SYSTEMS

Abstract

An optimized method based on a dual promoter vector of the reprogramming factors combined with knock-down of the neural silencing complex RESTi to convert adult fibroblasts into induced neurons (iNs). We have also designed and cloned vector constructs of which some include all these components which allows for a one-step method to efficiently reprogram dermal fibroblasts including those obtained from elderly individuals. The single vector system can be used to obtain iNs of high yield and purity from biopsies from aged individuals with a range of familial and sporadic neurodegenerative disorders including Parkinson's, Huntington's as well as Alzheimer's disease.

Claims

1. A gene expression system comprising: (a) a nucleotide sequence encoding Asci1; (b) a nucleotide sequence encoding Brn2; and (c) at least one nucleotide sequence encoding a REST-silencing sequence capable of suppressing REST-expression.

2. A gene expression system according to claim 1, wherein the nucleotide sequences of (a) and (b) are comprised in a single vector, optionally, wherein the nucleotide sequences of (a), (b) and (c) are comprised in a single vector.

3. A gene expression system according to claim 1, wherein the expression system is a lentiviral vector and/or wherein the nucleotide sequences of (a) and (b) are configured such that they are transcribed into a single transcript.

4. A gene expression system according to claim 1 wherein the nucleotide sequences are under the control of a constitutive promoter such as a PGK promoter or under the control of a regulatable promoter such as a doxycycline regulatable promoter.

5. A gene expression system according to claim 1 wherein the order of the nucleotide sequences of (a) and (b) is pBrn2.pAscll, optionally wherein the promoter is PGK and the order is pgk.Brn2.pgk.Asc11 (pB.pA).

6. A gene expression system according to claim 1, wherein the gene expression system further comprises a Woodchuck Heptatitis Virus Posttranscriptional Regulatory Element (WPRE), and/or wherein the REST-silencing sequence is shRNA.

7. A mammalian cell transformed, transduced or transfected with the gene expression system of claim 1, optionally wherein the cell is a human cell.

8. The cell of claim 7, wherein the cell is derived from a biopsy sample obtained from an animal such as a human, optionally (i) wherein the biopsy sample comprises fibroblasts, such as a skin punch biopsy or a lung biopsy; and/or (ii) wherein the biopsy sample is obtained from an individual with a neurodegenerative disorder, optionally wherein the neurodegenerative disorder is familial or sporadic Alzheimer's disease or familial or sporadic Parkinson's disease, or Huntington's disease; and/or (iii) wherein the biopsy sample is obtained from a healthy individual; and/or (iv) wherein following introduction of the gene expression system, the cell has been cultured until converted into an induced neuron directly, optionally wherein the cell was passaged at least 3 times, or wherein the cell was passaged up to 10 times before introduction of the gene expression system.

9. A method of inducing neurons directly from fibroblast cells comprising the step of introducing the gene expression system of claim 1 into a fibroblast cell, wherein the gene expression system is introduced into the fibroblast cell by transduction.

10. A method according to claim 9, wherein following introduction of the gene expression system into fibroblast cell, the cells are cultured in a neural differentiation medium, such as NDiff227, optionally: (a) wherein the neural differentiation medium is supplemented with one or more growth factors, optionally wherein the one or more growth factors are selected from LM-22A4, GDNF, NT3 and db-cAMP; or (b) wherein the neural differentiation medium is supplemented with one or more small molecules, optionally wherein the one or more small molecules are selected from CHIR99021, SB-431542, noggin, LDN-193189 and valproic acid sodium salt; or (c) wherein the method further comprises assessing the cell for one or more neuronal characteristics, optionally by at least one method selected from immunocytochemistry, fluorescence activated cell sorting, and electrophysiology.

11. An induced neuron cell obtainable by carrying out the method of claim 9, optionally wherein the cell passaged at least 3 times, or wherein the cell was passaged up to 50 times before introduction of the gene expression system.

12. Use of a gene expression system according to claim 1 in disease modelling, or in diagnostics or in drug screening.

13. A gene expression system according to claim 1 for use in diagnostics, or in cell therapy or in gene therapy.

14. A method of screening for a compound that alters at least one disease related biomarker, the method comprising: (a) exposing an induced neuron as defined in claim 7 to at least one chemical compound to be tested; (b) registering the level of at least one disease related biomarker; (c) comparing the registered level of at least one disease related biomarker in b. with one or more reference levels; and (d) selecting at least one compound that alters the level of at least one disease related biomarker with the one or more reference levels, optionally wherein the disease related biomarker is a biomarker of a neurological disorder, such as any of Alzheimer's disease, Parkinson's disease or Huntington's disease.

15. A method for detecting the presence, progression or early stage onset/development of an age related neurological clinical condition in an individual comprising: (a) introducing the gene expression system of claim 1 into fibroblasts in a biopsy sample obtained from the individual; (b) registering the level of at least one potential disease-associated phenotype or biomarker in these cells at the stage of induced neuron; (c) comparing the registered level of at least one potential disease-associated phenotype or biomarker in (b) with one or more reference levels; and (d) stratifying the sample based on the correlation to the reference levels in (c) as indicative of the absence, the presence, progression or early stage onset/development of an age related neurological clinical condition, optionally (i) wherein the potential disease-associated phenotype or biomarker is a potential neurological disease-associated phenotype or biomarker, such as any of Alzheimer's disease, Parkinson's disease or Huntington's disease; and/or (ii) wherein the age related neurological clinical condition in an individual is selected from the group comprising Familial and sporadic Alzheimer's disease; Familial and sporadic Parkinson's disease; Huntington's disease.

Description

[0149] The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.

[0150] The invention will now be described with reference to the following Figures and Examples.

[0151] FIG. 1. Bicistronic approach successfully reprograms fetal fibroblasts but fails to reprogram adult fibroblasts.

[0152] (A) Vector maps of constructs containing the neural conversion factors ASCL1 coding for MASH1 and BRN2A as well as woodchuck hepatitis post-transcriptional element (WPRE) at different positions. (B) Quantitative analysis showing the difference in fluorescence intensity of ASCL1 (red bar graphs) and BRN2a (yellow bar graphs) following transduction with the different constructs.

[0153] (C) Quantification of the number of iNs converted 12 days after transduction with either Pgk.Ascl1+Pgk.Brn2a+Pgk.Myt1L or pB.pA. Data are expressed as meansSEM. * p<0.05. (D) Gene ontology enrichment analysis reveal significant enrichment of neuronal genes (in bold) among the up-regulated genes in the pB.pA transduced fetal fibroblasts. (E) Gene ontology enrichment analysis showing the genes associated with neurons (in bold) that are up-regulated in the pB.pA transduced fetal fibroblasts but not in the adult fibroblasts transduced with pB.pA.

[0154] Data information: Data are expressed as meanSEM and are from biological replicates (n=3). *p<0.05.

[0155] FIG. 2. REST Knockdown promotes the pB.pA-driven reprogramming of adult human fibroblasts.

[0156] (A) qPCR analysis of REST gene expression. (B) Quantification of neuronal efficiency and purity of pB.pA+RESTi reprogrammed adult human dermal fibroblasts from five healthy donors (61-71 years old). (C) Quantification of neuronal efficiency and purity of an adult human dermal fibroblast line reprogrammed with pB.pA+RESTi at different passages. (D) In vitro Patch clamp recordings of adult iNs depicting repetitive current-induced action potentials indicative of mature neuronal physiology at 12-15 weeks post transduction. (E) Presence of repetitive current-induced action potentials and spontaneous post-synaptic currents in vivo 8 weeks following transplantation.

[0157] Data information: Abbreviations: ahDF: adult human dermal fibroblasts; shREST: short hairpin RNA against REST. Data are expressed as meanSEM and are from biological replicates (n=3-4). *p<0.05.

[0158] FIG. 3. Neuronal microRNA expression partly drives neuronal reprogramming of adult fibroblasts.

[0159] (A) qPCR measurements of miR-124 and miR-9 in adult fibroblasts reprogrammed with pB.pA only or pB.pA+RESTi and normalized on the non-transduced fibroblast values (yellow dashed line). (B) Region-specific microRNAs qPCR measurements in adult fibroblasts reprogrammed with pB.pA only or pB.pA+RESTi and normalized on the non-transduced fibroblast values (yellow dashed line). (C) Vector maps of constructs containing the transcription factors Ascl1 and Brn2a with and without miR-9 and miR-124, as well as the shRNA sequences against REST. (D) Quantification of the neuronal yield as assessed by MAP2 expression in adult fibroblasts transduced with different reprogramming vectors. (E) Quantification of the total number of cells as well as the percentage of TAU.sup.+ cells and the average fluorescence intensity in adult iNs with and without miR-124. (F) Quantification of the total number of cells as well as the percentage of TAU.sup.+ cells and the average fluorescence intensity in adult iNs with and without miR-9 knockdown.

[0160] Data information: Abbreviations: CTR: Control; KD: Knockdown. Data are expressed as meanSEM and are from biological replicates (n=3-4). *p<0.05, **p<0.01.

[0161] FIG. 4. All-in-one vector to reprogram skin fibroblasts from patients with a range of different neurodegenerative disorders.

[0162] (A) Map of the single reprogramming vector containing REST shRNA sequences as well as Brn2a and Ascl1. (B) Quantitative comparison of the total number of cells, as well as the number of MAP2.sup.+ and TAU.sup.+ cells per well using separate or one single vectors for pB.pA+RESTi reprogramming in four different adult dermal fibroblast lines. (C) Quantification of the neuronal counts and purity. (D) percentage of cells displaying various number of neurites for each line (n=3 replicates per line). (E) qPCR analysis of 6 neuronal genes in healthy individuals as well as from patients with various neurodegenerative disorders. Data information: Abbreviations: FAD: Familial Alzheimer's disease; FPD: Familial Parkinson's disease; HD: Huntington's disease; SPD: sporadic Parkinson's disease. Data are expressed as meanSEM and are from biological replicates (n=4).

[0163] FIG. 5. High miRNA-9 and miRNA-124 expression following transduction with pB.mir9/124.pA. (a, b) Quantitative PCR analysis of miR-9 (a) and miR-124 (b) three days following the transduction with either pB.pA or pB.mir9/124.pA as compared to fibroblast levels. Abbreviations: ahDF: adult human dermal fibroblasts.

EXAMPLE 1 REST SUPPRESSION MEDIATES NEURAL CONVERSION OF ADULT HUMAN FIBROBLASTS VIA MICRORNA-DEPENDENT AND -INDEPENDENT PATHWAYS

Introduction

[0164] Direct conversion of human fibroblasts into mature and functional neurons, termed induced neurons (iNs), was achieved for the first time 6 years ago. This technology offers a promising shortcut for obtaining patient- and disease-specific neurons for disease modeling, drug screening, and other biomedical applications. However, fibroblasts from adult donors do not reprogram as easily as fetal donors, and no current reprogramming approach is sufficiently efficient to allow the use of this technology using patient-derived material for large-scale applications. Here, we investigate the difference in reprogramming requirements between fetal and adult human fibroblasts and identify REST as a major reprogramming barrier in adult fibroblasts. Via functional experiments where we overexpress and knockdown the REST-controlled neuron-specific microRNAs miR-9 and miR-124, we show that the effect of REST inhibition is only partially mediated via microRNA up-regulation. Transcriptional analysis confirmed that REST knockdown activates an overlapping subset of neuronal genes as microRNA overexpression and also a distinct set of neuronal genes that are not activated via microRNA overexpression. Based on this, we developed an optimized one-step method to efficiently reprogram dermal fibroblasts from elderly individuals using a single-vector system and demonstrate that it is possible to obtain iNs of high yield and purity from aged individuals with a range of familial and sporadic neurodegenerative disorders including Parkinson's, Huntington's, as well as Alzheimer's disease.

Results

Development of a Bicistronic Vector for Co-Delivery of Neural Conversion Genes

[0165] In order to achieve a highly effective and reproducible conversion system with less variability in transcription factor expression in each cell, we generated and tested three different dual promoter vectors. Although the level of expression of each transgene may vary between each cell, this dual vector approach insures a delivery of the coding sequence of the two neural conversion genes Ascl1 (NM_008553.4) and Brn2 (NM_008899.2) in all cells. The vectors are based on the human PGK promoter and the conversion genes were placed in a different order and distance from the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE) (FIG. 1a). For a regulatable system the PGK promoter can be replaced by a doxycycline regulatable promoter. When expressed in human fetal fibroblasts, the three constructs resulted in different levels of expression of the conversion genes (FIG. 1b), and we found that the pB.pA construct, yielding the highest ASCL1 to BRN2 protein expression ratio, resulted in the highest level of neural conversion. When co-delivering the two conversion factors using the pB.pA dual promoter vector we found that we increased the yield of iNs by more than 30 fold compared to when the neural conversion factors were delivered using separate vectors (FIG. 1c).

Difference in Conversion Mechanism/Requirement Between Fetal and Adult Fibroblasts

[0166] Global gene expression analysis confirmed that the pB.pA dual promoter construct induced a major change in gene expression in the fetal fibroblasts. We found 561 significantly (Benjamini-Hochberg (BH) corrected p-value <0.001) up-regulated and 328 significantly down-regulated genes 5 days after delivering the conversion vector. Gene ontology analysis showed that many of the up-regulated genes were associated with a neuronal identity, in line with the high conversion yield observed using this reprogramming vector. We next used the same system to convert adult human dermal fibroblasts from a healthy 67-year-old individual. However, we detected only very few, if any, iNs after 30 days. To rule out the possibility that this failure to reprogram was in fact related to adult vs. fetal fibroblasts and not due to difference in the origin of the fibroblast, we confirmed the failure to reprogram using adult lung fibroblasts from a 45-65 individual.

[0167] To better understand the difference in reprogramming requirements between fetal and adult fibroblasts, we assessed the transcriptional response in the cells after delivery of the dual-conversion vector using RNA-seq. We found that while 204 genes were up-regulated (p<0.001) in both adult and fetal fibroblasts after transduction with pB.pA dual promoter vector, another 357 and 421 genes were uniquely up-regulated in the transduced fetal or adult fibroblasts respectively (Pearson correlation: 0.307, FIG. 1d). GO analysis of the genes up-regulated in the fetal, but not adult fibroblasts resulted in gene categories associated with neuronal functions (FIG. 1e). This demonstrates that the neural conversion factors activates a largely different set of genes with limited overlap in the two starting populations, and suggests that there are specific barriers to reprogramming present in adult but not fetal fibroblasts. When looking at the top 10 genes related to neuronal differentiation and development uniquely up-regulated in the fetal fibroblasts, 4 were identified as REST targets: JAG2, L1CAM, DYNLL2, DCLK1, suggesting that REST blocks the activation of neuronal genes and subsequent neuronal conversion in the adult fibroblasts.

REST Inhibition Removes Neural Reprogramming Block in Human Adult Lung and Dermal Fibroblasts

[0168] To test the hypothesis that REST prevents neural conversion of adult fibroblasts transduced with ASCL1 and BRN2, we performed qRT-PCR analysis in fetal and adult fibroblasts which revealed slightly increased levels of REST transcripts in adult cells (FIG. 2a, p<0.05). We next used RNAi to knockdown REST, which reduced REST transcript levels in adult fibroblasts down to that observed in fetal human fibroblasts (FIG. 2a). When we expressed the dual promoter conversion vector together with the shRNAs against REST in adult dermal fibroblasts from two different donors (age 61 and 67) we consistently observed exceptionally high neural conversion levels. We also confirmed that RESTi removes the reprogramming barrier also of adult lung fibroblasts. The high conversion efficiency was confirmed using five primary lines from dermal biopsies of individuals aged from 61 to 71 years old and sourced from three different clinical sites (FIG. 2b). We also observed that in contrast to previous reports demonstrating that the reprogramming efficiency decreases at higher passages, there was no decrease in the conversion efficiency or neuronal purity when the fibroblasts from a 67-year-old donor were reprogrammed with the dual promoter construct and RESTi at passages ranging from 3 to 10 (FIG. 2c) implying that RESTi also removes the barriers to reprogramming associated with extensive passaging of the fibroblasts previously observed.

[0169] We next analyzed the mature neuronal properties of the resulting iNs. We found that they did indeed express mature neuronal markers such as MAP2, NEUN, SYNAPSIN and TAU. Patch clamp electrophysiological recordings of the iNs after terminal differentiation and maturation in culture showed that they had acquired the functional properties of neurons (FIG. 2d and Table S2). This was also the case when cells pre-labeled with a vector containing GFP expressed under the control of the human synapsin promoter were transplanted to the neonatal brain and analyzed after 7-9 weeks of maturation in vivo. When analyzing the transplanted iNs detected based on GFP expression, we again found current evoked multiple action potentials in the iNs (n=8 from 4 different mice) (FIG. 2e), and the cells displayed postsynaptic currents that could be blocked with the glutamate antagonist CNQX (FIG. 2e), demonstrating that these adult iN cells converted in the presence if RESTi functionally mature, integrate and receive glutamatergic synaptic inputs from the host brain.

RESTi Results in Up-Regulation of Neural Specific miRNAs

[0170] MiRNAs have been implicated as important mediators of cell reprogramming, including in neural conversion. Inhibition of REST is known to increase expression of neuron specific miRNAs, and we speculated that the potential up-regulation of miRNAs could be what mediated the effect of RESTi during neural conversion of adult human fibroblast. We therefore assessed the neuron specific miRNA expression levels in the absence and presence of REST inhibition, and found that miR-9 was up-regulated when adult fibroblasts are converted in the presence of RESTi (FIG. 3a). We also checked the expression of a number of region-specific miRNAs but found no clear differences, indicating that RESTi affects pan-neuronal expression without affecting subtype identity (FIG. 3b). To further investigate this, we tested if expression of neuron specific miRNAs could mimic the effect of RESTi. We therefore expressed miR-9/9* and miR-124 together with the conversion factors (FIG. 3c) but without RESTi. We found that adult fibroblasts transduced with this construct expressed high levels of miR-9 and miR-124 (FIG. S1a, b) and converted adult fibroblasts into neurons with similar efficiency to the cells treated with RESTi (FIG. 3d), supporting the hypothesis that RESTi effect could be mediated via up-regulation of miR-9/9* and miR-124, and that miRNAs, like RESTi removes the reprogramming barrier in adult fibroblasts allowing also fibroblasts from aged donors to efficiently and reproducibly be converted into neurons.

[0171] To experimentally address whether the RESTi effect is mediated via miRNA up-regulation, we next performed conversions using pB.pA+RESTi while simultaneously knocking down miR-124 or miR-9 in the cells and checked for effects on neural conversion (FIG. 3e-f). We found that while inhibition of miR-124 during the conversion did not significantly affect the iN formation (FIG. 3e), the inhibition of miR-9 during the conversion resulted in a decrease in the number of iNs generated compared to control (FIG. 3f).

[0172] Taken together, our data show that the effect of RESTi can be mimicked via miRNA overexpression but that blocking miRNA inhibition during the conversion process only partially affects the neural conversion. This supports that the RESTi acts via miRNA activation and the previously suggested interplay between RESTi and miRNAs.

MicroRNA Independent Effects of REST Inhibition

[0173] In order to better understand the mechanisms that mediate the conversion of adult fibroblasts driven by RESTi or miR-9/miR-124, we performed a comparative global gene expression analysis using RNA sequencing 5 days following the initiation of conversion. In this analysis, we included unconverted adult human fibroblasts and adult fibroblasts in which REST is inhibited as controls. The conversion groups included were: pB.pA (that gives rise to only very low level iN conversion if any); pB.pA+RESTi; pB.miR9/124.pA and pB.miR9/124.pA+RESTi. We compared the genes up-regulated (BH-corrected p-value <0.001) in the pB.pA+RESTi group and the pB.miR9/124.pA groups. This analysis showed that both RESTi and miR-9/miR-124 delivery caused a major transcriptomic change in the cells, and that the effect was not cumulative. Further analysis showed that most of the genes with the largest FC are significant in both the miR-9/miR-124 and RESTi transduced cells (Pearson correlation=0.81). Most genes (more than 1700) were up-regulated in both groups suggesting that these factors largely work on the same neurogenic pathway(s) and activate similar gene cascades.

[0174] We next investigated in more detail the differences in gene expression profiles between the RESTi- and miRNA-converted cells. Unsupervised clustering based on euclidean sample distances revealed that the two controls (fibroblasts and fibroblasts+RESTi) as well as the pB.pA (very low conversion group) clustered together while all three groups with successful neural conversion clustered together. Principal component analysis revealed that the three conversion groups were very similar on the PC1 axis, and distinctly different from the control groups. Furthermore, the PC2 axis showed a separation of the groups with RESTi, from those without. The GO term and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses of the differentially expressed genes revealed that those differentially expressed in the RESTi conversion group were enriched for the regulation of synaptic transmission, synaptic plasticity as well as cell morphogenesis and the differentiation and regulation of neurogenesis and synapse formation. In contrast, the genes uniquely up-regulated in the pB.miR9/124.pA were not associated with neuronal properties

[0175] Taken together, our results show that the RESTi, when combined with the neural conversion genes Ascl1 and Brn2a, overcomes human specific barriers of both reprogramming and neuronal maturation. The miRNA knockdown experiments, as well as the global transcriptome analysis, suggest that this effect is only partially mediated via miR-9/miR-124 expression.

[0176] Based on this, we designed and cloned a single all-in-one construct that expressed both RESTi hairpins and conversion genes on the same construct (FIG. 4a). This vector resulted in similar conversion efficiencies compared to the vector system in which the conversion genes are delivered using the dual promoter vector pB.pA and the two REST shRNAs on three separate vectors while less virus is needed (FIG. 4b). Modeling neurodegenerative disorders would greatly benefit from this technology, as iNs from elderly donors have been shown to maintain their aging signature, which is critical given that age is the biggest risk factor for developing these disorders. To establish its utility for generating cells for disease modeling, we used the new single vector system to convert dermal fibroblasts from healthy adults as well as individuals with sporadic PD, familial PD (LRRK2 c.6055G>A mutation), HD (41 CAG repeats) and familial AD (APP KM670/671NL mutation) (Table S1). All lines were successfully converted to iNs expressing MAP2, albeit with some variation between the lines in terms of yield and purity (FIG. 4c). We also used TAU as a neuronal marker in addition to MAP2 in order to assess the conversion into more mature neurons. Conversion of all lines resulted in neurons with a similar morphological complexity as assessed by the proportion of cells developing variable numbers of neurites for each line (FIG. 4d). Additionally, qPCR analysis revealed a major increase in all the neuronal genes that we assessed (NCAM, MAP2, MAPT, SYNAPSIN, SNCA and SYNAPTOPHYSIN) in every line converted, independently of the disease status of the donor (FIG. 4e).

TABLE-US-00005 TABLE 1 Demographic information on the biopsy donors Disease Duration Cells source Source Disease Sex Age (years) Mutation Dermal biopsy John van Geest None F 52 Centre for Brain Repair Dermal biopsy John van Geest None F 61 Centre for Brain Repair Dermal biopsy John van Geest None F 67 Centre for Brain Repair Dermal biopsy John van Geest None M 69 Centre for Brain Repair Dermal biopsy John van Geest None F 70 Centre for Brain Repair Dermal biopsy John van Geest None M 71 Centre for Brain Repair Lung biopsy Lund None F 45-65 University, Lund Dermal biopsy Lund None F 74 University, Lund Dermal biopsy Karolinska Genetic F 58 4 APP Institute, Alzheimer's KM670/671NL Stockholm disease Dermal biopsy John van Geest Huntington's M 61 HTT - 41 CAG Centre for disease (41 repeats Brain Repair CAG repeats) Dermal biopsy John van Geest Sporadic M 77 4 Centre for Parkinson's Brain Repair disease Dermal biopsy John van Geest Genetic F 55 8 LRRK2 Centre for Parkinson's c.6055G > A Brain Repair disease mutation

TABLE-US-00006 TABLE 2 Summary of the electrophysiological properties Intrinsic properties Adult iN in vitro Adult iN in vivo Resting membrane potential 47.28 4.05 71.14 3.93 (mV) (n = 18) (n = 7) Cell capacitance (pF) 21.78 7.55 60.88 11.99 (n = 22) (n = 8) Membrane resistance (M) 1808 308.3 76.63 33.89 (n = 20) (n = 8) Number of AP able to evoke 1.35 0.65 3.25 1.35 (n = 20) (n = 8) N of cells with post synaptic 1/20 6/8 activity

Discussion

[0177] The direct conversion of one cell type to another, without going through a stem cell intermediate, has been successfully achieved for a number of cell types including the generation of neurons. This type of conversion makes it possible to study otherwise hard to access patient and disease specific neurons, and holds great promise for creating age relevant models of neurological disorders. iNs, that are obtained via direct conversion, present a faster route by which to generate neurons compared to conventional reprogramming approaches using induced pluripotent stem cells (iPSCs) followed by directed differentiation. However, as iN technology converts one mature cell type directly into a post-mitotic neuron, the requirement for high yield conversion is absolutely essential in order to obtain a sufficient number of neurons for downstream applications.

[0178] To date, over a dozen studies have reported successful neural reprogramming of adult primary dermal fibroblasts using a wide array of conversion genes, chemical cocktails and miRNAs, but all have resulted in relatively low numbers of induced neurons. While purification steps or antibiotic selection can increase the purity of the iNs, this is associated with large cell loss making the total yield low which in turn requires a high number of input cells which in this case is limited since adult dermal fibroblasts do not expand indefinitely. In this study, we set out to gain a better mechanistic understanding of the road blocks to reprogramming present specifically in adult human fibroblast, by studying the early transcriptional response in fetal vs. adult fibroblasts. We found that the most commonly used neural conversion genes (ASCL1 and BRN2) elicit largely distinct transcriptional response in these two populations. Bioinformatic data from our experiments showed that many of the genes that were up-regulated only in the fetal fibroblasts were REST targets and thus suggested REST as a potential adult specific reprogramming barrier.

[0179] We thus focused our subsequent studies on the knockdown of REST. RESTi has also been shown to induces the expression of miR-124 as well as miR-9 in a number of cell types which is interesting given that these miRNAs can mediate neural conversion alone or when expressed together with neuronal transcription factors. We also show that while the effect of RESTi can be partially mimicked via overexpression of neuron specific miRNAs, inhibiting activation of miRNA during the neural conversion process only partially inhibits the formation of iNs. This suggests that RESTi mediates its effect on neural conversion both via up-regulation of neuronal miRNAs but also via a miRNA independent mechanism. This hypothesis was supported by our comparative RNA-seq analysis that revealed that while many of the same neuronal genes are up-regulated in fibroblasts converted with RESTi, miRNA overexpression or both RESTi and miRNA expression combined, additional gene transcription changes that are associated with a neuronal identity are uniquely up-regulated when fibroblasts are reprogrammed in the presence of RESTi.

[0180] Combined, our results show that a conversion strategy based on co-delivery of the conversion factors Ascl1 and Brn2 in combination with RESTi is sufficient to overcome the reprogramming barriers previously associated with adult donors, in the absence of additional miRNA expression. It results in high efficiency and high purity conversion of aged dermal fibroblasts without the need for a purification step. In addition, we also show that the passage number of the starting fibroblast culture does not impact on the reprogramming efficiency, at least up until 10 passages, ensuring that one skin biopsy will provide enough iN material to complete large scale disease modeling, drug screening and transplantation studies. For example, with the efficiency of our system it would be possible to obtain approximately 10 billion neurons from one skin biopsy, which by far makes our method the most efficient approach reported to date using skin biopsies from elderly donors. This makes our approach suitable to explore any potential disease-associated phenotypes in these cells, as well as offering a readily available source of relevant cells for drug screenings and diagnostics.

Material and Methods

Biopsy Sampling

[0181] Adult dermal fibroblasts were obtained from the Parkinson's Disease Research and Huntington's disease clinics at the John van Geest Centre for Brain Repair (Cambridge, UK) and used under local ethical approval (REC 09/H0311/88); from the Clinical Memory Research Unit (Malm, Sweden) and used under the Regional Ethical Review Board in Lund, Sweden (Dnr 2013-402); from the Karolinska Institutet (Stockholm, Sweden) (Dnr 2005/498-31/3, 485/02; 2010/1644-32); and lung fibroblasts from a healthy individual with no clinical history of lung disease from Lunds Universitet under approval of the local Ethics committee (Dnr 413/2008 and 412/03) (See Table S1). Written informed consent was taken from each participant and the skin biopsies were taken with a 4 mm punch biopsy from the upper or lower arm under local anesthetic (1% lidocaine), and the site was then closed with steri-strips or a stitch. Primary fibroblast cultures from biopsies were cultured according to the two following methods: 1) fibroblasts were isolated using standard fibroblast medium (Dulbecco's Modified Eagle Medium (DMEM)+Glutamax (Gibco) with 100 mg/mL penicillin/streptomycin (Sigma), and 10% FBS (Biosera)). The skin biopsy was sectioned into 4-6 pieces and placed in a 6 cm dish coated with 0.1% gelatin containing 1.5 ml of medium, which was topped up with 0.5 ml every 2-3 days for a week. One week after the initial plating down of the cells, all of the medium was removed and 2 ml of fresh medium was added. Medium was changed every 3-4 days until full confluency of the fibroblasts was observed. The skin biopsy specimen was then transferred into a new dish and the process was repeated until no more cells grew out of the biopsy. 2) Subjects from the Swedish Biofinder Study had a 3 mm skin punch biopsy taken through the whole dermis to the subcutaneous fat layer using standard clinical procedures. The biopsies were immediately placed on ice in phosphate buffered saline containing calcium and magnesium with glucose (1.8 g/l) and antibiotic-antimycotic (Gibco). Within 1.5-4 hours the biopsies were cut into 10-15 pieces avoiding the subcutaneous fat and the epidermis. The dermal pieces were placed in one well of a 6-well culture plate (Nunclon) and left inside a laminar flow cabinet until dry, usually for less than 15 min. 2 ml fibroblast culture medium (DMEM, 20% FBS, penicillin-streptomycin, sodium pyruvate and antibiotic-antimycotic, all from Gibco) was then added. Incubation was in a standard cell culture incubator in 5% CO.sub.2 and humidified air at 37 C. Half the medium was changed twice weekly. When approximately 30% of the culture well surface was covered by fibroblasts cells were harvested by trypsinisation for approximately 5 min at 37 C. (0.05% trypsin/EDTA, Sciencell). Cells were washed, centrifuged for 3 min at 100g at room temperature, transferred to a T25 culture flask (Nunc) and cultured in either DMEM (as above but with 10% FBS) or in a defined serum free medium (Fibrolife, Lifeline Celltech). The explants were fed with new DMEM with 20% FBS and placed back in the incubator to allow more fibroblasts to migrate out. Fibroblasts expanded in T25 flasks were either transferred to one T75 flask (Nunc) or frozen for long-term storage. For the lung biopsy, alveolar parenchymal specimens were collected 2-3 cm from the pleura in the lower lobes. Vessels and small airways were removed from the peripheral lung tissues and the remaining tissues were chopped into small pieces and allowed to adhere to the plastic of cell culture flasks for 4 h. They were then kept in cell culture medium in 37 C. cell incubators until the outgrowth of fibroblasts was confluent.

Cell Culture and Cell Lines

[0182] HFL1 (ATCC-CCL-153) cells were obtained from the American Type Culture Collection (ATCC), and expanded in standard fibroblast medium. All the fibroblasts used in this study were expanded at 37 C. in 5% CO.sub.2 in fibroblast medium. The cells were then dissociated with 0.05% trypsin, spun, and frozen in either 50/50 DMEM/FBS with 10% DMSO (Sigma) or DMEM+10% FBS with 10% DMSO.

Viral Vectors and Virus Transduction

[0183] DNA plasmids expressing mouse open reading frames (ORFs) for Ascl1 or Brn2 or a combination of Ascl1 and Brn2 with or without short hairpin RNA (shRNA) targeting REST or miRNA loops for miR-9/9* and miR-124 in a third-generation lentiviral vector containing a non-regulated ubiquitous phosphoglycerate kinase (PGK) promoter were generated. For electrophysiological recordings in vivo, a vector expressing GFP under the control of the neuron specific Synapsin promoter was generated and cells were transduced at a multiplicity of infection (MOI) of 5 on day 0. All the constructs have been verified by sequencing. Lentiviral vectors were produced using standard techniques and titrated by quantitative PCR (qPCR) analysis. Unless otherwise stated, transduction was performed at a MOI of 10 for separate vectors and MOI 20 for the single vector (all viruses used in this study tittered between 310.sup.8 and 610.sup.9).

Neural Reprogramming

[0184] For direct neural reprogramming, fibroblasts were plated at a density of 27 800 cells per cm.sup.2 in 24-well plates (Nunc) coated with 0.1% gelatin (Sigma). Three days after viral transduction, fibroblast medium was replaced by neural differentiation medium (NDiff227; Takara-Clontech) supplemented with growth factors at the following concentrations: LM-22A4 (2 M, R&D Systems), GDNF (2 ng/mL, R&D Systems), NT3 (10 ng/L, R&D Systems) and db-cAMP (0.5 mM, Sigma) and the small molecules CHIR99021 (2 M, Axon), SB-431542 (10 M, Axon), noggin (0.5 g/ml, R&D Systems), LDN-193189 (0.5 M, Axon), as well as valproic acid sodium salt (VPA; 1 mM, Merck Millipore). Half of the neuronal conversion medium was replaced every 2-3 days. Cells were replated onto a combination of polyornithine (15 g/mL), fibronectin (0.5 ng/L) and laminin (5 g/mL) coated 24-well plates at day 12 post-transduction. 18 days post-transduction, the small molecules were stopped and the neuronal medium was supplemented with only the growth factors (LM-22A4, GDNF, NT3 and db-cAMP) until the end of the experiment.

microRNA Knockdown Experiment

[0185] Eight tandem repeats of an imperfectly complementary sequence, forming a central bulge when binding to miR-9 and miR-124 (knock down sponge sequence), were synthesized and cloned into a third-generation lentiviral vector under a PGK promoter. The sponge sequences were as follow: miR-9 TATCATACAGCTACGACCAAAGACG (SEQ ID NO: 5) and miR-124 TGGCATTCATACGTGCCTTAA (SEQ ID NO: 6). Adult dermal fibroblasts were transduced with lentiviral vectors containing pgk.Brn2a.pgk.Ascl1 (pB.pA), REST shRNA (all MOI=10) and either mCherry.mir-9.sp and GFP.mir-124.sp or control vectors containing the reporter gene only (mCherry or GFP) (All MOI=5). Cells were transduced again weekly with the mCherry.mir-9.sp, GFP.mir-124.sp, mCherry or GFP and triplicates of each conditions were analyzed at 25 days post-transduction with the reprogramming factors. Average fluorescence intensity analysis was performed on GFP.sup.+ or mCherry.sup.+ cells.

Immunocytochemistry, Imaging and High Content Screening Quantifications

[0186] Cells were fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton-X-100 in 0.1 M PBS for 10 min. Thereafter, cells were blocked for 30 min in a solution containing 5% normal serum in 0.1 M PBS. The following primary antibodies were diluted in the blocking solution and applied overnight at 4 C.: mouse anti-ASCL1 (1:100, BD Biosciences), goat anti-BRN2 (1:500, Santa Cruz Biotechnology), rabbit anti-MAP2 (1:500, Millipore), mouse anti-MAP2 (1:500, Sigma), mouse anti-NEUN (1:100, Millipore), rabbit anti-SYNAPSIN I (1:200, Calbiochem), mouse anti-TAU clone HT7 (1:500, Thermo Scientific) and rabbit anti-TUJ1 (1:500, Covance). Fluorophore-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) were diluted in blocking solution and applied for 2 hrs. Cells were counterstained with DAPI for 15 min followed by three washes in PBS. The total number of DAPI.sup.+, MAP2.sup.+ and TAU.sup.+ cells per well as well as the average fluorescence intensity for ASCL1, BRN2 and TAU were quantified using the Cellomics Array Scan (Array Scan VTI, Thermo Fischer). Applying the program Target Activation, 289 fields (10 magnification) were acquired in a spiral fashion starting from the center. The same array was used for the analysis of the number of neurites per TAU.sup.+ cells using the program Neuronal Profiling. Neuronal purity was calculated as the number of MAP2.sup.+ or TAU.sup.+ over the total number of cells in the well at the end of the experiment, whereas conversion efficiency was calculated as the number of TAU.sup.+ over the total number of fibroblasts plated for reprogramming.

Fluorescence Activated Cell Sorting

[0187] For qRT-PCR analysis of neuronal gene expression, reprogrammed cells were detached from cultureware with Accutase (PAA Laboratories), gently triturated and washed with washing buffer containing Hank's balanced salt solution (GIBCO) with 1% bovine serum albumin and DNAse. Fibroblasts were either directly used for sorting according to GFP expression or incubated in washing buffer containing a mouse anti-human NCAM antibody labeled with APC (1:50 for fetal fibroblasts or 1:10 for adult fibroblasts, BD Biosciences) for 15 min at 4 C. The cells were sorted using a FACSAria III cell sorter according to human NCAM (Neural cell adhesion molecule 1) expression gated against unstained converted iNs.

qRT-PCR Analysis for miR-9, miR-124 and RE1-Silencing Transcription Factor

[0188] Total RNA, including miRNA, was extracted from human fibroblasts as well as NCAM.sup.+ sorted converted fibroblasts from the same lines using the micro miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas, for RNA analysis; Exiqon for miRNA expression). Three reference genes were used for each qPCR analysis (ACTB, GAPDH and HPRT1). LNA-PCR primer sets, specific for hsa-miR-9-5p, hsa-miR-124-3p and hsa-miR-103 (the latter used as normalization miRNA), were purchased from Exiqon and used for the miRNA qPCR analysis. All primers were used together with LightCycler 480 SYBR Green I Master (Roche). Standard procedures of qRT-PCR were used, and data quantified using the Ct-method. Statistical analyses were performed on triplicates from each groups.

RNA-Seq Analysis

[0189] Fibroblasts were transduced with the different lentiviral vectors (pB.pA or pB.mir9/124.pA+/RESTi) and both untransduced fibroblasts and fibroblasts transduced only with REST shRNA were used as controls (CTR). Cells were collected 5 days after transduction. RNA was extracted using RNAeasy mini kit (Qiagen) with DNase treatment and sent for RNA-seq to UCLA Clinical Microarray Core. cDNA libraries were prepared using the KAPA Stranded mRNA-Seq Kit from KAPAbiosystems. The 50-bp single-end reads from the Illumina HiSeq 2000 were mapped to the human genome assembly (GRCh38) using STAR (2.4.0j) with default parameters. mRNA expression was quantified using the subread package FeatureCounts quantifying to NCBI annotation (GRCh38). Read counts were normalized to the total number of reads mapping to the genome. Clustering and differential expression analysis was done with DESeq2. Downstream analyses were performed using in-house R and unix scripts. Gene ontology analysis was done with the Functional Annotation Tool of DAVID Bioinformatic Resources 6.7. To get a list of uniquely up-regulated genes in the gene ontology analysis BH-corrected p-values<0.001 were used to get the genes strongly up-regulated in one group (fetal fibroblasts+pB.pA and pB.pA+RESTi), while genes with p-value <0.05 in the other group (adult fibroblasts+pB.pA and pB.mir9/124.pA) were removed from the gene list. This ensured that no genes that showed a strong trend for up-regulation were classified as not up-regulated. For the principal component analysis (PCA) one of the pB.pA+RESTi triplicate clustered with the pB.pA group which is most likely due to lack of co-expression of pB.pA and REST shRNA as they are delivered on separate vectors. This group was excluded from further analysis.

Transplantation

[0190] Adult fibroblasts were first transduced with Syn-GFP and then lentiviral vectors containing pB.pA, REST shRNAs. Cells were prepared for transplantation 3 days past initiation of neural conversion and transplanted to the striatum of neonatal rats (p1) under Fentanyl-Dormitor anesthesia using a 5-L Hamilton syringe fitted with a glass capillary (outer diameter 60-80 m). The rats received a 1 L injection of 200 000 cells through one needle penetration. After injection, the syringe was left in place for 2 min before being retracted slowly.

Electrophysiology

[0191] In vitro patch-clamp electrophysiology was performed on iNs reprogrammed from adult dermal fibroblasts on coverslips and co-cultured with glia between day 85 and 100 post-transduction. Cells were recorded in a Krebs solution composed of (in mM): 119 NaCl, 2.5 KCl, 1.3 MgSO.sub.4, 2.5 CaCl.sub.2, 25 Glucose and 26 NaHCO.sub.3. Cells (n=20) with a neuronal morphology as evidenced by them possessing a round cell body, processes and expressing GFP under the control of the synapsin promoter (co-transduced with the reprogramming factors) were patched for whole-cell recordings.

[0192] For recordings on slices, coronal brain slices from transplanted rats were prepared at 8 weeks post-conversion. Rats were killed by an overdose of pentobarbital and the brains were rapidly removed and cut coronally on a vibratome at 275 m. Slices were transferred to a recording chamber and submerged in a continuously flowing Krebs solution gassed with 95% 02 and 5% CO.sub.2 at 28 C. The composition of the Krebs solution for slice recording was (in mM): 126 NaCl, 2.5 KCl, 1.2 NaH.sub.2PO.sub.4H.sub.2O, 1.3 MgCl.sub.2-6H.sub.2O, and 2.4 CaCl.sub.2.6H.sub.2O. Converted cells were identified by their GFP fluorescence and patched (n=8 in total).

[0193] Recordings were made using Multi-clamp 700B (Molecular Devices), and signals were acquired at 10 kHz using pClamp10 software and a data acquisition unit (Digidata 1440A, Molecular Devices). Borosilicate glass pipettes (3-7M) for patching were filled with the following intracellular solution (in mM): 122.5 potassium gluconate, 12.5 KCl, 0.2 EGTA, 10 Hepes, 2 MgATP, 0.3 Na.sub.3GTP and 8 NaCl and adjusted to pH 7.3 with KOH as in (29). Resting membrane potentials were monitored immediately after breaking into the cell, in current-clamp mode. In cultures, cells were kept at a membrane potential of 60 mV to 80 mV, and 500 ms currents were injected from 20 pA to +90 pA using 10 pA increments to induce action potentials. For slices, action potentials were induced with a 500 ms current injected from 100 pA to +400 pA with 50 pA increments. Spontaneous postsynaptic activity was recorded in current-clamp mode at resting membrane potentials using 0.1 kHz Lowpass filter.

Statistical Analysis

[0194] All data are expressed as meanthe standard error of the mean. Statistical analyses were conducted using the GraphPad Prism 7.0. An alpha level of p<0.05 was set for significance. Groups were compared using a one-way ANOVA with a Bonferroni post hoc or Student t test in case of only two groups.

EMBODIMENTS OF THE INVENTION

[0195] 1. A gene expression system comprising
a. A first nucleotide sequence encoding a peptide of Ascl1
b. A second nucleotide sequence encoding a peptide of Brn2
c. A third nucleotide sequence of at least one nucleotide sequence encoding a REST-silencing sequence, such as short hairpin REST sequences suppressing REST-expression
2. According to embodiment 1 where the expression system is a lentiviral vector or any suitable vector system
3. According to any of embodiments above where the nucleotide sequences to be expressed is under the control of a constitutive promoter, such as an PGK promoter or a regulatable promoter
4. According to any of embodiments above where nucleotide sequences of Ascl1 and Brn2 are cloned into the same vector
5. According to any of embodiments above where Ascl1 and Brn2 is cloned to be transcribed into a single transcript (e.g. bicistronic)
6. According to any of the embodiments above the conversion genes were placed in a different order and distance from the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE) (FIG. 1a)
7. According to any of embodiments above where the order of the first and second nucleotide sequence are pgk.Brn2.pgk.Ascl1 (pB.pA)
8. According to any of embodiments above where gene expression system is comprised in a single vector
9. An mammalian cell transformed/transduced/transfected with the gene expression system of embodiments 1 to 8
10. The mammalian cell of embodiment 9 is a human cell
11. The mammalian cell of embodiment 9 or 10 is a mature cell type cultured to primary fibroblasts
12. The cell of embodiment 9 to 11 is cultured until converted into a post-mitotic neuron directly
13. The cell of embodiments 9 to 12 where the cell is derived from a biopsy sample obtained from an individual animal, such as a human
14. The cell of embodiment 13 where the biopsy sample comprises fibroblasts such as a skin punch biopsy or lung biopsy
15. According to embodiments 9 to 14 where the biopsy sample obtained from an individual with various neurodegenerative disorders, in particular individuals with a history of Familial or sporadic Alzheimer's disease; Familial or sporadic Parkinson's disease; Huntington's disease; or from healthy individuals
16. A method of inducing neurons directly from fibroblast cells comprising the step of transducing said fibroblast cell with the gene expression system of embodiments 1 to 8
17. A method of screening for compounds altering disease related biomarkers comprising the steps of culturing cells of either one of embodiments 9 to 15 comprising the steps of
a. Expose said cells, e.g. induced neurons (iNs) to at least one chemical compound to be tested
b. Register measured levels of a selection of at least one disease related biomarker or intracellular marker
c. Compare the registered measured levels in b. with one or more reference levels
d. Select for compounds altering disease related biomarkers or intracellular markers
18. A method for detecting the presence, progression or early stage onset/development of an age related neurological clinical condition in an individual comprising
a. transduce fibroblasts in a biopsy sample obtained from an individual being investigated, with the gene expression system of embodiments 1 to 7
b. Register measured levels of any potential disease-associated phenotypes or biomarkers in these cells at the stage of induced neuron
c. Compare the registered measured levels in b. with one or more reference levels
d. Stratifying samples based on their correlation to the reference levels in c. as indicative of the absence, the presence, progression or early stage onset/development of an age related neurological clinical condition
19. According to embodiment 18 where the age related neurological clinical condition in an individual is selected from the group comprising Familial and sporadic Alzheimer's disease; Familial and sporadic Parkinson's disease; Huntington's disease
20. Kit of parts for inducing neurons in an animal fibroblast cell, such as a human fibroblast cell comprising
a. An expression vector system according to embodiments 1 to 7
21. Use of either of the embodiments above in diagnostics or for the preparation of biological cells, tissue in cell therapy or for preparing cells or tissue for gene therapy

Paragraphs of the InventionI

[0196] 1. A gene expression system comprising
a. A first nucleotide sequence encoding a peptide of Ascl1
b. A second nucleotide sequence encoding a peptide of Brn2
c. A third nucleotide sequence of at least one nucleotide sequence encoding a REST-silencing sequence, such as short hairpin REST sequences suppressing REST-expression
2. According to paragraph 1 where the expression system is a lentiviral vector or any suitable vector system
3. According to any of paragraphs above where the order of the first and second nucleotide sequence are pgk.Brn2.pgk.Ascl1 (pB.pA)
4. According to any of paragraphs above where gene expression system is comprised in a single vector
5. An mammalian cell transduced with the gene expression system of paragraphs 1 to 4
6. The mammalian cell of paragraph 5 is a human cell
7. A method of inducing neurons directly from fibroblast cells comprising the step of transducing said fibroblast cell with the gene expression system of paragraphs 1 to 4
8. A method of screening for compounds altering disease related biomarkers comprising the steps of culturing cells of either one of paragraphs 5 to 7 comprising the steps of
a. Expose said cells, e.g. induced neurons (iNs) to at least one chemical compound to be tested
b. Register measured levels of a selection of at least one disease related biomarker or intracellular marker
c. Compare the registered measured levels in b. with one or more reference levels
d. Select for compounds altering disease related biomarkers or intracellular markers
9. A method for detecting the presence, progression or early stage onset/development of an age related neurological clinical condition in an individual comprising
a. transduce fibroblasts in a biopsy sample obtained from an individual being investigated, with the gene expression system of paragraphs 1 to 4
b. Register measured levels of any potential disease-associated phenotypes or biomarkers in these cells at the stage of induced neuron
c. Compare the registered measured levels in b. with one or more reference levels
d. Stratifying samples based on their correlation to the reference levels in c. as indicative of the absence, the presence, progression or early stage onset/development of an age related neurological clinical condition
10. Use of any of the paragraphs above in diagnostics or for the preparation of biological material, cells or tissue in cell therapy or for preparing cells or tissue for gene therapy

Paragraphs of the InventionII

[0197] 1. A gene expression system comprising
a. at least one nucleotide sequence encoding a neuronal conversion factor; and
b. at least one nucleotide sequence encoding a REST-silencing sequence capable of suppressing REST-expression.
2. A gene expression system according to paragraph 1 comprising
a. (i) a nucleotide sequence encoding Ascl1; [0198] (ii) a nucleotide sequence encoding Brn2; and
b. at least one nucleotide sequence encoding a REST-silencing sequence capable of suppressing REST-expression.
3. A gene expression system according to paragraph 2, wherein the nucleotide sequences of (a) (i) and (a) (ii) are comprised in a single vector.
4. A gene expression system according to any of paragraphs 1-3, wherein the nucleotide sequences of (a) and (b) are comprised in a single vector.
5. A gene expression system according to any of paragraphs 1-4, wherein the expression system is a lentiviral vector.
6. A gene expression system according to any of paragraphs 1-5, wherein the nucleotide sequences of (a), e.g. the nucleotide sequences of (a) (i) and (a) (ii), are configured such that they are transcribed into a single transcript (e.g. bicistronic).
7. A gene expression system according to any of paragraphs 1-6 wherein the nucleotide sequences are under the control of a constitutive promoter such as a PGK promoter or under the control of a regulatable promoter such as a doxycycline regulatable promoter.
8. A gene expression system according to any one of paragraphs 2-7 wherein the order of the nucleotide sequences of (a) (i) and (a) (ii) is pBrn2.pAscl1, optionally wherein the promoter is PGK and the order is pgk.Brn2.pgk.Ascl1 (pB.pA).
9. A gene expression system according to any one of paragraphs 1-8, wherein the gene expression system further comprises a transcriptional regulatory element such as a Woodchuck Heptatitis Virus Posttranscriptional Regulatory Element (WPRE).
10. A gene expression system according to any one of paragraphs 1-9, wherein the REST-silencing sequence is selected from the group consisting of shRNA, siRNA and miRNA.
11. A cell comprising the gene expression system of paragraphs 1 to 10, optionally wherein the host cell is mammalian.cell.
12. The cell of paragraph 11 which is a human cell
13. The cell of paragraph 11 or 12, wherein the cell is a primary fibroblast that has been cultured from a mature cell type.
14. The cell of any one of paragraphs 11-13, wherein the cell is derived from a biopsy sample obtained from an animal such as a human.
15. The cell of paragraph 14, wherein the biopsy sample comprises fibroblasts, such as a skin punch biopsy or a lung biopsy.
16. The cell of paragraph 14 or 15 wherein the biopsy sample is obtained from an individual with a neurodegenerative disorder, optionally wherein the neurodegenerative disorder is familial or sporadic Alzheimer's disease or familial or sporadic Parkinson's disease, or Huntington's disease; or wherein the biopsy sample is obtained from a healthy individual.
17. The cell of any one of paragraphs 11-16, wherein following introduction of the gene expression system, the cell has been cultured until converted into an induced neuron directly.
18. The cell according to paragraph 17, wherein the cell was passaged at least 3 times before introduction of the gene expression system.
19. A method of inducing neurons directly from somatic cells (eg fibroblast cells) comprising the step of introducing the gene expression system of paragraphs 1 to 10 into a somatic cell (eg fibroblast cell).
20. A method according to paragraph 19, wherein the gene expression system is introduced into the somatic cell (eg fibroblast cell) by transduction.
21. A method of paragraph 19 or 20, wherein following introduction of the gene expression system into the somatic cell (eg fibroblast cell), the cells are cultured in a neural differentiation medium, such as NDiff227.
22. A method according to paragraph 21, wherein the neural differentiation medium is supplemented with one or more growth factors, optionally wherein the one or more growth factors are selected from LM-22A4, GDNF, NT3 and db-cAMP.
23. A method according to paragraph 21 or 22, wherein the neural differentiation medium is supplemented with one or more small molecules, optionally wherein the one or more small molecules are selected from CHIR99021, SB-431542, noggin, LDN-193189 and valproic acid sodium salt.
24. A method according to any of paragraphs 19-23, wherein the method further comprises assessing the cell for one or more neuronal characteristics, optionally by at least one method selected from immunocytochemistry, fluorescence activated cell sorting, and electrophysiology.
25. An induced neuron cell obtainable by carrying out the method of any one of paragraphs 19-24.
26. A neuronal cell according to paragraph 25, wherein the cell was passaged at least
3 times, or wherein the cell was passaged up to 50 times before introduction of the gene expression system.
27. Use of a gene expression system according to any one of paragraphs 1-10, or a cell as defined in any one of paragraphs 11-18, 25 and 26 in disease modelling, or in diagnostics or in drug screening.
28. A gene expression system according to any one of paragraphs 1-10 or a cell as defined in any one of paragraphs 11-18, 25 and 26 for use in medicine.
29. A gene expression system according to any one of paragraphs 1-10 or a cell as defined in any one of paragraphs 11-18, 25 and 26 for use in diagnostics, or cell therapy or gene therapy.
30. A pharmaceutical composition comprising a gene expression system according to any one of paragraphs 1-10 or a cell as defined in any one of paragraphs 11-18, 25 and
26, and a pharmaceutically acceptable carrier.
31. A method of screening for a compound that alters at least one disease related biomarker, the method comprising
a. exposing an induced neuron as defined in any one of paragraphs 17, 18, 25 and
26 to at least one chemical compound to be tested
b. registering the level of at least one disease related biomarker
c. comparing the registered level of at least one disease related biomarker in b. with one or more reference levels; and
d. selecting at least one compound that alters the level of at least one disease related biomarker with the one or more reference levels.
32. A method according to paragraph 31, wherein the disease related biomarker is a biomarker of a neurological disorder, such as any of Alzheimer's disease, Parkinson's disease or Huntington's disease.
33. A method for detecting the presence, progression or early stage onset/development of an age related neurological clinical condition in an individual comprising
a. introducing the gene expression system of any one of paragraphs 1 to 10 into fibroblasts in a biopsy sample obtained from the individual;
b. registering the level of at least one potential disease-associated phenotype or biomarker in these cells at the stage of induced neuron
c. comparing the registered level of at least one potential disease-associated phenotype or biomarker in b. with one or more reference levels; and
d. stratifying the sample based on the correlation to the reference levels in c. as indicative of the absence, the presence, progression or early stage onset/development of an age related neurological clinical condition.
34. A method according to paragraph 33, wherein the potential disease-associated phenotype or biomarker is a potential neurological disease-associated phenotype or biomarker. such as any of Alzheimer's disease, Parkinson's disease or Huntington's disease.
35. A method according to paragraph 33 or 34 wherein the age related neurological clinical condition in an individual is selected from the group comprising Familial and sporadic Alzheimer's disease; Familial and sporadic Parkinson's disease; Huntington's disease.
36. Use of RESTi in directly converting a fibroblast into an induced neuron.
37. A method of directly converting a fibroblast into an induced neuron comprising contacting the fibroblast with a REST inhibitor.