Expression Constructs and Methods for Expressing Polypeptides in Eukaryotic Cells
20200172634 ยท 2020-06-04
Assignee
Inventors
- Christel AEBISCHER-GUMY (La Chaux-de-Fonds, CH)
- Martin Bertschinger (La Chaux-de-Fonds, CH)
- Pierre MORETTI (La Chaux-de-Fonds, CH)
Cpc classification
C07K2317/64
CHEMISTRY; METALLURGY
C07K2317/14
CHEMISTRY; METALLURGY
C12N2840/445
CHEMISTRY; METALLURGY
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to an expression construct for the expression of polypeptides in host cells using alternative splicing. The expression construct can be used for the expression of polypeptides such as antibodies, antibody fragments and bispecific antibodies by expressing the gene products required for protein expression at the ratio leading to the highest titres or the best product quality profile.
Claims
1. An expression construct comprising in a 5 to 3 direction: a promoter; (ii) an optional first splice donor site; (iii) a first flanking intron; (iv) a first splice acceptor site; (v) a first exon encoding a first polypeptide; (vi) an optional second splice donor site; (vii) a second flanking intron; (viii) a second splice acceptor site; and (ix) a second exon encoding a second polypeptide, (x) wherein upon entry into a host cell, transcription of the first exon results in expression of the first polypeptide and/or transcription of the second exon results in expression of the second polypeptide, wherein the first and the second flanking introns have a nucleic acid sequence homology of at least 80% for at least 50 nucleotides.
2. The expression construct according to claim 1, wherein the first and the second flanking introns are selected from the group consisting of: chicken troponin (cTNT) intron 4, cTNT intron 5 and first intron of the human EF1alpha gene.
3-5. (canceled)
6. The expression construct according to claim 1, further comprising at least one polypyrimidine (poly(Y)) tract upstream or downstream of the first exon.
7-8. (canceled)
9. The expression construct according to claim 6, wherein the poly(Y) tract comprises less than 30 pyrimidine bases.
10-11. (canceled)
12. The expression construct according to claim 1, wherein the expression construct comprises a third splice donor site, an intron and a third splice acceptor site located downstream of said promoter.
13. The expression construct according to claim 12, wherein the splice donor site, intron and splice acceptor site are constitutive.
14. The expression construct according to claim 12, wherein the third splice donor site is preceded by a 5UTR and/or the third splice acceptor site is followed by a 5UTR.
15. The expression construct according to claim 1, wherein the flanking intron sequences are selected from the group consisting of: SEQ ID Nos: 129 to 175.
16. The expression construct according to claim 1, wherein the first polypeptide is an antibody heavy chain or fragment thereof and the second polypeptide is an antibody light chain or fragment thereof, or wherein the first polypeptide is an antibody light chain or fragment thereof and second polypeptide is an antibody heavy chain or fragment thereof.
17. The expression construct according to claim 1, wherein the first polypeptide is an antibody heavy chain and the second polypeptide is a Fc-scFv or wherein the first polypeptide is a Fc-scFv and the second polypeptide is an antibody heavy chain.
18. A polynucleotide encoding the expression cassette according to claim 1.
19. A cloning or expression vector comprising one or more polynucleotides according to claim 18.
20. A host cell comprising one or more cloning or expression vectors according to claim 19.
21-23. (canceled)
24. A method of producing a polypeptide comprising culturing the host cell of claim 20 in a culture and isolating the polypeptide expressed from the culture.
25. A method of producing a bispecific antibody comprising culturing the host cell of claim 20 and isolating the polypeptide expressed from the culture.
26. A method of optimizing the expression level of a protein of interest encoded by one or more expression cassettes according to claim 1, comprising: (i) using first and second flanking introns having a nucleic acid sequence homology of at least 80% for at least 50 nucleotides; (ii) reducing the number of pyrimidine bases in a poly(Y) tract upstream of the first exon or increasing the number of pyrimidine bases in a poly(Y) tract downstream of the first exon; and/or (iii) deleting a splice donor site upstream of the second flanking intron.
27. A method of optimizing the heterodimerization level of a protein of interest encoded by one or more expression cassettes according to claim 1, comprising: (i) using first and second flanking introns having a nucleic acid sequence homology of at least 80% for at least 50 nucleotides; (ii) reducing the number of pyrimidine bases in a poly(Y) tract upstream of the first exon or increasing the number of pyrimidine bases in a poly(Y) tract downstream of the first exon; and/or (iii) deleting a splice donor site upstream of the second flanking intron.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION OF THE INVENTION
[0048] The present invention provides expression constructs and methods for expressing polypeptides, especially heteromultimeric polypeptides such as recombinant antibodies or fragments thereof or bispecific antibodies in host cells using alternative splicing. The invention provides a construct which may be expressed in a host cell using a single promoter to drive the transcription of a pre-mRNA which can be spliced into two or more mRNAs with the subsequent translation into different polypeptides.
[0049] The term expression construct or construct as used interchangeably herein includes a polynucleotide sequence encoding a polypeptide to be expressed and sequences controlling its expression such as a promoter and optionally an enhancer sequence, including any combination of cis-acting transcriptional control elements. The sequences controlling the expression of the gene, i.e. its transcription and the translation of the transcription product, are commonly referred to as regulatory unit. Most parts of the regulatory unit are located upstream of coding sequence of the gene and are operably linked thereto. The expression construct may also contain a downstream 3 untranslated region comprising a polyadenylation site. The regulatory unit of the invention is either operably linked to the gene to be expressed, i.e. transcription unit, or is separated therefrom by intervening DNA such as for example by the 5 -untranslated region (5UTR) of the heterologous gene. Preferably the expression construct is flanked by one or more suitable restriction sites in order to enable the insertion of the expression construct into a vector and/or its excision from a vector. Thus, the expression construct according to the present invention can be used for the construction of an expression vector, in particular a mammalian expression vector.
[0050] The term polynucleotide sequence encoding a polypeptide as used herein includes DNA coding for a gene, preferably a heterologous gene expressing the polypeptide.
[0051] The terms heterologous coding sequence, heterologous gene sequence, heterologous gene, recombinant gene or gene are used interchangeably. These terms refer to a DNA sequence that codes for a recombinant gene, in particular a recombinant heterologous protein product that is sought to be expressed in a host cell, preferably in a mammalian cell and harvested. The product of the gene can be a polypeptide. The heterologous gene sequence is naturally not present in the host cell and is derived from an organism of the same or a different species and may be genetically modified.
[0052] The terms protein and polypeptide are used interchangeably to include a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
[0053] The term promoter as used herein defines a regulatory DNA sequence generally located upstream of a gene that mediates the initiation of transcription by directing RNA polymerase to bind to DNA and initiating RNA synthesis. Promoters for use in the invention include, for example, viral, mammalian, insect and yeast promoters that provide for high levels of expression, e.g. the mammalian cytomegalovirus or CMV promoter, the SV40 promoter, or any promoter known in the art suitable for expression in eukaryotic cells.
[0054] The term 5 untranslated region (5UTR) refers to an untranslated segment in the 5 terminus of the pre-mRNA or mature mRNA. On mature mRNA, the 5UTR typically harbours on its 5 end a 7-methylguanosine cap and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5 end of the mRNA by the translational machinery and protection of the mRNAs against degradation.
[0055] The term intron refers to a segment of nucleic acid non-coding sequence that is transcribed and is present in the pre-mRNA but is excised by the splicing machinery based on the sequences of the donor splice site and acceptor splice site, respectively at the 5 and 3 ends of the intron, and therefore not present in the mature mRNA transcript. Typically introns have an internal site, called the branch point, located between 20 and 50 nucleotides upstream of the 3 splice site. The length of the intron used in the present invention may be between 50 and 450 nucleotides long. A shortened intron may comprise 50 or more nucleotides. A full length intron may comprise up to 450 nucleotides.
[0056] The term exon refers to a segment of nucleic acid sequence that is transcribed into mRNA.
[0057] The term splice site refers to specific nucleic acid sequences that are capable of being recognized by the splicing machinery of a eukaryotic cell as suitable for being cut and/or ligated to a corresponding splice site. Splice sites allow for the excision of introns present in a pre-mRNA transcript. Typically the 5 portion of the splice site is the referred to as the splice donor site and the 3 corresponding splice site is referred to as the acceptor splice site. The term splice site includes, for example, naturally occurring splice sites, engineered splice sites, for example, synthetic splice sites, canonical or consensus splice sites, and/or non-canonical splice sites, for example, cryptic splice sites.
[0058] The term poly(Y) tract refers to the stretch of nucleic acids found between the branch point and the intron-exon border (illustrated in
[0059] The term 3 untranslated region (3UTR) refers to an untranslated segment in the 3 terminus of the pre-mRNAs or mature mRNAs. On mature mRNAs this region harbours the poly(A) tail and is known to have many roles in mRNA stability, translation initiation and mRNA export.
[0060] The term enhancer as used herein defines a nucleotide sequence that acts to potentiate the transcription of genes independent of the identity of the gene, the position of the sequence in relation to the gene, or the orientation of the sequence. The vectors of the present invention optionally include enhancers.
[0061] The term polyadenylation signal refers to a nucleic acid sequence present in the mRNA transcripts, that allows for the transcripts, when in the presence of the poly(A) polymerase, to be polyadenylated on the polyadenylation site located 10 to 30 bases downstream the poly(A) signal. Many polyadenylation signals are known in the art and may be useful in the present invention. Examples include the human variant growth hormone polyadenylation signal, the SV40 late polyadenylation signal and the bovine growth hormone polyadenylation signal.
[0062] The terms functionally linked and operably linked are used interchangeably and refer to a functional relationship between two or more DNA segments, in particular gene sequences to be expressed and those sequences controlling their expression. For example, a promoter and/or enhancer sequence, including any combination of cis-acting transcriptional control elements is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system. Promoter regulatory sequences that are operably linked to the transcribed gene sequence are physically contiguous to the transcribed sequence.
[0063] Orientation refers to the order of nucleotides in a given DNA sequence. For example, an orientation of a DNA sequence in opposite direction in relation to another DNA sequence is one in which the 5 to 3 order of the sequence in relation to another sequence is reversed when compared to a point of reference in the DNA from which the sequence was obtained. Such reference points can include the direction of transcription of other specified DNA sequences in the source DNA and/or the origin of replication of replicable vectors containing the sequence.
[0064] The term nucleic acid sequence homology or nucleotide sequence homology as used herein include the percentage of nucleotides in the candidate sequence that are identical with the nucleotide sequence of the comparison sequence e.g. percentage of nucleotides in the first flanking intron that are identical with the nucleotide sequence of the second flanking intron, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Thus sequence identity can be determined by standard methods that are commonly used to compare the similarity in position of the nucleotides of two nucleotide sequences. Usually the nucleic acid sequence homology of the flanking intron sequences to each other is at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95%, in particular 96%, more particular 97%, even more particular 98%, most particular 99%, including for example, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%.
[0065] The term expression vector as used herein includes an isolated and purified DNA molecule which upon transfection into an appropriate host cell provides for a high-level expression of a recombinant gene product within the host cell. In addition to the DNA sequence coding for the recombinant or gene product the expression vector comprises regulatory DNA sequences that are required for an efficient transcription of the DNA coding sequence into mRNA and for an efficient translation of the mRNAs into proteins in the host cell line.
[0066] The term about as used herein in relation to the length of a nucleic acid sequence, includes deviations of a maximum of 50%, preferably of a maximum of 10% of the stated values e.g. about 50 nucleotides includes values of 25 to 75 nucleotides, preferably 45 to 55 nucleotides, about 450 nucleotides includes values of 225 to 675 nucleotides, preferably 405 to 495 nucleotides.
[0067] The terms host cell or host cell line as used herein include any cells, in particular mammalian cells, which are capable of growing in culture and expressing a desired recombinant product protein.
[0068] Recombinant polypeptides and proteins can be produced in various expression systems such as prokaryotic (e.g. E. coli), eukaryotic (e.g. yeast, insect, vertebrate, mammalian), and in vitro expression systems. Most commonly used methods for the large-scale production of protein-based biologics rely on the introduction of genetic material into host cells by transfection of DNA vectors. Transient expression of polypeptides can be achieved with transient transfection of host cells. Integration of vector DNA into the host cell genome results in a cell line that is stably transfected and propagation of such a stable cell line can be used for the large-scale production of polypeptides and proteins.
[0069] In contrast to the alternative splicing approaches described previously, the present applicants have designed an alternative splicing approach for the expression of polypeptides at a desired ratio through the use of multiple splice donor and acceptor sites in an expression construct. Such an approach enables high transient and stable titres of polypeptides to be produced, with transient titres of up to 60 times higher compared to those obtained in prior art approaches. For example, titres of up to 15 g/ml of antibody were observed following transient transfection using an expression construct of the present invention, compared to levels of, for example, 0.25 g/ml observed in Table 1 of WO200589285, supra. For stably transfected cell lines, titres of up to 200 g/ml of antibody were observed in batch culture (
[0070] An expression construct of the present invention, comprises two alternate exons, each encoding a polypeptide. A splice donor site is included both upstream and downstream of the first exon. In addition, a splice acceptor site is included both upstream and downstream of the first exon. In a preferred embodiment of the present invention, the first exon is flanked by two functional copies of the same intron. During a splice event, these same intron sequences are cut out and are not present in the mature mRNA. Such a construct is functionally similar to naturally occurring alternate exons. Introns suitable for use in an expression construct of the present invention can be selected from the list consisting of: -globin/IgG chimeric intron, -globin intron, IgG intron, mouse CMV first intron, rat CMV first intron, human CMV first intron, Ig variable region intron and splice acceptor sequence (Bothwell et al., (1981) Cell, 24: 625-637; U.S. Pat. No. 5,024,939), introns of the chicken TNT gene and introns of EF1alpha, preferably the first intron of EF1alpha. In a preferred embodiment, the intron flanking the first exon can be the cTNT intron number 4 (cTNT-I4), the cTNT intron number 5 (cTNT-I5) or the EF1alpha first intron. In more preferred embodiment, the intron flanking the first exon is cTNT-I4.
[0071] In order to adjust the ratio of expression between the first and second exons, small variations in the intron upstream of the first exon can be introduced. Such variations comprise altering the number of pyrimidine bases in a polypyrimidine (poly(Y)) tract located upstream of the first exon. As is demonstrated in Example 2, altering the number of pyrimidine bases in the poly(Y) tract can have a major impact on the expression of the first and second exons. For example, increasing the number of pyrimidine bases in the poly(Y) tract strengthens the splice acceptor site of the second exon coding for the second polypeptide. Alternatively, decreasing the number of pyrimidine bases in the poly(Y) tract weakens the splice acceptor site of the first exon coding for the first polypeptide. It was found that decreasing the strength of the first splice acceptor site upstream of the first exon leads towards exclusion of the first exon and therefore results in higher expression from the second exon. In an embodiment of the present invention, the expression construct comprises a poly(Y) tract upstream of the first exon. The number of pyrimidine bases in the poly(Y) tract may comprise between 0 and 30 bases. Preferably the poly(Y) tract comprises a number of pyrimidine bases selected from the group consisting of 28, 27, 26, 25 and 24 bases. More preferably, the poly(Y) tract comprises 10 pyrimidine bases or less, even more preferably 7 bases or less, most preferably 5 bases or less. In one embodiment of the present invention, the poly(Y) tract is absent from the expression construct.
[0072] In another embodiment of the present invention, to shift the ratio of expression from the first exon to the second exon, the second splice donor site upstream of the second exon can be eliminated. Such a deletion can be achieved by deleting the exon-intron consensus region and the entire intron upstream of the second splice acceptor region. Such a deletion increased the shift from expression of the first polypeptide to expression of the second polypeptide. In a preferred embodiment, the elimination of the second splice donor site can be combined with a reduction in the number of pyrimidine bases in the poly(Y) tract upstream of the first exon of the expression construct. Combination of these two features led to almost predominant expression of the second exon and therefore the second polypeptide, as demonstrated in Example 1.
[0073] In an aspect of the present invention, the ratio of expression between the first and second exons can be altered by using introns of the same sequence to flank the first exon, altering the number of pyrimidine bases in the poly(Y) tract and/or eliminating the splice donor site upstream of the second flanking intron.
[0074] In another embodiment of the present invention, the expression construct further comprises a splice donor site and a splice acceptor site that flank an intron downstream of a promoter region at the 5 end of the expression construct. These constitutive intron, splice donor and splice acceptor sites are constitutively spliced during maturation of the pre-mRNA into mature mRNA. These constitutive components of the expression construct are separated from the intron upstream of the first exon by a 5untranslated region. In a further embodiment of the present invention, a polyadenylation site is located downstream of the second exon at the 3 end of the construct.
[0075] In an aspect of the present invention, the expression construct is suitable for expressing two or more polypeptides, in particular polypeptide multimers for example antibodies or fragments thereof.
[0076] The term antibody as referred to herein includes whole antibodies and any antigen binding fragments or single chains thereof. An antibody refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, or an antigen binding fragment thereof. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region is comprised of three domains, CH1 CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is comprised of one domain, CL. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR) which are hypervariable in sequence and/or involved in antigen recognition and/or usually form structurally defined loops, interspersed with regions that are more conserved, termed framework regions (FR or FW). Each VH and VL is composed of three CDRs and four FWs, arranged from amino-terminus to carboxy-terminus in the following order: FW1, CDR1, FW2, CDR2, FW3, CDR3, FW4. The amino acid sequences of FW1, FW2, FW3, and FW4 all together constitute the non-CDR region or non-extended CDR region of VH or VL as referred to herein.
[0077] The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
[0078] Antibodies are grouped into classes, also referred to as isotypes, as determined genetically by the constant region. Human constant light chains are classified as kappa (C) and lambda (C) light chains. Heavy chains are classified as mu (), delta (), gamma (), alpha (), or epsilon (), and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. The IgG class is the most commonly used for therapeutic purposes. In humans this class comprises subclasses IgG1, IgG2, IgG3 and IgG4.
[0079] The term Fab or Fab region as used herein includes the polypeptides that comprise the VH, CH1, VL, and CL immunoglobulin domains. Fab may refer to this region in isolation, or this region in the context of a full length antibody or antibody fragment.
[0080] The term Fc or Fc region, as used herein includes the polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain. Thus Fc refers to the last two constant region immunoglobulin domains of IgA, IgD, and IgG, and the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge N-terminal to these domains. For IgA and IgM, Fc may include the J chain. For IgG, Fc comprises immunoglobulin domains C gamma 2 and C gamma 3 (C2 and C3) and the hinge between C gamma 1 (C1) and C gamma 2 (C2). Although the boundaries of the Fc region may vary, the human IgG heavy chain Fc region is usually defined to comprise residues C226 or P230 to its carboxyl-terminus, wherein the numbering is according to the EU numbering system. For human IgG1 the Fc region is herein defined to comprise residue P232 to its carboxyl-terminus, wherein the numbering is according to the EU numbering system (Edelman G M et al., (1969) Proc Natl Acad Sci USA, 63(1): 78-85). Fc may refer to this region in isolation or this region in the context of an Fc polypeptide, for example an antibody.
[0081] The term full length antibody as used herein includes the structure that constitutes the natural biological form of an antibody, including variable and constant regions. For example, in most mammals, including humans and mice, the full length antibody of the IgG class is a tetramer and consists of two identical pairs of two immunoglobulin chains, each pair having one light and one heavy chain, each light chain comprising immunoglobulin domains VL and CL, and each heavy chain comprising immunoglobulin domains VH, CH1 (C1), CH2 (C2), and CH3 (C3). In some mammals, for example in camels and llamas, IgG antibodies may consist of only two heavy chains, each heavy chain comprising a variable domain attached to the Fc region.
[0082] Antibody fragments include, but are not limited to, (i) the Fab fragment consisting of VL, VH, CL and CH1 domains, including Fab and Fab-SH, (ii) the Fd fragment consisting of the VH and CH1 domains, (iii) the Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment (Ward E S et al., (1989) Nature, 341: 544-546) which consists of a single variable, (v) F(ab).sub.2 fragments, a bivalent fragment comprising two linked Fab fragments (vi) single chain Fv molecules (scFv), wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site (Bird R E et al., (1988) Science 242: 423-426; Huston J S et al., (1988) Proc. Natl. Acad. Sci. USA, 85: 5879-83), (vii) bispecific single chain Fv dimers (PCT/US92/09965), (viii) diabodies or triabodies, multivalent or multispecific fragments constructed by gene fusion (Tomlinson I & Hollinger P (2000) Methods Enzymol. 326: 461-79; WO94/13804; Holliger P et al., (1993) Proc. Natl. Acad. Sci. USA, 90: 6444-48) and (ix) scFv genetically fused to the same or a different antibody (Coloma M J & Morrison S L (1997) Nature Biotechnology, 15(2): 159-163).
[0083] Antibodies and fragment thereof that can be expressed by an expression construct as described herein may bind to an antigen selected from the list consisting of: AXL, Bcl2, HER2, HER3, EGF, EGFR, VEGF, VEGFR, IGFR, PD-1, PD-1L, BTLA, CTLA-4, GITR, mTOR, CS1, CD3, CD16, CD16a, CD19, CD20, CD22, CD25, CD27, CD28, CD30, CD32b, CD33, CD38, CD40, CD52, CD64, CD79, CD89, CD137, CD138, CA125, cMet, CCR6, MUCI, PEM antigen, Ep-CAM, EphA2, 17-1a, CEA, AFP, HLA class II, HLA-DR, HSG, IgE, IL-12, IL-17a, IL-18, IL-23, IL-1alpha, IL-1beta, GD2-ganglioside, MCSP, NG2, SK-I antigen, Lag3, PAR2, PDGFR, PSMA, Tim3, TF, CTLA4, TL1A, TIGIT, SIRPa, ICOS, Treml2, NCR3, HVEM, OX40, VLA-2 and 4-1BB.
[0084] Bispecific or heterodimeric antibodies have been available in the art for many years. However the generation of such antibodies is often associated with the presence of mispaired by-products, which reduces significantly the production yield of the desired bispecific antibody and requires sophisticated purification procedures to achieve product homogeneity. The mispairing of immunoglobulin heavy chains can be reduced by using several rational design strategies, most of which engineer the antibody heavy chains for heterodimerisation via the design of man-made complementary heterodimeric interfaces between the two subunits of the CH3 domain homodimer. The first report of an engineered CH3 heterodimeric domain pair was made by Carter et al. describing a protuberance-into-cavity approach for generating a hetero-dimeric Fc moiety (U.S. Pat. No. 5,807,706; knobs-into-holes; Merchant A M et al., (1998) Nat Biotechnol, 16(7):677-81). Alternative designs have been recently developed and involved either the design of a new CH3 module pair by modifying the core composition of the modules as described in WO2007110205 or the design of complementary salt bridges between modules as described in WO2007147901 or WO2009089004. The disadvantage of the CH3 engineering strategies is that these techniques still result in the production of a significant amount of undesirable homo-dimers. A more preferred technique for generating bispecific antibodies in which predominantly heterodimers are produced is described in WO2012131555. Bispecific antibodies can be generated to a number of targets, for example, a target located on tumour cells and/or a target located on effector cells. Preferably, a bispecific antibody can bind to two targets selected from the list consisting of: AXL, Bcl2, HER2, HER3, EGF, EGFR, VEGF, VEGFR, IGFR, PD-1, PD-1L, BTLA, CTLA-4, GITR, mTOR, CS1, CD3, CD16, CD16a, CD19, CD20, CD22, CD25, CD27, CD28, CD30, CD32b, CD33, CD38, CD40, CD52, CD64, CD79, CD89, CD137, CD138, CA125, cMet, CCR6, MUCI, PEM antigen, Ep-CAM, EphA2, 17-1a, CEA, AFP, HLA class II, HLA-DR, HSG, IgE, IL-12, IL-17a, IL-18, IL-23, IL-1alpha, IL-1beta, GD2-ganglioside, MCSP, NG2, SK-I antigen, Lag3, PAR2, PDGFR, PSMA, Tim3, TF, CTLA4, TL1A, TIGIT, SIRPa, ICOS, Treml2, NCR3, HVEM, OX40, VLA-2 and 4-1BB.
[0085] In a further aspect, the present invention provides a host cell comprising an expression construct or an expression vector as described supra. The host cell can be a human or non-human cell. Preferred host cells are mammalian cells. Preferred examples of mammalian host cells include, without being restricted to, Human embryonic kidney cells (Graham F L et al., (1977) J. Gen. Virol. 36: 59-74), MRCS human fibroblasts, 983M human melanoma cells, MDCK canine kidney cells, RF cultured rat lung fibroblasts isolated from Sprague-Dawley rats, B16BL6 murine melanoma cells, P815 murine mastocytoma cells, MT1 A2 murine mammary adenocarcinoma cells, PER:C6 cells (Leiden, Netherlands) and Chinese hamster ovary (CHO) cells or cell lines (Puck T T et al., (1958), J. Exp. Med. 108: 945-955).
[0086] In a particular preferred embodiment the host cell is a Chinese hamster ovary (CHO) cell or cell line. Suitable CHO cell lines include e.g. CHO-S (Invitrogen, Carlsbad, Calif., USA), CHO K1 (ATCC CCL-61), CHO pro3-, CHO DG44, CHO P12 or the dhfr-CHO cell line DUK-BII (Urlaub G & Chasin L A (1980) PNAS 77(7): 4216-4220), DUXBI 1 (Simonsen C C & Levinson A D (1983) PNAS 80(9): 2495-2499), or CHO-K1SV (Lonza, Basel, Switzerland).
[0087] In a preferred aspect of the present invention, the optimal ratio of expression of the first polypeptide to the second polypeptide will be determined in transient transfection experiments. The ratio of splicing remains similar in transient and in stable cell lines. The construct with the optimal splice ratio can then be used for stable cell line generation, leading to cell lines that express for example, an antibody heavy and light chain (or all subunits of a bispecific molecule) at an optimal ratio. In an embodiment of the invention, the expression construct permits stable expression at an unchanged ratio for multiple generations, as shown in Example 2. Furthermore, use of a selection pressure is not required to maintain stable expression at the desired ratio.
[0088] In one aspect, the splice ratio of antibody heavy chain to light chain for optimal expression may be 1:1. Preferably the splice ratio of antibody heavy chain to light chain for optimal expression may be 1:2 or 1:3 or 2:3. Alternatively, the splice ratio of antibody heavy chain to light chain for optimal expression may be 2:1 or 3:1 or 3:2. Such a ratio for optimal expression will be dependent on the respective antibody.
[0089] In a further aspect, for the optimal expression of bispecific antibodies the different subunits may be expressed at different ratios using alternative splicing. A preferred bispecific antibody of the present invention comprises the subunits of a heavy chain, a light chain and an Fc-scFv. For a bispecific antibody, as shown in the present invention, the ratio of heavy chain to Fc-scFv expression was found to be the most important parameter. Therefore the splice ratio of heavy chain to Fc-scFv for optimal expression may be 1:1. Preferably the splice ratio of heavy chain to Fc-scFv for optimal expression may be 1:2 or 1:3 or 2:3. Alternatively, the splice ratio of heavy chain to Fc-scFv for optimal expression may be 2:1 or 3:1 or 3:2. Such a ratio for optimal expression will be dependent on the respective antibody.
[0090] In a further aspect, the present disclosure provides an in vitro method for the expression of a polypeptide, comprising transfecting a host cell with the expression construct or an expression vector as described supra culturing the host cell and recovering the polypeptide. The polypeptide is preferably a heterologous, more preferably a human polypeptide.
[0091] For transfecting the expression construct or the expression vector into a host cell according to the present invention any transfection technique such as those well-known in the art, e.g. electoporation, calcium phosphate co-precipitation, DEAE-dextran transfection, lipofection, can be employed if appropriate for a given host cell type. It is to be noted that the host cell transfected with the expression construct or the expression vector of the present invention is to be construed as being a transiently or stably transfected cell line. Thus, according to the present invention the present expression construct or the expression vector can be maintained episomally i.e. transiently transfected or can be stably integrated in the genome of the host cell i.e. stably transfected.
[0092] A transient transfection is characterised by non-appliance of any selection pressure for a vector borne selection marker. In transient expression experiments which commonly last two to up to ten days post transfection, the transfected expression construct or expression vector are maintained as episomal elements and are not yet integrated into the genome. That is the transfected DNA does not usually integrate into the host cell genome. The host cells tend to lose the transfected DNA and overgrow transfected cells in the population upon culture of the transiently transfected cell pool. Therefore expression is strongest in the period immediately following transfection and decreases with time. Preferably, a transient transfectant according to the present invention is understood as a cell that is maintained in cell culture in the absence of selection pressure up to a time of two to ten days post transfection.
[0093] In a preferred embodiment of the invention the host cell e.g. the CHO host cell is stably transfected with the expression construct or the expression vector of the present invention. Stable transfection means that newly introduced foreign DNA such as vector DNA is becoming incorporated into genomic DNA, usually by random, non-homologous recombination events. The copy number of the vector DNA and concomitantly the amount of the gene product can be increased by selecting cell lines in which the vector sequences have been amplified after integration into the DNA of the host cell. Therefore, it is possible that such stable integration gives rise, upon exposure to further increases in selection pressure for gene amplification, to double minute chromosomes in CHO cells. Furthermore, a stable transfection may result in loss of vector sequence parts not directly related to expression of the recombinant gene product, such as e.g. bacterial copy number control regions rendered superfluous upon genomic integration. Therefore, a transfected host cell has integrated at least part or different parts of the expression construct or the expression vector into the genome.
[0094] In a further aspect, the present disclosure provides the use of the expression construct or an expression vector as described supra for the expression of a heterologous polypeptide from a mammalian host cell, in particular the use of the expression construct or an expression vector as described supra for the in vitro expression of a heterologous polypeptide from a mammalian host cell.
[0095] An expression construct as described in the present invention can be used in a method of optimizing the expression level of a protein of interest. For example, when the protein of interest is an antibody, the expression ratio of the light chain to the heavy chain or vice versa can be altered, to achieve the optimal expression level of the antibody when expressed in a host cell. Using an expression construct comprising in a 5 to 3 direction:
[0096] a promoter;
[0097] an optional first splice donor site;
[0098] a first flanking intron;
[0099] a splice acceptor site;
[0100] a first exon encoding a first polypeptide;
[0101] an optional second splice donor site;
[0102] a second flanking intron;
[0103] a splice acceptor site; and
[0104] a second exon encoding a second polypeptide,
[0105] the expression level of a protein of interest may be optimised by a method comprising the steps of: [0106] (i) using first and second flanking introns having a nucleic acid sequence homology of at least 80% for a stretch of nucleic acids of at least 50 nucleotides; [0107] (ii) reducing the number of pyrimidine bases in a poly(Y) tract located upstream of the first exon or increasing the number of pyrimidine bases in a poly(Y) tract located downstream of the first exon; and/or [0108] (iii) deleting the splice donor site upstream of the second flanking intron.
[0109] Furthermore, an expression construct as described in the present invention can be used in a method of optimizing the heterodimerisation level of a protein of interest. For example, if the protein of interest is a bispecific antibody, such a bispecific antibody may be encoded by one or more expression constructs according to the present invention, which encode a heavy chain, light chain and Fc-scFv. By using the methods of alternative splicing as described herein, the expression ratio of the heavy chain to Fv-scFv or vice versa, for example, can be altered to achieve the optimal expression level of the bispecific antibody when expressed in a host cell. Using an expression construct comprising in a 5 to 3 direction:
[0110] a promoter;
[0111] an optional first splice donor site;
[0112] a first flanking intron;
[0113] a splice acceptor site;
[0114] a first exon encoding a first polypeptide;
[0115] an optional second splice donor site;
[0116] a second flanking intron;
[0117] a splice acceptor site; and
[0118] a second exon encoding a second polypeptide,
[0119] the heterodimerisation level of a protein of interest may be optimised by a method comprising the steps of: [0120] (iv) using first and second flanking introns having a nucleic acid sequence homology of at least 80% for a stretch of nucleic acids of at least 50 nucleotides; [0121] (v) reducing the number of pyrimidine bases in a poly(Y) tract upstream of the first exon or increasing the number of pyrimidine bases in a poly(Y) tract downstream of the first exon; and/or [0122] (vi) deleting the splice donor site upstream of the second flanking intron.
[0123] Expression and recovering of the protein can be carried out according to methods known to the person skilled in the art.
[0124] In a further aspect, the present disclosure provides the use of the expression construct or the expression vector as described supra for the preparation of a medicament for the treatment of a disorder.
[0125] In a further aspect, the present disclosure provides the expression construct or the expression vector as described supra for use as a medicament for the treatment of a disorder.
[0126] In a further aspect, the present disclosure provides the expression construct or the expression vector as described supra for use in gene therapy.
EXAMPLES
Example 1
Materials and Methods
LB Culture Plates
[0127] 500 ml of water was mixed and boiled with 16 g of LB Agar (Invitrogen, Carlsbad, Calif., USA) (1 liter of LB contains 10 g tryptone, 5 g yeast extract and 10 g NaCl). After cooling, the respective antibiotic was added to the solution which was then distributed in culture dishes (ampicilin plates at 100 g/ml and kanamycin plates at 50 g/ml).
Polymerase Chain Reaction (PCR)
[0128] All PCRs were performed using 1 l of dNTPs (10 mM for each dNTP; Invitrogen, Carlsbad, Calif., USA), 2 units of Phusion DNA Polymerase (Finnzymes Oy, Espoo, Finland), 25 nmol of Primer A (Mycrosynth, Balgach, Switzerland), 25 nmol of Primer B (Mycrosynth, Balgach, Switzerland), 10 l of 5HF buffer (7.5 mM MgCl2, Finnzymes, Espoo, Finland), 1.5 l of Dimethyl sulfoxide (DMSO, Finnzymes, Espoo, Finland) and 1-3 l of the template (10-20 ng) in a 50 l final volume.
[0129] The PCRs were started by an initial denaturation at 98 C. for 3 minutes, followed by 35 cycles of 30 sec denaturation at 98 C., 30 sec annealing at a primer-specific temperature (according to CG content) and elongation at 72 C. (30 sec/kB of template). A final elongation at 72 C. for 10 min was performed before cooling and keeping at 4 C. All primers used for this example are listed in the following Table 1.
TABLE-US-00001 TABLE1 Listofallprimersusedforcloning Seq ID Primer No: Sequence Glnpr991 001 GGTCATTTCGAATCATTACTTGTACAGCTCGT Glnpr1095 002 CGCTGGCTAGCGTTTAAACTTAAG Glnpr1096 003 ATCGTTCGAATATGGGCCCTCTCGCACACCGGTCT CCTCTTCCTCCTC Glnpr1097 004 TATAGGGCCCTGTGAGCAAGGGCGAGGAG Glnpr1098 005 GCGCTTCGAATCATTACTTGTACAGCTCGTC Glnpr1099 006 TATAGGGCCCTCTACAGGAACAGGTGGTG Glnpr1100 007 ATTAACCGGTGCCTCCTCCGAGGACGTC Glnpr1138 008 AATTAAGCTAGCGTTTAAACTTAAGCTTCCTTGGA TTACAAGGATGACGAT Glnpr1139 009 GTGGCGATATCGCCTGGATCCTGAG Glnpr1140 010 CCAGGCGATATCGCCACCATGGGTGCCTCCTCCGA GGA Glnpr1141 011 CTACCTGAATTCTTCCGTTACTACAGGAACAGGTG GTGGCGGC Glnpr1142 012 GAGGAGACCGGTGCCACCATGGAGCAAGGGCGAGG AGCTGT Glnpr1158 013 AATTAAGCTAGCGTTTAAACTTAAGCTTCCTTGGA GGACCCAGTACCCGGATCTAGAGGTAGG Glnpr1180 014 AATTAAACCGGTGCCACCATGGTGAGCAAGGGCGA GGAGC Glnpr1181 015 GCGCGGCTAGCGTTTAAACTTAAGC Glnpr1182 016 TTGTGATATCGCCTGGATCCTGTGCAATAAGGACA GGGTTAGCCAGGTGCCTTAAAGCTGTG Glnpr1183 017 AGCAGGATATCGCCTGGATCCTGAGACAGGGAGGA GG Glnpr1184 018 ATATGATATCGCCTGGATCCTGAGCCAGGGAGCAG GCAAGGCAAGAAGCGCAGAGGTTAGCC Glnpr1185 019 AGTCGATATCGCCTGGATCCTGAGCCAGGTAGCAG GGAAGGGAAG Glnpr1186 020 GATGGATATCGCCTGGATCCTGAGCCAGGGAGGAG GGAAGGCAACAAGCGCAGAGGTTAGCC Glnpr1187 021 GCGCGAATTCAGGTAGTTACTGCAC Glnpr1189 022 TATAACCGGTCTCCTCTTCCTCCTCGTCCTCCTGA TCCTCCTGACCTGAGCCAGGGAGGAGGGAAG Glnpr1190 023 TAATACCGGTCTCCTCTTCCTCCTCGTCCTCCTGA TCCTCCTGACCTGAGCCAGGGAGCAGGCAAGGCAA GAAG Glnpr1191 024 ATATACCGGTCTCCTCTTCCTCCTCGTCCTCCTGA TCCTCCTGACCTGAGACAGGGAGGAGGGAAG Glnpr1192 025 ATATACCGGTCTCCTCTTCCTCCTCGTCCTCCTGA TCCTCCTGACCTGAGCCAGGGAGGAGGGAAG Glnpr1193 026 ATATACCGGTCTCCTCTTCCTCCTCGTCCTCCTGA TCCTCCTGACCTGAGCCAGGTAGCAGGGAAGGGAA GAAG Glnpr1237 027 GGCGGCTAGCGTTTAAACTTAAGCTTCCTTGGAGG ACCCAGTACCCGGATCTAGAGTAGTTACTGCACCT TTCTTTG Glnpr1238 028 ATCGGATATCGCCTGGATCCTGTGCAATAAGGACA GGGTC Glnpr1239 029 GTGGCGATATCGCCTGGATCCTHTGCAATAAGGAC Glnpr1240 030 TGGCGATATCGCCTGGATCCTGTGCAATAAGGACA GCCTTAGCCAGGTGCCTTAAAG Glnpr1241 031 TGGCGATATCGCCTGGATCCTGTGCAATAAGGACA GGGTTCTCCAGGTGCCTTAAAG Glnpr1242 032 TGGCGATATCGCCTGGATCCTGTGCAATAAGGACA GGGCAAGCCAGGTGCCTTAAAG Glnpr1243 033 TGGCGATATCGCCTGGATCCTGTGCAATAAGGACA GCGTAGGCCAGGTGCCTTAAAG Glnpr1244 034 GCGATATCGCCTGGATCCTGTCCCCTAAGGACTCG GTTAGCCAGGTGCCTTAAAGCTGTG Glnpr1245 035 GCGATATCGCCTGGATCCTGTGCAATCCTCCCAGG GTTAGCCAGGTGCCTTAAAGCTGTG Glnpr1246 036 GCGATATCGCCTGGATCCTGTTCCCTCCTCCCTCG GTTAGCCAGGTGCCTTAAAGCTGTG Glnpr1285 037 CGGAAGAATTCAGCCACAGCTTTAAGGCACCTGGC TAAC
Restriction Digest
[0130] For all restriction digests 1 g of plasmid DNA (quantified with Nano Drop) was mixed to 10-20 units of each enzyme, 4 l of corresponding 10 NEBuffer (NEB, Ipswich, Mass., USA), and the volume was completed to 40 l with sterile H.sub.2O. Without further indication, digestions were incubated 1 hour at 37 C. After each preparative digestion of backbone, 1 unit of Calf Intestinal Alkaline Phosphatase (CIP; NEB, Ipswich, Mass., USA) was added and the mix was incubated 30 min at 37 C.
PCR Purification and Gel Agarose Electrophoresis
[0131] To allow digestion all PCR fragments were cleaned prior to restriction digests using the Macherey Nagel NucleoSpin Extract II kit (Macherey Nagel, Oensingen, Switzerland) following the manual of the manufacturer. This protocol was also used for changing buffers of DNA samples.
[0132] For gel electrophoresis, 1% gels were prepared using UltraPure Agarose (Invitrogen, Carlsbad, Calif., USA) and 50 Tris Acetic Acid EDTA buffer (TAE, pH 8.3; Bio RAD, Munich, Germany). For staining of DNA 1 l of Gel Red Dye (Biotum, Hayward, Calif., USA) was added to 100 ml of agarose gel. As a size marker 2 g of the 1 kb DNA ladder (NEB, Ipswich, Mass., USA) was used. The electrophoresis was run for 1 hour at 125 Volts.
[0133] The bands of interests were cut out from the agarose gel and purified using the kit NucleoSpin Extract II (Macherey-Nagel, Oensingen, Switzerland), following the manual of the manufacturer.
Ligation
[0134] For each ligation, 4 l of insert were mixed to 1 l of vector, 400 units of ligase (T4 DNA ligase, NEB, Ipswich, Mass., USA), 1 l of 10 ligase buffer (T4 DNA ligase buffer; NEB, Ipswich, Mass., USA) in a 10 l volume. The mix was incubated for 1-2 h at RT.
[0135] 25-50 l of competent bacteria (One Shot TOP 10 Competent E. coli; Invitrogen, Carlsbad, Calif., USA) were thawed on ice for 5 minutes. 5 l of ligation product were added to competent bacteria and incubated for 20-30 min on ice before the thermic shock for 1 minute at 42 C. Then, 500 l of S.O.C medium (Invitrogen, Carlsbad, Calif., USA) were added per tube and incubated for 1 hour at 37 C. under agitation with 600 rpm on thermoshaker. Finally, the bacteria were put on a LB plate with ampicillin (Sigma-Aldrich, St. Louis, Mo., USA) or kanamycin and incubated overnight at 37 C.
Plasmid Preparation in Small (Mini) and Medium Scale (Midi)
[0136] For mini-preparation, colonies of transformed bacteria were grown for 6-16 hours in 2.5 ml of LB and ampicillin or kanamycin at 37 C., 200 rpm. The DNA was extracted with a plasmid purification kit for E. coli (NucleoSpin QuickPure or NucleoSpin Plasmid (No Lid), Macherey Nagel, Oensingen, Switzerland), following the provided manual.
[0137] For midi-preparation, transformed bacteria were grown at 37 C. overnight in 200 ml of LB and ampicillin (or kanamycin). Then, the culture was centrifuged 20 min at 725 g and the plasmid was purified using a commercial kit (NucleoBond Xtra Midi; Macherey Nagel, Oensingen, Switzerland) following the protocol provided in the manual of the manufacturer.
[0138] Plasmid-DNA from midi-preparation was quantified three times with the Nano Drop ND-1000 Spectrophotometer, confirmed by restriction digest and finally sent for sequencing (Fasteris SA, Geneva, Switzerland).
Cultivation and Transfection of Cells
[0139] The cells were cultivated for routine passaging in 100 ml growth medium (PowerCHO2 (Lonza, Verviers, Belgium), 4 mM Gln for CHO-S cells and Ex-cell293 (Sigma-Aldrich, St. Louis, Mo.), 4 mM Gln for HEK293 cells). Cells were seeded at 0.5E6 cells/ml twice a week and incubated in a shaken incubator in an atmosphere of 5% CO2 and 80% humidity.
[0140] The constructs were transfected in CHO-S cells and HEK293 cells. For transfection, the cells were seeded at a density of 1E6 cells/ml prior to the day of transfection. The day of transfection, the cells were resuspended in either Optimem (CHO-S) or RPMI (HEK293) and transfected with JetPEI (Polyplus-transfection, Strasbourg, France) according to the manual of the manufacturer. After 5 hours one volume of the respective growth medium was added (for HEK293 cells this was supplemented with Pluronic F68). The cells were analysed three to five days after transfection by FACS for GFP and dsRED expression. The transfection was done in 12 or 24 well plates (TPP, Trasadingen, Switzerland) using a final volume of 2 ml or 1 ml, respectively, or in 50 ml bioreactor tubes (Tubespins, TPP) using a final medium volume of 10 ml.
FACS Analysis
[0141] The cells were gated on living cells using forward and side scatter. For the analysis of the ratio of dsRED and GFP expressing cells, compensation was performed using dsRED transfected cells and GFP transfected cells. For the estimation of the shift from dsRED to GFP expressing cells, non-transfected cells were excluded by adding a gate.
Results
Design of Constructs and Cloning Steps
[0142] In order to be able to visualize the expression of two alternate open reading frames located on two different exons of the same primary transcript, the fluorescence markers GFP and dsRED were used. Both proteins can be intracellularly expressed at high levels, are well tolerated by cells and can be easily distinguished in FACS analysis or under a fluorescent microscope. A disadvantage of using fluorescent markers is the fact that the measured fluorescence cannot be easily attributed to a quantity of protein and therefore only conclusions on relative expression levels of one protein compared to another are possible. Therefore at this early experimental phase, different constructs were created in order to obtain a range of different relative expression levels from exon 1 and 2 (see scheme in
[0143] The alternate splicing constructs were made based on the chicken troponin (cTNT) introns 4 and 5 surrounding the alternate cTNT exon 5. Troponin is expressed exclusively in cardiac muscle and embryonic skeletal muscle. Over 90% of the mRNAs include the exon in early embryonic heart and skeletal muscle, whereas >95% of mRNAs in the adult exclude the exon (Cooper & Ordahl (1985) JBC 260(20):11140-8). In the constructs of the present invention, the cTNT introns were cloned as second and third intron of the primary transcript. The first intron is a constitutive intron that is used in combination with the mCMV or the hCMV promoter. It is important to note, that the cTNT intron names used in this example designate an intron sequence and not the position of the intron in the construct (cTNT intron 4 may be intron number 2 or 3 in the constructs). In order to avoid confusion the cTNT intron 4 will be abbreviated cTNT-I4 and the cTNT intron 5 will be abbreviated cTNT-I5, while the position of the introns in the respective construct will be counted using AS intron numbers (for example in the basic construct, cTNT-I4 was cloned in position AS intron #2). In the basal construct (GSC2250), the intron sequences cTNT-I4 (AS intron #2) and cTNT-I5 (AS intron #3) flank a modified alternate exon which contains the open reading frame coding for dsRED. Downstream of AS intron #3 (in basal construct cTNT-I5) follows the exon which contains the open reading of GFP (see
Cloning of the Vector Described in Orengo et al
[0144] The alternate splicing construct of the invention was based on a construct described by Orengo et al (Orengo J R et al., (2006) Nucleic Acids Res. 2006; 34(22): e148). In this construct, the start codon of the expression cassette is shared between the open reading frames coding for dsRED and GFP, followed by a flag tag and a short nuclear localization sequence. The very short alternate exon flanked by the chicken troponin introns 4 and 5 had been adjusted in length by the authors to be excluded at approximately 50%. If excluded, the open reading of dsRED is in frame with the start codon and only dsRED is expressed. Inclusion of the small alternate exon will introduce a frameshift to the reading frame. The open reading frame of dsRED will be read in the second frame (no stop codon is present in this frame of dsRED) leading to a fusion protein of dsRED (read in the second frame) and GFP. The disadvantages of this technology are numerous. First, one of the proteins is necessarily a fusion protein of the second frame of the first protein and the second protein. Second, not many proteins have a second open reading frame without stop codons and very few proteins will show biological activity with a nonsense protein fused to the N-terminus. Furthermore, this technology is unsuitable for use in a therapeutic context, because of the immunogenic potential of the unfolded fusion protein, therefore this construct was used as a control for the alternate expression of dsRED and GFP and as a basis for further and optimized constructs.
[0145] The DNA construct was ordered from GeneArt (Regensburg, Germany, now Life Technologies). The lyophilized plasmid DNA from GeneArt was resuspended according to the specifications of GeneArt and used as template for a PCR amplification using the primers GlnPr1095 and GlnPr1096. This added a NheI site to the 5 end. The SacII restriction site at the 3 end was replaced by ApaI and an additional BstBI site was added to the 3 end. The digestion of this fragment with the restrictions enzymes NheI and BstBI allowed ligation into the backbone of pGLEX3HM-MCS, opened using the same enzymes and CIPed. The pGLEX3HM-MCS vector contains an expression cassette under control of the hCMV promoter. The new vector with the GeneArt fragment in the pGLEX3HM-MCS backbone was called pGLEX3-ASC.
[0146] EGFP was amplified from pGLEX3 (a vector previously cloned in-house that contained an open reading frame coding for EGFP (in short: GFP) derived from the plasmid pEGFP-N1 (Clontech)) using the primers GlnPr1097 and GlnPr1098. The amplification removes the start codon ATG from the open reading frame of GFP and adds an ApaI site to the 5 end and a BstBI site to the 3 end. Digestion of the amplicon using the restriction enzymes ApaI, BstBI and ligation into pGLEX3-ASC, opened with the same enzymes, led to the vector pGLEX3-ASC-GFP.
[0147] The dsRED open reading frame was amplified from the plasmid pdsRED-Express 1 (Clontech) using the primers GlnPr1099 and GlnPr1100. These primers remove the start codon ATG from the 5 end and add an AgeI restriction site to the 5 end and an ApaI site to the 3end. The amplicon was digested using the restriction enzymes AgeI and ApaI and ligated in pGLEX3-ASC-GFP, digested using the same enzymes and CIPed. This generated plasmid pGLEX3-ASC-dsRED-GFP. This vector contains the construct created by Orengo et al., supra.
Cloning of Vector pGLEX3-ASC-dsRED-GFP-woFLAGcorr
[0148] The modification of the alternate splicing construct was done by modifying PCR. A first PCR was performed using the primers GlnPr1142 and GlnPr991 and the template pGLEX3-ASC-dsRED-EGFP. The PCR product was cut using the restriction enzymes AgeI and BstBI and cloned into pGLEX-ASC-dsRED-GFP opened using the same enzymes and CIPed, leading to the intermediate construct pGLEX-ASC-dsRED-GFP-interm. Using the plasmid pGLEX3-ASC-dsRED-EGFP as template, a second amplicon was obtained using primers GlnPr1138 and GlnPr1139 and a third using primers GlnPr1140 and GlnPr1141. These two amplicons were then used as templates for a fusion PCR using primers GlnPr1138 and GlnPr1141.
[0149] This fusion product was cut using the restriction enzymes NheI and EcoRI and cloned into the vector pGLEX-ASC-dsRED-GFP-interm opened with the same enzymes and CIPed in order to obtain the final construct pGLEX3-ASC-dsRED-GFP-sep. This vector was numbered GSD634.
[0150] The flag tag still present in pGLEX3-ASC-dsRED-GFP-sep contains the sequence motif ATG that might be used as a translation start point (start codon). The deletion was done by modifying PCR, using the primers GlnPr1158 and 1139 and plasmid GSD634 as template. The PCR product was digested using the restriction enzymes NheI and EcoRV and cloned into GSD634, opened using the same enzymes followed by a CIP treatment in order to minimize re-circularisation. The resulting plasmid was called pGLEX3-ASC-dsRED-GFP-sepwoFLAG with the batch number GSC2223 (SEQ ID No: 110). The resulting midi scale preparation of this plasmid received the batch number GSD679 and has the same sequence as GSC2223.
[0151] It was observed that two nucleotides of the GFP had been different compared to the standard GFP sequence. This was due to the design of a forward primer. Using the primers GlnPr991 and 1180 and the template pGLEX3, the GFP fragment was re-amplified with the correct sequence. This fragment was digested using the enzyme AgeI and cloned into the vector the backbone of GSD679, opened using AgeI and subsequently CIPed, leading to the vector pGLEX3-ASC-dsRED-GFP-woFLAGcorr. The miniprep of pGLEX3-ASC-dsRED-GFP-woFLAGcorr was given the batch number GSC2246 and the midiprep, the batch number GSC2250 (SEQ ID No: 38), therefore both these constructs had the same sequence.
Cloning of Constructs with Alternate Splicing Pattern
[0152] The construct GSC2250 was further modified in order to obtain constructs with a different ratio of alternative splicing, leading to a shift in expression from the first to the second open reading frame in the construct. The modifications were introduced by amplification of the chicken troponin intron 4 or 5 using modified primers. These amplicons were then recloned in the backbone of GSC2250 or a similar plasmid using the restriction enzymes NheI and EcoRV for cloning in position of the AS intron #2 and EcoRI and AgeI for cloning in the position of the AS intron #3 (see
TABLE-US-00002 TABLE 2 Primers and templates used for the modifications of the AS intron #2. Name of Forward Backward Template used for construct primer used primer used amplification I4(22 + 1) GlnPr1181 GlnPr1183 GSC2246 (miniprep) I4(15Y-5) GlnPr1181 GlnPr1186 GSC2246 (miniprep) I4(15Y-3) GlnPr1181 GlnPr1185 GSC2246 (miniprep) I4(22Y-3) GlnPr1181 GlnPr1184 GSC2246 (miniprep) I4(5Y) GlnPr1181 GlnPr1182 GSC2246 (miniprep) I4(5Y-5) GlnPr1181 GlnPr1245 GSC2338 I4(0Y) GlnPr1181 GlnPr1246 GSC2338 I4(5Ynude) GlnPr1181 GlnPr1244 GSC2338 I4(5Y, b-2) GlnPr1181 GlnPr1243 GSC2338 I4(5Y, b-a) GlnPr1181 GlnPr1242 GSC2338 I4(5Y, b-ct GlnPr1181 GlnPr1241 GSC2338 I4(5Y, b-y) GlnPr1181 GlnPr1240 GSC2338 I4(5Y-G) GlnPr1181 GlnPr1239 GSC2338 cTNT-I5 GlnPr1237 GlnPr1238 GSC2250
TABLE-US-00003 TABLE 3 Primers and templates used for the modifications of the AS intron #3 Name of Forward Backward Template used for construct primer used primer used amplification I5 (22Y + 1) GlnPr1187 GlnPr1191 Amplicon 1187/1188 on GSC2246 (miniprep) I5 (22Y-3) GlnPr1187 GlnPr1190 Amplicon 1187/1188 on GSC2246 (miniprep) I5 (22Y) GlnPr1187 GlnPr1189 Amplicon 1187/1188 on GSC2246 (miniprep) I5 (15Y-3) GlnPr1187 GlnPr1193 Amplicon 1187/1188 on GSC2246 (miniprep) I5 (15Y-5) GlnPr1187 GlnPr1192 Amplicon 1187/1188 on GSC2246 (miniprep) I4(sh) GlnPr1285 GlnPr991 GSC2741
Screening of Alternate Splicing Constructs in Transient Using GFP and dsRED
[0153] The different constructs were cloned in the combinations listed in Table 4, produced at midi scale and thoroughly verified by sequencing (Fasteris, Plan-les-Ouates, Switzerland). An alignment of all introduced modifications is shown in
[0154] The transfections were done in 12 well plate scale as described in the material and methods part using HEK293 and CHO-S cells. Although this transfection scale is robust, variations in the transfection efficiency do not allow conclusions on the absolute expression level of the individual constructs.
TABLE-US-00004 TABLE 4 List of constructs used in order to shift the splice ratio from the first exon (dsRED expression) to the second exon (GFP expression). Available clones are indicated by the in-house plasmid batch number and the SEQ ID listing. The SEQ ID comprises the entire mRNA, from the nucleotide of the first exon to the end of the SV 40 poly(A) site. Intron constructs used downstream of the alternate exon (position AS intron #3) Name of cTNT- I5 I5 I5 I5 cTNT- I4 construct I5 (22Y + I) (22Y-3) (22Y) (15Y-3) I4 (sh) Intron Poly(Y) cTNT- GSC 2250 GSC 2329 GSC 2330 GSC 2323 GSC 2619 GSC 2781 constructs tract I4 Seq ID 38 Seq ID 39 Seq ID 40 Seq ID 41 Seq ID 42 Seq ID 43 used modifications I4 GSC 2342 GSC 2328 GSC 2321 GSC 2324 upstream (22Y + 1) Seq ID 44 Seq ID 45 Seq ID 46 Seq ID 47 of the I4 GSC 2339 GSC 2334 GSC 2336 alternate (15Y-5) Seq ID 48 Seq ID 49 Seq ID 50 exon I4 GSC 2340 GSC 2331 GSC 2453 GSC 2325 GSC 2332 (position (15Y-3) Seq ID 51 Seq ID 52 Seq ID 53 Seq ID 54 Seq ID 55 AS intron I4 GSC 2341 GSC 2326 GSC 2454 GSC 2327 #2) (22Y-3) Seq ID 56 Seq ID 57 Seq ID 58 Seq ID 59 I4 GSC 2338 GSC 2335 GSC 2333 GSC 2337 GSC 2322 (5Y) Seq ID 60 Seq ID 61 Seq ID 62 Seq ID 63 Seq ID 64 I4 GSC 2617 GSC 2739 GSC 2782 (5Y-5) Seq ID 65 Seq ID 66 Seq ID 67 I4 GSC 2621 GSC 2740 GSC 2783 (0Y) Seq ID 68 Seq ID 69 Seq ID 70 I4 GSC 2622 GSC 2742 GSC 2784 (5Ynude) Seq ID 71 Seq ID 72 Seq ID 73 Branch I4 GSC 2620 GSC 2737 point (5Y, b-2) Seq ID 74 Seq ID 75 mutations I4 GSC 2743 (5Y, b-a) Seq ID 77 I4 GSC 2615 GSC 2738 (5Y, b-ct) Seq ID 76 Seq ID 78 I4 GSC 2618 GSC 2975 (5Y, b-y) Seq ID 79 Seq ID 80 Intron- I4 GSC 2613 Exon (5Y, G) Seq ID 81 consensus Intron cTNT-I5 GSC 2614 GSC 2741 GSC 2780 Switch Seq ID 82 Seq ID 83 Seq ID 84
Expression of Constructs with Modifications in the Poly(Y) Tract
[0155] The basal construct GSC2250 contains the alternate exon coding for the open reading frame of dsRED flanked by the unmodified cTNT-I4 sequence as AS intron #2 and the unmodified cTNT-I5 sequence as AS intron #3, followed by an exon coding for the open reading frame of GFP (orientation in short cTNT-I4|cTNT-I5). In transfected CHO-S or HEK293 cells, the construct shows expression of dsRED and GFP (see
[0156] Different constructs with decreasing amount of Ys (from 28 in a modified version of the basic construct cTNT-I4 down to 0) in the poly(Y) tract (see
[0157] From the expression of these early constructs, it was clear that the basal expression level of the new construct was much in favour of dsRED expression. It has been described for the chicken troponin alternate exon that the size of the exon is a key factor of the alternative splicing event. Xu et al., 1993 (Mol Cell Biol, 13(6): 3660-74) describe that artificial exons smaller than 49 nucleotides are not recognized by the splice machinery if they lack a splice enhancer element (which is not present in the construct of the invention). On the other hand they show that exons with a size between 49 and 119 nucleotides are alternatively spliced. The exon with dsRED has a size of 718 nucleotides (6 times the maximum exon size analysed by Xu et al., supra) and is mainly included. Therefore the shift towards expression of the first exon might be simply due to the size of the exon.
[0158] The changes in shift in expression from dsRED to GFP by modifications in the poly(Y) were disappointing compared to data described in the literature (for example compared to the changes described in Fallot et al, 2009 (Nucleic Acids Res, 37(20):e134). Clearly alternate splicing could not be obtained by simply reducing the poly(Y) content of the intron upstream of the alternative exon.
[0159] The intron cTNT-I5, cloned downstream of the alternate exon (AS intron #3) has a rather reduced poly(Y) tract containing only 10 Ys. As the reduction of the number of Ys in AS intron #2 (which might lead to a weakening of the splice acceptor strength) favoured a shift towards GFP expression, it was speculated, that an increase in the content of Ys in AS intron #3 might lead to an increase in the splice acceptor strength and therefore to a shift from dsRED to GFP expression. Modified cTNT-I5 intron sequences containing up to 28 Ys (compared to the 10 that were present in the original construct) were cloned in position AS intron #3 (see
Transfection of Constructs with Modifications in the Branch Point and in the Intron-Exon Border
[0160] In order to further shift the splice ratio in favour of GFP expression, sequence modifications were introduced in the branch point region and in the intron-exon consensus region of AS intron #2, upstream of the alternate exon (exon #3 in
[0161] Additionally, the introns cTNT-I4 and cTNT-I5 were rearranged in different ways. First, intron cTNT-I4 and cTNT-I5 were exchanged, so that the alternate exon expressing dsRED was flanked by cTNT-I5 in position AS intron #2 and by cTNT-I4 in position AS intron #3. Then, the sequence cTNT-I4 was used for AS intron #2 and AS intron #3. The same was done using the intron sequence cTNT-I5. Flanking the alternate exon with two identical introns increased the double positive (dsRED and GFP) population significantly. The best construct in HEK293 and CHO-S cells (GSC2614; cTNT-I5|cTNT-I5) increased the double positive population significantly (see
Combination of Poly(Y) and Branch Point Modifications in the cTNT-I4|cTNT-I4 Combination
[0162] In the previous experiments a significant, but minor shift towards the GFP could be observed for constructs with reduced content of Y in the poly(Y) tract and of constructs having the same intron flanking the alternate exon (orientation cTNT-I4|cTNT-I4 or cTNT-I5|cTNT-I5). In order to analyse whether combining these modifications would lead to a further shift towards the expression of GFP, modifications of the poly(Y) tract and the branch point of AS intron #2 were introduced in the construct GSC2619 containing the cTNT-I4 intron up- and downstream of the alternate exon (orientation cTNT-I4|cTNT-I4). For these experiments the poly(Y) modifications showing the highest shift towards GFP expression were used (I4(5Y-5), I4(0Y), I4(5Ynude)). The construct GSC2250 (cTNT-I4|cTNT-I5) was included as a reference for the splice ratio of the basal construct. The combination of poly(Y) tract reduction and the use of cTNT-I4|cTNT-I4 configuration showed a significant shift towards GFP expression for all three constructs in HEK293 and CHO-S cells (
Elimination of the Splice Donor Site
[0163] In order to shift the splice ratio from the first exon expressing dsRED to the second exon expressing GFP even further, the splice donor site of cTNT-I4 in position AS intron #3 was eliminated (see
Summary on GFP-dsRED Expression Experiments
[0164] Different designs of alternate splicing constructs were tested based on the cTNT alternate exon 5 flanking introns. The basic construct (cTNT-I4|cTNT-I5) showed a preference for inclusion of the alternate exon and expressed mainly dsRED, the reporter protein expressed on the first open reading frame. It has been shown in literature that the size of the alternate exon has a major impact on the exclusion (in case of small exons) or inclusion (in case of larger exons) of the alternative exon. The reduction of the amount of Ys in the poly(Y) tract and the use of the same intron up- and downstream of the alternate exon, in particular the cTNT-I4 was shown to lead to a significant shift from dsRED expression (on the alternate exon) towards the expression of GFP (expressed on the second open reading frame). This shift could be further increased by combining the poly(Y) reduction and the cTNT-I4 up- and downstream of the alternate exon. This was a surprising finding, as the current literature does not suggest that the use of the same intron sequence up- and downstream of an exon leads to a shift towards exclusion of the flanked exon. Even more surprising, this effect could be confirmed using the EF1alpha first intron. This intron usually is not subject to alternative splicing. This demonstrates a general mechanism leading to alternative splicing.
[0165] Finally, the deletion of the splice donor site downstream of the alternate exon (AS intron #3) led to further exclusion of the alternate exon. The cells transfected with these constructs seemed to express mainly GFP. The final alternate splicing constructs covered both extremes of alternate splicing (mainly inclusion of the alternate exon leading to predominant dsRED expression to mainly exclusion of the alternate exon leading to predominant GFP expression) as well as intermediate ratios (see
[0166] As mentioned above, it cannot be totally excluded that the fluorescence signal per protein, the detection level and the production efficiency of the two reporter proteins used are significantly different. Nevertheless, the three conditions identified above (usage of same intron before and after alternate exon, decrease the amount of Ys in the poly(Y) tract, elimination of the splice donor site) should be also valid for different proteins expressed using alternate splicing.
TABLE-US-00005 TABLE 5 List of Constructs Name of plasmid SEQ ID No. GSC 2250 38 GSC 2329 39 GSC 2330 40 GSC 2323 41 GSC 2619 42 GSC 2781 43 GSC 2342 44 GSC 2328 45 GSC 2321 46 GSC 2324 47 GSC 2339 48 GSC 2334 49 GSC 2336 50 GSC 2340 51 GSC 2331 52 GSC 2453 53 GSC 2325 54 GSC 2332 55 GSC 2341 56 GSC 2326 57 GSC 2454 58 GSC 2327 59 GSC 2338 60 GSC 2335 61 GSC 2333 62 GSC 2337 63 GSC 2322 64 GSC 2617 65 GSC 2739 66 GSC 2782 67 GSC 2621 68 GSC 2740 69 GSC 2783 70 GSC 2622 71 GSC 2742 72 GSC 2784 73 GSC 2620 74 GSC 2737 75 GSC 2615 76 GSC 2743 77 GSC 2738 78 GSC 2618 79 GSC 2975 80 GSC 2613 81 GSC 2614 82 GSC 2741 83 GSC 2780 84
Example 2
Stable Cells Expressing dsRED and GFP
Materials and Methods
[0167] Materials and Methods for Example 2 were the same as those described for Example 1.
Results
Cloning of the Expression Construct
[0168] Different constructs for alternate splicing of a pre-mRNA leading to expression of GFP and dsRED have been described in Example 1. One of the constructs was chosen for development of a stable CHO cell line. As the pGLEX3 vector backbone is best suited for transient expression in HEK293 cells, the alternate splicing cassette of the selected construct GSC 2739 was inserted in the proprietary expression vector pGLEX41 (batch number GSC281). In this vector the alternate splicing cassette is driven by the mCMV promoter, which is well suited for stable expression in CHO cells. The expression cassette was cut out using the enzymes NheI and BstBI and cloned into the backbone of pGLEX41 opened using the same enzymes and CIPed. The resulting vector was called pGLEX41-ASC-cTNT-I4(5Y-5)|cTNT-I4-dsRED-GFP and received the batch number GSC3166 (SEQ ID NO: 111). The vector conferring the resistance genes against the antibiotic puromycin was pSEL3, a pGL3 (Promega, Madison, Wis.) derived vector. The puromycin resistance in this vector is under control of the SV40 promoter.
Stable Transfection
[0169] The routine cell culture and the transfection of CHO-S have been described in Example 1. The DNA cocktail used for this transfection leading to stable cell lines was a mix of 95% pGLEX41 and 5% of pSEL3 (molar ratio). After the transfection, the cells were incubated for one day on an orbital shaker. The following day, the cells were plated in different dilutions on 96 well plates under selection pressure. The concentration of puromycin used for selection reliably yields stable populations that are referred to as minipools, because they can be a mix of different stable integration events, rather than clonal populations. After one week the selection pressure was refreshed. Screening for wells containing minipools was performed after two weeks using an Elisaplate reader. Cells showing high fluorescence signal were expanded to 24 well plate scale and analysed by FACS. In order to obtain clonal populations, one minipool was chosen for a second round of limiting dilution. For this the cells were diluted at different concentrations and plated in 96 well plates. Clonal populations were selected and expanded based on the amount of colonies growing on a plate and the absence of multiple growth centres in a well. After expansion to 24 well, the dsRED and GFP expression of the clonal populations were assessed by FACS.
[0170] A comparison of the relative expression levels of dsRED and GFP of the clones obtained after limiting dilution 2 showed a very similar ratio of dsRED to GFP expression for most clones, although the overall expression level varies between different clones. All clones were double-positive for dsRED and GFP. No clone was observed that expressed only GFP or dsRED.
[0171] The similar splicing ratio of different clones derived from the same parental minipool shows that the splice ratio remains stable over multiple generations, without shifts towards one of the two exons. This indicates that the alternate splicing ratio is mostly defined by the DNA construct, although every clone might have a slightly different splicing ratio for the alternate exons (leading to minor differences in the ratio of GFP to dsRED expression). It also indicates that there is no strong selection pressure against the use of alternate splicing for expression of recombinant proteins, otherwise many clones would have lost expression.
[0172] In summary, clonal populations generated in this example show that the alternate splicing construct of the invention allows stable expression at an unchanged ratio for multiple generations without the use of selection pressure.
Example 3
Transient Expression of Antibodies
Materials and Methods
Cloning of Constructs
[0173] An anti-HER2 antibody was used in the preparation of a reporter construct. Heavy and light chains of the anti-HER2 antibody were codon-optimized for expression in CHO cells. The genes were cloned in both possible combinations in the position of GFP and dsRED of the vectors described in Example 1. Selected constructs were cloned in the plasmid pGLEX41 for further analysis. In this vector the expression of the alternate splicing construct is controlled by the mouse CMV promoter.
Transfection of Cells and Quantification of Secreted Anti-HER2 Antibody
[0174] The constructs were transfected in CHO-S cells and HEK293 cells in 24 well format or 50 ml bioreactor format as described in Examples 1 and 2. After transfection the cells were incubated on a shaken platform at 37 C., 5% CO2 and 80% humidity. The secreted antibody was quantified 3 to 6 days after transfection using the Octet QK system (Fortebio) with Protein A bioprobes according to the specifications of the manufacturer. The calibration curve was done using the purified anti-HER2 antibody.
Transient Expression of Anti-HER2 Using Alternate Splicing Constructs
[0175] The anti-HER2 antibody was used as a model protein for the expression of antibodies using alternate splicing. This antibody is well expressed and stable in culture supernatants during the production phase. It was shown in previous co-transfection experiments that this anti-HER2 antibody is better expressed if the heavy chain is transfected in a two-fold molar excess over the light chain. This ratio was shown to depend on the respective antibody. Therefore the best constructs in this study might show high expression only for the anti-HER2 antibody in question. Other antibodies might have a different optimal ratio of heavy to light chain and might require different splicing constructs.
[0176] The open reading frames coding for the anti-HER2 antibody heavy and light chains were cloned in two different orientations (orientation 1: first light chain, then heavy chain; orientation 2: first heavy chain, then light chain) in the position of the two fluorescence markers GFP and dsRED of Example 1.
[0177] As described in Example 1, the first intron (AS intron #1) is a constitutively spliced intron sequence that is present in all constructs. The second intron (AS intron #2) is located upstream of the alternate exon, which contains the first of the two open reading frames. The third intron (AS intron #3) is downstream of the alternate exon. This intron is upstream of the exon containing the second open reading frame. Depending on the splice event the final mature mRNA will code either for the open reading frame 1 on the alternate exon or for open reading frame 2 (see
[0178] Expression constructs with varying amount of poly(Y) were selected from the preliminary study using GFP and dsRED (see Table 1) based on the absolute expression level and the shift in the expression from the first (dsRED) to the second open reading frame (GFP). These were combined with the full length AS intron #3 or the shortened version (sh) that was shown to lead to efficient expression of the second open reading frame.
[0179] In order to check whether constructs showing only a minor shift in the dsRED to GFP ratio could have an influence of the expression level of the anti-HER2 antibody, some of the constructs that were showing no obvious effect (branch point modifications and the intron-exon consensus region modifications) were reassessed using the anti-HER2 antibody as reporter protein and the influence of the poly(Y) tract was analysed more in detail (see Table 6 for all constructs and the alignments in
[0180] For expression of an antibody, both heavy and light chain have to be expressed at relevant levels, and it was shown that for the anti-HER2 antibody, a two-fold excess of HC expression is favourable for the antibody secretion in transient transfections. Constructs with a different amount of Y in the poly(Y) tract were cloned and transfected in CHO-S cells. On day six the amount of accumulated anti-HER2 antibody in the supernatant was quantified by Octet.
[0181] The expression levels of constructs with orientation LC-HC and orientation HC-LC are shown in
[0182] The expression level of all constructs increased with a decreasing amount of Ys in the poly(Y) tract (with the exception of the series I4I4 in orientation HC-LC). Less Ys in the first intron shift the splicing ratio away from the predominantly expressed first exon to the second alternate exon and hence to higher relative expression of the open reading frame present on the second alternate exon. As the antibody needs expression of heavy and light chain for successful assembly and secretion, this is beneficial to the expression of the entire antibody. It was observed, that the expression level starts to increase significantly if the poly(Y) tract has 7 or less Ys. This might be when the alternate splicing is shifted towards approximately equimolar expression of the two alternate exons (because the effect is observed for the I4I4sh constructs in both orientations). Surprisingly, the shortening of AS intron #3 has little effect on the amount of Ys in the poly(Y) tract leading to best expression. This might be due to the insensitivity of the reporter system, allowing a relatively wide range of the HC:LC ratio.
TABLE-US-00006 TABLE 6 List of constructs based on pGLEX3 made for anti-HER2 antibody expression. SEQ ID Nos: 85 to 102 comprise the first exon of the mRNA up to the start codon (ATG) of the first open reading frame. SEQ IDs 103 to 108 start with the stop codon of the first open reading frame and terminate with the start codon of the second open reading frame. LC-HC HC-LC cTNT-I4 cTNT-I5 I4(sh) cTNT-I4 cTNT-I5 I4(sh) Ys in SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID construct No: 103 No: 104 No: 105 No: 106 No: 107 No: 108 Ys in construct cTNT-I4 27 GSC2821 GSC2822 GSC3164 GSC2816 GSC2819 GSC3170 I4 (5Y) 10 GSC4218 GSC4228 GSC4222 GSC4225 SEQ ID No: 085 I4 (9Ynude) 9 GSC4344 GSC4339 GSC4335 GSC4336 SEQ ID No: 086 I4 (7Ynude) 7 GSC4345 GSC4355 GSC4337 GSC4341 SEQ ID No: 087 I4 (5Y-5) 5 GSC2820 GSC4226 GSC4217 GSC4221 SEQ ID No: 088 I4 (5Ynude) 5 GSC4220 GSC4215 GSC2823 GSC4223 SEQ ID No: 089 I4 (3Ynude) 3 GSC4340 GSC4354 GSC4333 SEQ ID No: 090 I4 (1Ynude) 1 GSC4332 GSC4407 GSC4331 GSC4405 SEQ ID No: 091 I4 (0Y) 0 GSC2818 GSC4224 GSC3151 GSC4214 SEQ ID No: 092 I4 (5Y, b-ct) GSC2977 GSC3154 SEQ ID No: 093 I4 (5Y, b-y) GSC3182 SEQ ID No: 094 I4 (5Y, b-2) GSC2985 GSC3155 GSC2984 GSC3147 SEQ ID No: 095 I4 (5Y, b-a) GSC2986 SEQ ID No: 096 I4 (5Y-A) GSC2976 GSC3158 SEQ ID No: 097 I4 (5Y-5, G) GSC3085 SEQ ID No: 098 I4 (5Ynude, A) GSC3089 SEQ ID No: 099 I4 (5Ynude, b-2) GSC3184 SEQ ID No: 100 I4 (5Ynude, A) GSC3153 SEQ ID No: 101 I4 (5Y-5, G) GSC3160 SEQ ID No: 102
[0183] For the constructs in the orientation LC-HC, the constructs 3Ynude and 1Ynude show less expression compared to constructs with less (0Y) or more Ys (5Ynude) in the poly(Y) tract. This shows that minor variations in the sequence also impact the splice ratio and that the number of Ys in the poly(Y) tract and the exon size are not the only factors influencing the splice efficiency.
[0184] In contrast to this, the I4I4-constructs with HC-LC orientation show a relative high expression level independent of the poly(Y) content. It has been described in the literature that increasing the length of the alternate exon shifts the splice ratio towards the alternate (first) exon (and therefore open reading frame 1). Using the shortened AS intron #3, the poly(Y) content influences the expression of the anti-HER2 antibody tested, and therefore the splice ratio. One explanation of these experimental results is that the large exon coding for the open reading frame of the heavy chain in the first position weakens the impact of the poly(Y) tract on the splice ratio, leading to a fixed ratio of the two splice variants. Only when the splicing event is further destabilized by shortening the second intron and the elimination of the splice donor of the second intron, the poly(Y) tract might influence the splice ratio.
[0185] In the screening described above, the constructs 5Y-5, 5Ynude and 0Y were identified as constructs giving the highest transient expression results for the orientation LC-HC. These expression constructs were cloned into the expression vector used for stable cell line development. As the pre-splicing RNA construct remains unchanged (only the promoter was changed) this cloning step was not expected to lead to significant differences in the splicing ratio.
[0186] Using GFP and dsRED as reporter proteins, no effect of intron-exon consensus modifications or of branch point modifications could be observed (see Example 1). However, minor shifts in the splicing ratio might not be detectable using the GFP/dsRED reporter system. In order to verify whether intron-exon modifications or branch point modifications might be useful for fine tuning the splice ratio for antibody expression, new constructs were cloned based on the 5Y-5, 5Ynude and 0Y constructs in pGLEX41 (see Table 7 for complete list of constructs and
TABLE-US-00007 TABLE 7 List of constructs used for fine tuning of heavy chain to light chain expression in the final vector pGLEX41. SEQ ID Nos: 88, 89, 92, 99, 100, 102 and 112 to 128 listed below, comprise the first exon of the mRNA up to the start codon (ATG) of the first open reading frame. SEQ ID No: 103 starts with the stop codon of the first open reading frame and terminates with the start codon of the second open reading frame Intron constructs used downstream of the alternate exon (position AS intron #3) Intron constructs used cTNT-I4 (SEQ ID No: 103) upstream of the alternate GS number exon (position AS intron #2) LC-HC HC-LC I4(0Y) GSC3157 GSC3151 SEQ ID No: 92 GSC4219 I4(0Y, b-a) GSC3436 GSC3466 SEQ ID No: 112 I4(0Y, b-ct) GSC3432 GSC3470 SEQ ID No: 113 I4(0Y, b-y) GSC3439 GSC3465 SEQ ID No: 114 I4(0Y, b-2) GSC3462 GSC3465 SEQ ID No: 115 I4(0Y, A) GSC3447 GSC3442 SEQ ID No: 116 I4(0Y, T) GSC3453 GSC3430 SEQ ID No: 117 I4(0Y, G) GSC3434 GSC3446 SEQ ID No: 118 I4(5Ynude) GSC3162 GSC3169 SEQ ID No: 89 I4(5Ynude, b-a) GSC3460 GSC3441 SEQ ID No: 119 GSC3449 I4(5Ynude, b-ct) GSC3461 SEQ ID No: 120 I4(5Ynude, b-y) GSC3451 GSC3444 SEQ ID No: 121 I4(5Ynude, b-2) GSC3464 GSC3433 SEQ ID No: 100 I4(5Ynude, A) GSC3448 GSC3458 SEQ ID No: 99 I4(5Ynude, T) GSC3457 GSC3450 SEQ ID No: 122 I4(5Y-5) GSC3150 SEQ ID No: 88 I4(5Y-5, b-a) GSC3455 GSC3463 SEQ ID No: 123 I4(5Y-5, b-ct) GSC3431 SEQ ID No: 124 14(5Y-5, b-y) GSC3467 GSC3429 SEQ ID No: 125 I4(5Y-5, b-2) GSC3454 SEQ ID No: 126 I4(5Y-5, A) GSC3456 SEQ ID No: 127 I4(5Y-5, T) GSC3459 SEQ ID No: 128 GSC3468 I4(5Y-5, G) GSC3452 GSC3437 SEQ ID No: 102
[0187] As shown in
[0188] As only minor differences were observed in the expression level of branch point and intron-exon modifications, the two constructs for stable cell line development were chosen on convenience and availability. Both constructs show similar expression levels: I4(0Y)-I4 and I4(0Y, b-2)-I4.
Alternate Splicing is Enhanced if the Alternate Exon is Flanked by Similar Introns
[0189] In previous experiments (Example 1) it was observed that using the same intron (either the cTNT intron #4 or the cTNT intron #5) up- and downstream of the alternate exon leads to higher expression of the second open reading frame. In order to analyse whether this is only true for introns naturally involved in alternate splicing, a constitutive intron from the human EF1alpha gene was used for the expression of an anti-HER2 antibody. The EF1alpha intron was cloned up- and downstream of the alternate exon. Intermediate constructs with EF1alpha as first intron and cTNT-I4 as second intron were cloned as well.
[0190] The results are shown in
[0191] Using the cTNT introns the expression level is higher compared to the EF1alpha introns, although the human EF1alpha intron was described to have an enhancer activity. This surprising result shows that using introns involved naturally in alternate splicing leads to higher expression of the second exon and hence to better expression of multimeric proteins like antibodies. Another example of using the same intron flanking the alternate exon was shown with the cTNT-Intron 5 in Example 1. Here as well the use of the same intron lead to a more equilibrated expression of the two alternate exons.
Example 4
[0192] Creation of Stable Cell Lines Expressing Anti-HER2 Antibody
[0193] In order to obtain stable expression of the reporter anti-HER2 antibody in CHO-S cells, the alternate splicing construct I4(0Y)I4-anti-HER2-LC-HC described in Example 3 was cloned in the expression vector pGLEX41 under control of the mouse CMV promoter and the Ig variable region intron and splice acceptor sequence (Bothwell et al., supra). This cloning step leads to the vector pGLEX41-ASC-I4(0Y)I4-anti-HER2-LC-HC.
[0194] Two additional vectors carry the resistance genes for puromycin and neomycin. Both resistance genes are under control of the SV40 promoter.
[0195] The cells were transfected using JetPEI (Polyplus-transfections, Strasbourg, France) following the procedure recommended by the manufacturer. The expression vector carrying the product gene and the two vectors providing the genes for resistance to the antibiotics used for selection (puromycin and geneticin) were linearised and co-transfected into the CHO-S (cGMP banked) host cells. The plasmids are introduced at a random integration site in the genome of the CHO-S host cell line. In our hands, this process is highly reproducible for rapidly and efficiently generating stable high expressing cell lines.
[0196] The transfection as well as the subsequent cultivation of the cells was performed in animal derived components free media. The day after the transfection, cells were seeded in selective medium (growth medium containing puromycin and geneticin) into 96 well plates at different cell densities. Both antibiotics are efficient inhibitors of protein biosynthesis. The high selection pressure due to the double selection efficiently eliminates not only untransfected cells but also non- and low-producer clones. After one week of incubation at 37 C., 5% CO2, and 80% humidity, the selection pressure was renewed by addition of 1 volume of selective medium to the cells. After another week of static incubation the dilutions yielding less than 30% of wells showing growth were identified. The supernatants of the wells showing growth were analysed for accumulated anti-HER2 antibody using the Octet (Fortebio, Manlo Park, Calif.). The 72 minipools showing the highest expression were expanded first into 24 well plates, then into tubespin scale in suspension and assessed in a supplemented 14 days batch in tubespin 50 ml bioreactors. The highest titer obtained at the end of the batch culture was 197 g/ml (see
[0197] In order to obtain clonal populations, the four best expressing minipools with an expression level ranging from 150-197 g/ml were chosen to undergo a second round of limiting dilution. This was done by plating the cells at different dilutions in growth medium in 96 well plates. After two weeks the number of colonies that had grown in the different dilutions was assessed. The clonal populations were expanded first to 24 well plate and then to 50 ml bioreactor tube scale. In this scale the highest titers obtained were 250 g/ml in a supplemented non-optimized batch in 50 ml bioreactor tubes using 10 ml of medium (see
Example 5
Expression of Bispecific Antibodies Using Alternate Splicing Constructs
[0198] Bispecific antibodies are antibodies that have been engineered in order to recognize two different epitopes. A major problem in the development of bispecific antibodies for therapeutic applications is the production at an industrially relevant scale. Therefore the development of technologies that allow either higher expression of bispecific antibodies or production of the bispecific antibodies at higher purity (with lower contamination of the bispecific antibody by-products) are of upmost importance.
[0199] Bispecific antibodies are composed by multiple subunits. The number of subunits needed for expression depends on the chosen format. In an aspect of the present invention, bispecific antibody constructs are composed by three different subunits coding for a light chain, a heavy chain and an Fc-scFv. Similar to regular antibodies where the heavy chain and the light chain need to be transfected in an optimal ratio, bispecific constructs are best expressed at a specific ratio of the three subunits. This ratio depends on the bispecific antibody and also might vary from one format to another.
[0200] The alternate splicing expression cassettes developed in Examples 1-3 allow the simultaneous expression of two different proteins (GFP or dsRED) or subunits of the same protein (heavy chain and light chain of an antibody) at a fixed ratio. As it is favourable to express the subunits of the bispecific antibody at a certain molar ratio, the alternate splicing construct might prove useful for the expression of two subunits at the ratio leading to the highest expression or to the lowest contamination with by-products. An in-house generated bispecific antibody is composed of three different subunits: heavy chain, light chain and the Fc-scFv. For optimal expression of the correctly composed product, the ratio of heavy chain to Fc-scFv was shown to be the most important parameter in transient co-transfection experiments. The relative ratio of the light chain was of minor importance.
[0201] Based on this observation, the heavy chain and the Fc-scFv were cloned into the alternate splicing construct I4(7Y)I4sh described in Example 3, leading to the vectors GSC5642 (orientation: HC-scFv), GSC5643 (orientation: scFv-HC) and GSC5641 for the expression of the light chain.
[0202] The vectors with the alternate splicing construct and the vector for the light chain were co-transfected in CHO-S cells using different ratios of the alternate splicing construct and the vector coding for the light chain. The expression levels of the resulting antibodies are shown in
[0203] In general, the expression level increases for both constructs with increasing ratio of the alternate splicing construct over the light chain construct. Higher expression of light chain reduces the amount of antibody in the supernatant. The highest expression level was observed for a three-fold molar excess. As no plateau was observed, the true optimum might be an even higher molar excess. No experiment has been performed to optimize the expression level of bispecific antibodies or the level of by-products in the secreted proteins using varying amounts of poly(Y). Therefore there might be an additional potential for higher expression or lower by-product contamination in the used construct.
[0204] The presence of bispecific antibodies has been confirmed by ELISA (specific for the two arms of the bispecific antibody). The successful expression of bispecific antibodies using the alternate splicing construct 14(7Y)I4sh demonstrates that alternate splicing can be used for successful expression of regular antibodies as well as bispecific antibodies with more than two types of subunits. Expression at the optimal ratio might also be achieved by co-transfection (as it was done for identification of the optimal ratio). Nevertheless a major advantage of using the alternate splicing cassette is the possibility to directly translate the optimal ratio in a stable cell format.