Method of Detecting the Presence of Different Target Analytes and Related Kits Thereof

Abstract

This disclosure relates to a multiplex diagnostic method and related kits thereof for detecting the presence of different target analytes in a sample, the method comprising providing the sample and a plurality of reporter particles such as gold nanoparticles having different colours to a substrate, the substrate having a assigned spatial regions; and determining, on the substrate, the presence of a colour arising from the reporter particles in each of assigned spatial regions on the substrate, wherein each of the assigned spatial regions on the substrate is configured to immobilize a target analyte that is different from the other assigned spatial regions, wherein reporter particles of each different colour are configured to couple to a target analyte that is different from the reporter particles of the other different colours, and wherein is an integer that is at least two and is an integer that is at least two. In one embodiment, the reporter particles are configured to give rise to a secondary colour when reporter particles of two or more different colours are colocalized in the same spatial region, wherein the secondary colour resulting from the colocalization of the reporter particles of two or more different colours from the different colours is distinct from another secondary colour resulting from the colocalization of reporter particles of other combinations of colours from the different colours.

Claims

1. A method of detecting the presence of different target analytes in a sample, the method comprising: providing the sample and a plurality of reporter particles having different colours to a substrate, the substrate having a assigned spatial regions; and determining, on the substrate, the presence of a colour arising from the reporter particles in each of a assigned spatial regions on the substrate, wherein each of the assigned spatial regions on the substrate is configured to immobilize a target analyte that is different from the other assigned spatial regions, wherein reporter particles of each different colour are configured to couple to a target analyte that is different from the reporter particles of the other different colours, and wherein is an integer that is at least two and is an integer that is at least two or is three.

2. The method of claim 1, wherein the reporter particles are configured to give rise to a secondary colour when reporter particles of two or more different colours are colocalized in the same spatial region, wherein the secondary colour resulting from the colocalization of the reporter particles of two or more different colours from the different colours is distinct from another secondary colour resulting from the colocalization of reporter particles of other combinations of colours from the different colours.

3. The method of claim 2, wherein the presence of a secondary colour arising from the colocalization of reporter particles in an assigned spatial region is indicative of the presence of at least two different target analytes in the sample.

4. (canceled)

5. The method of claim 1, wherein each of different colours is a colour selected from the group consisting of: a colour with absorbance wavelength of from 550 nm to 570 nm, a colour with absorbance wavelength of from 400 nm to 420 nm and a colour with absorbance wavelength of from 610 nm to 630 nm.

6. The method of claim 1, wherein each of different colours is a colour selected from the group consisting of: yellow, magenta and cyan, and when combined with one of more of the other different colours, is configured to give rise to a secondary colour selected from: blue, green, red and black.

7. The method of claim 1, wherein the analyte comprises a polynucleotide and the method further comprises subjecting the sample to an amplification reaction configured to amplify the polynucleotide prior to the providing step.

8. The method of claim 1, wherein the analyte comprises a polynucleotide and the method further comprises contacting the sample with a labelled oligonucleotide for hybridizing to at least a portion of the polynucleotide or its amplicons thereof, the labelled oligonucleotide being configured to couple to the reporter particles of at least one of different colours optionally wherein the oligonucleotide comprises a primer.

9. (canceled)

10. The method of claim 1, wherein the step of providing the sample and the plurality of reporter particles having different colours to a substrate comprises first providing the sample to the substrate and subsequently providing the plurality of reporter particles having different colours to the substrate.

11. The method of claim 1, wherein the reporter particles of each of different colours have a single localized surface plasmon resonance (LSPR) absorption peak.

12. The method of claim 1, wherein the reporter particles comprise one or more of the following selected from the group consisting of: solid gold nanoparticles, solid silver nanoparticles with gold core and hollow gold nanoshells.

13. The method of claim 1, the method further comprising: assigning a code to each spatial region based on the colour at the spatial region; combining the code assigned to each spatial region to obtain a combined code, wherein the combined code is used to determine the presence of different target analytes in the sample; and optionally comparing the combined code with a list of predetermined codes to determine the presence of different target analytes in the sample.

14. A kit for detecting different target analytes in a sample, the kit comprising: a substrate that comprises assigned spatial regions, each spatial region being configured to immobilize a target analyte that is different from the other assigned spatial regions; and a plurality of reporter particles having different colours or precursors thereof, wherein the reporter particles of each different colour are configured to couple to a target analyte that is different from the reporter particles of the other different colours, wherein is an integer that is at least two and is an integer that is at least two or is three.

15. The kit of claim 14, wherein the reporter particles are configured to give rise to a secondary colour when reporter particles of two or more different colours are colocalized in the same spatial region, wherein the secondary colour resulting from the colocalization of the reporter particles of two or more different colours from the different colours is distinct from another secondary colour resulting from the colocalization of reporter particles of other combinations of colours from the different colours.

16. (canceled)

17. The kit of claim 14, wherein each of different colours is a colour selected from the group consisting of: a colour with absorbance wavelength of from 550 nm to 570 nm, a colour with absorbance wavelength of from 400 nm to 420 nm and a colour with absorbance wavelength of from 610 nm to 630 nm.

18. The kit of claim 14, wherein each of different colours is a colour selected from the group consisting of: yellow, magenta and cyan, and when combined with one of more of the other different colours, is configured to give rise to a secondary colour selected from: blue, green, red and black.

19. The kit of claim 14, further comprising an oligonucleotide for hybridizing to at least a portion of a polynucleotide of the target analyte.

20. The kit of claim 19, wherein the oligonucleotide comprises a labelled oligonucleotide that is configured to couple to the reporter particles of at least one of different colours.

21. The kit of claim 14, wherein the reporter particles of each of different colours have a single localized surface plasmon resonance (LSPR) absorption peak.

22. The kit of claim 14, wherein the reporter particles comprise one or more of the following selected from the group consisting of: solid gold nanoparticles, solid silver nanoparticles with gold core, hollow gold nanoshells and any combinations thereof.

23. The kit of claim 14, further comprising: instructions on assigning a code to each spatial region selected from the spatial regions based on the colour at the spatial region and combining the code assigned to each spatial region to obtain a combined code for determining the presence of different target analytes in the sample; and optionally a list of predetermined codes for comparison with the combined code to determine the presence of different target analytes in the sample.

Description

BRIEF DESCRIPTION OF FIGURES

[0106] FIG. 1 shows the characterization of coloured reporter particles comprising Au/Ag nanoparticles (NPs) in accordance with one embodiment disclosed herein. (A)(I) shows the scanning electron microscope (SEM) image of Au NPs in accordance with one embodiment disclosed herein. (A)(II) shows the transmission electron microscopy (TEM) image of Au NPs in accordance with one embodiment disclosed herein. (A)(III) shows the geometric model of Au NPs in accordance with one embodiment disclosed herein. (A)(IV) shows the UV-vis spectrum of Au NPs in accordance with one embodiment disclosed herein. (B)(I) shows the SEM image of Au@Ag core-shell NPs in accordance with one embodiment disclosed herein. (B(II) shows the TEM image of Au@Ag core-shell NPs in accordance with one embodiment disclosed herein. (B)(III) shows the geometric model of Au@Ag core-shell NPs in accordance with one embodiment disclosed herein. (B)(IV) shows the UV-vis spectrum of Au@Ag core-shell NPs in accordance with one embodiment disclosed herein. (C)(I) shows the SEM image of Au/Ag hollow NPs in accordance with one embodiment disclosed herein. (C)(II) shows the TEM image of Au/Ag hollow NPs in accordance with one embodiment disclosed herein. (C)(III) shows the geometric model of Au/Ag hollow NPs in accordance with one embodiment disclosed herein. (C)(IV) shows the UV-vis spectrum of Au/Ag hollow NPs in accordance with one embodiment disclosed herein.

[0107] FIG. 2 shows that galvanic replacement of the Au@Ag core-shell NPs with HAuCl.sub.4 solution allowed for tuning of the LSPR peak of the Au/Ag NPs spanning the visible spectrum in accordance with one embodiment disclosed herein. (A) shows that Au/Ag NPs prepared by reacting Au@Ag core-shell NP solution with different volumes of a 20 mM HAuCl.sub.4 solution exhibited different colours in accordance with one embodiment disclosed herein. (B) shows the corresponding UV-visible absorbance spectra of Au/Ag NP solutions shown in (A) in accordance with one embodiment disclosed herein.

[0108] FIG. 3 shows the colour combinations using NPs of three primary colours in accordance with one embodiment disclosed herein. (A) shows that combination of NPs of three primary colours resulted in NP mixtures of unique secondary colours in accordance with one embodiment disclosed herein. (B) shows the colour palette obtained by mixing primary NPs at various ratios in accordance with one embodiment disclosed herein. (C) shows FITC-labeled dsDNA target being detected by single primary coloured NPs and a mixture of NPs in accordance with one embodiment disclosed herein.

[0109] FIG. 4 illustrates two-parameter multiplexing based on spatial separation and colour colocalization in accordance with one embodiment disclosed herein. (A) depicts the detection scheme in accordance with one embodiment disclosed herein. (B) shows the multiplexed detection of all 32 possible target combinations in accordance with one embodiment disclosed herein.

[0110] FIG. 5 illustrates multiplexed LFA for HSV subtyping with two-parameter multiplexing strategy in accordance with one embodiment disclosed herein. (A) is a schematic illustration of the multiplex HSV subtyping in accordance with one embodiment disclosed herein. (B) shows the multiplexed detection of all 8 target combinations including a negative sample in accordance with one embodiment disclosed herein.

[0111] FIG. 6 is a schematic illustration of the preparation of multicoloured Au/Ag NPs i.e. Au NPs (magenta solution), Au@Ag NPs (yellow solution) and Au hollow NPs (cyan solution) in accordance with one embodiment disclosed herein.

DETAILED DESCRIPTION OF FIGURES

[0112] FIG. 1 shows the characterization of coloured reporter particles comprising Au/Ag nanoparticles (NPs) in accordance with one embodiment disclosed herein.

[0113] FIGS. 1(A)(I) and (A)(II) show the general product morphology and the structure of Au NPs respectively in accordance with one embodiment disclosed herein. As shown, the Au NPs exhibited a truncated octahedral shape similar to that illustrated in (A)(III). Further, the Au NPs had an absorption peak at about 563 nm as shown in (A)(IV).

[0114] FIGS. 1(B)(I) and (B)(II) show the general product morphology and the structure of Au@Ag core-shell NPs respectively in accordance with one embodiment disclosed herein. As shown, the Au@Ag core-shell NPs exhibited a truncated cubic shape similar to that illustrated in (B)(III). Further, the Au NPs had an absorption peak at about 407 nm as shown in (A)(IV).

[0115] FIGS. 1(C)(I) and (C)(II) show the general product morphology and the structure of Au/Ag hollow NPs respectively in accordance with one embodiment disclosed herein. As shown, the Au/Ag hollow NPs exhibited a hollow cuboid structure similar to that illustrated in (C)(III). Further, the Au/Ag hollow NPs had an absorption peak at about 617 nm as shown in (A)(IV).

[0116] FIG. 2 shows that galvanic replacement of the Au@Ag core-shell NPs with HAuCl.sub.4 solution allowed for tuning of the LSPR peak of the Au/Ag NPs spanning the visible spectrum in accordance with one embodiment disclosed herein.

[0117] FIG. 2A shows that dropwise addition of 20 mM HAuCl.sub.4 to the Au@Ag core-shell NP solution to obtain Au/Ag NPs solution gradually changed the colour of the solution from yellow to orange, to reddish brown and finally to cyan in accordance with one embodiment disclosed herein. The colours were visually distinguishable.

[0118] FIG. 2B shows the corresponding absorbance spectra of the solutions in FIG. 2A with dropwise addition of 20 mM HAuCl.sub.4 to the Au@Ag core-shell NP solution in accordance with one embodiment disclosed herein. As shown, the LSPR peak position of the Au/Ag NPs was tunable from about 453 nm to about 620 nm with HAuCl.sub.4 solution volumes.

[0119] FIG. 3A shows that combination of NPs of cyan, magenta and yellow (designated by C, M and Y respectively) resulted in NP mixtures of unique secondary colours, such as blue (designated by B) arising from a mixture of cyan and magenta NPs, green (designated by G) arising from a mixture of cyan and yellow NPs, red (designated by R) arising from a mixture of yellow and magenta NPs and black (designated by K) arising from a mixture of all three cyan, magenta and yellow NPs in accordance with one embodiment disclosed herein. These colours were unique and easily distinguishable by unaided eyes.

[0120] FIG. 3B shows the colour palette obtained by mixing primary NPs at various ratios in accordance with one embodiment disclosed herein. Across the first row, decreasing concentration of yellow NPs and a corresponding increasing concentration of magenta NPs led to a gradual colour change from yellow to red to magenta. Across the second row, decreasing concentration of yellow NPs and a corresponding increasing concentration of cyan NPs led to a gradual colour change from yellow to green to cyan. Across the third row, decreasing concentration of magenta NPs and a corresponding increasing concentration of cyan NPs led to a gradual colour change from magenta to blue to cyan.

[0121] FIG. 3C shows FITC-labeled dsDNA target being detected by the primary colours (cyan, magenta and yellow designated by C, M and Y respectively) of single coloured NPs and the secondary colours (blue, green, red and black designated by B, G, R and K respectively) of a mixture of NPs in accordance with one embodiment disclosed herein.

[0122] FIG. 4 illustrates two-parameter multiplexing based on spatial separation and colour colocalization in accordance with one embodiment disclosed herein.

[0123] FIG. 4A depicts the detection scheme 400. Two protein-based targets in the form of HCG 401 and AFP 403 were detected at a zone 411 (Zone A), and three DNA-based targets 405, 407 and 409 were detected at another zone 413 (Zone B). For each protein target, a pair of detecting agent and capturing agent in the form of antibodies that would bind to different epitopes of the protein, was used. For protein target HCG 401, a detecting agent in the form of anti-HCG 417 and a capturing agent in the form of anti-HCG 415 were used. For protein target AFP 403, a detecting agent in the form of anti-AFP 421 and a capturing agent in the form of anti-AFP 419 were used. The capturing agents anti-HCG 415 and anti-AFP 419 were immobilised on the substrate at zone 411 while the detecting agent anti-HCG 417 and anti-AFP 421 were each conjugated to yellow nanoparticle 431 and cyan nanoparticle 433 respectively. For each DNA target 405, 407 and 409, one end of the DNA was labelled with a ligand in the form of biotin (not shown), and the other end was labelled with a hapten in the form FITC 441, DIG 443 or DNP 445 respectively for each of the DNA targets 405, 407 and 409. A common capturing agent 423 in the form of streptavidin which is a receptor to the ligand biotin, was immobilised on the substrate at zone 413 for capturing the biotin-labelled DNA targets 405, 407 and 409. The detecting agents in the form of anti-FITC 425, anti-DIG 427 and anti-DNP 429 were each conjugated to cyan nanoparticle 435, yellow nanoparticle 437 and magenta nanoparticle 439 respectively. Each of antibody-conjugated nanoparticles 435, 437 and 439 would thus bind to the FITC 441, DIG 443 or DNP 445 of DNA target 405, 407 and 409 respectively.

[0124] FIG. 4B shows the multiplexed detection of all 32 possible target combinations in accordance with one embodiment disclosed herein. The presence of a target analyte was reported by both the location and the colour of the signal. Colocalization of multiple primary coloured NPs resulted in unique secondary colours. For example, yellow at zone 411 meant the presence of HCG, magenta at zone 413 meant the presence of DNP-labelled DNA, and green at zone 411 arising from a colocalization of yellow and cyan meant the presence of both HCG and AFP. Final results were reported by a combined code, for example, a two-letter code wherein the first letter indicated the colour signal at zone 411 and the second letter indicated the colour signal at zone 413. In the figure, the one-letter code used to designate each colour signal is as follows: Ccyan, Mmagenta, Yyellow, Bblue, Ggreen, Rred and Kkey (black) and Nno visible/detectable colour (nil).

[0125] FIG. 5 illustrates multiplexed LFA for HSV subtyping with two-parameter multiplexing strategy in accordance with one embodiment disclosed herein.

[0126] FIG. 5A is a schematic illustration 500 of the multiplex HSV subtyping in accordance with one embodiment disclosed herein. Each of the target analytes 501, 503 and 505 corresponding to HSV-1 viral DNA, HSV-2 viral DNA and HSV-3 viral DNA respectively were dually labelled with a ligand biotin (not shown) and a hapten DPN 541, FITC 543 and DIG 545 respectively by use of labelled primers in a loop-mediated isothermal amplification (LAMP) process. A control sample containing a DNA 507 was also subjected to dual labelling with a hapten in the form of Texas red 547 and another hapten in the form TAMRA 549 by use of labelled primers in the same LAMP process. Detecting agents 511 and 519 in the form of anti-FITC were each coupled to yellow nanoparticle 523 and 531 respectively. The yellow nanoparticle 523 would thus be able to couple to the FITC-labelled HSV-2 viral DNA 503. Detecting agent 513 and 517, in the form of anti-DIG, were each coupled to cyan nanoparticle 525 and 529 respectively. The cyan nanoparticle 525 would thus be able to couple to the DIG-labelled HSV-3 viral DNA 505. A detecting agent in the form of anti-DPN 509 and another detecting agent in the form of an anti-TAMRA 515, were each coupled to magenta nanoparticle 521 and 527 respectively. The magenta nanoparticle 521 would thus be able to couple to the DPN-labelled HSV-1 viral DNA 501. The magenta nanoparticle 527 would thus be able to thus couple to the TAMRA-labelled control DNA 507. A capturing agent in the form of streptavidin 533 which is a receptor to the ligand biotin, was immobilised on the substrate at test zone 539 to capture all three biotin/labelled target analytes 501, 503 and 505 and their amplicons thereof. Another capturing agent in the form of an anti-Texas red 535, was immobilised at control zone 551 to capture the Texas red-labelled control DNA 507 and its amplicons thereof. A further capturing agent 537, in the form of a goat anti-rabbit was also immobilised at the control zone 551 to capture excess coloured reporter particles. The detection of a magenta colour at the control zone 551 indicated the successful amplification of the control DNA, and therefore also indicated the successful amplification of the target analytes. The capturing agent 537, in the form of a goat anti-rabbit at the control zone 551 would bind to excess coloured reporter particles 529 and 531. A valid control was when the colour at the control zone 551 is any secondary colour comprising magenta, in other words, a colour other than yellow, cyan, magenta and green. The colour at the test zone 539 revealed what target were present in a sample. For example, if the sample contained HSV-2 viral DNA, the colour at the test zone 539 was cyan. If the sample contained both HSV-1 and HSV-3, the colour at the test zone 539 was red. If the sample contained all three viral subtypes, the colour at the test zone was black. Using embodiments of the method, each of the three viral subtypes and any combinations thereof were successfully identified.

[0127] FIG. 5B shows the multiplexed detection of all 8 target combinations including a negative sample in accordance with one embodiment disclosed herein. The colour of the test zone 539 indicated the type(s) of viral DNA present in the sample. Final result was reported by a code indicating the colour signal at the test zone 539, for example, a one-letter code. In the figure, the one-letter code used to designate each colour signal is as follows: Ccyan, Mmagenta, Yyellow, Bblue, Ggreen, Rred and Kkey (black) and Nno visible/detectable colour (nil).

[0128] FIG. 6 is a schematic illustration 600 of the preparation of multi-coloured Au/Ag NPs i.e. Au NPs (magenta solution), Au@Ag NPs (yellow solution) and Au hollow NPs (cyan solution) in accordance with one embodiment disclosed herein. Briefly, a typical synthesis began with the preparation of Au seed particles 601. The addition of reagent 609 in the form of HAuCl.sub.4, to Au seed particles 601 led to the formation of the magenta Au NPs 603. The addition of reagent 611 in the form AgNO.sub.3 to Au seed particles 601 led to the formation of the yellow Au@Ag NPs 605. The further dropwise addition of reagent 613 in the form of HAuCl.sub.4 to the yellow Au@Ag NPs 605 led to the formation of the cyan Au/Ag hollow NPs 607.

EXAMPLES

[0129] Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following examples, tables and if applicable, in conjunction with the figures. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new exemplary embodiments.

[0130] In the examples provided herein, the inventors demonstrated a two-parameter multiplexing strategy for paper or membrane-based diagnostic platforms such as LFA based on the spatial separation of the test zone and the colour of the test spot. In these examples, the platform disclosed herein differentiated targets based on the location of the test zone and the colour of the signal readout. Au/Ag NPs of visually distinguishable colours, which were fine-tuned by simply altering their composition and the morphology, were employed as the reporter. Different combinations of targets would display signals at unique locations with distinctive colours at each location. Compared to single-parameter multiplexing strategy, the two-parameter multiplexing strategy in the examples used herein required fewer test zones and fewer particle types to achieve a high degree of multiplexing, which would greatly improve the multiplexing capability and the applicability of LFA.

Reporter NPs With Tunable Colours

[0131] Au/Ag NP systems were selected as the reporter NPs. One of the most useful features of this system was the distinctive and highly tunable optical properties that originated from localized surface plasmon resonance (LSPR). Tight control over the morphology and composition of the NPs allowed one to fine-tune the LSPR peaks over a broad range of the visible spectrum. Such exceptional tunability endowed the Au/Ag NP system with great promise in colorimetric sensing and labelling applications.

[0132] 0-D Au, Au@Ag and hollow Au/Ag NPs with distinctive plasmonic absorption were employed in this example. 0-D NPs were selected instead of 1-D nanorods and 2-D nanoplates due to their symmetrical shape. Such symmetry resulted in a single plasmonic absorption, which could benefit the unique colocalization feature in the assay design.

[0133] Au NPs and Au@Ag NPs were synthesized using a seed-mediated growth method. Au NPs exhibited a truncated octahedral shape with an absorption peak at 563 nm (FIG. 1A). Au@Ag NPs adopted a truncated cubic shape with an absorption peak at 407 nm (FIG. 1B). Galvanic replacement of the Au@Ag NPs with HAuCl.sub.4 solution allowed for straightforward tuning of the LSPR peak of nanostructures spanning the visible spectrum.

[0134] FIG. 2A shows the vials of Au/Ag NP solutions prepared by reacting Au@Ag NPs with different volumes of HAuCl.sub.4 solution (20 mM). The colours of the solution were visually distinguishable. The corresponding absorbance spectra (FIG. 2B) indicated that the LSPR peak position of the Au/Ag NPs was tunable from 453 nm to 620 nm with HAuCl4 solution volumes. The galvanic replacement reaction also resulted in morphological change from a solid cube to a hollow structure (FIG. 1C).

NP Colour Palette

[0135] The inventors selected NPs of three subtractive primary colours for subsequent experiments. The absorption of each of the yellow (Y) NPs, the magenta (M) NPs and the cyan (C) NPs was centred at 407 nm, 563 nm 617 nm, respectively. The selective combination of three primary colours provided an entire palette with visually distinguishable secondary colours (FIG. 3A). By mixing the magenta and cyan NPs, a blue (B) colour was obtained (which looked purplish on the LFA test strip due to particle aggregation). Mixing yellow and cyan NPs resulted in a green colour. The mixture of yellow and magenta NPs gave a red (R) colour. The combination of all three primary colours led to black (K). The aforementioned colours were unique and easily distinguishable by unaided eyes. By mixing the three primary NPs at various ratios, the inventors were able to obtain an entire spectrum of colours (FIG. 3B).

[0136] As a proof of concept, the inventors labeled anti-fluorescein isothiocyanate (FITC) antibody primary NPs and NPs mixtures of secondary colours with a total of seven aforementioned colours (C, M, Y, B, G, R and K). The test strip had streptavidin immobilized at the test zone. The target DNA was dually labeled with biotin at one end and FITC at the other end. As the target flowed through the test strip, double-stranded DNA (dsDNA) molecules would accumulate at the test zone via biotin-streptavidin interaction. The antibody-conjugated NPs bound to the FITC at the test zone through the dsDNA target and present various colours (FIG. 3C).

[0137] Detector antibodies could be conjugated to a single type of NPs, in which case the test zone would display one of the primary colours. Alternatively, the detector antibodies could be conjugated to a mixture of NPs, whereby different types of NPs would colocalize at the test zone and display the secondary colours. These colours were all visually distinguishable on the test strip.

Space-Colour Two-Parameter Multiplexing for LFA

[0138] Unlike conventional single-parameter multiplexing, the inventors' strategy used a combination of two parameters to achieve a high degree of multiplexing. The two parameters the inventors employed for multiplexed LFA were space and colour. The inventors analyzed five targets with NPs of three colours at two different locations on the strip. First, two test zones were spatially separated along the flow paths (FIG. 4A). Two protein-based targets (alpha fetoprotein (AFP) and human chorionic gonadotropin (HCG)) were detected at Zone A, and three DNA-based targets were detected at Zone B. For each protein target, a pair of antibodies that would bind to different epitopes of the protein was used for detection. One of the antibodies was immobilized on the test strip as the capture antibody, and the other antibody was conjugated to the reporter NPs. For each DNA target, one end of the DNA was labeled with biotin, and the other end was labeled with a hapten molecule (FITC, digoxigenin (DIG) or dinitrophenol (DNP)). Streptavidin was used as the common capture agent to be immobilized on the test strip. The detector antibody for each target was conjugated to one of the three primary NPs. Anti-HCG was conjugated to yellow NPs; anti-AFP was conjugated to cyan NPs; anti-FITC was conjugated to yellow NPs; anti-DIG was conjugated to cyan NPs; anti-DNP was conjugated to magenta NPs. All five NP-conjugated antibodies were mixed. As the mixture flowed through the test strip, each type of NP would accumulate at the test zone if the corresponding target was present in the sample. In the absence of corresponding target, the NP would flow downstream without any trace at the test zone.

[0139] The presence of a target was reported by both the location and the colour of the signal (FIGS. 4B and C). Any of the 32 possible combinations of targets (five targets with 2.sup.5 combinations could be distinguished based on the colour and location of the signal. Yellow at Zone A would mean the presence of HCG, and magenta at Zone B would indicate there was DNP-labeled DNA. If more than one protein targets or DNA targets were present in the sample, NPs of different primary colours would colocalize at one test zone, resulting in a distinctive secondary colour. Each colour indicated a unique combination of targets. For example, the presence of FITC-labeled and DNP-labeled DNA targets would give rise to a red spot at Zone B, and the presence of HOG-labeled and AFP-labeled protein targets would produce a green spot at Zone A. Final results were reported by a two-letter colour code where the first letter and second letter would indicate the colour signals at Zone A and Zone B, respectively (FIG. 4B). For instance, CB was translated to AFP+, HCG, FITC, DIG+ and DNP+. GK indicated the presence of all five targets. NR (N for Nil) implied the absence of either protein target, and only FITC and DNP-labeled dsDNA targets were present. Using the two-parameter multiplexing strategy, the inventors successfully analyzed all 32 possible combinations of the targets (FIG. 4B).

[0140] A unique feature of platform presently disclosed was the two-parameter strategy the inventors employed to facilitate a high-degree of multiplexing. One parameter was the spatial separation. Targets were grouped and spatially separated on the test strip. The location of the signal would indicate which group the target belonged to. The other parameter relied on the colour. When NPs of different primary colours colocalized at the same test zone, it would lead to a distinctive secondary colour that contained the target information. The two-parameter multiplexing has significant advantages over the single-parameter approach. Given the same number of input N for each parameter, a single-parameter multiplexing can only detect N targets with 2.sup.N number of different combinations. In a two-parameter multiplexing, N input for each parameter allows the detection of 2N number of targets with 2.sup.2N number of different combinations. Therefore, the two-parameter strategy considerably improves the multiplexing capability. The two-parameter strategy could also reduce the number of required input, but still achieve the same degree of multiplexing.

[0141] Take the experiment in FIG. 4 for instance, to detect five targets, the traditional single-parameter multiplexing platform requires five separate test zones. In the context of manufacturing, most liquid printing equipment has a limited number of printer head, which means the five test zones have to be printed in multiple runs. In each run, the printer heads would need to be washed and the antibody solutions would have to be reloaded, which would result in waste of reagents and significant time delay. In contrast, the two-parameter strategy would only require two test zones, which could be easily printed in a single run. This would greatly reduce the cost and manufacturing cycle. In the colour-based single-parameter multiplexing, it is difficult to go beyond three targets due to spectral overlap. The NPs colocalization would result in colours indistinguishable from the base colours. For example, if one uses green particles, in addition to the three primary colours, to detect the fourth target, the colocalization of cyan and green would yield a dark greenish colour that is implausible to distinguish by unaided eyes.

Multiplexed Subtyping of Herpes Virus

[0142] Herpes virus is a large family of DNA viruses that causes various types of disease in human. Some of the widely spread herpes viruses include herpes simplex virus-1 (HSV-1) and HSV-2, which cause oral and genital herpes, and varicella zoster virus (also known as HSV-3), which causes chicken pox and shingles. In this example, the inventors applied the two-parameter multiplexing strategy to detect the aforementioned three herpes viruses by amplifying the viral DNA using loop-mediated isothermal amplification (LAMP), and detecting LAMP amplicons using multiplexed LFA. Three target-specific LAMP primer sets and one internal control primer set were used in each reaction (Table 1 below).

TABLE-US-00001 TABLE1 Primersequences. Sequence HSV-1 FIP Biotin-CCAGACGTTCCGTTGGTAGGTCACTTTGACTA TTCGCGCACC BIP CCATCATCGCCACGTCGGACTCGGCGTCTGCTTTTTGTG F3 CAGCCACACACCTGTGAA B3 TCCGTCGAGGCATCGTTAG LF FAM-AAATCCTGTCGCCCTACACAGCGG LB CACCCCGCGACGGGACGCCG HSV-2 FIP Biotin-CCCTGGTACGTGACGTGTACGAGTATGGAGGG TGTCGCG BIP AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT F3 TCAGCCCATCCTCCTTCG B3 GCCCACCTCTACCCACAA LF DIG-CACGTCTTTGGGGACGGCGGCT LB ATCTGGGACCGCGCCGCGGAGACAT HSV-3 FIP Biotin-CTCCCACTGGTACGTCAAGTGGAGGGTCAAAA ACCCTGGC BIP TTCCTCAACATCCCCGACATCGTACCCGATGGGGGATACC F3 CCAATACGACCACCGGATC B3 TGGCTTCGTCTCGAGGATTT LF DPN-CGAAATGTAGGATATAAAGG LB CATCCTTATATTCAAAAGTAGCT Internal Control FIP TexasRed-CGACGACCCTTCTTTTTCCTCAAGCCAAA CCTAAAACCAGC BIP TCTCGATAAAGTCTCTACAGAGACCTTTTTCCAGATCTT CACGC F3 GTGAAGCAAAACGTAGCG B3 CTGACTACGTAGACGCTC LF TAMRA-AGCGGCTGCTCGCCTTT LB ACCGTTGATATTACTTGTGCCGAAG

[0143] Each primer set contained six primers. In HSV-1, HSV-2 and HSV-3 primer sets, the FIP primers were labeled with biotin, and the LF primers were labeled with FITC, DIG and DPN, respectively. In the internal control primer set, the FIP primer was labeled with Texas red, and the LF primer was labeled with 5-carboxytetramethylrhodamine (TAMRA). Anti-FITC, anti-DIG antibodies were labeled with yellow and cyan NPs respectively, and anti-DPN and anti-TAMRA antibodies were labeled with magenta NPs. Streptavidin was immobilized at the test zone to capture all three target amplicons. Anti-Texas red antibody was immobilized at the control zone to capture the internal control amplicon. Goat-anti-rabbit antibody was also immobilized at the control zone to capture excess anti-FITC yellow NPs and anti-DIG cyan NPs (FIG. 5A).

[0144] In the presence of the target, the viral DNA was amplified to a detectable level, and each amplicon was dually labeled with biotin and a hapten molecule. As the amplicon flowed through the LFA test strip, it was captured at the test zone via biotin-streptavidin interaction. The antibody-conjugated NP would recognize the hapten and tag the amplicon with the corresponding NP to reveal its identity (FIG. 5A). The internal control ensured successful LAMP reaction. The internal control amplicon would be tagged by the magenta NP at the control zone. The goat-anti-rabbit antibody at the control zone would bind to excess yellow and cyan NPs. In the end, the colour of the test spot revealed what targets were present in the sample (FIG. 5B). For example, if the sample contained HSV-2, the test spot was cyan in colour. If the sample contained both HSV-1 and HSV-3, the test spot was red in colour. If the sample contained all 3 types of viruses, the spot appeared black.

[0145] The inventors successfully identified all three viruses and their combinations in the sample using this method. Ideally, the control spot should be black in colour. However, due to the fact that different amount of cyan and yellow NPs were consumed at the test spot, the three primary NPs might be present at different ratios at the control spot. Therefore, as long as the control spot comprised of at least two primary colours and one of which was magenta, it was considered a valid control. In other words, a valid control spot could be any colour other than yellow, cyan, magenta or green.

[0146] In summary, the inventors developed a two-parameter multiplexing strategy for paper or membrane-based diagnostic platforms such as LFA based on the spatial separation of the test zone and the colour of the test spot. First, different groups of targets were separated to distinct test zones on the LFA test strip. In addition, the inventors selected morphology and composition-controlled Au/Ag NPs of three primary colours as the reporter particles. When conjugated to antibody, each type of primary NP would report the presence of the corresponding target by its colour. The colocalization of the primary NPs would produce an array of secondary colours that indicated various target combinations. Compared to traditional single-parameter multiplexing, the two-parameter strategy would greatly improve the multiplexing capability of LFA. Using the two-parameter multiplexing strategy, the inventors successfully distinguished all possible combinations of two protein targets and three DNA targets using LFA. The inventors also successfully performed the multiplexed subtyping of three herpes viruses by combining LAMP and LFA.

Synthesis of Au/Ad NPs

[0147] The overall synthesis route of NPs with three primary colours is illustrated in FIG. 6.

[0148] A typical synthesis began with the preparation of Au seed NPs for the synthesis of Au NPs and Au@Ag core-shell NPs. Seed-mediated growth method provided better control over the size and shape of metal nanostructures. Adoption of single-crystalline seeds with relatively large size in seed-mediated growth method avoided the structure fluctuations of the NPs during the growth stage, and led to the formation of exclusively single-crystalline NPs.

[0149] The synthesis of Au seed NPs was based on seed-mediated growth with NaBH.sub.4-reduced Au seeds. For the preparation of NaBH.sub.4-reduced Au seeds, 7 mL of 75 mM cetyltrimethylammonium bromide (CTAB) solution was first prepared by dissolving CTAB at 30 C. with constant stirring. 87.5 L of 20 mM HAuCl.sub.4 solution was added to the CTAB solution. 0.6 mL of an ice-cold NaBH.sub.4 solution (10 mM) was then injected quickly into the mixture under vigorous mixing to form a brown seed solution. Stirring continued gently at 30 C. for 2-5 h to decompose the excess NaBH.sub.4. A growth solution was prepared by adding 90 L of 20 mM HAuCl.sub.4 solution and 1.392 mL of 38.8 mM ascorbic acid (in the stated order) into 43 mL of 16.7 mM CTAB solution in a clean test tube at 30 C. with thorough mixing after each addition. 0.54 mL of the NaBH.sub.4-reduced seed solution was added to the growth solution and thoroughly mixed. The mixture was left unperturbed at 30 C. overnight.

[0150] For the preparation of Au NPs (magenta solution), 0.36 mL of the Au seed NP solution was added to 45 mL of a growth mixture containing 16 mM CTAB, 0.04 mM HAuCl4 and 1.2 mM ascorbic acid. The mixture was thoroughly mixed and left unperturbed overnight. The colour of the solution changed to magenta, indicating the formation of Au NPs. The Au NPs adopted a truncated octahedral morphology with good monodispersity in both size and shape (FIG. 1A). The rhombic projections with slight truncations in the corners in the TEM image are the NPs viewed in <110> directions.

[0151] For the preparation of Au@Ag core-shell NPs (yellow solution), 4.64 mL of 38.8 mM ascorbic acid, 180 L of 1 M NaOH, and 1.8 mL of Au seed solution were added to 38 mL 18.9 mM CTAB solution in the stated order, followed by addition of 0.45 mL of 20 mM AgNO3. The mixture was thoroughly mixed and left on a thermoshaker at 40 C. overnight. The colour of the solution changed to yellow, indicating the formation of Ag shells. The Au@Ag NPs adopted a truncated cubic morphology (FIG. 1B). The Au cores can be clearly observed from the TEM image with a darker contrast.

[0152] For the preparation of Au/Ag Hollow NPs (cyan solution), 157.4 L of 20 mM HAuCl.sub.4 aqueous solution was added dropwise to 45 mL of as-synthesized Au@Ag core-shell NP solution on a thermoshaker. Ag shell would be oxidized by HAuCl4 according to 3Ag+AuCl.sub.4.fwdarw.Au+3Ag++4Cl, because the standard reduction potential of AuCl.sub.4/Au (1.002 V vs. standard hydrogen electrode (SHE)) was more positive than that of Ag+/Ag (0.7996 V vs SHE). The resulted Au atoms would deposit on the Ag shell template and adopt its morphology, as interior Ag was oxidized to produce a hollow structure. According to reaction stoichiometry, three Ag atoms were removed from the Ag shell with the deposition of one Au atom. The amount of Au would be 33.3 at % of Ag to fully replace the entire Ag shell, and to produce the hollow Au/Ag nanostructures subsequently. The hollow interior was clearly visible in the TEM image (FIG. 10). The solution gradually changed from yellow to orange, to reddish brown, and finally to a cyan colour with the dropwise addition of HAuCl.sub.4 solution. HAuCl.sub.4/Ag ratios of 0.03, 0.06, 0.09, 0.12, 0.15, 0.18, 0.21, 0.24, 0.27, 0.3, 0.325 and 0.35 were obtained with the addition of 13.5, 27, 40.5, 54, 67.5, 81, 94.5, 108, 121, 135, 146.2 and 157.4 L of 20 mM HAuCl4 to 45 mL of as-synthesized Au@Ag core-shell NP solution. The resulting solutions and the corresponding UV-vis spectra are shown in FIGS. 2A and 2B.

Materials Characterizations

[0153] The structure of the NPs was analyzed by transmission electron microscopy (TEM) on FEI Tecnai F20 electron microscope operating at the 200 kV accelerating voltage. Field emission scanning electron microscopy (FESEM) (JEOL JSM-7400F) was used to examine the general product morphology. TEM samples were prepared by dispensing a drop of the washed product on a copper grid, followed by drying in air at room temperature. The optical absorption spectra were recorded by a Shimadzu UV-vis-NIR spectrophotometer UV-3600.

Conjugation of Antibody to Au/Ag NPs

[0154] NPs of three subtractive primary colours (cyan, magenta and yellow) were selected for multiplexing in this study. After the synthesis, the NPs were washed by centrifugation at 8,000 g for 10 min. The supernatant was then discarded, and the NPs were resuspended in 5 mM phosphate buffer (pH=5.5). Next, the NPs were subjected to another round of washing under the same condition. Finally, the yellow NPs, magenta NPs and cyan NPs were resuspended in 5 mM phosphate buffer (pH=5.5) at optical densities (ODs) of 20, 10 and 10, respectively.

[0155] The detector antibodies were conjugated to NPs by passive adsorption. A titration was performed to estimate the amount of protein required for labelling. The optimal amount of protein was determined by observing the degree of aggregation. Ideally, the protein would not cause the NPs to aggregate and change colour. It was determined that 5 g, 2.5 g and 0.5 g would be used to conjugate to 1000 OD.Math.L of cyan, magenta and yellow NPs, respectively.

[0156] To conjugate antibodies to NPs, desired amount of antibodies (10 g for cyan NPs, 5 g for magenta NPs, and 2.5 g for yellow NPs) were diluted to 200 L in 5 mM phosphate buffer (pH=5.5). 200 L of NPs at stock concentration (OD=10 for cyan NPs, OD=10 for magenta, and OD=20 for yellow NPs) were mixed with the diluted antibodies and incubated at room temperature for 6 h. After incubation, 200 L of 10 mM CTAB was added to the mixture and incubated for 10 min. Next, the NPs with antibodies adsorbed on the surface were washed by centrifugation at 2000 g for 15 min. The supernatant was discarded, and the particles were resuspended in 200 L of 5 mM phosphate buffer (pH=5.5).

[0157] For the LFA experiment illustrated in FIG. 3, all NPs were conjugated to anti-FITC (Abcam, Cambridge, United Kingdom). For the LFA experiment illustrated in FIGS. 4 and 5, anti-FITC and anti-HCG (Arista Biologicals, Pennsylvania, USA) were conjugated to yellow NPs. Anti-DIG (Fitzgerald, Mass., USA) and anti-AFP (Thermo Pierce, Illinois, USA) were conjugated to cyan NPs. Anti-DNP (LifeSpan Biosciences, Washington, USA) was conjugated to magenta NPs. For the experiment illustrated in FIG. 5, anti-TAMRA was conjugated to magenta NPs.

Preparation of LFA Test Strips

[0158] For the LFA experiment illustrated in FIG. 3, streptavidin (Promega, Wisconsin, USA) was diluted to 1 mg/mL with 200 mM phosphate buffer (pH=8), and 1 L of the diluted streptavidin was dispensed onto the HF135 nitrocellulose test strip (Merck Millipore, Massachusetts, USA). For the LFA experiment illustrated in FIG. 4, 1 L of streptavidin of the same condition was dispensed onto the test zone B. Capture antibodies of HCG (Arista Biologicals, Pennsylvania, USA) and AFP (Arista Biologicals, Pennsylvania, USA) were mixed and diluted to 0.5 mg/mL each in 200 mM phosphate buffer (pH=8). 1 L of the antibody mixture was dispensed onto test zone A. After the dispensing, the strips were dried under vacuum for 30 min. They were then blocked with commercial blocking solution (Candor Bioscience, Wangen, Germany) for another 30 min. Subsequently, the test strips were washed with 5 mM phosphate buffer (pH=7-7.5 for 1 h. In the end, the strips were dried under vacuum for 3 h before use.

[0159] For HSV subtyping, streptavidin (Promega, Wisconsin, USA) was diluted to 1 mg/mL with 200 mM phosphate buffer (pH=8), and 1 L of the diluted streptavidin was dispensed onto the test zone of strip (HF135, Merck Millipore, Massachusetts, USA). Anti-Texas red and goat-anti-rabbit was mixed and diluted to 0.5 mg/mL each in 200 mM phosphate buffer (pH=8). 1 L of the antibody mixture was dispensed onto the control zone. The rest of the procedure was the same as described above.

Sample and Assay Conditions

[0160] For the LFA experiment illustrated in FIG. 3, only one type of dsDNA was used. An arbitrary 76-bp DNA oligonucleotide T20 (Integrated DNA technology, Iowa, USA) was labeled with biotin at its 5 terminal. Its complementary strand (Integrated DNA technology, Iowa, USA) was labeled with fluorescein at its 5 terminal. The two strands were mixed at equal-molar ratio in 1tris buffered saline (1TBS, First base technology, Singapore). The mixture was heated at 95 C. for 10 min, and then allowed to cool down to room temperature. To prepare the sample, the hybridized dsDNA was diluted to 1 M with 1TBS. 5 L of biotin-FITC dsDNA target was added to 50 L 1phosphate buffered saline (1PBS, First base technology, Singapore) supplemented with 5% bovine serum albumin (BSA). The sample was then applied to the test strip. The NP conjugates were added to 50 L of 1PBS supplemented with 5% BSA, and applied to the test strip after the sample had flowed through. For the three primary colours, cyan NPs (2.5 L), magenta NPs (5 L), and yellow NPs (10 L) were used in the respective reaction. For the secondary colours, different NPs of the same volumes mentioned above were mixed in 1PBS supplemented with 5% BSA, and applied to the test strip. In the end, the test strip was washed with 50 L of 1PBS supplemented with 5% BSA.

[0161] For the LFA experiment illustrated in FIG. 4, a total of five targets were used. Recombinant HCG (Arista Biologicals, Pennsylvania, USA) and AFP (Arista Biologicals, Pennsylvania, USA) antigens were purchased from commercial source. The same 76-bp DNA oligonucleotide T20 was used. Three complementary strands were labeled with FITC, DIG and DNP, respectively. Three dsDNA targets were prepared by hybridizing the biotinylated T20 with the three labeled complementary oligonucleotides. The resulting dsDNA targets were dually labeled with biotin-FITC, biotin-DIG and biotin-DNP, respectively. To prepare the sample, 5 L of HCG antigen at 10 g/mL, 5 L of AFP antigen at 10 g/mL, and 2 L of each dsDNA target at 1 M were added to 50 L of 1PBS supplemented with 5% BSA. Each sample might or might not contain all the targets. The sample was first applied to the test strip, and allowed to flow through. The detector mixture was prepared by mixing the five NP-conjugated detector antibodies (2.5 L of cyan anti-DIG, 2.5 L of cyan anti-AFP, 5 L of magenta anti-DNP, 10 L of yellow anti-FITC, and 10 L of yellow anti-HCG) with 25 L of 1PBS supplemented with 10% BSA. The mixture of reporter NPs was applied to the test strip after the sample has flowed through. Lastly, the test strip was washed with 50 L of 1PBS supplemented with 5% BSA.

HSV Subtyping

[0162] All three types of viral DNA were acquired from American Type Culture Collection (ATCC, Virginia, USA). All primers were ordered from Integrated DNA Technology (IDT DNA, Iowa, USA). The three target-specific primer sets were obtained from Kaneko et al., 41 and the internal control primer set was designed in house using Primer Explorer Software (https://primerexplorer.jp/e/). The LAMP recipe is shown in Table 2 below. The LAMP reagents were purchased from New England Biolab (NEB, Massachusetts, USA). The reaction was conducted at 65 C. for 1 h. After amplification, 3 L of amplicon was added to 50 L of 1PBS supplemented with 5% BSA, and applied to the test strip. After the sample flowed to the test strip, the detector mixture, which contained 2.5 L of cyan anti-DIG, 5 L of magenta anti-DNP, 5 L of yellow anti-FITC and 5 L of magenta anti-TAMRA in 25 L of 1PBS supplemented with 10% BSA, was applied to the test strip. In the end, the test strip was washed with 50 L of 1PBS supplemented with 5% BSA.

TABLE-US-00002 TABLE 2 LAMP recipe Initial 25 L Vol. Item Concentration Final Concentration (L) 10 isothermal 10 1 (2 mM Mg.sup.2+ final 2.5 buffer in 1 buffer) dNTP 10 mM each 1 mM each 2.5 MgSO.sub.4, Mg.sup.2+ 100 mM 8 mM 2 Target Primers 5 M each 200 nM each 1 (18 primers) Target DNA 1 L of each of the 3 targets. 3 template Use water to make up the volume if the reaction contains < 3 targets. Control Primer 10 M each 200 nM each 0.5 Control DNA 1 pg/L 1 pg 1 template Water 11.5 Warmstart Bst 8 unit/L 8 unit 1 Total Volume: 25

APPLICATIONS

[0163] Paper or membrane-based diagnostic platform such as LFA is a well-established platform widely used in point-of-care diagnostics. A new strategy for multiplexing on diagnostic platform such as LFA has been disclosed herein. In addition to spatial separation, embodiments of the method disclosed herein employ morphology and composition-controlled Au/Ag nanoparticles of three primary colors to add another parameter for multiplexing. The colocalization of primary particles may result in an array of secondary colors as an indication of various target combinations. This two-parameter multiplexing strategy significantly improves the multiplexing capability of LFA, and extends the applicability of LFA to more complicated analysis. In the examples provided, using the proposed two-parameter multiplexing LFA, the inventors successfully identified all 32 combinations of two protein and three DNA targets. The inventors also successfully identified subtypes of three herpes viruses by amplifying the viral DNA with loop-mediated isothermal amplification, and detecting the amplicons using the two-parameter multiplexing LFA.

[0164] Embodiments of the methods and related kits disclosed herein provide a highly multiplexed strategy of detecting different target analytes in a sample that is not only sensitive and specific, but also relatively equipment-free, easy to implement, convenient, low cost, and efficient, making them suitable point-of-care diagnostic or home diagnostic.

[0165] It will be appreciated by a person skilled in the art that other variations and/or modifications may be made to the specific embodiments without departing from the spirit or scope of the disclosure as broadly described. The present embodiments are, therefore, to be considered in all respects to be illustrative and not restrictive.