Application Publication No. 2012/0244535, incorporated by reference.
(43) The term linker and linking group refers to a moiety that is used to assemble various portions of the molecule or to covalently attach the molecule (or portions thereof) to a solid support. Typically, a linker or linking group has functional groups that are used to interact with and form covalent bonds with functional groups in the ligands or components (e.g., fluorophores, oligonucleotides, minor groove binders, or quenchers) of the oligonucleotide probes described and used herein. Additionally, a linker can include linear or acyclic portions, cyclic portions, aromatic rings or combinations thereof (U.S. Pat. Nos. 5,419,966; 5,696,251; 5,585,481; 5,942,610 and 5,736,626).
(44) The terms functional and reactive groups in this invention are used interchangeably and refer to chemical groups and moieties that are suitable for the formation of a chemical bond. They are exemplified but not limited to amines, oxyamines, hydrazines, hydrazides, semi-carbazides, semi-thiocarbazides, hydroxyl-substituted compounds, sulfur compounds (such as thiols, dithiols, thiocarbonyl compounds, phosphorothiates), carboxylates, phosphates, phosphonates, aromatic nitrogens (such as in pyridine), amide nitrogens, azides, electron-rich aromatics, etc.), acids (in the presence of activating agents), esters, imidoesters, anhydrides, acid chlorides, acyl azides, lactones, azlactones, isocyanates, isothiocyanates, o-acylisoureas, acid amides (such as acyl imidazolides or phosphoramidites), carbonyl compounds, halogenated hydrocarbons, halogenated aromatics (such as triazine chloride, electron-deficient fluoroaromatics), unsaturated hydrocarbons, aromatic diazonium salts, epoxides, aziridines. Other types of functional or reactive groups include photo-reactive (azides, benzophenones, diazirines, etc.), metal chelating groups (aminodiacetic acid), substrates for metal-catalyzed coupling, ligands for molecular recognition (such as biotin), antigens and haptens. Functional and reactive groups of this invention may also be used in conjunction with bi-functional or poly-functional cross-linking reagents (such as bis-amines, bis-aldehydes, maleimido-NHS esters, etc). Other examples of reactive groups and cross-linking reaction can be found in literature (Hermanson, Bioconjugate Techniques, Elsevier, 1996).
(45) Leaving group means a molecular fragment that departs with a pair of electrons in heterolytic bond cleavage. Common leaving groups are halides such as Cl, Br, and I, sulfonate esters such as tosylate (TsO), phenolates such as 4-nitrophenylate, and water (Smith, 2007).
(46) Protecting group or protected form thereof or protected functional group or PFP or blocking group refers to a grouping of atoms that, when attached to a reactive group in a molecule, masks, reduces or prevents that reactivity. Examples of protecting groups can be found in T. W. Greene and P. G. Wuts, 2007 and Harrison and Harrison et al 1971 to 1996. Representative amino protecting groups include formyl, acetyl, trifluoroacetyl, benzyl, benzyloxycarbonyl (CBZ), tert-butoxycarbonyl (Boc), trimethyl silyl (TMS), 2-trimethylsilylethanesulfonyl (SES), trityl and substituted trityl groups, allyloxycarbonyl, 9-fluorenylmethyloxycarbonyl (FMOC), nitro-veratryloxycarbonyl (NVOC) and the like. Representative hydroxy protecting groups include those where the hydroxy group is either acylated or alkylated such as benzyl and trityl ethers as well as alkyl ethers, tetrahydropyranyl ethers, trialkylsilyl ethers and allyl ethers.
(47) The term solid support or synthesis solid support refers to any support that is compatible with oligonucleotide synthesis including, for example, glass, controlled pore glass, polymeric materials, polystyrene, beads, coated glass and the like.
(48) The term exocyclic amino group means an amino group situated outside of a chemical ring, such as in aniline.
(49) The term alkyl refers to a linear, branched, or cyclic saturated monovalent hydrocarbon substituent or a combination of cyclic and linear or branched saturated monovalent substituents having the number of carbon atoms indexed in the prefix. For example, (C.sub.1-C.sub.8)alkyl is meant to include methyl, ethyl, n-propyl, 2-propyl, tert-butyl, pentyl, cyclopentyl, cyclopropylmethyl and the like. For each of the definitions herein (e.g., alkyl, alkenyl, alkoxy, aralkyloxy), when a prefix is not included to indicate the number of chain carbon atoms in an alkyl portions, the substituent thereof will have eight or fewer main chain carbon atoms.
(50) The term alkylene refers to a linear saturated divalent hydrocarbon substituent or a branched saturated divalent hydrocarbon substituent having the number of carbon atoms indicated in the prefix. For example, (C.sub.1-C.sub.6)alkylene is meant to include methylene, ethylene, propylene, 2-methylpropylene, pentylene, and the like.
(51) The term aromatic or aryl means a monovalent or bivalent (e.g., arylene) monocyclic, bicyclic aromatic or tricyclic hydrocarbon substituent of 5 to 14 ring atoms which is unsubstituted or substituted. If substituted the substituents are selected from those groups provided below. The term heteromatic or heteroaryl refers to aryl wherein one or more heteroatoms or heteroatom functional groups have replaced a ring carbon, while retaining aromatic properties, e.g., pyridyl, quinolinyl, quinazolinyl, thienyl, and the like. More specifically the terms aryl and heteroaryl include, but are not limited to, phenyl, 1-naphthyl, 2-naphthyl, thienyl, thiazolyl and benzothiazolyl, and the substituted forms thereof.
(52) Substituents for the aryl and heteroaryl groups are varied and are selected from: -halogen, OR, OC(O)R, NRR, SR, R, CN, NO.sub.2, CO.sub.2R, CONRR, C(O)R, OC(O) NRR, NRC(O)R, NRC(O)2R, NRC(O), NRR, NHC(NH2)=NH, NRC(NH2)=NH, NHC(NH2)=NR, S(O)R, S(O).sub.2R, S(O).sub.2NRR, N.sub.3, CH(Ph).sub.2, perfluoro(C.sub.1-C.sub.4)alkoxy, and perfluoro(C.sub.1-C.sub.4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R, R and R are independently selected from hydrogen, (C.sub.1-C.sub.8)alkyl and heteroalkyl, unsubstituted aryl and heteroaryl, (unsubstituted aryl)-(C.sub.1-C.sub.4)alkyl, and (unsubstituted aryl)oxy-(C.sub.1-C.sub.4)alkyl. Preferred substituents are OH, Halogen, OR, OC(O)R, NRR, SR, R, CN and NO.sub.2 where R and R are independently H or (C.sub.1-C.sub.4).
(53) The prefix halo and the term halogen, when used to describe a substituent, refer to F, Cl, Br and I. Certain compounds or oligonucleotides of the present disclosure may exist in a salt form.
(54) Such salts include base addition salts such as sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When the compounds or modified oligonucleotides of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from organic acids like acetic, propionic, isobutyric, maleic, malonic, lactic, benzoic, succinic, suberic, fumaric, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (Berge, S. M., et al. 1977). Certain specific compounds described herein contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present disclosure.
(55) Certain compounds of the present disclosure can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are intended to be encompassed within the scope of the present disclosure. Certain compounds of the present disclosure may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present disclosure and are intended to be within the scope of the present disclosure.
(56) Certain compounds of the present disclosure possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are all intended to be encompassed within the scope of the present disclosure. The methods for the determination of stereochemistry and the separation of isomers are well-known in the art (March J. 1992).
(57) The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (.sup.3H), iodine-125 (.sup.125I) or carbon-14 (.sup.14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not (e.g, .sup.2H), are intended to be encompassed within the scope of the present disclosure.
(58) Optional or optionally in the above definitions means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. For example, aryl optionally mono- or di-substituted with an alkyl group means that the alkyl group may, but need not, be present, and the description includes situations where the aryl group is mono- or bis-substituted with an alkyl group and situations where the aryl group is not substituted with the alkyl group.
(59) In certain instances, amplification is carried out using a polymerase. The polymerase can, but need not, have 5 nuclease activity. In certain other instances, primer extension is carried out using a reverse transcriptase and amplification is carried out using a polymerase (U.S. Pat. Nos. 6,312,894, and 7,381,818). In other instances, the amplification is isothermal (U.S. Patent Application No. 2014 0255928).
(60) In one embodiment, the amplified targets are detected, with dual FRET DSQ-conjugute probes, as taught in U.S. Pat. Nos. 6,312,894, 7,381,818 and U.S. Patent Application No. 2014 0255928, all incorporated by reference)
(61) The term digital PCR refers to an approach to nucleic acid detection and quantification, which is a method of absolute quantification since it directly counts the number of target molecules rather than relying on reference standards or endogenous controls (Sedlak and Jerome 2013).
(62) The term arrays refers to hybridization of the probes of the invention to an immobilized oligonucleotide (U.S. Pat. No. 6,045,996). In some arrays, the probes described herein are immobilized to a solid support (U.S. Pat. No. 6,821,727).
(63) The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques in organic chemistry, biochemistry, oligonucleotide synthesis and modification, bioconjugate chemistry, nucleic acid hybridization, molecular biology, microbiology, genetics, recombinant DNA, and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Maniatis, Fritsch & Sambrook 1982; Sambrook, Fritsch & Maniatis, (1989); Ausubel, et al., 1987, 1988, 1989, 1990, 1991, 1992, 1993, 1994, 1995, 1996; Gait (ed.), 1984; Eckstein (ed.), 1991.
(64) Description
(65) Certain diaryl-azo derivatives are described herein, wherein said derivatives are efficient fluorescence quenchers as well as nucleic acid duplex-stabilizing agents. These derivates may also be referred to as Duplex-Stabilizing Quenching (DSQ) compounds, derivatives or agents.
(66) In preferred embodiments, DSQ derivatives comprise a diaryl-azo carboxylic acid of general Formula I:
(67) ##STR00001##
wherein Ar.sup.1 and Ar.sup.2 are aromatic moieties, optionally comprising a functional group or a linker with a functional group or protected functional group.
(68) In certain preferred embodiments, the diaryl-azo carboxylic acids of Formula I are coupled via a carboxamide bond to a minor groove binding aromatic amino acid (or peptide) of Formula II to yield DSQ compounds of Formula III:
(69) ##STR00002##
wherein Ar.sup.1 and Ar.sup.2 are aromatic or hetero-aromatic moieties, which are optionally substituted with a functional group or a linker with a functional group or protected functional group or a linker connecting to a synthesis solid support;
Ar.sup.3 is an aromatic or hetero-aromatic moiety;
R.sup.1 is H, alkyl or alkyl covalently connected to Ar.sup.3;
X is hydroxyl, a leaving group, a linker with a functional group or protected functional group, or a linker connecting to a synthesis solid support; and
n is from 0 to 5. If n is greater than 1 each Ar.sup.3 may be the same or different.
(70) Table 1 below shows examples of HOOCAr.sup.1 and Ar.sup.2 groups in accordance with preferred embodiments disclosed herein, where the HOOCAr.sup.1 and Ar.sup.2 groups are substituted with preferred substituents. The wavy bond indicates the attachment point to the azo group in Formula III.
(71) TABLE-US-00001 TABLE 1 HOOCAr.sup.1
(72) Table 2 below shows examples of minor groove binding aromatic amino acids (HOOCAr.sup.3NH(R.sup.1)) of Formula II in accordance with preferred embodiments disclosed herein, where the minor groove binding aromatic amino acids are substituted with preferred substituents. The wavy bond indicates the attachment point to the azo group in Formula II.
(73) TABLE-US-00002 TABLE 2 HOOCAr.sup.3NH(R.sup.1)
(74) In preferred embodiments, the diaryl-azo carboxylic acids are coupled to a minor groove binding aromatic amino acid that is 3,6,7,8-tetrahydro-benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (CDPI) yielding DSQ derivatives of Formula III (a):
(75) ##STR00029##
wherein Ar.sup.1 and Ar.sup.2 are aromatic or hetero-aromatic moieties, which are optionally substituted with a functional group or a linker with a functional group or protected functional group or a linker connecting to a synthesis solid support;
X is hydroxyl, a leaving group, a linker with a functional group or protected functional group, or a linker connecting to a synthesis solid support; and
n is from 0 to 5.
(76) In further preferred embodiments of the diaryl-azo carboxylic acids, with regard to Formula III (a), the Ar.sup.1 moiety is an indole or benzothiazole ring yielding DSQ derivatives of Formula III (b) and Formula III (c):
(77) ##STR00030##
(78) In additional preferred embodiments, in Formula III (b) and III (c), the Ar.sup.2 moiety is an aromatic or hetero-aromatic ring with an exocyclic amino group, in which said exocyclic amino group is optionally substituted with one or two of an alkyl, a linker with a functional group or protected functional group, or a linker connecting to a synthesis solid support; n is between 0 and 3; X is OH, a leaving group, a linker with a functional group or protected functional group, or a linker connecting to a synthesis solid support.
(79) Additional preferred embodiments include Formula III derivatives represented by Formula III (d) and III (e):
(80) ##STR00031##
wherein X is hydroxyl, OPFP, or a leaving group, and n is 0, 1 or 2.
(81) Compounds of Formula III are particularly useful for the preparation of oligonucleotide conjugates of Formula IV (a) or IV (b):
(82) ##STR00032##
wherein ODN is an oligonucleotide; L is a linking group having from 0 to 100 main chain atoms selected from C, N, O, S, P and Si and can be acyclic, cyclic or aromatic or combinations thereof; R.sup.1 is H, alkyl, or alkyl covalently connected to Ar.sup.3; and R.sup.3 is hydroxyl, a linking or blocking group; Ar.sup.1 and Ar.sup.2 are aromatic or hetero-aromatic moieties; and Ar.sup.3 is an aromatic moiety. If n is greater than 1, each Ar.sup.3 may be the same or different. In preferred embodiments, the oligonucleotide conjugate may further comprise a fluorophore connected to the oligonucleotide, and the fluorophore may be any suitable fluorophire including FAM, AP525, AP559, AP593 or AP662. The oligonucleotide may further comprise a minor groove binder connected to the oligonucleotide. The oligonucleotide conjugate may also include one or more modified nucleobases or modified bases. The linker L may be connected to the oligonucleotide at its 3-end or its 5-end, or it may be connected to the oligonucleotide at a position other than a 3- or 5-end.
(83) In preferred embodiments, the oligonucleotide conjugates of Formula IV (a) are represented by Formula IV (c):
(84) ##STR00033##
wherein n is 1, 2, or 3.
(85) In additional preferred embodiments, the oligonucleotide conjugates of Formula IV (c) are represented by Formula IV (d) or IV (e):
(86) ##STR00034##
wherein n is 1, 2 or 3.
Oligonucleotide Conjugate Preparation
(87) Oligonucleotide conjugates of the disclosure (including those of Formula IV (a) and IV (b)) can be synthesized in a variety of ways. One way is to use the activated derivatives of Formula III, wherein X is a leaving group. One such leaving group is the pentafluorophenyloxy (OPFP) group exemplified in this disclosure. Other examples of suitable leaving groups are N-succinimidyloxy and p-nitrophenyloxy groups as practiced in Greg T. Hermanson, Bioconjugate Techniques, Elsevier 1996, incorporated by reference.
(88) These derivatives can be conveniently reacted with oligonucleotides bearing primary or secondary aliphatic amino groups to form covalent amide bonds between oligonucleotides and diaryl-azo compounds of the disclosure. Description and examples of suitable procedures for such conjugation reactions can be found, for instance, in Kutyavin et al., Current Protocols in Nucleic Acid Chemistry, 2003, 8.4.1-8.4-21 and Lukhtanov et al., Bioconjugate Chem. 1995, 6, 418-426.
(89) These activated derivatives can also be used to introduce a variety of functional groups suitable for other types of conjugation reactions examples of which are reviewed in Hermanson, in Bioconjugate Techniques, Elsevier, 1996, and Kolb et al., Angewandte Chemie, 2001, 40, (11), 2004-2021.
(90) A generic procedure for the preparation of diaryl-azo derivatives of Formula III, wherein X is PFPO, is depicted in reaction Scheme 1 (
(91) The activated esters g9 are also used to react with linker moieties. Those linker moieties may be mono- or poly functional and contain various functional groups such as maleimide, biotin, azide, alkyne, amine, hydroxyl, DMT-protected hydroxyl, etc. One particular type of poly functional linker is a 6-aminohexane-1,2-diol and is suitable for the preparation of solid synthesis supports as illustrated in scheme 1 (
(92)
(93) Another example of a suitable linker for the preparation of DNA synthesis supports of the disclosure is hydroxyprolinol, a trifunctional reagent that has an amino, a primary and a secondary hydroxyl group. This linker as well as examples of other trifunctional reagents having an amino, primary and a secondary hydroxyl group, are described in U.S. Pat. No. 5,512,667. The primary hydroxyl group in this example is protected with a dimethoxytrityl group whereas the secondary hydroxyl and amino groups are available for further modifications.
(94) The synthesis support used in synthetic Scheme 1 is a highly cross-linked porous styrene-divinylbenzene copolymer further aminomethylated to enable the surface chemistry (Applied Biosystems, PN 360865C). Another example of synthesis support is Controlled Pore Glass (CPG) (Glen Research, Sterling, Va.), which is commercially available in different pore sizes and with long chain alkylamine extension for more efficient phosphoramidite coupling.
(95) Oligonucleotide conjugates of Formula IV (a) can also be obtained using a polystyrene synthesis support ID #480 exemplified in reaction scheme 3 (
(96) In the particular example depicted in reaction scheme 3, diaryl-azo-dye 66 is prepared by diazotization of 2-amino-1,3-benzothiazole-6-carboxylic acid followed by coupling with N-substituted aniline analog 65. The acid 66 is converted into activated PFP ester 67 for the following condensation with CDPI.sub.2 dipeptide yielding intermediate 68. This intermediate is activated via the formation of PFP ester 69 and then reacted with O-DMT-protected aminohexanol to afford intermediate 70 with two orthogonally-protected hydroxyl groups. The acetyl protection of the intermediate 70 is selectively saponified to give hydroxyl intermediate 71. To introduce the cleavable succinate linker, hydroxyl intermediate 71 is reacted with succinic anhydride and then activated with PFP-TFA. The obtained PFP ester 72 is reacted with aminomethyl polystyrene support (e.g. used in synthetic scheme 1) to yield synthesis support ID #480. Analytical HPLC is shown in
(97) Some oligonucleotide conjugates of Formula IV (b) can be prepared using the synthesis solid support ID #478 prepared according to the reaction scheme 2 (
(98) 2-Cyanoethyl N,N-diisopropylphosphoramidite chemistry is another way to prepare oligonucleotides bearing the compounds of the disclosure. One example of a suitable phosphoramidite reagent is shown in reaction scheme 4 (
(99)
(100) Applications of Oligonucleotide Conjugates
(101) Oligonucleotide conjugates of Formula IV (a) and (b) are useful for various application as described below. Preferred embodiments include a method for detecting a target nucleic acid sequence in a sample, comprising contacting the sample with embodiments of the oligonucleotide conjugates described herein, wherein the oligonucleotide conjugate has a nucleic acid sequence at least partially complementary to the target nucleic acid sequence, and wherein the oligonucleotide conjugate further comprises a fluorophore, and detecting a fluorescent signal from the oligonucleotide conjugate upon hybridization to the target nucleic acid sequence. Further preferred embodiments also include the step of amplifying the target nucleic acid sequence. In some preferred embodiments the oligonucleotide conjugate is a primer or a probe.
(102) In one embodiment of Formula IV the DSQ-conjugates comprise a 3-DSQ and a 5-fluorophore to yield oligonucleotides of general Formula V:
5-Fl-ODN-DSQ Formula V
wherein Fl is a fluorophore and ODN-DSQ is an oligonucleotide conjugate of Formula IV (a) or (b).
(103) Conjugates of Formula V are particularly useful as DNA probes for fluorescence-based real-time and endpoint PCR applications that rely on the hybridization-dependent 5-exonuclease activity of DNA polymerase for fluorophore cleavage, also known as the TaqMan technology. Examples of TaqMan PCR applications using conjugates of Formula V are shown in
(104) In other preferred embodiments, with reference to Formula IV, the oligonucleotide conjugates comprise a 5 DSQ and a 3 fluorophore as represented by Formula VI:
5-DSQ-ODN-Fl Formula VI
wherein Fl is a fluorophore and DSQ-ODN is an oligonucleotide conjugate of Formula IV (a) or (b).
(105) Oligonucleotide conjugates of Formula VI are useful as DNA probes for fluorogenic probes whose fluorescence signal is generated due to the hybridization with a target. The 5 DSQ moiety prevents the 5 exonuclease probe degradation. One particular type of such fluorogenic probes is the Molecular Beacon technology, which relies on the stem-loop structure to improve signal-to-background ratio and mismatch discrimination.
(106) In additional preferred embodiments, with reference to Formula IV, the oligonucleotide conjugates comprise a 5-DSQ and a 5-fluorophore positioned adjacent to each other as represented by Formula VII:
5-DSQ-Fl-ODN Formula VII
(107) Such oligonucleotides are useful as hybridization-triggered fluorogenic probes and primers as illustrated in
(108) In additional preferred embodiments, the oligonucleotides of Formula IV could be used in digital PCR and arrays (U.S. Pat. Nos. 9,328,384 and 7,759,126 incorporated by reference).
(109) Although not illustrated in Formulas V-VII, in some preferred embodiments the DSQ moiety is covalently attached to an internal position of an oligonucleotide, for example to an amine-tailed nucleobase.
(110) In further preferred embodiments, the DSQ oligonucleotides are used to differentiate single nucleotide polymorphisms as taught in U.S. Pat. No. 6,312,894 and, 7,718,374 incorporated by reference. In a related embodiment, different targets are detected utilizing melting curve analyse as taught in Hymas and Hillyard, 2009, incorporated by reference.
(111) Other applications, not specifically described in this specification but known in the art (for example Didenko, Biotechniques 2001, 31(5): 1106-1121, Kim, Y. et al., Int. J. Clin. Exp. Pathol. (2008) 1, 105-116, and U.S. Pat. No. 7,790,385), are also potential applications of the new derivatives and oligonucleotides of the disclosure.
EXAMPLES
(112) The following examples illustrate the functional performance of oligonucleotides labeled with preferred embodiments of the DSQ derivatives and are not intended to limit the scope of the claims.
Example 1. Preparation of DSQ Intermediates and PFP Esters
Ethyl 5-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1H-indole-2-carboxylate (1)
(113) ##STR00035##
(114) To a suspension of ethyl 5-aminoindole-2-carboxylate (3.0 g, 14.7 mmol) in 80 mL of water was added 2.5 mL of conc. HCl. The stirred suspension was cooled in ice/water bath to 0-4 C. and treated with a solution of NaNO.sub.2 (1.1 g, 15.9 mmol) in 20 mL of water via an addition funnel over 5 min. The reaction was stirred at 0-4 C. for 20 min then warmed to room temperature and stirred for another 10 min to give a dark, mostly clear solution. N,N-Dimethylaniline (2.5 mL, 19.7 mmol) was added in one portion and stirring was continued for 1 h. The precipitated solid was collected by filtration, washed with water and resuspended in 50 mL of MeOH. The suspension was heated to reflux then cooled and filtered to collect the precipitated solid. Drying in vacuo afforded 2.9 g (59% yield) of the desired dye 1 as a brown-orange solid. .sup.1H NMR (DMSO-d6) 12.17 (s, 1H), 8.14 (d, J=1.8 Hz, 1H), 7.83 (dd, J.sub.1=9 Hz, J.sub.2=2.1 Hz, 1H), 7.79 (d, J=9 Hz, 2H), 7.53 (d, J=8.7 Hz, 1H), 7.31 (d, J=0.9 Hz, 1H), 6.84 (d, J=8.7 Hz, 2H), 4.37 (q, J=7.2 Hz, 2H), 3.05 (s, 6H), 1.36 (t, J=7.2 Hz, 3H).
5-{(E)-[4-(Dimethylamino)phenyl]diazenyl}-1H-indole-2-carboxylic Acid (2)
(115) ##STR00036##
(116) A suspension of 1 (2.9 g, 8.6 mmol) in a mixture of THF (60 mL), MeOH (40 mL) and 1N NaOH (20 mL) was heated at 50 C. with stirring for 2.5 h to give a clear red-brown solution. The reaction was cooled, neutralized with 20 mL of 1N HCl and concentrated to about 40 mL. The precipitated black solid was collected by filtration, washed with water and dried to afford 2.6 g (98% yield) of acid 2 as a black solid. .sup.1H NMR (DMSO-d6) 12.06 (s, 1H), 8.13 (d, J=1.5 Hz, 1H), 7.83 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.78 (d, J=9 Hz, 2H), 7.52 (d, J=8.7 Hz, 1H), 7.26 (d, J=1.5 Hz, 1H), 6.84 (d, J=8.7 Hz, 2H), 3.05 (s, 6H).
Pentafluorophenyl 5-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1H-indole-2-carboxylate (3)
(117) ##STR00037##
(118) To a suspension of 2 (2.6 g, 8.4 mmol) in 30 mL of anhydrous CH.sub.2Cl.sub.2 was added triethylamine (4.2 mL) followed by pentafluorophenyl trifluoroacetate (PFP-TFA) in several portions until no more starting acid 2 was observed by TLC or HPLC analysis. Total of 3.5 mL (20.25 mmol) of PFP TFA was added over 16 h. The completed reaction was concentrated and the obtained residue resuspended in cold MeOH (50 mL). The insoluble material was collected by filtration, washed with MeOH (210 mL) and dried to afford 2.7 g (68% yield) of 3 as a brown-orange solid. .sup.1H NMR (DMSO-d6) 12.72 (s, 1H), 8.22 (d, J=1.5 Hz, 1H), 7.93 (dd, J.sub.1=8.7 Hz, J.sub.2=1.8 Hz, 1H), 7.80 (d, J=9 Hz, 2H), 7.73 (d, J=1.5 Hz, 1H), 7.61 (d, J=9 Hz, 1H), 6.84 (d, J=9 Hz, 2H), s (3.05, 6H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (4)
(119) ##STR00038##
(120) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (WO 2004043350) (2.5 mmol) in 10 mL of anhydrous dimethylformamide (DMF) was added triethylamine (1.5 mL) followed by 1.2 g (2.5 mmol) of PFP ester 3. The reaction was briefly stirred to initially give a clear solution but the product precipitation started within minutes. The reaction was agitated for 20 h then the precipitated material was collected by filtration, washed with small amount of DMF (2 mL), MeOH (10 mL) and ether. Drying in vacuo afforded 1.6 g (94% yield) of the title acid 4 (partial triethylammonium salt) as an orange-brown solid. .sup.1H NMR (DMSO-d6) 12.00 (s, 1H), 11.78 (s, 1H), 11.02 (s, 1H), 8.26 (m, 2H), 8.16 (d, J=1.5 Hz, 1H), 7.81 (dd, J.sub.1=8.7 Hz, J.sub.2=1.8 Hz, 1H), 7.80 (d, J=9 Hz, 2H), 7.58 (d, 9 Hz, 1H), 7.39 (d, 9 Hz, 1H), 7.32 (m, 2H), 7.12 (d, J=1.5 Hz, 1H), 6.93 (d, J=1.8 Hz, 1H) 6.85 (d, J=9 Hz, 2H), 4.68 (m, 4H), 3.4 (m, 6H), 3.06 (s, 6H), 2.76 (m, 4H), 1.06 (t, J=7.2 Hz, 6H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (5)
(121) ##STR00039##
(122) To a suspension of 5 (1.5 g, 2.2 mmol) in 10 mL of anhydrous DMF was added 1.2 ml of triethylamine followed by several portions of PFP-TFA over the course of 24 h until no more starting 5 was found by HPLC analysis. A total of 0.9 mL (5.2 mmol) of PFP-TFA was used. MeOH (20 mL) was added to initiate product precipitation. The resultant solid was collected by filtration, washed with methanol (210 mL) and ether. Drying in vacuo afforded 1.73 g (93% yield) of PFP ester 5 as a brown solid. NMR analysis indicated a partial (40%) TFA-protection of the indole NH-groups. .sup.1H NMR (DMSO-d6) 12.64 (s, 0.4H), 12.55 (s, 0.6H), 12.07 (s, 0.4H), 12.00 (s, 0.6H), 11.81 (s, 0.6H), 8.44 (m, 1H), 8.29 (m, 1H), 8.16 (s, 1H), 7.8 (m, 3H), 7.7-7.1 (m, 6H), 6.85 (d, J=9 Hz, 2H), 4.72 (m, 4H), 3.5 (m, 4H), 3.06 (s, 6H).
Ethyl 5-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1H-indole-2-carboxylate (6)
(123) ##STR00040##
(124) To a suspension of ethyl 5-aminoindole-2-carboxylate (3.0 g, 14.7 mmol) in 80 mL of water was added 2.5 mL of conc. HCl. The stirred suspension was cooled in ice/water bath to 0-4 C. and treated with a solution of NaNO.sub.2 (1.1 g, 15.9 mmol) in 20 mL of water via an addition funnel over the course of 5 min. The reaction was stirred at 0-4 C. for 20 min then warmed to room temperature and stirred for another 10 min to give a dark, mostly clear solution. 1-(2,5-dimethoxyphenyl)pyrrolidine (M. Sarma et al. J. Org. Chem. 2012, 77(1), 432-444) (4.08 g, 19.7 mmol) was added in one portion and stirring was continued for 10 min before solid sodium acetate trihydrate (5.3 g) was added. The resultant brown suspension was stirred for 2 h. The precipitated solid was collected by filtration, washed with water, MeOH and dried in vacuo to afford 5.3 g (85% yield) of the desired dye 6 as a brown-orange solid. .sup.1H NMR (DMSO-d6) 12.11 (s, 1H), 8.08 (d, J=1.5 Hz, 1H), 7.78 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.50 (d, J=9 Hz, 2H), 7.33 (s, 1H), 7.29 (d, J=1.2 Hz, 1H), 6.30 (s, 1H), 4.37 (q, J=7.2 Hz, 2H), 3.94 (s, 3H), 3.75 (s, 3H), 3.51 (m, 4H), 1.90 (m, 4H), 1.36 (t, J=7.2 Hz, 3H).
5-{(E)-[2,5-Dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1H-indole-2-carboxylic Acid (7)
(125) ##STR00041##
(126) To a solution of 6 (5.0 g, 11.8 mmol) in 90 mL of THF was added 60 mL of MeOH and 30 mL of 1N NaOH. The initial suspension was stirred at 50 C. for 1.5 h to give a dark solution. The reaction was cooled, neutralized with 1N HCl (30 mL) and concentrated to about 60 mL. The resultant solid was collected by filtration, washed with water and dried to give 4.5 g (97% yield) of acid 7 as a black solid. .sup.1H NMR (DMSO-d6) 13.06 (br s, 1H), 12.01 (s, 1H), 8.06 (d, J=1.5 Hz, 1H), 7.76 (dd, J.sub.1=9 Hz, J.sub.2=1.2 Hz, 1H), 7.49 (d, J=8.7 Hz, 2H), 7.35 (s, 1H), 7.23 (s, 1H), 6.29 (s, 1H), 3.95 (s, 3H), 3.76 (s, 3H), 3.54 (br s, 4H), 1.89 (br s, 4H).
Pentafluorophenyl 5-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1H-indole-2-carboxylate (8)
(127) ##STR00042##
(128) A solution of 7 (1.18 g, 3.0 mmol) and triethylamine (2.2 mL) in 20 mL of anhydrous CH.sub.2Cl.sub.2 was added PFP-TFA in several portions over the course of 2 days to a total amount of 1.76 mL (10.1 mmol). The reaction (suspension of partially precipitated product) was concentrated and resuspended in 20 mL of MeOH. The insoluble material was collected by filtration, washed with MeOH and dried in vacuo to afford 1.33 g (79% yield) of PFP ester 8 as an orange solid. .sup.1H NMR (DMSO-d6) 12.67 (s, 1H), 8.16 (d, J=1.5 Hz, 1H), 7.89 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.73 (d, J=1.2 Hz, 1H), 7.58 (d, J=9 Hz, 2H), 7.35 (s, 1H), 6.30 (s, 1H), 3.95 (s, 3H), 3.75 (s, 3H), 3.52 (m, 4H), 1.90 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (9)
(129) ##STR00043##
(130) To a solution 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.8 mmol) in 4 mL of anhydrous DMF was added triethylamine (0.5 mL) followed by 0.45 g (0.8 mmol) of PFP ester 8. The initial suspension was stirred at room temperature for 5 min and then briefly warmed up to approx. 45 C. to give a clear red solution. Product precipitation started soon after that. The reaction was allowed to proceed for 20 h. The precipitated material was collected by filtration, washed with DMF (22 ml), acetone (210 mL) and dried in vacuo to give 0.56 g (96% yield) of acid 9 (partial triethylammonium salt) as a brown solid. .sup.1H NMR (DMSO-d6) 11.95 (s, 1H), 11.77 (s, 1H), 11.61 (s, 1H), 8.26 (m, 2H), 8.11 (d, J=1.2 Hz, 1H), 7.76 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.55 (d, J=8.7 Hz, 2H), 7.38 (d, 9 Hz, 1H), 7.35 (s, 1H), 7.32 (m, 2H), 7.12 (d, J=1.5 Hz, 1H), 6.92 (s, 1H) 6.32 (s, 1H), 4.68 (m, 4H), 3.95 (s, 3H), 3.76 (s, 3H), 3.5-3.3 (m, 8H), 2.67 (q, J=7.2 Hz, 4H), 1.91 (m, 4H), 1.06 (t, J=7.2 Hz, 6H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (10)
(131) ##STR00044##
(132) To a suspension of 9 (0.47 g, 0.62 mmol) in 6 mL of anhydrous DMF was added 0.5 mL of triethylamine and 0.2 mL (1.16 mmol) of PFP-TFA. The reaction was stirred for 8 h and treated with another portion of PFP-TFA (0.05 mL) to complete the PFP ester formation. After being stirred for 16 h the precipitated material was collected by filtration, washed with DMF (21 mL), acetone (45 mL) and dried in vacuo to give 0.43 (75% yield) of PFP ester 10 as an orange solid. .sup.1H NMR (DMSO-d6) 12.55 (s, 1H), 11.95 (s, 1H), 11.80 (s, 1H), 8.42 (br d, J=9 Hz, 1H), 8.29 (br d, J=8 Hz, 1H), 8.10 (d, J=1.2 Hz, 1H), 7.76 (dd, J.sub.1=9 Hz, J.sub.2=1.5 Hz, 1H), 7.60 (d, J=1.5 Hz, 1H), 7.55 (d, J=9 Hz, 2H), 7.43 (d, 9 Hz, 1H), 7.39 (d, 9 Hz, 1H), 7.35 (s, 1H), 7.30 (s, 1H), 7.16 (s, 1H) 6.32 (s, 1H), 4.71 (m, 4H), 3.95 (s, 3H), 3.76 (s, 3H), 3.5 (m, 8H), 1.91 (m, 4H).
Ethyl 2-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylate (11)
(133) ##STR00045##
(134) Ethyl 2-amino-1,3-benzothiazole-6-carboxylate (4.44 g, 20 mmol) was resuspended in 100 mL of a 1:1 mixture of acetic and propionic acids. The partial solution was cooled to 0-4 C. and treated with 6.7 mL of 40% nitrosylsulfuric acid maintaining the temperature below 10 C. The reaction was stirred for 5 h then allowed to briefly warm to room temperature before cooling again to 0-4 C. The obtained solution of diazonium salt was added via an addition funnel to a stirred cold (ice/water bath) mixture prepared by combining a solution of N,N-dimethylaniline (3 mL) in 25 mL of MeOH and a solution of 0.6 g of sulfamic acid in 200 mL of water. The stirring was continued for 3 h before the reaction was neutralized by adding approx. 200 mL of 40% aqueous trimethylamine to a pH of 6-7. The resultant solid was collected by filtration, washed with water and resuspended in hot MeOH (50 mL). After cooling the insoluble material was collected by filtration, washed with MeOH (210 mL) and dried in vacuo to afford 4.34 g (61% yield) of dye 11 as a dark-purple solid. .sup.1H NMR (CDCl.sub.3) 8.55 (d, J=1.5 Hz, 1H), 8.14 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.5 Hz, 1H), 8.07 (skewed d, J=8.4 Hz, 1H), 8.02 (d, J=9.6 Hz, 2H), 6.78 (d, J=9.6 Hz, 2H), 4.44 (q, J=7.2 Hz, 2H), 3.19 (s, 6H), 1.43 (t, J=7.2 Hz, 3H).
2-{(E)-[4-(Dimethylamino)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylic Acid (12)
(135) ##STR00046##
(136) To a solution of 11 (0.18 g, 0.51 mmol) in 9 mL of THF was added MeOH (6 mL) followed by 3 mL of 1N NaOH. The mixture was stirred at 50 C. for 70 min, cooled, neutralized with 1N HCl (3 mL) and concentrated to about 5 mL. The precipitated material was collected by filtration, washed with water and dried to afford 0.143 g (86% yield) of the desired acid 12 as a black solid. .sup.1H NMR (DMSO-d6) 13.10 (br s, 1H), 8.60 (s, 1H), 8.02 (s, 2H), 7.87 (d, J=9 Hz, 2H), 6.93 (d, J=9 Hz, 2H), 3.18 (s, 6H).
Pentafluorophenyl 2-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylate (13)
(137) ##STR00047##
(138) To a solution of 12 (0.14 g, 0.42 mmol) and triethylamine (0.4 mL) in 2 mL of anhydrous DMF was added 0.2 mL (1.16 mmol) of PFP-TFA. After being stirred for 30 min the reaction was concentrated and diluted with acetone (4 mL). The precipitated material was collected by filtration washed with acetone (2 mL), 20% ethyl acetate/hexane (5 mL) and dried in vacuo to give 0.158 g (76% yield) of PFP ester 13 as a dark brown solid. .sup.1H NMR (CDCl.sub.3) 8.72 (d, J=1.5 Hz, 1H), 8.26 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.5 Hz, 1H), 8.16 (skewed d, J=8.4 Hz, 1H), 8.03 (d, J=9.3 Hz, 2H), 6.79 (d, J=9.6 Hz, 2H), 3.21 (s, 6H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(2-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (14)
(139) ##STR00048##
(140) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.33 mmol) in 5 mL of anhydrous DMF was added triethylamine (0.2 mL) followed by 0.156 g (0.32 mmol) of PFP ester 13. The reaction was stirred at 50 C. for 5 h and then cooled to room temperature. The precipitated material was collected by filtration, washed with DMF (21 ml), acetone (25 mL) and dried in vacuo to give 0.167 g (75% yield) of acid 14 (partial triethylammonium salt) as a brown solid. .sup.1H NMR (DMSO-d6) 11.75 (s, 1H), 11.66 (s, 1H), 8.30 (s, 1H), 8.1-8.3 (m, 2H), 8.05 (d, J=8.4 Hz, 1H), 7.88 (d, J=9.6 Hz, 2H), 7.72 (d, J=8.1 Hz, 1H), 7.35 (br s, 1H), 7.29 (d, J=9 Hz, 1H), 7.07 (s, 1H), 6.94 (d, J=9 Hz, 2H), 6.93 (s, 1H), 4.62 (t, J=8.7 Hz, 2H), 4.20 (t, J=8.4 Hz, 2H), 3.3 (m, 8H), 3.18 (s, 6H), 2.68 (m, 3H), 1.02 (t, J=7 Hz, 4H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(2-{(E)-[4-(dimethylamino)phenyl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (15)
(141) ##STR00049##
(142) To a suspension of 14 (0.163 g, 0.23 mmol) in 2 mL of anhydrous DMF was added 0.1 mL of triethylamine and 0.1 mL (0.58 mmol) of PFP-TFA. After being stirred for 16 h the reaction was concentrated and the resulting material resuspended in acetone (2-3 mL). Filtration, wash with acetone and drying in vacuo afforded 0.175 g (88% yield) of PFP ester 15 as a brown solid. NMR analysis indicated a partial (25%) TFA-protection of the indole NH-groups. .sup.1H NMR (DMSO-d6) 12.62 (s, 0.25H), 12.52 (s, 0.75H), 11.78 (s, 0.75H), 8.5-8.1 (m, 3H), 8.06 (d, J=8.7 Hz, 0.25H), 8.05 (d, J=8.7 Hz, 0.75H), 7.87 (d, J=9 Hz, 2H), 7.73 (m, 1H), 7.61 (d, J=1.2 Hz, 0.25H), 7.57 (d, J=1.5 Hz, 0.75H), 7.5-7.3 (m, 2H), 7.09 (s, 1H), 6.94 (d, J=9 Hz, 2H), 4.66 (m, 2H), 4.20 (m, 2H), 3.46 (m, 2H), 3.29 (m, 2H), 3.17 (s, 6H).
Ethyl 2-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylate (16)
(143) ##STR00050##
(144) To a suspension of ethyl 2-amino-1,3-benzothiazole-6-carboxylate (0.64 g, 2.86 mmol) in acetic acid (8 mL) was added 1 mL of 40% nitrosylsulfuric acid with stirring over a period of 1 min to give a light yellow partial solution. The mixture was stirred at room temperature for 30 min before being used in the next step. A solution of 1-(2,5-dimethoxyphenyl)pyrrolidine (0.88 g, 4.2 mmol) in 20 mL of THF was combined with a solution of sodium acetate trihydrate (2.4 g) in 12 mL of water to give a biphasic mixture. The mixture was cooled to 0-4 C. and treated with the solution of diazonium salt from step 1. The resulting blue suspension was stirred for 1 h and then poured into saturated NaHCO.sub.3. The crude dye was extracted with ethyl acetate and purified on silica eluting with a gradient of ethyl acetate in hexane. Concentration of the pure product fractions afforded 0.17 g (13% yield) of dye 16 as a dark purple solid. .sup.1H NMR (DMSO-d6) 8.54 (d, J=1.8 Hz, 1H), 7.99 (skewed dd, J.sub.1=8.7 Hz, J.sub.2=1.8 Hz, 1H), 7.89 (skewed d, J=8.4 Hz, 1H), 7.31 (s, 1H), 6.20 (s, 1H), 4.35 (q, J=7.2 Hz, 2H), 4.00 (s, 3H), 3.81 (s, 3H), 3.79 (m, 4H), 1.95 (m, 4H), 1.36 (t, J=7.2 Hz, 3H).
2-{(E)-[2,5-Dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylic Acid (17)
(145) ##STR00051##
(146) To a solution of 11 (0.17 g, 0.39 mmol) in 9 mL of THF was added MeOH (6 mL) followed by 3 mL of 1N NaOH. The mixture was stirred at 50 C. for 70 min, cooled, neutralized with 1N HCl (3 mL) and concentrated to about 5 mL. The precipitated material was collected by filtration, washed with water and dried to afford 0.16 g (99% yield) of the desired acid 17 as a black solid. .sup.1H NMR (DMSO-d6) 8.51 (d, J=1.5 Hz, 1H), 7.98 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.5 Hz, 1H), 7.82 (skewed d, J=8.4 Hz, 1H), 7.28 (s, 1H), 6.21 (s, 1H), 4.01 (s, 3H), 3.85 (m, 4H), 3.83 (s, 3H), 1.96 (m, 4H).
Pentafluorophenyl 2-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1,3-benzothiazole-6-carboxylate (18)
(147) ##STR00052##
(148) A solution of 17 (0.16 g, 0.39 mmol) and triethylamine (0.4 mL) in 2 mL of anhydrous DMF was treated with several portions (0.05 mL each) of PFP-TFA until no more starting 17 was found by HPLC analysis. A total of 0.35 mL (2 mmol) of PFP-TFA was used. The reaction was concentrated and chromatographed on silica eluting with a gradient of ethyl acetate (50-100%) in hexane. Concentration of the pure product fractions afforded 0.14 g (62% yield) of PFP ester 18 as a black solid. .sup.1H NMR (CDCl.sub.3) 8.51 (m, J=0.9 Hz, 1H), 8.21 (skewed d of m, J.sub.1=8.4 Hz, J.sub.2=0.9 Hz, 1H), 8.03 (skewed d, J=8.4 Hz, 1H), 7.55 (s, 1H), 6.01 (s, 1H), 4.05 (s, 3H), 3.82 (s, 3H), 3.77 (m, 4H), 2.01 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(2-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (19)
(149) ##STR00053##
(150) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.245 mmol) in 5 mL of anhydrous DMF was added triethylamine (0.2 mL) followed by 0.14 g (0.24 mmol) of PFP ester 18. The reaction was stirred at 50 C. for 3 h and then cooled to room temperature. The precipitated material was collected by filtration washed with acetone (35 mL) and dried in vacuo to give 0.117 g (62% yield) of acid 19 (partial triethylammonium salt) as a black solid. .sup.1H NMR (DMSO-d6) 11.78 (s, 1H), 11.71 (s, 1H), 8.4-8.0 (m, 3H), 7.93 (d, J=8.4 Hz, 1H), 7.68 (d, J=8.1 Hz, 1H), 7.33 (s, 1H), 7.4-7.2 (m, 2H), 7.10 (s, 1H), 6.98 (s, 1H), 6.21 (s, 1H), 4.66 (t, J=8.1 Hz, 2H), 4.23 (t, J=8.1 Hz, 2H), 4.00 (s, 3H), 3.82 (s, (3H), 3.78 (m, 4H), 3.45 (m, 2H), 2.71 (m, 2H), 1.96 (m, 4H), 1.04 (t, J=8.4 Hz, 3H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(2-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (20)
(151) ##STR00054##
(152) To a suspension of 19 (0.117 g, 0.15 mmol) in 2 mL of anhydrous DMF was added triethylamine (0.1 mL) followed by PFP-TFA (0.1 mL, 0.58 mmol). The reaction was stirred for 1 h and then concentrated. The resultant material was resuspended in acetone (3 mL) and filtered. The collect solid was washed with acetone and dried in vacuo to afford 0.125 g (88% yield) of compound 20 as a dark-purple solid. .sup.1H NMR (DMSO-d6) 12.57 (s, 1H), 11.82 (s, 1H), 8.44 (d, J=7.8 Hz, 1H), 8.4-8.0 (m, 2H), 7.92 (d, J=8.4 Hz, 1H), 7.8-7.6 (m, 3H), 7.5-7.2 (m, 3H), 7.12 (s, 1H), 6.19 (s, 1H), 4.70 (t, J=8.1 Hz, 2H), 4.23 (t, J=8.1 Hz, 2H), 4.00 (s, 3H), 3.82 (s, (3H), 3.78 (m, 4H), 3.5-3.3 (m, 4H), 1.96 (m, 4H).
Methyl 3-chloro-4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}benzoate (21)
(153) ##STR00055##
(154) To a suspension of methyl 4-amino-3-chlorobenzoate (1.1 g, 5.9 mmol) in 32 mL of water was added 1 mL of conc. HCl. The stirred suspension was cooled in ice/water bath to 0-4 C. and treated with a solution of NaNO.sub.2 (0.44 g, 6.3 mmol) in 8 mL of water via an addition funnel over the course of 5 min. The reaction was stirred at 0-4 C. for 30 min then warmed to room temperature and stirred for another 10 min to give a mostly complete solution. 1-(2,5-dimethoxyphenyl)pyrrolidine (1.9 g, 9.1 mmol) was added in one portion and stirring was continued for 10 min before solid sodium acetate trihydrate (5.0 g) was added. The reaction was allowed to warm to room temperature, stirred for 3 h and then carefully neutralized with saturated NaHCO.sub.3. The precipitated solid was collected by filtration, washed with water and dried in vacuo. The crude product was crystallized from hot MeOH to afford 1.8 g (67% yield) of dye 21 as a black crystalline solid. .sup.1H NMR (CDCl.sub.3) 8.14 (d, J=1.8 Hz, 1H), 7.92 (dd, J.sub.1=8.7 Hz, J.sub.2=1.8 Hz, 1H), 7.71 (d, J=8.7 Hz, 1H), 7.50 (s, 1H), 6.14 (s, 1H), 4.01 (s, 3H), 3.93 (s, 3H), 3.82 (s, 3H), 3.63 (m, 4H), 1.98 (m, 4H).
3-Chloro-4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}benzoic Acid (22)
(155) ##STR00056##
(156) A solution of 21 (1.6 g, 3.96 mmol) in a mixture of THF (90 mL) and MeOH (60 mL) was treated with 1N NaOH (30 mL). The reaction was heated at 50 C. with stirring for 2.5 h to give a clear red solution. The reaction was cooled, neutralized with 30 mL of 1N HCl and concentrated to about 60 mL. The precipitated solid was collected by filtration, washed with water and dried in vacuo to afford 1.7 g (98% yield) of acid 22 as a black solid. .sup.1H NMR (DMSO-d6) 12.15 (br s, 1H), 8.02 (s, 1H), 7.93 (d, J=7.5 Hz, 1H), 7.65 (d, J=7.8 Hz, 1H), 7.34 (s, 1H), 6.22 (s, 1H), 3.97 (s, 3H), 3.77 (s, 3H), 3.68 (m, 4H), 1.93 (m, 4H).
Pentafluorophenyl 3-chloro-4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}benzoate (23)
(157) ##STR00057##
(158) Acid 22 (1.7 g, 4.3 mmol) was dried by co-evaporation with 25 mL of anhydrous DMF and 1 mL of triethylamine. The dried material was re-dissolved in another portion (25 mL) of DMF with 1 mL of triethylamine and treated with 0.75 mL (4.3 mmol) of PFP-TFA. The reaction was stirred for 60 min to give a thick suspension due to the product precipitation. DMF was removed in vacuo and the resultant solid resuspended in water. The precipitate was collected by filtration, washed with MeOH and dried in vacuo over P.sub.2O.sub.5. The crude PFP ester 23 was re-crystallized from ethyl acetate to afford 1.94 g (81% yield) of PFP ester 23 as a black crystalline solid. .sup.1H NMR (CDCl.sub.3) 8.29 (d, J=1.8 Hz, 1H), 8.06 (dd, J.sub.1=8.7 Hz, J.sub.2=1.8 Hz, 1H), 7.82 (d, J=8.7 Hz, 1H), 7.52 (s, 1H), 6.11 (s, 1H), 4.02 (s, 3H), 3.83 (s, 3H), 3.67 (m, 4H), 1.99 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[3-chloro-4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}benzoyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (24)
(159) ##STR00058##
(160) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.8 mmol) in 4 mL of anhydrous DMF was added triethylamine (0.5 mL) followed by 0.44 g (0.8 mmol) of PFP ester 23. The reaction was stirred at 50 C. for 5 h and then cooled to room temperature. The precipitated material was collected by filtration, washed with DMF (32 ml), acetone (25 mL) and dried in vacuo to give 0.46 g (75% yield) of acid 24 (partial triethylammonium salt) as a brown solid. .sup.1H NMR (DMSO-d6) 11.79 (s, 1H), 11.69 (s, 1H), 8.3-8.1 (m, 2H), 7.84 (s, 1H), 7.66 (apparent br s, 2H), 7.4-7.2 (m, 3H), 7.10 (s, 1H), 6.97 (s, 1H), 6.27 (s, 1H), 4.65 (t, J=7.5 Hz, 2H), 4.22 (t, J=7.8 Hz, 2H), 3.97 (s, 3H), 3.76 (s, 3H), 3.62 (m, 4H), 3.5-3.3 (m, 4H), 2.73 (m, 3H), 1.93 (m, 4H), 1.05 (t, J=7.2 Hz, 4H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[3-chloro-4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}benzoyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (25)
(161) ##STR00059##
(162) To a suspension of 24 (0.46 g, 0.61 mmol) in 6 mL of anhydrous DMF was added 0.3 ml of triethylamine followed by several portions of PFP-TFA over the course of 24 h until no more starting 24 was found by HPLC analysis. A total of 0.36 mL (2.1 mmol) of PFP-TFA was used. The reaction was concentrated and the residue resuspended in acetone. The precipitate was collected by filtration, washed with acetone and dried in vacuo to give 0.44 g (78% yield) of PFP ester 25 as a dark brown solid. .sup.1H NMR (DMSO-d6) 12.56 (s, 1H), 11.82 (s, 1H), 8.44 (d, J=8.4 Hz, 1H), 8.3-8.1 (m, 2H), 7.84 (s, 1H), 7.66 (apparent br s, 2H), 7.6 (s, 1H), 7.4 (m, 3H), 7.12 (s, 1H), 6.22 (s, 1H), 4.69 (t, J=7.5 Hz, 2H), 4.22 (t, J=7.8 Hz, 2H), 3.97 (s, 3H), 3.76 (s, 3H), 3.63 (m, 4H), 3.6-3.3 (m, 4H), 1.93 (m, 4H), 3.49 (t, 2H), 3.30 (m, 2H), 1.93 (m, 4H).
4-[(E)-(4-Amino-2,5-dimethoxyphenyl)diazenyl]benzoic Acid (26)
(163) ##STR00060##
(164) A solution of NaNO.sub.2 (2.5 g, 36.5 mmol) in 25 mL of water was added via an addition funnel over the course of 40 min to a cold (0-4 C.) stirred solution of 4-aminobenzoic acid in a mixture of water (200 mL) and conc. HCl (6.2 mL). The resulting light yellow solution was stirred at 0-4 C. for 30 min before being used in the next step. Solid 2,5-dimethoxyaniline (5.59 g, 36.5 mmol) was added in one portion to the stirred solution of diazonium salt from step 1. The reaction was stirred at 0-4 C. for 1.5 h and then at room temperature for 1 h to give a suspension due to the product precipitation. The precipitate was collected by filtration, washed with water and dried. The crude dye was chromatographed on silica eluting with a gradient of MeOH in CH.sub.2Cl.sub.2 (0-20%). The pure dye fractions were concentrated to afford 3.7 g (33%) of compound 26 as a dark red solid. .sup.1H NMR (DMSO-d6) 12.9 (br s, 1H), 8.01 (d, J=8.7 Hz, 2H), 7.72 (d, J=8.7 Hz, 2H), 7.25 (s, 1H), 6.41 (s, 1H), 6.24 (s, 2H), 3.83 (s, 3H), 3.76 (s, 3H),
4-[(E)-(2,5-Dimethoxy-4-{(E)-[4-(dimethylamino)phenyl]diazenyl}phenyl)diazenyl]benzoic Acid (27)
(165) ##STR00061##
(166) A solution of NaNO.sub.2 (0.85 g, 12.3 mmol) in 8 mL of water was added via an addition funnel over the course of 5 min to a cold (0-4 C.) stirred suspension of compound 26 (3.7 g, 12.3 mmol) in a mixture of water (67 mL) and conc. HCl (2.0 mL). The reaction was stirred at 0-4 C. for 30 min and then at room temperature for 2 h before being used in the next step. A solution of N,N-dimethylaniline (2.4 mL) in 10 mL of MeOH was added in one portion to the diazonium salt from step 1 followed by 5.0 g of sodium acetate trihydrate. The resulting dark suspension was stirred at room temperature for 16 h and then filtered to collect the precipitated solid. The crude dye was purified by trituration in hot MeOH (20 mL) followed by cooling and filtration to yield 2.2 g (41%) of dye 27 as a black solid. .sup.1H NMR (DMSO-d6) 13.17 (br s, 1H), 8.11 (d, J=8.4 Hz, 2H), 7.93 (d, J=8.7 Hz, 2H), 7.80 (d, J=8.7 Hz, 2H), 7.39 (s, 1H), 7.35 (s, 1H), 6.83 (d, J=9 Hz, 2H), 3.96 (s, 3H), 3.92 (s, 3H), 3.06 (s, 6H).
Pentafluorophenyl 4-[(E)-(2,5-dimethoxy-4-{(E)-[4-(dimethylamino)phenyl]diazenyl}phenyl)diazenyl]benzoate (28)
(167) ##STR00062##
(168) PFP-TFA (1.2 mL, 6.9 mmol) was added in two portions to a solution of 27 (2.2 g, 5.07 mmol) and triethylamine (2 mL) in 50 mL of anhydrous CH.sub.2Cl.sub.2. After being stirred for 2 h the reaction was concentrated and the obtained semi-solid residue resuspended in 2-propanol (25 mL). The resulting solid was collected by filtration and dried in vacuo to afford crude ester 28, which was then further purified by trituration in hot 4:1 mixture of hexane and ethyl acetate (20 mL) followed by cooling and filtration. Drying in vacuo afforded 2.2 g (72%) of PFP ester 28. .sup.1H NMR (CDCl.sub.3) 8.34 (d, J=8.4 Hz, 2H), 8.05 (d, J=8.7 Hz, 2H), 7.96 (d, J=9 Hz, 2H), 7.53 (s, 1H), 7.49 (s, 1H), 6.77 (d, J=9 Hz, 2H), 4.10 (s, 3H), 4.07 (s, 3H), 3.13 (s, 6H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[4-[(E)-(2,5-dimethoxy-4-{(E)-[4-(dimethylamino)phenyl]diazenyl}phenyl)diazenyl]benzoyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (29)
(169) ##STR00063##
(170) A mixture of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (1 mmol), 28 (0.6 g, 1 mmol), DMF (5 mL) and triethylamine was stirred at 50 C. for 20 h and then cooled to room temperature. The resulting precipitate was collected by filtration, washed with DMF (2 mL), CH.sub.2Cl.sub.2 (23 mL) and dried to yield 0.76 g (84%) of compound 29 as a black solid (partial triethylammonium salt according to NMR analysis). .sup.1H NMR (DMSO-d6) 11.80 (br s, 1H), 11.55 (br s, 1H), 8.22 (m, 2H), 7.98 (m, 2H), 7.85 (m, 3H), 7.46 (s, 1H), 7.42 (s, 1H), 7.30 (d, J=8.7 Hz, 2H), 7.10 (s, 1H), 6.89 (m, 3H), 4.65 (t, J=7.5 Hz, 2H), 4.21 (t, J=7.2 Hz, 2H), 4.02 (s, 3H), 3.99 (s, 3H), 3.39 (m, 4H), 3.11 (s, 6H), 2.76 (m, 6H), 1.08 (t, J=7.2 Hz, 8H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[4-[(E)-(2,5-dimethoxy-4-{(E)-[4-(dimethylamino)phenyl]diazenyl}phenyl)diazenyl]benzo yl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (30)
(171) ##STR00064##
(172) To a suspension of 29 (0.76 g, 0.84 mmol) in 10 mL of anhydrous DMF was added 0.5 mL of triethylamine and 0.2 mL (1.16 mmol) of PFP-TFA. The reaction was stirred for 8 h and treated with another portion of PFP-TFA (0.15 mL) to complete the PFP ester formation. After being stirred for 48 h the precipitated material was collected by filtration, washed with DMF (20.5 mL), acetone (45 mL) and dried in vacuo to give 0.44 (54% yield) of PFP ester 30 as a brown solid. .sup.1H NMR (DMSO-d6) 12.57 (br s, 1H), 11.84 (br s, 1H), 8.44 (d, J=8.4 Hz, 1H), 8.22 (m, 1H), 8.00 (d, J=8.4 Hz, 2H), 7.86 (m, 4H), 7.62 (s, 1H), 7.45 (m, 4H), 7.16 (s, 1H), 6.89 (d, J=9 Hz, 2H), 4.71 (t, J=7.5 Hz, 2H), 4.23 (t, J=7.2 Hz, 2H), 4.03 (s, 3H), 4.00 (s, 3H), 3.55 (t, J=8.4 Hz, 2H), 3.35 (m, 2H), 3.13 (s, 6H).
Ethyl 5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylate (31)
(173) ##STR00065##
(174) To a suspension of ethyl 5-aminoindole-2-carboxylate (1.5 g, 7.34 mmol) in 40 mL of water was added 1.25 mL of conc. HCl. The stirred suspension was cooled in ice/water bath to 0-4 C. and treated with a solution of NaNO.sub.2 (0.55 g, 8 mmol) in 10 mL of water via an addition funnel over the course of 5 min. The reaction was stirred at 0-4 C. for 20 min then warmed to room temperature and stirred for another 30 min to give a dark, mostly clear solution. 2-(Pyrrolidin-1-yl)-1,3-thiazole (C. Boga et al., Org. Biomol. Chem. 2016, 14, 7061-7068) (1.5 mL, 9.7 mmol) was added in one portion followed by 2.7 g of sodium acetate trihydrate and 7 mL of MeOH and stirring was continued for 3 h. The precipitated solid was collected by filtration, washed with water and resuspended in 100 mL of MeOH. The suspension was heated to reflux then cooled and filtered to collect the precipitated solid. Drying in vacuo afforded 2.35 g (86%) of the desired dye 31 as an orange solid. .sup.1H NMR (DMSO-d6) 12.14 (s, 1H), 8.05 (s, 1H), 7.97 (d, J=1.5 Hz, 1H), 7.68 (dd, J.sub.1=9 Hz, J.sub.2=1.5 Hz, 1H), 7.49 (d, J=9 Hz, 1H), 7.25 (s, 1H), 4.35 (q, J=7.9 Hz, 2H), 3.51 (apparent br s, 4H), 2.00 (m, 4H), 1.34 (t, J=7.2 Hz, 3H).
5-{(E)-[2-(Pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylic Acid (32)
(175) ##STR00066##
(176) A suspension of 31 (2.35 g, 6.3 mmol) in a mixture of THF (135 mL), MeOH (90 mL) and 1N NaOH (45 mL) was heated at 50 C. with stirring for 2.5 h. The reaction was cooled, neutralized with 45 mL of 1N HCl and concentrated to about 80 mL. The precipitated solid was collected by filtration, washed with water and dried to afford 2.17 g (100% yield) of acid 32 as a brown solid. .sup.1H NMR (DMSO-d6) 13.08 (br s, 1H), 12.03 (s, 1H), 8.06 (s, 1H), 7.97 (d, J=1.8 Hz, 1H), 7.68 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.47 (d, J=9 Hz, 1H), 7.20 (d, J=1.2 Hz, 1H), 3.52 (apparent br s, 4H), 2.01 (m, 4H).
Pentafluorophenyl 5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylate (33)
(177) ##STR00067##
(178) To a solution of 32 (1.0 g, 2.92 mmol) and triethylamine (2 mL) in 30 mL of anhydrous CH.sub.2Cl.sub.2 was added PFP-TFA in several 0.5 mL portions over the course of 2 days until no more starting material was found by HPLC analysis. A total of 1.5 mL (8.7 mmol) of PFP-TFA was added. The precipitated product was collected by filtration, washed with small amount (approx. 2 mL) of CH.sub.2Cl.sub.2, 4:1 hexane-ethyl acetate and hexane. Drying in vacuo afforded 0.865 g (58%) of PFP ester 33 as a yellow solid. .sup.1H NMR (DMSO-d6) 12.71 (d, J=1.2 Hz, 1H), 8.11 (s, 1H), 8.07 (d, J=1.8 Hz, 1H), 7.80 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.71 (d, J=1.5 Hz, 1H), 7.58 (d, J=9 Hz, 1H), 3.54 (apparent br s, 4H), 2.03 (m, 4H).
3,6,7,8-Tetrahydro-6-[(5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (34)
(179) ##STR00068##
(180) To a solution of 3,6,7,8-tetrahydro-benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid, (0.79 mmol) and 0.5 mL of triethylamine in 5 mL of DMF was added 0.4 g (0.79 mmol) of PFP ester 33 and the reaction was stirred for 18 h. Precipitated material was collected by filtration, washed with MeOH (25 ml) and dried in vacuo to give 0.414 g (99%) of compound 34 (partial triethylammonium salt) as a yellow solid. .sup.1H NMR (DMSO-d6) 11.98 (s, 1H), 11.73 (s, 1H), 8.26 (d, J=8.1 Hz, 1H), 8.06 (s, 1H), 7.99 (d, J=1.5 Hz, 1H), 7.68 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.53 (d, J=9 Hz, 1H), 7.32 (d, J=9 Hz, 1H), 7.26 (s, 1H), 7.00 (s, 1H), 4.65 (t, J=8.1 Hz, 2H), 3.54 (apparent br s, 4H), 3.43 (t, J=8.1 Hz, 2H), 2.79 (q, J=7.2 Hz, 2H), 2.03 (m, 4H), 1.08 (t, J=7.2 Hz, 3H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[(5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (35)
(181) ##STR00069##
(182) To a suspension of 34 (0.40 g, 0.76 mmol) in 9 mL of anhydrous DMF was added 0.5 mL of triethylamine and 0.2 mL (1.16 mmol) of PFP-TFA. The reaction was stirred for 1 h and treated with another portion of PFP-TFA (0.2 mL) to complete the PFP ester formation. After being stirred for 2 h the reaction was concentrated and the precipitated material was collected by filtration. The solid was resuspended in 2-propanol (5 mL), washed with more 2-propanol (25 mL) and dried to yield 0.57 g (100%) of PFP ester 35. According to NMR analysis the product was partially (approx. 40%) TFA-blocked at one of the indole NH-groups. .sup.1H NMR (DMSO-d6) 12.64 (s, 0.4H), 12.55 (s, 0.6H), 12.00 (s, 1H), 8.5-7.2 (aromatic protons, 8H), 4.69 (m, 2H), 3.52 (m, 6H), 2.03 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (36)
(183) ##STR00070##
(184) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.79 mmol) in 5 mL of anhydrous DMF was added 0.5 mL of triethylamine followed by 0.4 g (0.79 mmol) of PFP ester 33. The mixture was briefly stirred to initially give a clear solution which quickly turned into a suspension due to the product precipitation. The reaction was swirled for 18 h and the precipitated material collected by filtration. The collected solid was washed with MeOH (35 mL), CH.sub.2Cl.sub.2 (10 mL) and dried in vacuo to afford 0.59 g (100%, as triethylammonium salt) of compound 36 as an orange solid. .sup.1H NMR (DMSO-d6) 12.00 (s, 1H), 11.78 (d, J=1.2 Hz, 1H), 11.63 (s, 1H), 8.27 (m, 2H), 8.07 (s, 1H), 7.99 (d, J=1.5 Hz, 1H), 7.69 (dd, J.sub.1=9 Hz, J.sub.2=1.5 Hz, 1H), 7.54 (d, J=9 Hz, 1H), 77.39 (d, J=9 Hz, 1H), 7.31 (d, J=9 Hz, 1H), 7.27 (s, 1H), 7.13 (s, 1H), 6.94 (s, 1H), 4.67 (m, 4H), 3.53 (m, 4H), 3.42 (m, 4H), 2.72 (q, J=7.2 Hz, 4H), 2.03 (m, 4H), 1.05 (t, J=7.2 Hz, 6H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(5-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (37)
(185) ##STR00071##
(186) To a suspension of 36 (0.58 g, 0.8 mmol) in DMF (9 mL) was added triethylamine (0.5 mL) followed by PFP-TFA (0.2 mL). The suspension was stirred for 2 h and treated with another 0.2 mL portion of PFP-TFA and stirring was continued for 3 more days. The precipitated material was collected by filtration, washed with 2-propanol (25 mL) and dried in vacuo to afford 0.40 g (57%) of PFP ester 37 as a yellow solid. .sup.1H NMR (DMSO-d6) 12.56 (s, 1H), 11.99 (s, 1H), 11.82 (s, 1H), 8.42 (br d, J=8.7 Hz, 1H), 8.29 (br d, J=7.5 Hz, 1H), 8.07 (s, 1H), 8.00 (d, J=1.5 Hz, 1H), 7.68 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.61 (d, J=1.2 Hz, 1H), 7.54 (d, J=9 Hz, 1H), 7.44 (d, J=9 Hz, 1H), 7.39 (d, J=9 Hz, 1H), 7.27 (s, 1H), 7.17 (s, 1H), 4.69 (m, 4H), 3.53 (m, 8H), 2.03 (m, 4H).
4-{(E)-[2,5-Dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1-methyl-1H-pyrrole-2-carboxylic Acid (38)
(187) ##STR00072##
(188) 4-[[(1,1-dimethylethoxy)carbonyl]amino]-1-methyl-1H-pyrrole-2-carboxylic acid 90.49 g (2.04 mmol) was treated with 11 mL of conc. HCl for 30 min. The resultant solution was cooled to 0-4 C. and while being stirred treated with a solution of sodium nitrite (0.15 g) in 3 mL of water maintaining the temperature below 5 C. The cold reaction was stirred at 0-4 C. for 2 h before being used in the next step. A solution of 1-(2,5-dimethoxyphenyl)pyrrolidine (0.66 g, 3.2 mmol) in 50 mL of MeOH was added with stirring to the solution of diazonium salt from step 1 followed by 100 mL of 1 NaOH and the reaction was allowed to warm to room temperature. After being stirred for 10 h the reaction was concentrated to approx. 100 mL and the resultant solid collected by filtration. The solid was washed with water and dried in vacuo to afford 0.275 g (37%) of dye 38 as a black solid. .sup.1H NMR (DMSO-d6) 7.65 (s, 1H), 7.29 (s, 1H), 6.99 (d, J=1.8 Hz, 1H), 6.29 (s, 1H), 3.91 (s, 6H), 3.74 (s, 3H), 3.36 (apparent br s, 4H), 1.90 (m, 4H).
Pentafluorophenyl 4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1-methyl-1H-pyrrole-2-carboxylate (39)
(189) ##STR00073##
(190) To a solution of 38 (0.27 g, 0.75 mmol) and triethylamine (0.5 mL) in 7.5 mL of anhydrous CH.sub.2Cl.sub.2 was added PFP-TFA in several 0.1 mL portions over the course of 2 days until no more starting material was found by HPLC analysis. A total of 0.3 mL (1.7 mmol) of PFP-TFA was added. The reaction was concentrated and the residue triturated with 2-propanol (5 mL). The sold material was collected by filtration, washed with small amount (approx. 2 mL) of MeOH and dried to afford 0.17 g (43%) of PFP ester 39 as a brown orange solid. .sup.1H NMR (DMSO-d6) 7.99 (d, J=1.5 Hz, 1H), 7.40 (d, J=1.8 Hz, 1H), 7.21 (s, 1H), 6.26 (s, 1H), 3.96 (s, 3H), 3.89 (s, 3H), 3.71 (s, 3H), 3.49 (m, 4H), 1.88 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6[(4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1-methyl-1H-pyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (40)
(191) ##STR00074##
(192) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.33 mmol) in 2 mL of anhydrous DMF was added 0.3 mL of triethylamine followed by 0.17 g (0.32 mmol) of PFP ester 39. The reaction was stirred at 50 C. for 24 h and then concentrated. The obtained dark residue was triturated with ethyl acetate (10 mL), the precipitated material was collected by filtration, washed with MeOH (25 mL) and dried to afford 0.203 g (84%) of compound 40 as a dark brown solid. .sup.1H NMR (DMSO-d6) 13.00 (br s, 1H), 11.84 (s, 1H), 11.76 (s, 1H), 8.28 (br d, J=7.5 Hz, 1H), 7.98 (br s, 1H), 7.64 (s, 1H), 7.34 (d, J=9H, 2H), 7.20 (s, 1H), 7.09 (s, 1H), 7.05 (s, 1H), 6.88 (s, 1H), 6.28 (s, 1H), 4.65 (t, J=8.1 Hz, 2H), 4.44 (t, J=8.1 Hz, 2H), 3.88 (s, 3H), 3.83 (s, 3H), 3.71 (s, 3H), 3.5-3.4 (m, 8H), 1.88 (m, 4H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6-[(4-{(E)-[2,5-dimethoxy-4-(pyrrolidin-1-yl)phenyl]diazenyl}-1-methyl-1H-pyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (41)
(193) ##STR00075##
(194) To a suspension of 40 (0.197 g, 0.27 mmol) in DMF (3 mL) was added triethylamine (0.2 mL) followed by PFP-TFA (0.1 mL). The suspension was stirred for 20 h and treated with another 0.05 mL portion of PFP-TFA and stirring was continued for 1 more hour. DMF was removed and the residue triturated with 2-propanol (5 mL). The resultant material was collected by filtration, washed with 2-propanol (25 mL) and dried in vacuo to afford 0.218 g (90%) of PFP ester 41 as a brown solid. .sup.1H NMR (DMSO-d6) 12.54 (s, 1H), 11.78 (s, 1H), 8.40 (br d, J=7.8 Hz, 1H), 7.99 (br s, 1H), 7.64 (s, 1H), 7.59 (s, 1H), 7.42 (d, J=9 Hz, 1H), 7.32 (d, J=9 Hz, 1H), 7.20 (s, 1H), 7.11 (s, 1H), 6.88 (s, 1H), 6.28 (s, 1H), 4.66 (t, J=8.1 Hz, 2H), 4.44 (t, J=8.1 Hz, 2H), 3.88 (s, 3H), 3.83 (s, 3H), 3.71 (s, 3H), 3.5-3.4 (m, 8H), 1.88 (m, 4H).
Ethyl 2-[(E)-2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yldiazenyl]-1,3-benzothiazole-6-carboxylate (42)
(195) ##STR00076##
(196) A solution of ethyl 2-amino-1,3-benzothiazole-6-carboxylate (2.22 g, 10 mmol) in a 1:1 mixture of acetic and propionic acids (50 mL) was cooled to 0-4 C. and then treated with 3.1 mL of 40% nitrosylsulfuric acid over the course of 5 min. The resulting suspension was stirred at 0-4 C. for 5 min and then at room temperature for another 5 min to give a clear solution and then cooled back to 0-4 C. before being used in the next step. A solution of julolidine (2.1 g, 12 mmol) in MeOH (15 mL) was combined with a solution of sulfamic acid (0.3 g) in water (100 mL) and then cooled to 0-4 C. To this mixture was added the previously prepared diazonium salt over the course of 5 min. The reaction was stirred for 1 h and then diluted with water (400 mL) and neutralized with 90 mL of triethylamine. The precipitated solid was extracted with ethyl acetate, washed with saturated NaHCO.sub.3, dried over Na.sub.2SO.sub.4 and concentrated under reduced pressure. The obtained residue was triturated with warm 1:1 hexane-ethyl acetate (30 mL) and the resultant solid collected by filtration. Drying under reduced pressure afforded 0.8 g (48%) of sufficiently pure dye 42 as a dark purple solid. .sup.1H NMR (CDCl.sub.3) 8.51 (d, J=1.5 Hz, 1H), 8.11 (skewed dd, J.sub.1=8.7 Hz, J.sub.2=1.5 Hz, 1H), 8.01 (skewed d, J=8.7 Hz, 1H), 7.61 (s, 2H), 4.42 (q, J=7.2 Hz, 2H), 3.39 (t, J=6 Hz, 4H), 2.80 (t, J=6 Hz, 4H), 2.00 (m, 4H), 1.43 (t, J=7.2 Hz, 3H).
2-[(E)-2,3,6,7-Tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yldiazenyl]-1,3-benzothiazole-6-carboxylic Acid (43)
(197) ##STR00077##
(198) To a solution of 42 (0.35 g, 0.86 mmol) in a mixture of THF (18 mL) and MeOH (12 mL) was added 6 mL of 1N NaOH. The reaction was stirred at 50 C. for 1.5 h then cooled, neutralized with 1N HCl (6 mL) and concentrated under reduced pressure to about 10 mL. The resulting precipitate was collected by filtration, washed with water and dried to afford 0.32 g (98%) of compound 43 as a black solid. .sup.1H NMR (DMSO-d6) 13.0 (br s, 1H), 8.54 (d, J=1.5 Hz, 1H), 7.99 (skewed dd, J.sub.1=8.7 Hz, J.sub.2=1.5 Hz, 1H), 7.93 (skewed d, J=8.7 Hz, 1H), 7.47 (s, 2H), 3.43 (t, J=6 Hz, 4H), 2.77 (t, J=6 Hz, 4H), 1.90 (m, 4H).
Pentafluorophenyl 2-[(E)-2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yldiazenyl]-1,3-benzothiazole-6-carboxylate (44)
(199) ##STR00078##
(200) To a solution of 43 (0.32 g, 0.84 mmol) and triethylamine (0.5 mL) in 10 mL of anhydrous DMF was added PFP-TFA in several portions over the course of 3 hours until no more starting material was found by HPLC analysis. A total of 0.5 mL (2.9 mmol) of PFP-TFA was added. The reaction was concentrated under reduced pressure and the residue chromatographed on silica eluting with a gradient of ethyl acetate in hexane. Concentration of the pure product fractions afforded 0.13 g (28%) of PFP ester 44 as a dark purple solid. .sup.1H NMR (DMSO-d6) 8.86 (d, J=1.8 Hz, 1H), 8.18 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.8 Hz, 1H), 8.05 (skewed d, J=8.4 Hz, 1H), 7.52 (s, 2H), 3.47 (t, J=6 Hz, 4H), 2.79 (t, J=6 Hz, 4H), 1.92 (m, 4H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yldiazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (45)
(201) ##STR00079##
(202) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.24 mmol) in 2 mL of anhydrous DMF was added 0.2 mL of triethylamine followed by 0.13 g (0.24 mmol) of PFP ester 44. After being stirred at 50 C. for 6 h the reaction was concentrated under reduced pressure to yield a dark purple residue. To isolate the product the residue was resuspended in MeOH (10 mL), the precipitated material was collected by filtration, washed with MeOH (25 mL) and dried to afford 0.181 g (100%) of compound 45 as a dark purple solid. .sup.1H NMR (DMSO-d6) 12.9 (br s, 1H), 11.84 (s, 1H), 11.76 (s, 1H), 8.4-8.1 (m, 3H), 7.98 (d, J=8.4 Hz, 1H), 7.68 (br d, J=7.8 Hz, 1H), 7.48 (s, 2H), 7.3 (m, 2H), 7.07 (d, J=1.5 Hz, 1H), 7.05 (d, J=1.5 Hz, 1H), 4.63 (t, J=7.8 Hz, 2H), 4.20 (t, J=7.5 Hz, 2H), 3.4 (m, 6H), 3.27 (m, 2H), 2.78 (t, J=6 Hz, 4H), 1.91 (m, 4H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-2,3,6,7-tetrahydro-1H,5H-pyrido[3,2,1-ij]quinolin-9-yldiazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (46)
(203) ##STR00080##
(204) To a suspension of 45 (0.175 g, 0.23 mmol) in DMF (2.5 mL) was added triethylamine (0.2 mL) followed by two 0.1 mL portions of PFP-TFA over the course of 3 hours. DMF was removed under reduces pressure and the residue triturated with 2-propanol (5 mL). The resultant insoluble material was collected by filtration, washed with 2-propanol (25 mL) and dried under reduced pressure to afford 0.20 g (95%) of PFP ester 46 as a dark purple solid. .sup.1H NMR (DMSO-d6) 12.53 (s, 1H), 11.78 (s, 1H), 8.6-7.0 (aromatic protons, 11H), 4.66 (t, J=7.8 Hz, 2H), 4.20 (t, J=7.5 Hz, 2H), 3.9-3.0 (m, 8H), 3.27 (m, 2H), 2.77 (m, 4H), 1.90 (m, 4H).
Ethyl 6-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazole-2-carboxylate (47)
(205) ##STR00081##
(206) To a suspension of ethyl 5-amino-1,3-benzothiazole-2-carboxylate (prepared by Fe/NH.sub.4Cl/water/EtOH reduction of ethyl 5-nitro-1,3-benzothiazole-2-carboxylate (U.S. Pat. No. 8,586,759)) (0.9 g, 3.57 mmol) in water (20 mL) was added conc. HCl (0.625 mL). The mixture was stirred at room temperature for 5 min and then cooled to 0-4 C. A solution of NaNO.sub.2 (0.246 g) in water (5 mL) was added with stirring over the course of 5 min. The reaction was stirred for 10 min and then warmed to room temperature and stirred for another 10 min. To the resultant solution of diazonium salt was added a solution of 2-(pyrrolidin-1-yl)-1,3-thiazole (0.66 g, 4.28 mmol) in 10 mL of methanol followed by solid sodium acetate, trihydrate (1.35 g). The reaction was stirred at room temperature for 2 h to give a thick orange suspension. The precipitated material was collected by filtration, washed with water and dried to give crude product, which was then re-crystallized from ethyl acetate to afford 0.91 g (66%) of dye 47 as an orange solid. .sup.1H NMR (DMSO-d6) 8.45 (d, J=1.8 Hz, 1H), 8.26 (s, 1H), 8.24 (d, J=9 Hz, 1H), 7.92 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 4.44 (q, J=6.9 Hz, 2H), 3.56 (br s, 4H), 2.14 (m, 4H), 1.34 (t, J=6.9 Hz, 3H).
6-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazole-2-carboxylic Acid (48)
(207) ##STR00082##
(208) To a solution of 47 (0.90 g, 2.32 mmol) in a mixture of THF (48 mL) and MeOH (32 mL) was added 16 mL of 1N NaOH. The reaction was stirred at 50 C. for 1.5 h then cooled, neutralized with 1N HCl (16 mL) and concentrated under reduced pressure to about 30 mL. The resulting precipitate was collected by filtration, washed with water and dried to afford 0.81 g (97%) of compound 48 as a black solid. .sup.1H NMR (DMSO-d6) 8.40 (s, 1H), 8.22 (s, 1H), 8.19 (d, J=8.4 Hz, 1H), 7.88 (d, J=8.4 Hz, 1H), 3.55 (br s, 4H), 2.01 (br s, 4H).
Pentafluorophenyl 6-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazole-2-carboxylate (49)
(209) ##STR00083##
(210) Prior to reaction starting acid 48 (0.8 g, 2.22 mmol) was dried by co-evaporation with anhydrous DMF (10 mL) supplemented with 0.5 mL of triethylamine and then re-dissolved in a fresh portion of DMF (10 mL). To this solution was added triethylamine (0.5 mL) followed by PFP-TFA (0.4 mL, 2.3 mmol). Within minutes a thick suspension was obtained. The reaction was agitated on an orbital shaker for 1 h, then concentrated under reduced pressure and the resultant residue chromatographed on silica eluting with ethyl acetate. Concentration of the product-containing fractions and re-crystallization from ethyl acetate afforded 0.803 g (69%) of PFP ester 49 as a red solid. .sup.1H NMR (CDCl.sub.3) 8.34 (d, J=1.8 Hz, 1H), 8.32 (d, J=9 Hz, 1H), 8.14 (s, 1H), 8.07 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 3.67 (br s, 4H), 2.03 (m, 4H).
3,6,7,8-Tetrahydro-6-[(6-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (50)
(211) ##STR00084##
(212) To a solution of 3,6,7,8-tetrahydro-benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (0.69 mmol) and 0.45 mL of triethylamine in 4.5 mL of DMF was added 0.35 g (0.67 mmol) of PFP ester 49. The reaction was stirred for 2 hours at 50 C. and cooled to room temperature. The precipitated material was collected by filtration, washed with DMF (2 mL), acetone (315 mL), methanol (210 ml) and dried to give 0.375 g (100%) of compound 50 as a brick-red solid. .sup.1H NMR (DMSO-d6) 11.70 (s, 1H), 8.39 (s, 1H), 8.28 (d, J=9.3 Hz, 1H), 8.22 (s, 1H), 8.17 (d, J=9 Hz, 1H), 7.87 (d, J=9 Hz, 1H), 7.32 (d, J=9.3 Hz, 1H), 6.93 (s, 1H), 4.89 (m, 2H), 3.7-3.3 (m, 6H), 2.01 (br s, 4H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[(6-{(E)-[2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (51)
(213) ##STR00085##
(214) PFP-TFA (a total of 0.35 mL, 1.63 mmol) was added in several portions over the course of 20 h to a suspension of 50 (0.36 g, 0.66 mmol) and triethylamine (0.4 mL) in 5 mL of anhydrous DMF until no more starting material was found by HPLC analysis. The reaction was concentrated under reduced pressure and the obtained semi-solid residue resuspended in methanol (25 mL). The resulting solid was collected by centrifugation at 4,000 rpm for 10 min, methanol decanted and the procedure was repeated two more times. Drying under reduced pressure afforded 0.340 g (72%) of PFP ester 51 as a brick-red solid. .sup.1H NMR (DMSO-d6) 12.62 (s, 1H), 8.48 (8.46 (d, J=9 Hz, 1H), 8.44 (d, J=1.5 Hz, 1H), 8.25 (s, 1H), 8.21 (d, J=9 Hz, 1H), 7.90 (dd, J.sub.1=9 Hz, J.sub.2=1.5 Hz, 1H), 7.62 (s, 1H), 7.46 (d, J=9 Hz, 1H), 4.95 (t, J=8.1 Hz, 2H), 3.55 (br s, 4H), 3.50 (t, J=8.4 Hz, 2H), 2.03 (m, 4H).
4-Phenyl-2-(pyrrolidin-1-yl)-1,3-thiazole (52)
(215) ##STR00086##
(216) A mixture of 2-Bromo-4-phenyl-1,3-thiazole (5.4 g, 22.5 mmol) and pyrrolidine (5 mL, 60 mmol) was heated at 80 C. for 2.5 h, then cooled and concentrated. The resultant semi-solid was resuspended in 1:2 ethyl-acetate-hexane and the precipitate pyrrolidinium bromide removed by filtration. The filtrate was concentrated and the residue chromatographed on silica eluting with 1:2 ethyl acetate-hexane to afford 5.15 g of compound 52 as a colorless crystalline solid. .sup.1H NMR (CDCl.sub.3) 7.86 (m, 1H), 7.83 (m, 1H), 7.36 (dt, J.sub.1=6 Hz, J.sub.2=1.5 Hz, 2H), 7.26 (skewed dt, J.sub.1=6 Hz, J.sub.2=1.5 Hz, 1H), 6.66 (s, 1H), 3.51 (m, 4H), 2.04 (m, 4H).
Ethyl 5-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylate (53)
(217) ##STR00087##
(218) To a suspension of ethyl 5-aminoindole-2-carboxylate (0.75 g, 3.67 mmol) in 20 mL of water was added 0.625 mL of conc. HCl. The stirred suspension was cooled in ice/water bath to 0-4 C. and treated with a solution of NaNO.sub.2 (0.275 g, 3.98 mmol) in 5 mL of water over the course of 5 min. The reaction was stirred at 0-4 C. for 30 min then warmed to room temperature and stirred for another 30 min. To this solution was added a solution of 52 (1.1 g, 4.85 mmol) in 16 mL of methanol followed by sodium acetate, trihydrate (1.35 g) and stirring was continued for 5 h. The resultant precipitated was collected by filtration, washed with water, resuspended in 20 mL of MeOH and dried. The crude dye was re-crystallized from methanol to afford 1.42 g (87%) of dye 53 as an orange-red solid. .sup.1H NMR (CDCl.sub.3) 8.96 (br s, 1H), 8.34 (dd, J.sub.1=8.1 Hz, J.sub.2=1.5 Hz, 2H), 8.07 (d, J=1.8 Hz, 1H), 7.85 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.55-7.35 (m, 4H), 7.30 (s, 1H), 4.42 (q, J=6.9 Hz, 2H), 3.66 (br s, 4H), 2.10 (m, 4H), 1.43 (t, J=6.9 Hz, 3H).
5-{(E)-[4-Phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylic Acid (54)
(219) ##STR00088##
(220) A suspension of 53 (1.3 g, 2.92 mmol) in a mixture of THF (60 mL) and methanol (40 mL) was added 1N NaOH (20 mL). The reaction was stirred at 50 C. for 1.5 h, then cooled, neutralized with 1N HCl (20 mL) and concentrated to approx. 40 mL. The precipitated material was collected by filtration, washed with water and dried to afford 1.22 g (100%) of acid 54 as a dark brown solid. .sup.1H NMR (DMSO-d6) 12.03 (s, 1H), 8.29 (d, J=8.7 Hz, 2H), 7.98 (d, J=1.5 Hz, 1H), 7.69 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.6-7.4 (m, 4H), 7.20 (d, J=1.5 Hz, 1H), 3.59 (br s, 4H), 2.04 (br s, 4H).
Pentafluorophenyl 5-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indole-2-carboxylate (55)
(221) ##STR00089##
(222) Acid 54 (1.22 g, 2.92 mmol) was first dried by co-evaporation with anhydrous DMF (15 mL) then re-dissolved in fresh portion of DMF (15 mL) and treated with triethylamine (1 mL) and PFP-TFA (0.57 mL, 3.3 mmol). After being stirred at room temperature for 3 h the reaction was concentrated under reduced pressure and the resultant sold resuspended in methanol (15 mL). The insoluble material was collected by filtration, washed with methanol (25 mL) and dried to afford 1.71 g (87% as a DMF adduct) of PFP ester 55 as an orange solid. .sup.1H NMR (CDCl.sub.3) 9.09 (br s, 1H), 8.34 (m, 2H), 8.11 (d, J=1.8 Hz, 1H), 8.02 (br s, 1H, DMF), 7.94 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.62 (d, J=1.8 Hz, 1H), 7.55-7.35 (m, 4H), 3.67 (br s, 4H), 2.96 (s, 3H, DMF), 2.89 (s, 3H, DMF), 2.12 (m, 4H).
3,6,7,8-Tetrahydro-6-[(5-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (56)
(223) ##STR00090##
(224) To a solution of 3,6,7,8-tetrahydro-benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (0.79 mmol) in 5 mL of DMF was added 0.5 mL of triethylamine followed by 0.53 g (0.79 mmol) of PFP ester 55. The mixture was stirred for a few minutes to give an almost complete solution before product precipitation began. The suspension was heated at 50 C. for 2 h and then diluted with methanol (10 mL). The precipitate was collected by filtration, washed with methanol (310 mL) and dried to afford 0.545 g (100% as triethylammonium salt) of compound 56 as an orange-red solid. .sup.1H NMR (DMSO-d6) 11.95 (s, 1H), 11.56 (s, 1H), 8.31 (m, 2H), 8.22 (br d, J=8.4 Hz, 1H), 7.99 (d, J=1.5 Hz, 1H), 7.69 (dd, J.sub.1=9 Hz, J.sub.2=1.8 Hz, 1H), 7.6-7.4 (m, 4H), 7.29 (d, J=9 Hz, 1H), 7.26 (s, 1H), 6.89 (s, 1H), 4.65 (t, J=8.1 Hz, 2H), 3.60 (br s, 4H), 3.41 (t, J=8.4 Hz, 2H), 2.67 (q, J=6.9 Hz, 6H), 2.04 (m, 4H), 1.03 (t, J=7.2 Hz, 9H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[(5-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1H-indol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (57)
(225) ##STR00091##
(226) Before starting the reaction, acid 56 (0.545 g, 0.79 mmol) was dried by co-evaporation with anhydrous DMF (20 mL), then re-dissolved in fresh portion of DMF (6 mL) and treated with triethylamine (0.5 mL). PFP-TFA was added in several 0.1 mL portions over the period of 9 h until no more starting acid 56 was found by HPLC analysis. A total of 0.8 mL (4.66 mmol) of PFP-TFA was added. The resultant suspension was concentrated and the residue triturated in methanol (10 mL). The solid was collected by filtration, washed with methanol and dried to afford 0.6 g (99%) of PFP ester 57 as a red-orange solid. This product was partially TFA-blocked at the indole NH groups. .sup.1H NMR (DMSO-d6) 12.55 (s, 0.4H), 11.98 (s, 1H), 8.33 (m, 2H), 8.00 (s, 1H), 7.8-7.2 (aromatic protons, approx. 9H), 4.70 (t, J=8.4 Hz, 2H), 3.60 (br s, 4H), 5.52 (m obscured by water signal, 2H), 2.05 (br s, 4H).
3,6,7,8-Tetrahydro-6-[[6-acetyl-3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (58)
(227) ##STR00092##
(228) Acetic anhydride (0.12 mL, 1.27 mmol) was added to a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (1.0 mmol) and 0.4 mL of triethylamine in 10 mL of DMF. Precipitation of the product started within minutes after the addition. Reaction was allowed to continue for 15 h, the precipitated material was collected by filtration, washed with acetone (315 mL) and dried to afforded 0.36 g (84%) of 58 as an off-white solid. .sup.1H NMR (DMSO-d6) 13.0 (br s, 1H), 11.85 (d, J=1.8 Hz, 1H), 11.70 (d, J=1.8 Hz), 8.28 (br d, J=8.7 Hz, 1H), 8.17 (d, J=8.7 Hz, 1H), 7.33 (d, J=9.3 Hz, 1H), 7.29 (d, J=8.4 Hz, 1H), 7.07 (d, J=1.2 Hz, 1H), 7.05 (d, J=1.5 Hz, 1H), 4.65 (t, J=8.1 Hz, 2H), 4.22 (t, J=8.4 Hz, 2H), 3.43 (t, 8.1 Hz, 2H), 3.39 (m partially obscured by the water signal, 2H), 2.18 (s, 3H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[6-acetyl-3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (59)
(229) ##STR00093##
(230) PFP-TFA was added in several portions (0.04-0.12 mL each) with stirring over the period of 20 h to a solution of 58 (0.35 g, 0.82 mmol) and triethylamine (0.4 mL) in 10 mL of anhydrous DMF until no more starting material was found by HPLC analysis. DMF was removed under reduced pressure and the residue resuspended in acetone (10 mL). The insoluble material was collected by filtration, washed with acetone and dried to afford 0.46 g (94%) of 59 as an off-white solid. .sup.1H NMR (DMSO-d6) 12.56 (d, J=1.8 Hz, 1H), 11.73 (d, J=1.5 Hz), 8.44 (br d, J=9.3 Hz, 1H), 8.19 (d, J=9 Hz, 1H), 7.97 (s, 1H), 7.61 (d, J=1.5 Hz, 1H), 7.45 (d, J=9 Hz, 1H), 7.31 (d, 9 Hz, 1H), 7.08 (d, J=1.5 Hz, 1H), 4.69 (t, J=8.4 Hz, 2H), 4.22 (t, J=8.4 Hz, 2H), 3.49 (t, 8.4 Hz, 2H), 3.39 (m partially obscured by the water signal, 2H), 2.19 (s, 3H).
Example 2. Preparation of DSQ-Modified 6-aminohexane-1,2-diol Synthesis Solid Supports
(6-N-(Fluorenylmethoxycarbonyl)amino-1-(4,4-dimethoxytriphenylmethoxy)hex-2-yl)oxy-4-oxobutanoyl Polystyrene Support (ID #349 PS)
(231) ##STR00094##
(232) (6-N-(Fluorenylmethoxycarbonyl)amino-1-(4,4-dimethoxytriphenylmethoxy)hex-2-yl)oxy-4-oxobutanoyl Polystyrene Support (ID #349 PS) (DMT loading 20 mol/g) was prepared in the same manner as the CPG support described in U.S. Pat. No. 6,492,346 starting from aminomethyl polystyrene support (33 mmol/g, Applied Biosystems PN 360865C).
Example 3. Preparation of Polystyrene Supports
(233) General Procedure for the Preparation of Polystyrene Supports ID #473, 474-477, 479, 481-488
(234) Step 1. FMOC Deprotection
(235) Polystyrene support (ID #349 PS) (2.0 g) was resuspended in 15 mL of 0.2 M solution of 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in DMF and agitated on an orbit shaker for 10 min. DMF was removed by filtration and the procedure was repeated two more times. The polystyrene support was then washed with either DMF or N-Methyl-2-pyrrolidone (NMP) (350 mL), depending on the choice of solvent in the next step, and immediately reacted with a PFP ester as described below.
(236) Step 2. PFP Ester Coupling
(237) A solution of one of the PFP ester (50 mol) synthesized as described above in Example 1 (complete list of PFP esters used in this reaction is shown in Table 3) and triethylamine (0.2 mL) in 8.5 mL of a solvent indicated in Table 3 was combined with the polystyrene support from Step 1. The suspension was agitated for the period of time indicated in Table 3 then filtered, washed with the same solvent (350 mL) and immediately taken to the next step.
(238) TABLE-US-00003 TABLE 3 Step 2 Resultant Step 2 reaction Polystyrene PFP ester time (h) Solvent Support ID # 5 18 DMF 473 10 18 NMP 475 20 18 NMP 476 15 18 NMP 477 25 12 NMP 479 30 16 NMP 481 59 20 NMP 482 41 12 DMF 483 35 20 NMP 484 37 24 NMP 485 46 20 DMF 486 51 22 NMP 487 49 24 NMP 488 33 24 NMP 489 57 15 NMP 490
(239) Step 3. Blocking Unreacted Amino Groups
(240) The support from step 2 was resuspended in 18 mL of pyridine and treated with 2 mL of acetic anhydride. The suspension was agitated for 30 min, then filtered, washed with DMF (350 mL) and acetone (350 mL) and dried under reduced pressure.
Example 4. Preparation of Polystyrene Support ID #478
Ethyl 2-[(E)-{4-[(6-acetyloxyhexyl)(methyl)amino]phenyl}diazenyl]-1,3-benzothiazole-6-carboxylate (60)
(241) ##STR00095##
(242) To a cold (0-4 C.) suspension of ethyl 2-amino-1,3-benzothiazole-6-carboxylate (0.444 g, 2.0 mmol) in a mixture of acetic (5 mL) and propionic (5 mL) acids was added dropwise 0.62 mL of 40% nitrosylsulfuric acid with stirring. After being stirred for 3 h an almost clear yellow-orange solution was obtained which was immediately used in the next step. The solution of diazonium salt was added in several portions to a cold (0-4 C.) mixture prepared by combining a solution of 6-[methyl(phenyl)amino]hexyl acetate (WO 2008008481) (0.6 g, 2.4 mmol) in 2.5 mL of MeOH and a solution of sulfamic acid (0.060 g) in 20 mL of water. The reaction was stirred at 0-4 C. for 2 hours, neutralized by adding saturated NaHCO.sub.3 in several portions and the precipitated material extracted with ethyl acetate. The extract was concentrated under reduced pressure and the obtained residue triturated with 4:1 hexane-ethyl acetate (30 mL). The resulting solid was collected by filtration, washed with MeOH (15 mL) and dried to afford 0.415 g (42%) of azo-dye 60 as a black solid. .sup.1H NMR (CDCl.sub.3) 8.55 (s, 1H), 8.13 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.2 Hz, 1H), 8.07 (skewed d, J=8.4 Hz, 1H), 8.00 (d, J=9.3 Hz, 2H), 6.76 (d, J=9.3 Hz, 2H), 4.43 (q, J=7.2 Hz, 2H), 4.07 (t, J=6.6 Hz, 2H), 3.49 (t, J=7.5 Hz, 2H), 3.14 (s, 3H), 2.05 (s, 3H), 1.66 (m, 4H), 1.44 (m, 7H).
2-[(E)-{4-[(6-hydroxyhexyl)(methyl)amino]phenyl}diazenyl]-1,3-benzothiazole-6-carboxylic Acid (61)
(243) ##STR00096##
(244) 1N NaOH (6 mL) was added to a solution of azo-dye 60 (0.415 g, 0.86 mmol) in a mixture of THF (18 mL) and MeOH (12 mL). The reaction was heated at 50 C. with stirring for 1.5 h, then cooled to room temperature, neutralized with 1 N HCl (6 mL) and concentrated under reduced pressure to about 10 mL. The resulting precipitate was collected by filtration, washed with water and dried to yield 0.356 g (100%) of compound 61 as a black solid. .sup.1H NMR (DMSO-d6) 13.08 (s, 1H), 8.58 (s, 1H), 7.99 (s, 2H), 7.83 (d, J=9.3 Hz, 2H), 6.92 (d, J=9.3 Hz, 2H), 4.32 (br s, 1H), 3.51 (t, J=6.9 Hz, 2H), 3.35 (m, 2H), 3.12 (s, 3H), 1.56 (m, 2H), 1.36 (m, 2H), 1.29 (m, 4H).
Pentafluorophenyl 2-[(E)-{4-[(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhexyl)(methyl)amino]phenyl}diazenyl]-1,3-benzothiazole-6-carboxylate (62)
(245) ##STR00097##
(246) Compound 61 (0.355 g, 0.86 mmol) was dried by co-evaporation with anhydrous pyridine (25 mL) and then re-dissolved in a fresh portion of pyridine (10 mL). Dimethoxytrityl chloride (0.336 g, 1.0 mmol) was added, the reaction was stirred for 3 h and treated with PFP-TFA (0.4 mL, 2.3 mmol) and allowed to react for another 3 h. Pyridine was removed under reduced pressure and the residue partitioned between ethyl acetate and 10% citric acid. The organic phase was dried over Na.sub.2SO.sub.4, concentrated and the resulting material chromatographed on silica eluting with a gradient of ethyl acetate in hexane (30 to 50%). Fractions containing the desired product were concentrated to give 0.45 g (59%) of PFP ester 62 as an amorphous dark purple solid. This material was sufficiently pure for subsequent use.
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-{4-[(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhexyl)(methyl)amino]phenyl}diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (63)
(247) ##STR00098##
(248) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (0.45 mmol) in 8 mL of anhydrous DMF was added 0.5 mL of triethylamine followed by 0.4 g (0.45 mmol) of PFP ester 62. After being stirred at room temperature for 20 h the reaction was concentrated under reduced pressure. The obtained residue was resuspended in acetone (10 mL), the precipitated material was collected by filtration, washed with more acetone (25 mL) and dried to afford 0.41 g (84%) of compound 63 as a black solid. .sup.1H NMR (DMSO-d6) 11.85 (s, 1H), 11.78 (s, 1H), 8.5-6.9 (aromatic protons, 26H), 4.64 (m, 2H), 4.21 (m, 2H), 3.74 (s, 6H), 3.6-3.2 (m, 8H), 3.13 (s, 3H), 1.58 (m, 4H), 1.36 (m, 2H), 1.28 (m, 2H).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-{4-[(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhexyl)(methyl)amino]phenyl}diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (64)
(249) ##STR00099##
(250) To a suspension of 63 (0.285 g, 0.26 mmol) in DMF (4 mL) was added triethylamine (0.2 mL) followed PFP-TFA (0.1 mL). After being stirred for 1 h the reaction was concentrated and the resulting residue resuspended in acetone (10 mL). The solid material was collected by filtration, washed with acetone (25 mL) and dried under reduced pressure to afford 0.25 g (77%) of PFP ester 64 as a dark brawn solid. .sup.1H NMR (DMSO-d6) 12.54 (s, 1H), 11.80 (s, 1H), 8.5-6.9 (aromatic protons, 26H), 4.68 (m, 2H), 4.22 (m, 2H), 3.74 (s, 6H), 3.6-3.2 (m, 8H), 3.13 (s, 3H), 1.58 (m, 4H), 1.36 (m, 2H), 1.28 (m, 2H).
(251) Preparation of Polystyrene Support ID #478
(252) ##STR00100##
(253) (N-MMT-5-aminopentyl)glycolate polystyrene support (U.S. Pat. No. 7,381,818) (5.0 g, 20 umol/g MMT loading) was deprotected by suspending in 30 mL of 3% trichloactetic acid in CH.sub.2Cl.sub.2 and filtration. The procedure was repeated approx. 10 times until no more yellow color was observed. The support then was washed with CH.sub.2Cl.sub.2, 10% triethylamine/CH.sub.2Cl.sub.2 and N-methylpyrrolidinone (NMP) before being resuspended in a solution of 64 (0.156 g, 0.12 mmol, 25 umol/g offering) and triethylamine (0.2 mL) in 25 mL of NMP. The suspension was swirled on an orbital shaker for 18 h then filtered and washed with NMP. To block unreacted aminogroups the support was suspended in pyridine (22.5 mL), treated with acetic anhydride (2.5 mL) and swirled for 30 min. The blocking reagents were removed by filtration and the support was washed with several 50 mL portions of NMP and acetone followed by drying under reduced pressure to afford polystyrene support ID #478 as a light purple solid. DMT loading was 19.0 mol/g according to a colorimetric acid cleavage test.
Example 5. Preparation of Polystyrene Support ID #480
3-[Methyl(phenyl)amino]propyl Acetate (65)
(254) ##STR00101##
(255) A mixture of N-methylaniline (23.6 mL, 0.218 mol), 3-chloropropylacetate (32.4 ml, 0.266 mol), diisopropylethylamine (46.4 mL, 0.267 mol) and sodium iodide (2.2 g, 14.7 mmol) was heated at 120 C. with stirring for 7 h before being cooled and partioned between water (500 mL) and ethyl acetate (200 mL). The organic phase was washed with brine, dried over Na.sub.2SO.sub.4 and concentrated. The resultant crude product was purified by vacuum distillation at 1 mmHg with the desired product distilling at approx. 110 C. yielding 35.8 g (80%) of 3-[methyl(phenyl)amino]propyl acetate (65) as a pale yellow liquid. .sup.1H NMR (CDCl.sub.3) 7.7 (m, 2H), 6.7 (m, 3H), 4.11 (t, J=6.3 Hz, 2H), 3.42 (t, J=6.9 Hz, 2H), 2.93 (s, 3H), 2.07 (s, 3H), 1.91 (p, J=6.6 Hz, 2H).
2-[(E)-(4-{[3-(Acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazole-6-carboxylic Acid (66)
(256) ##STR00102##
(257) To a cold (0-4 C.) suspension of 2-amino-1,3-benzothiazole-6-carboxylic acid (1.25 g, 6.25 mmol) in a mixture of acetic (16 mL) and propionic (16 mL) acids was added dropwise 40% nitrosylsulfuric acid (2.0 mL) over the course of 5 min. The reaction was stirred at 0-4 C. for 2 h and then at room temperature for 2 h to give a light yellow suspension. This suspension was added slowly (approx. 5 min) to a cold (0-4 C.) mixture prepared by combining a solution of 3-[methyl(phenyl)amino]propyl acetate (65) (1.6 g, 7.7 mmol) in methanol (8 mL) and a solution of sulfamic acid (0.2 g) in water (65 mL). After being stirred for 1 h, the reaction was neutralized by adding 65 mL of triethylamine and diluted with water (500 mL). The precipitated solid was collected by filtration, washed with water and dried. The crude dye was triturated with 4:1 hexane-ethyl acetate (20 mL) and the solid was collected by filtration. Drying under reduced pressure afforded 1.66 g (64%) of sufficiently pure azo-dye 66 as a black solid. .sup.1H NMR (DMSO-d6) 8.62 (s, 1H), 8.04 (s, 2H), 7.89 (d, J=9 HZ, 2H), 6.98 (d, J=9 Hz, 2H), 4.07 (t, J=6 Hz, 2H), 3.66 (t, J=6.6 Hz, 2H), 3.16 (s, 3H), 2.04 (s, 3H), 1.93 (p, J=6.3 Hz, 2H).
Pentafluorophenyl 2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazole-6-carboxylate (67)
(258) ##STR00103##
(259) To a solution of 66 (1.66 g, 4.0 mmol) and triethylamine (0.5 mL) in 10 mL of anhydrous CH.sub.2Cl.sub.2 was added PFP-TFA in two portions over the course of 3 hours until no more starting material was found by HPLC analysis. A total of 1.1 mL (6.4 mmol) of PFP-TFA was added. The reaction was concentrated under reduced pressure and the residue resuspended in 20 mL of methanol. The precipitate was collected by filtration, washed with methanol and dried to afford 1.88 g (81%) of PFP ester 67 as dark purple solid. .sup.1H NMR (CDCl.sub.3) 8.72 (s, 1H), 8.27 (skewed dd, J.sub.1=8.4 Hz, J.sub.2=1.2 Hz, 1H), 8.16 (d, J=8.7 Hz, 1H), 8.03 (d, J=9 Hz, 2H), 6.79 (d, J=9 Hz, 2H), 4.16 (t, J=6 Hz, 2H), 3.63 (t, J=7.2 Hz, 2H), 3.18 (s, 3H), 2.11 (s, 3H), 2.03 (m, 2H).
3,6,7,8-Tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (68)
(260) ##STR00104##
(261) To a solution of 3,6,7,8-tetrahydro-6-[(3,6,7,8-tetrahydrobenzo[1,2-b:4,3-b]dipyrrol-2-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole]-2-carboxylic acid (3.05 mmol) in 20 mL of anhydrous DMF was added 2 mL of triethylamine followed by 1.8 g (3.11 mmol) of PFP ester 67. The reaction was stirred at 50 C. for 3 h and then concentrated. The obtained dark residue was triturated with acetone (30 mL), the resultant solid was collected by filtration, washed with acetone (210 mL) and dried to afford 2.55 g (107% due to a partial triethylammonium salt form) of compound 68 as a dark brown-purple solid. .sup.1H NMR (DMSO-d6) 11.77 (s, 1H), 11.62 (s, 1H), 8.32 (s, 1H), 8.2 (m, 2H), 8.07 (d, J=8.4 Hz, 1H), 7.89 (d, J=9 Hz, 2H), 7.74 (br d, J=8.1 Hz, 1H), 7.35 (br s, 1H), 7.29 (d, J=9 Hz, 1H), 7.08 (s, 1H), 6.98 (d, J=9.3 Hz, 2H), 6.92 (s, 1H), 4.63 (t, J=7.5 Hz, 2H), 4.21 (t, 2H), 4.07 (t, J=6 Hz, 2H), 3.66 (t, J=6.3 Hz, 2H), 3.40 (t, J=7.5 Hz, 2H), 3.31 (t, J=7.5 Hz, 2H), 3.16 (s, 3H), 2.73 (m, 5H, Et.sub.3NH.sup.+), 2.04 (s, 3H), 1.95 (m, 2H), 1.05 (t, J=7.2 Hz, 8H, Et.sub.3NH.sup.+).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (69)
(262) ##STR00105##
(263) To a suspension of 68 (2.55 g g, 2.67 mmol) in 25 mL of anhydrous DMF was added triethylamine (1 mL) followed by PFP-TFA in several portions over the course of 4 hours until no more starting material was found by HPLC analysis. A total of 0.91 mL (5.3 mmol) of PFP-TFA was added. The precipitate was collected by filtration, washed with acetone (320 mL) and dried to afford 2.40 g (95%) of PFP ester 69 as a red-purple solid. .sup.1H NMR (DMSO-d6) 12.54 (s, 1H), 11.80 (s, 1H), 8.5-8.2 (m, 3H), 8.07 (d, J=8.7 Hz, 1H), 7.89 (d, J=9 Hz, 2H), 7.74 (br d, J=8.1 Hz, 1H), 7.59 (s, 1H), 7.43 (d, J=8.7 Hz, 1H), 7.37 (br s, 1H), 7.11 (s, 1H), 6.98 (d, J=9.3 Hz, 2H), 4.68 (t, J=7.5 Hz, 2H), 4.22 (t, J=6.3 Hz, 2H), 4.07 (t, J=6.3 Hz, 2H), 3.66 (t, J=6.2 Hz, 2H), 3.48 (t, J=7.2 Hz, 2H), 3.31 (t, J=7.5 Hz, 2H), 3.16 (s, 3H), 2.04 (s, 3H), 1.93 (m, 2H).
N-(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhex-1-yl)-3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (70)
(264) ##STR00106##
(265) A solution of O-DMT-, N-Fmoc-protected 6-aminohexan-1-ol (S. Mahajan (2006)) (0.55 g, 0.86 mmol) in a mixture of DMF (6 mL) and triethylamine (6 mL) was heated at 80 C. for 1 h, then concentrated and re-dissolved in a fresh portion of DMF (30 mL) supplemented with triethylamine (0.45 mL). To this solution was added 0.74 g (0.78 mmol) of 69 and the reaction was stirred at 50 C. for 5 h and then at room temperature for 18 h. DMF was removed under reduced pressure and the resultant residue triturated with methanol. Filtration of the obtained solid followed by washing with methanol and drying yielded 0.885 g (87%) of compound 70 as a purple solid. .sup.1H NMR (DMSO-d6) 11.78 (s, 1H), 11.64 (s, 1H), 8.45 (br t, 1H), 8.33 (s, 1H), 8.20 (m, 2H), 8.08 (d, J=8.4 Hz, 1H), 7.90 (d, J=9.3 Hz, 2H), 7.75 (br d, J=6.9 Hz, 1H), 7.4-7.25 (m, 11H), 7.08 (s, 2H), 6.98 (d, J=9.3 Hz, 2H), 6.89 (d, J=9 Hz, 4H), 4.65 (t, J=7.5 Hz, 2H), 4.22 (t, J=6.3 Hz, 2H), 4.07 (t, J=6 Hz, 2H), 3.73 (s, 6H), 3.66 (t, J=6.2 Hz, 2H), 3.43 (t, J=7.2 Hz, 2H), 3.28 (m, 4H), 3.16 (s, 3H), 2.96 (t, J=6 Hz, 2H), 2.04 (s, 3H), 1.94 (m, 2H), 1.55 (m, 4H), 1.32 (m, 4H).
N-(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhex-1-yl)-3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-hydroxypropyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (71)
(266) ##STR00107##
(267) To a solution of 70 (0.61 g, 0.52 mmol) in 20 mL of DMF was added 10 mL of ethanol followed by 5 mL of 1 N NaOH. The reaction was heated at 50 C. with stirring for 30 min, then concentrated and the resultant residue resuspended in methanol (30 mL). The obtained solid was collected by filtration, washed with methanol (230 mL) and dried to afford 0.562 g (95%) of 71 as a purple solid. .sup.1H NMR (DMSO-d6) 11.77 (s, 1H), 11.64 (s, 1H), 8.45 (br t, 1H), 8.31 (s, 1H), 8.20 (m, 2H), 8.08 (d, J=8.4 Hz, 1H), 7.88 (d, J=9 Hz, 2H), 7.72 (br d, J=6.9 Hz, 1H), 7.4-7.25 (m, 11H), 7.07 (s, 2H), 6.97 (d, J=9.3 Hz, 2H), 6.87 (d, J=8.7 Hz, 4H), 4.65 (t, J=7.5 Hz, 2H), 4.21 (t, J=6.3 Hz, 2H), 3.71 (s, 6H), 3.62 (t, J=6.3 Hz, 2H), 3.49 (m, 2H), 3.39 (t, J=7.2 Hz, 2H), 3.27 (m, 4H), 3.16 (s, 3H), 2.92 (t, J=6 Hz, 2H), 1.76 (m, 2H), 1.54 (m, 4H), 1.31 (m, 4H).
N-(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhex-1-yl)-3,6,7,8-tetrahydro-6-[[3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-{[4-oxo-4-(pentafluorophenoxy)butanoyl]oxy}propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (72)
(268) ##STR00108##
(269) Compound 71 (0.56 g, 0.49 mmol) was dried by co-evaporation with anhydrous DMF and then re-dissolved in a fresh portion (10 mL) of DMF. Triethylamine (0.3 mL), N-methylimidazole (0.1 mL) and succinic anhydride (0.10 g, 1.0 mmol) were added and the reaction was stirred at 50 C. for 7 h until no starting material was found by HPLC analysis. The reaction was cooled and treated with triethylamine (0.2 mL) and PFP-TFA (0.21 mL, 1.22 mmol). After being stirred for 2 h the reaction was concentrated under reduced pressure and the resultant semi-solid resuspended in cold methanol (50 mL). The insoluble material was collected by filtration, washed with methanol (310 mL) and dried to afford 0.642 g (93%) of PFP ester 72 as a red-purple solid. .sup.1H NMR (DMSO-d6) 11.78 (s, 1H), 11.64 (s, 1H), 8.45 (br t, 1H), 8.32 (s, 1H), 8.20 (m, 2H), 8.08 (d, J=8.4 Hz, 1H), 7.86 (d, J=9 Hz, 2H), 7.76 (br d, J=6.9 Hz, 1H), 7.4-7.25 (m, 11H), 7.08 (s, 2H), 6.97 (d, J=9.3 Hz, 2H), 6.88 (d, J=8.4 Hz, 4H), 4.65 (t, J=7.5 Hz, 2H), 4.22 (t, J=6.3 Hz, 2H), 4.14 (t, J=5.4 Hz, 2H), 3.72 (s, 6H), 3.67 (m, 2H), 3.40 (m, 2H), 3.28 (m, 4H), 3.15 (s, 3H), 3.07 (t, J=6 Hz, 2H), 2.96 (t, J=6 Hz, 2H), 2.79 (t, J=6 Hz, 2H), 1.95 (m, 2H), 1.54 (m, 4H), 1.33 (m, 4H).
(270) Preparation of Polystyrene Support ID #480
(271) ##STR00109##
(272) Aminomethyl-polystyrene support (33 umol/g amine capacity, Applied Biosystems, PN 360865C) (5.0 g) was added to a solution of 72 (0.12 g, 0.14 mmol, 17 umol/g offering) and triethylamine (0.5 mL) in 25 ml of DMF. The suspension was swirled on an orbital shaker for 22 h then filtered and washed with DMF. To block unreacted aminogroups the support was suspended in pyridine (22.5 mL), treated with acetic anhydride (2.5 mL) and swirled for 30 min. The blocking reagents were removed by filtration and the support was washed with several 50 mL portions of DMF and acetone followed by drying under reduced pressure to afford polystyrene support ID #480 as a light purple solid. DMT loading was 16.1 mol/g according to a colorimetric acid cleavage test.
Example 6. Preparation of a DSQ-Phosphoramidite
N-ethoxycarbonyl-N-(6-(bis-(4-methoxyphenyl))(phenyl)methoxyhex-1-yl)-3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6-[[3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (73)
(273) ##STR00110##
(274) To a suspension of compound 70 (0.88 g, 0.74 mmol) in a solution of triethylamine (1 mL) and N,N-dimethylaminopyridine (0.054 g) in 13 mL of anhydrous DMF was added with stirring at 50 C. 1 mL of diethylpyrocarbonate. Five more portions of diethylpyrocarbonate totaling 6 mL were added over the course of 6 h. The reaction was allowed to proceed at room temperature for 2 more days then concentrated and partitioned between CH.sub.2Cl.sub.2 and water. The organic phase was dried over Na.sub.2SO.sub.4 and concentrated. The obtained residue was chromatographed on silica eluting with acetone in ethyl acetate (0-5%). Concentration of the main product fractions afforded 0.7 g of a purple amorphous solid. .sup.1H NMR analysis indicated the presence of two compounds, one likely to be the desired triethoxycabonyl-protected compound 73 (approx. 66%) and the other one being the dioxoimidazo cyclization product (approx. 33%) as shown in
N-ethoxycarbonyl-N-(6-hydroxyhex-1-yl)-3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6-[[3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (74)
(275) ##STR00111##
(276) Methanol (3 mL) and water (0.06 mL) were added to a solution of 73 (0.7 g, 0.52 mmol) in CH.sub.2Cl.sub.2 (12 mL) followed by trifluoroacetic acid (0.12 mL). After being kept at room temperature for 10 min the reaction was quenched by adding 0.24 mL of triethylamine and then concentrated. The obtained residue was chromatographed on silica eluting with 3:4 acetone-ethyl acetate. Concentration of the main product fractions afforded 0.52 g of a dark purple amorphous solid. .sup.1H NMR spectrum was consistent with the product being a mixture of the desired 74 and the dioxoimidazo analog (
N-ethoxycarbonyl-N-(6-{(cyanomethoxy)[di(propan-2-yl)amino]phosphanyl}oxyhex-1-yl)-3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6-[[3-(ethoxycarbonyl)-3,6,7,8-tetrahydro-6[(2-[(E)-(4-{[3-(acetyloxy)propyl](methyl)amino}phenyl)diazenyl]-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrol-2-yl]carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxamide (75)
(277) ##STR00112##
(278) To a solution of 74 (0.51 g, 0.5 mmol) in 10 mL of anhydrous CH.sub.2Cl.sub.2 was added diisopropylammonium tetrazolide (0.077 g) followed by 0.21 g (0.66 mmol) of 2-cyanoethyl N,N,N,N-tetraisopropylphosphorodiamidite. The reaction was stirred for 3 h then diluted with CH.sub.2Cl.sub.2 (100 mL) and extracted with 50 mL of saturated NaHCO.sub.3. The organic phase was washed with brine and dried over MgSO.sub.4. Concentration of the extract gave an amorphous solid foam which was then re-dissolved in small amount (approx. 6 mL) ethyl acetate followed by diluting with hexane (100 mL). The resultant precipitate was collected by filtration, washed with hexane and dried to afford 0.56 g of phosphoramidite 75 as a mixture with the dioxoimidazo analog shown in
Example 7. Preparation of Oligonucleotide Conjugates by Post-Synthetic Modification of Amine-Tailed Oligonucleotides
2-{(E)-[4-Phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazole-6-carboxylic Acid (76)
(279) ##STR00113##
(280) 40% Nitrosylsulfuric acid (0.8 mL) was added over the course of 1 min to a stirred suspension of 2-amino-1,3-benzothiazole-6-carboxylic acid (0.625 g, 3.22 mmol) in a mixture of acetic (8 mL) and propionic (8 mL) acids at approx. 5 C. The reaction was then stirred at room temperature for 2 h before being used in the next step. A solution of sulfamic acid (0.1 g) in water (30 mL) was combined with a solution of 52 (0.89 g, 3.87 mmol) in methanol (30 mL). The resultant emulsion was cooled to approx. 5 C. and then slowly (approx. 2 min) added to the diazonium salt from the first step. The obtained purple mixture was stirred at 0-4 C. for 2 h, at room temperature for 1 h, then diluted with water (300 mL) and filtered to collect the precipitated product. The precipitate was washed with water and dried to afford 0.69 g (49%) of crude dye 76 as a black solid. .sup.1H NMR (DMSO-d6) 12.25 (br s, 1H), 8.54 (s, 1H), 8.32 (m, 2H), 7.98 (skewed d, J=8.7 Hz, 1H), 7.87 (skewed d, J=8.7 Hz, 1H), 7.63 (m, 3H), 3.95 (m, 2H), 3.63 (m, 2H), 2.09 (m, 4H).
Pentafluorophenyl 2-{(E)-[4-Phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazole-6-carboxylate (77)
(281) ##STR00114##
(282) Acid 76 (0.69 g, 1.58 mmol) was first dried by co-evaporation with DMF (20 mL) supplemented with triethylamine (0.5 mL) then re-dissolved in a mixture of CH.sub.2Cl.sub.2 (20 mL) and triethylamine (0.5 mL). PFP-TFA (0.4 mL, 2.33 mmol) was added in one portion. The reaction was stirred for 1 h then concentrated and the obtained solid re-suspended in cold methanol (20 mL). The resultant precipitate was collected by filtration, washed with methanol (25 mL) and dried under reduced pressure to afford 0.76 g (80%) of PFP ester 77 as a black solid. .sup.1H NMR (CDCl.sub.3) 8.65 (s, 1H), 8.40 (m, 2H), 8.21 (skewed d, J=8.4 Hz, 1H), 8.03 (skewed d, J=8.4 Hz, 1H), 7.55 (m, 3H), 4.00 (m, 2H), 3.57 (m, 2H), 2.18 (m, 4H).
3,6,7,8-Tetrahydro-6-[(2-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic Acid (78)
(283) ##STR00115##
(284) To a solution of 3,6,7,8-tetrahydro-benzo[1,2-b:4,3-b]dipyrrole-2-carboxylic acid (0.25 mmol) in 2 mL of DMF was added 0.5 mL of triethylamine followed by 0.15 g (0.25 mmol) of PFP ester 77. The mixture was stirred for a few minutes to give an almost complete solution before product precipitation began. The suspension was stirred at room temperature for 3 h, then concentrated on a rotary evaporator and the resultant black residue was re-suspended in methanol (7 mL). The obtained precipitate was collected by filtration, washed with methanol (22 mL) and dried under reduced pressure to afford 0.158 g (100%) of compound 78 (partial triethylammonium salt) as a black solid. .sup.1H NMR (DMSO-d6) 11.69 (br s, 1H), 8.32 (m, 2H), 8.23 (s, 1H), 7.92 (d, J=8.4 Hz, 1H), 7.61 (m, 4H), 7.27 (br s, 1H), 6.93 (s, 1H), 4.17 (t, J=7.8 Hz, 2H), 3.92 (m, 2H), 3.61 (m, 2H), 3.25 (t, J=8.1 Hz, 2H), 2.76 (m, 2.5H, Et.sub.3NH.sup.+), 2.08 (m, 4H), 1.06 (t, J=7.2 Hz, 4.1H, Et.sub.3NH.sup.+).
Pentafluorophenyl 3,6,7,8-tetrahydro-6-[(2-{(E)-[4-phenyl-2-(pyrrolidin-1-yl)-1,3-thiazol-5-yl]diazenyl}-1,3-benzothiazol-6-yl)carbonyl]benzo[1,2-b:4,3-b]dipyrrole-2-carboxylate (79)
(285) ##STR00116##
(286) PFP-TFA was added in two, 0.05 mL portions over the period of 2 h to a solution of 78 (0.154 g, 0.25 mmol) and triethylamine (0.1 mL) in 5 mL of anhydrous DMF. The initial solution turned into a suspension by the end of this time. The suspension was cooled on ice, the insoluble material was cooled by filtration, washed with methanol and dried to afford 0.15 (76%) of PFP ester 79 as a black metallic solid. .sup.1H NMR (DMSO-d6) 12.52 (s, 1H), 8.32 (m, 2H), 8.26 (s, 1H), 7.94 (d, J=8.1 Hz, 1H), 7.68 (d, J=8.1 Hz, 1H), 7.61 (m, 3H), 7.55 (s, 1H), 7.38 (br s, 1H), 4.22 (t, J=7.8 Hz, 2H), 3.93 (m, 2H), 3.62 (m, 2H), 3.25 (t obscured by water signal, J=8.1 Hz, 2H), 2.08 (m, 4H).
(287) Post-Synthetic Conjugation of DSQ Groups by Reaction of the 6-amino-2-hydroxyhexyl-modified Octadeoxythymidylate with PFP Esters 44, 77, 79 and Dabcyl
(288) To a solution of 3-(6-amino-2-hydroxyhexyl)-octadeoxythymidylate (approx. 60 nmol), which had been prepared by oligonucleotide synthesis starting from the PS support ID #394 (Example 2) followed by C18 HPLC purification using triethylammonium bicarbonate buffer, in 20 L of DMSO was added 0.7 mg (1.1 mol) of PFP ester 44, 77 or 79 and 0.5 L of triethylamine. After being kept at room temperature (55 C. in case of PFP ester 79) for 20 h the reaction was diluted with 1HPLC buffer, centrifuged to spin down unreacted PFP ester and chromatographed on a C18 HPLC column eluting with a gradient of CH.sub.3CN in 0.1 M triethylammonium bicarbonate buffer (pH .sup.9). The product peak was collected and dried in a SpeedVac vacuum concentrator under reduced pressure. Dabcyl conjugation using Quencher-470 PFP ester (ELITechGroup Inc., product # M830572) was performed analogously. The identities and purity of the products were confirmed by ESI mass-spectrometry.
Example 8. Absorption Spectra of Exemplary Octadeoxythymidylate Conjugates of the Disclosure
(289) Absorption spectra of various compounds in accordance with preferred embodiments of the present disclosure conjugated to octadeoxythymidylate, as shown in
(290) TABLE-US-00004 TABLE 4 Instrumentation and measurement conditions Instrument PE Lambda 2S UV-VIS spectrophotometer Conc. (mM) 0.01-0.03 Diluent 50 mM Tris-HCl pH 8.5 Temperature ( C.) Ambient
(291)
Example 9. Oligonucleotide Synthesis
(292) All oligonucleotides and oligonucleotide conjugates used in Examples 10-14 were synthesized using the instrumentation, synthesis and purification conditions described in Table 5 below.
(293) TABLE-US-00005 TABLE 5 Instrumentation and synthesis conditions Instrument ABI 3900 DNA synthesizer Scale 200 nmol Deblocking 3% TCA Amidite conc. 100 mM (double coupling for all dye and quencher amidites) Activator 5-Ethylthiotetrazole Oxidation I.sub.2/Pyridine/Water Capping Ac.sub.2O/Pyridine/Melm Deprotection conc. NH.sub.4OH, 25% EtOH (70 C., 2 h) Purification 4.6 250 mm Luna C18 RP HPLC (2 mL/min, gradient of CH.sub.3CN, triethylammonium bicarbonate buffer, pH ~9) Mass Thermo Scientific, LCQ Fleet, ESI spectroscopy (TEA-HFIPA buffer)
(294) The mass spectrometry for the d(T.sub.8)-3-DSQ conjugates is listed in Table 6 below.
(295) TABLE-US-00006 TABLE 6 Summary of ESI mass- spectroscopy of the d(T.sub.8)-3-DSQ conjugates Conjugate DSQ MW MW Purity Name ID # Calc. (Da) Observed (Da) (%) T8-473 473 3225.5 3225.3 95.97 T8-475 475 3311.5 3311.5 97.47 T8-476 476 3329.6 3329.4 100 T8-477 477 3243.5 3243.2 100 T8-478 478 3299.6 3299.3 100 T8-479 479 3306.9 3306.6 98.23 T8-480 480 3271.6 3271.3 100 T8-481 481 3350.6 3350.8 95.67 T8-482 482 2977.2 2977.0 100 T8-483 483 3275.5 3275.4 100 T8-484 484 3074.3 3074.0 100 T8-485 485 3257.5 3258.4 95.09 T8-486 486 3295.57 3295.6 98.92 T8-487 487 3092.35 3092.0 100 T8-488 488 2908.16 2907.8 99.02 T8-489 489 2890.12 2896.9 100 T8-490 490 3150.41 3150.3 98.57 T8-77 77 2984.25 2983.7 100 T8-79 79 3168.45 3168.2 98.50 T8-44 44 2927.18 2927.2 96.79 T8-Dabcyl Dabcyl 2818.03 2817.9 100
Example 10. Thermal Denaturation of DSQ-Labeled TaqMan Probes
(296) To evaluate duplex-stabilizing and fluorescence quenching properties of new DSQ derivatives, two TaqMan probes labeled with FAM or AP525 were investigated. The probes (200 nM) FAM-5-G*CAGGTTCCGGTTTTG-DSQ (SEQ ID NO:1) or AP525-5-G*ACCACGTACCGCATTG-DSQ (SEQ ID NO:2) probes were hybridized in a PCR buffer with 1 M of the respective complement (FAM complement: 5-TCAAAACCGGAACCTGCT (SEQ ID NO:3); AP525 complement: TCAATGCGGTACGTGGTCT (SEQ ID NO:4) by briefly heating the solution to 80 C., cooling to 20 C., then ramping to 90 C. while monitoring fluorescence. Background fluorescence was measured at 90 C., temperature at which all duplexes have been completely denatured. Instrumentation and measurement conditions were as shown in Table 7 below. Results are summarized in
(297) TABLE-US-00007 TABLE 7 Instrumentation and experimental conditions Instrumentation and measurement conditions Instrument Varian Cary Eclipse Fluorimeter Data mode Fluorescence Scan mode Emission X Mode Wavelength (nm) Ex. Wavelength (nm) 496 (FAM), 527 (AP525) Em. Wavelength (nm) 517 (FAM), 549 (AP525) Ex. Slit (nm) 5 Em. Slit (nm) 5 Measurement 20.0-90.0, 1 C./min ramp temperature ( C.) 1X PCR buffer 40 mM NaCl, 10 mM Tris, 5 mM MgCl.sub.2, pH 8.9
(298)
(299)
Example 11. Fluorescence Melting Analysis of d(T.SUB.8.)-DSQ/FAM-d(A.SUB.8.CC) Duplexes
(300) To evaluate duplex stabilizing effect of representative DSQ derivatives in an A/T-rich sequence context, a short d(T.sub.8)/d(A.sub.8CC) duplex was investigated by fluorescence melting analysis. 3-DSQ-TTTTTTTT (d(T.sub.8)-DSQ) conjugates were combined with complement (5-FAM-AAAAAAAACC (SEQ ID NO:5)) in the buffer specified in Table 8 and the solution equilibrated to 10 C., and dissociation curves acquired by monitoring fluorescence from 10-70 C. at a ramp of 1 C./min. Duplex denaturation was monitored by detecting fluorescence change over a thermal ramp. Melting temperature (Tm) was calculated by finding second derivative maximum of the raw melt curve. Instrumentation and measurement conditions were as shown in Table 8 below. Results are summarized in Table 9 and
(301) TABLE-US-00008 TABLE 8 Instrumentation and experimental conditions Instrumentation and measurement conditions Instrument Varian Cary Eclipse Fluorimeter Data mode Fluorescence Ex. Wavelength (nm) 496 (FAM), 527 (AP525) Em. Wavelength (nm) 517 (FAM), 549 (AP525) Ex. Slit (nm) 5 Em. Slit (nm) 5 Measurement 10-70 C., 1 C./min temperature ( C.) Buffer 100 mM NaCl, 10 mM MgCl.sub.2, 10 mM Na2-PIPES, pH 7.0 T8 conjugate Concentration 0.2 M Complement Concentration 0.1 M
(302) TABLE-US-00009 TABLE 9 Tm data Sequence ID Tm General DSQ Structure: DSQ Tm relative to (CDPI).sub.n(O)CAr.sup.1NNAr.sup.2 Name ID # ( C.) T8-Dabcyl n (O)CAr.sup.1 Ar.sup.2 T8-473 473 45.6 30.0 2 Indolyl (Dimethylamino)phenyl T8-475 475 44.3 28.7 2 Indolyl (Pyrrolidino,dimethoxy)phenyl T8-476 476 21.9 6.3 2 Benzothiazolyl (Pyrrolidino,dimethoxy)phenyl T8-477 477 45.5 29.9 2 Benzothiazolyl (Dimethylamino)phenyl T8-478 478 44.2 28.6 2 Benzothiazolyl (Dimethylamino)phenyl T8-479 479 34.7 19.1 2 Phenyl (Pyrrolidino,dimethoxy)phenyl T8-480 480 45.3 29.7 2 Benzothiazolyl (Dimethylamino)phenyl T8-481 481 26.7 11.1 2 Phenyl (Dimethylamino)phenyl-azo-phenyl T8-482 482 26.7 11.1 2 N/A N/A T8-483 483 35.6 20.0 2 pyrrolyl (Pyrrolidino,dimethoxy)phenyl T8-484 484 28.8 13.2 1 Indolyl Pyrrolidinothiazolyl T8-485 485 44.8 29.2 2 Indolyl Pyrrolidinothiazolyl T8-486 486 47.6 32.0 2 Benzothiazolyl Julolidinyl T8-487 487 16.6 1.0 1 Benzothiazolyl Pyrrolidinothiazolyl T8-488 488 19.3 3.7 0 Benzothiazolyl Pyrrolidinothiazolyl T8-489 489 18.4 2.8 0 Indolyl Pyrrolidinothiazolyl T8-490 490 23.2 7.6 1 Indolyl (Pyrrolidino)phenylthiazolyl T8-77 77 23.9 8.3 0 Benzothiazolyl (Pyrrolidino)phenylthiazolyl T8-79 79 20.7 5.1 1 Benzothiazolyl (Pyrrolidino)phenylthiazolyl T8-44 44 16.5 0.9 0 Benzothiazolyl Julolidinyl T8-dabcyl Dabcyl 15.6 0.0 0 Phenyl (Dimethylamino)phenyl
(303)
Example 12. Evaluation of Sequence Effect on Duplex Stabilization by DSQ ID #477
(304) To establish the stabilizing contribution of the DSQ (ID #477) moiety to the duplex, sequences (Table 11) with varying G/C content in the inferred binding region of the DSQ moiety were evaluated. For comparison, CDPI.sub.2 (ID #482), CDPI.sub.3 (ID #391), MGB-Quencher (ID #385)-labeled and unmodified oligonucleotides were also tested. Duplexes were heated briefly to 80 C., equilibrated at 20 C., and then ramped to 70 or 90 C. while monitoring UV absorbance. Instrumentation and measurement conditions were as shown in Table 10 below. Results are summarized in Table 11 and
(305) TABLE-US-00010 TABLE 10 Instrumentation and experimental conditions Instrumentation and measurement conditions Instrument Cary Bio 400 Wavelength monitor 260 nm Measurement 20-70 or 20.0-90.0, temperature ( C.) 1 C./min ramp Buffer 1 20 mM Na.sub.2-PIPES, pH 8 Buffer 2 10 mM Na.sub.2-PIPES, 100 mM NaCl, 10 mM MgCl.sub.2, pH 7 Test Oligo Concentration 3 M Complement Concentration 6 M
(306) TABLE-US-00011 TABLE11 SEQ Tm( C.) ID Sequence 5- 5- 5- 5- NO: (5-3) none [482] [391] [385] [477] 6 ACACAAGCTACA 56.85 60.38 73.05 65.56 71.00 7 TTATATGCCACG 53.50 61.37 73.89 68.87 63.61 8 TACACTGGACAT 55.75 61.44 66.18 60.40 66.80 9 CAGAGCTTACAT 53.75 58.77 70.51 64.68 53.78 10 GCTCTGTTAAGT 50.27 52.19 57.69 56.53 54.20 11 GAAAACACCGTC 56.96 62.75 73.99 69.36 69.91 12 TCCTGAGTCAAC 55.29 60.56 61.66 61.15 53.42 13 CGCTAAATCCTG 55.91 61.83 75.16 67.17 71.78 14 TGTTCTACCGAG 54.95 62.52 73.78 68.68 68.94 15 CGAAATACCCTG 53.93 63.58 76.78 70.64 72.02
(307) In order to demonstrate that new DSQ moieties can stabilize DNA duplexes with different sequence context, the test shown in
Example 13. Real-Time PCR Using DSQ-Labeled TaqMan Probes
(308) To evaluate PCR performance of new DSQ derivatives, PCR was conducted using two DSQ-labeled TaqMan probes (TaqMan assay). PCR Monoreagent formulation and PCR conditions are shown in Table 12. Result are summarized in Table 13 and
(309) TABLE-US-00012 TABLE12 PCRformulationandPCRconditions Instrument ELITeInGenius KPCprimers AATAAATCATAAGCAGACTGGGCAGTCGG (SEQIDNO:18) AATAAATCATGTCATTTGCCGTGCCATAC (SEQIDNO:19) IC2primers CTCATTTTTTCTACCGGAGATCTTGT (SEQIDNO:20) CTGCACGGACCAGTTACTTTACG (SEQIDNO:21) KPCprobe FAM-G*CAGGTTCCGGTTTTG-MGBQ (SEQIDNO:22) IC2probe AP525-G*ACCACGTACCGCATTG-MGBQ (SEQIDNO:23) Primer 500nM concentration (nM) Probe 100nM concentration (nM) Magnesium 3 concentration (mM) Enzyme 3U/reaction concentration Thermocycling Precycle:95 C.,240sec 40cyclesofPCR: Denature:95 C.,10sec Anneal:56 C.,30sec Extend:73 C.,15sec KPCtarget 1000copies/PCRreaction concentration IC2target 1000copies/PCRreaction concentration
(310) TABLE-US-00013 TABLE 13 Summary of PCR data Ct Signal at Signal/ DSQ KPC* IC* cycle #45 Background Background ID # (Fluorophore) (AP525) KPC* IC* KPC* IC* KPC* IC* 385 28.6 (FAM) 30.3 6306 4551 1237 543 5.1 8.4 473 28.4 (FAM) 29.7 7469 9960 2329 3829 3.2 2.6 475 28.5 (FAM) 29.8 6914 7653 1564 1719 4.4 4.5 476 29.2 (FAM) 30.1 5525 5650 1038 479 5.3 11.8 477 28.7 (FAM) 30.4 5772 6289 909 438 6.4 14.4 477 29.7 (AP593) 27.9 3335 6994 329 724 10.1 9.7 477 28.3 (AP639) 27.7 18984 7360 1665 828 11.4 8.9 478 29.2 (FAM) 30.8 6125 5169 1030 447 5.9 11.6 479 29.3 (FAM) 30.8 5145 5252 1014 857 5.1 6.1 480 28.9 (FAM) 30.8 5428 5119 832 374 6.5 13.7 481 29.8 (FAM) 31.4 4526 4969 993 773 4.6 6.4 *All values are averages of three or more replicates
(311)
(312) Simultaneous amplification and detection of multiple targets is an essential requirement for multiplex PCR applications. This can only be enabled if multiple fluorophores with wide range of emission spectra are combined in one PCR reaction. In order to demonstrate that new DSQ derivatives are also suitable for PCR applications with red-shifted fluorophores an experiment was performed in which, the KPC probe was labeled either with AP593 (emission maximum 613 nm) or AP639 (emission maximum 655 nm) dye at the 5-end and the DSQ ID #477 at the 3-end. The obtained results (summarized in Table 12) confirmed that the KPC target was successfully amplified and efficiently detected with Ct values, background fluorescence and signal-to-background ratios similar or better to those of the FAM-labeled probe.
Example 14. Evaluation of Hybridization-Triggered Fluorescence of DSQ-Labeled Probes
(313) To evaluate fluorogenic properties of oligonucleotides of Formula VII, the duplex fluorescence at 50 C. (Signal), single strand fluorescence at 50 C. (Background) and Signal-to-background ratio (S/B) of two oligonucleotides labeled at the 5-end with DSQ ID #473 and either FAM-HEG (ELITechGroup Inc., product # M830100) or AP525-HEG (ELITechGroup Inc., product # M100104) were synthesized and tested. To generate a fluorescent signal the DSQ-FAM (or AP525)-5-TAAAAGGTGTAC (SEQ ID NO:24) (200 nM) were hybridized in a PCR buffer with 1 lIM of the complement (TTGTACACCTTTTATT (SEQ ID NO:25)) by briefly heating the solution to 80 C., cooling to 20 C., then ramping to 90 C. while monitoring fluorescence. Background was measured in the absence of complement. Instrumentation and measurement conditions were as shown in Table 14 below. Results are summarized in Table 15 and
(314) TABLE-US-00014 TABLE 14 Instrumentation and measurement conditions Instrument Varian Cary Eclipse Fluorimeter Data mode Fluorescence Scan mode Emission X Mode Wavelength (nm) Ex. Wavelength (nm) 496 (FAM), 527 (AP525) Em. Wavelength (nm) 517 (FAM), 549 (AP525) Ex. Slit (nm) 5 Em. Slit (nm) 5 Measurement 20.0-90.0, 1 C./min ramp temperature ( C.) 1X PCR buffer 40 mM NaCl, 10 mM Tris, 5 mM MgCl.sub.2, pH 8.9
(315) TABLE-US-00015 TABLE 15 Background Signal S/B FAM 21.5 128.7 6.0 AP525 45.4 629.5 13.9
(316) The new DSQ derivatives can also be used for the preparation of hybridization probes and primers, which rely on spatial separation between the quenching and fluorescent moieties upon hybridization to target to generate fluorescent signal. In one particular configuration, the DSQ and fluorophore moieties are positioned at the same end of an oligonucleotide. In such configuration, spatial separation between the quencher and fluorophore is achieved via the DSQ binding within the duplex minor groove. Such conjugates can be synthesized starting from a DSQ synthesis support followed by a fluorophore phosphoramidite that is suitable for internal incorporation (for example FAM-HEG and AP525-HEG phosphoramidites available from ELITechGroup Inc.), and then an oligonucleotide sequence.
REFERENCES CITED
(317) The following documents and publications are hereby incorporated by reference.
U.S. and Foreign Patent Documents
REFERENCES CITED
(318) The following documents and publications are hereby incorporated by reference.
U.S. and Foreign Patent Documents
(319) EP Patent No. 1384789 US patent application Nos. 20140335515 20130030166F US patent No. RE 38,416 U.S. Pat. No. 3,996,345 U.S. Pat. No. 5,419,966 U.S. Pat. No. 5,512,667 U.S. Pat. No. 5,585,481 U.S. Pat. No. 5,696,251 U.S. Pat. No. 5,736,626 U.S. Pat. No. 5,801,155 U.S. Pat. No. 5,942,610 U.S. Pat. No. 6,150,097 U.S. Pat. No. 6,312,894 U.S. Pat. No. 6,323,337 U.S. Pat. No. 6,399,392 U.S. Pat. No. 6,492,346 U.S. Pat. No. 6,699,661 U.S. Pat. No. 6,699,975 U.S. Pat. No. 6,727,356 U.S. Pat. No. 6,790,945 U.S. Pat. No. 6,821,727 U.S. Pat. No. 6,972,339 U.S. Pat. No. 7,019,129 U.S. Pat. No. 7,166,715 U.S. Pat. No. 7,205,105 U.S. Pat. No. 7,262,007 U.S. Pat. No. 7,381,818 U.S. Pat. No. 7,439,341 U.S. Pat. No. 7,564,567 U.S. Pat. No. 7,582,739 U.S. Pat. No. 7,767,834 U.S. Pat. No. 7,759,470 U.S. Pat. No. 7,803,536 U.S. Pat. No. 7,879,986 U.S. Pat. No. 7,790,385 U.S. Pat. No. 8,163,910 U.S. Pat. No. 8,586,759 U.S. Pat. No. 8,637,658 U.S. Pat. No. 9,056,887
Non-Patent References
(320) Ausubel, et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley &Sons (1987, 1988, 1989, 1990, 1991, 1992, 1993, 1994, 1995, 1996) Berge, S. M., et al., Journal of Pharmaceutical Science, 66: 1-19 (1977). Boga, C. et al., Org. Biomol. Chem. 14: 7061-7068 (2016) Bonnet et al., Proc. Natl. Acd. Sci. USA, 96: 6171-6176 (1999) Crisalli and Kool, Bioconjug Chem., 22: 2345-54 (2011) Demidov and Frank-Kamenetskii TRENDS in Biochemical Sciences, 29: 62-71 (2004) Eckstein (ed.), OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, IRL Press (1991). Edmonds et al. in Modern Carbonyl Olefination. Ed. T. Takeda, Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 2004 Gait (ed.), OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH, IRL Press (1984) T. W. Greene and P. G. Wuts, Greene's Protective Groups in Organic Chemistry, Wiley, 4nd ed. 2007 Harrison and Harrison et al., Compendium of Synthetic Organic Methods, Vols. 1-8, John Wiley and Sons. 1971-1996 Heid et al., Genome Res. 6: 986-994 (2009) Hermanson, Bioconjugate Techniques, Elsevier, 1996, pages 139-140 and 274-275, Hymas W C, Hillyard D R J Virol Methods. 156:124-8 (2009) Johansson et al. J. Am. Chem. Soc., 124: 6950-6956 (2002) Knemeyer and Marme, DNA & Gene Sequences. 1, No. 2: 145-157 (2007) Kutyavin et al. Nucl. Acids Res. 28: 655-661(2000) Lakowicz, Principles of Fluorescence Spectroscopy, Third Edition, Springer 2007, pages 368-394 Lukhtanov et al. Bioconjugate Chemistry, 6: 418-426 (1995) Lukhtanov et al., Bioconjug Chemistry, 7:564-567 (1996) Lukhtanov et al., Nucl. Acids Res., 35: e30 (2007) Mahajan, S. et al. Analytical Biochemistry, 351(2), 273-281 (2006) Malicka, J. M. et al. ChemistryA European Journal, 19: 12991-13001 (2013) March J. in Advanced Organic Chemistry, Chapter 4, 4th edition John Wiley and Sons, New York, 1992 pages 71-124 Maniatis, Fritsch & Sambrook, MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press (1982) Matayoshi et al., Science, 247:954-958 (1990) Morrison et al. Anal. Biochem., 183: 231-244 (1998) Ong et al. Org. Biomol. Chem., 10: 1040-1046 (2012) Paris et al. Nucleic Acids Res., 38(7): e95 (2010) Reddy, et al. (1999), Pharmacol. Therap., 84:1-111 (1999). Sambrook, Fritsch & Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press (1989) Sedlak and Jerome, Diagn Microbiol Infect Dis. 75(1):1-4 (2013). Smith, March. Advanced Organic Chemistry 6th ed. 2007 by John Wiley & Sons, Inc. (pages 501-502) Tolstrup et al. Nucl. Acids. Res., 31:3758-3762 (2003) Tyagi et al. Nat Biotechnol., 14; 303-8 (1996) Tyagi et al. Nat Biotechnol., 16: 49-53 (1998) Walker et al., Biopolymers, 44: 323-334 (1997) Wemmer, D. E., and Dervan P. B., Current Opinion in Structural Biology, 7:355-361 (1997) Zimmer, C & Wahnert, U., Prog. Biophys. Molec. Bio. 47: 31-112 (1986)