METHOD OF PRODUCING NANOPARTICLE DEVICE USING PRINT-ON HYDROGEL

Abstract

Provided are a method of producing a nanoparticle device and a nanoparticle device. The method of producing a nanoparticle device may be economical due to use of a hydrogel, may be easy to design in terms of mass production processes, and may reduce manufacturing times to 1/100 to 1/10 of the technology of the related art. In addition, a nanoparticle device may be produced in various designs by stably realizing a 3D pattern and pattern stacking, and may have highly uniform nanoparticle dispersion and excellent electrical activity through the removal of a surfactant without damaging the pattern. The nanoparticle device produced according to the production method may have excellent electrical activity due to nanoparticle uniformity pattern accuracy and thus may be applied to pattern stacking which could not be implemented by methods of the related art.

Claims

1. A method of producing a nanoparticle device, the method comprising: printing a colloidal composition on a hydrogel in a pattern, the colloidal composition comprising nanoparticles and a surfactant; and forming a nanoparticle device by removing the surfactant comprised in the colloidal composition through pores inside the hydrogel.

2. The method of claim 1, wherein the surfactant is sodium cholate, sodium dodecyl sulfate, sodium deoxycholate, Nonidet P-40, Triton X-100, Tween 20, polyethylene glycol 600, sodium lauryl sulfate, ammonium-oleate, cetyltrimethyl ammonium bromide, hydrolyzed tetraethyl orthosilicate, or any mixture thereof.

3. The method of claim 2, wherein the surfactant is sodium-cholate.

4. The method of claim 1, wherein the nanoparticles are graphene, highly oriented pyrolytic graphite (HOPG), graphene oxide, reduced graphene oxide, single-walled carbon nanotubes, double-walled carbon nanotubes, multi-walled carbon nanotubes, fullerene, metal nanowires, silver nanoparticles, platinum nanoparticles, gold nanoparticles, metal nanobeads, magnetic nanoparticles, silicon oxide, tungsten oxide, zinc oxide, neodymium oxide, titanium oxide, cerium oxide, iron oxide, boron nitride, titanium nitride, molybdenum disulfide (MoS.sub.2), tungsten disulfide (WS.sub.2), or any mixture thereof.

5. The method of claim 4, wherein the nanoparticles are graphene, single-walled carbon nanotubes, or any mixture thereof.

6. The method of claim 1, wherein the hydrogel is agarose gel, collagen, dextran, methyl cellulose, hyaluronic acid, polyethylene oxide, polyvinyl pyrrolidone, polyvinyl alcohol, sodium polyacrylate, acrylate polymer, acrylamide polymer, methacrylate polymer, or any mixture thereof.

7. The method of claim 1, wherein the pores inside the hydrogel have a diameter of 1 nm to 10 m.

8. The method of claim 7, wherein the hydrogel is 0.1 wt % to 10 wt % agarose gel.

9. The method of claim 7, wherein the hydrogel is 0.1 wt % to 25 wt % acrylamide polymer.

10. The method of claim 1, wherein the composition further comprises a peptide having the ability to bind to a carbonaceous material or a phage displaying a peptide having the ability to bind to a carbonaceous material.

11. The method of claim 10, wherein the phage is M13 phage, F1 phage, Fd phage, If1 phage, Ike phage, Zj/Z phage, Ff phage, Xf phage, Pf1 phage, or Pf3 phage, each being genetically engineered to have the ability to bind to nanoparticles.

12. The method of claim 10, wherein the peptide has at least one amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 12.

13. The method of claim 1, wherein the pattern is a one-dimensional pattern, a two-dimensional pattern, a three-dimensional pattern, or any mixed pattern thereof.

14. The method of claim 1, wherein the printing of the colloidal composition in the pattern is performed by repeating, twice to 20 times, printing of the same colloidal composition or different colloidal compositions in multiple layers.

15. The method of claim 1, further comprising transferring the nanoparticle device formed on the hydrogel to a substrate.

16. The method of claim 15, wherein the transferring of the nanoparticle device to the substrate is performed by contacting the substrate with an upper surface of the hydrogel.

17. The method of claim 15, wherein the transferring of the nanoparticle device to the substrate is performed by pouring a solution capable of hardening onto the upper surface of the hydrogel, allowing the solution to harden, and then detaching the hardened solution from the hydrogel.

18. The method of claim 15, wherein the transferring of the nanoparticle device to the substrate comprises: separating the nanoparticle device from the hydrogel by adding a liquid in which the nanoparticle device formed on the hydrogel is able to float; and transferring the nanoparticle device to the substrate by contacting the substrate with a surface of the floating nanoparticle device facing the hydrogel.

19. The method of claim 18, wherein a multi-layer is formed by stacking another functional layer onto the composition or immobilizing an enzyme onto the composition, and the multi-layer is transferred to the substrate with the stacking order maintained.

20. The method of claim 1, wherein the nanoparticle device is a flexible electrode device, a transparent electrode device, a biosensor device, a strain sensor device, a pressure sensor device, a memory device, a logic device, an energy device, or an electrochemical device.

21. A composition for removing a surfactant dispersed in a nanoparticle aqueous solution, the composition comprising a hydrogel having pores with a diameter of 1 nm to 10 m.

22. A nanoparticle device produced according to the method of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0045] The above and other aspects, features, and advantages of certain embodiments of the disclosure will be more apparent from the following description taken in conjunction with the accompanying drawings, in which:

[0046] FIG. 1 shows a flowchart of a method of preparing a nanoparticle device according to an embodiment;

[0047] FIG. 2 is a diagram illustrating a process of removing a surfactant (102) included in a colloidal composition through pores (103) of a hydrogel (104) after the colloidal composition is printed onto the hydrogel (104) in a flat pattern (101);

[0048] FIG. 3 is a diagram illustrating a nanoparticle device prepared by printing a complex pattern (101) onto a hydrogel (104);

[0049] FIG. 4 is a diagram illustrating a 3D pattern formed by uniformly printing a pattern (101) onto a 3D hydrogel (104);

[0050] FIG. 5 is a flowchart of a method of producing a nanoparticle device according to the present disclosure, including transferring the nanoparticle device to a substrate by contacting the substrate with an upper surface of a hydrogel;

[0051] FIG. 6 is a diagram illustrating a nanoparticle device prepared by printing a double-layered pattern (101, 106) onto a hydrogel (104) and transferring the pattern to a final substrate (105) while upside-down by contacting the substrate (105) with an upper surface of the hydrogel;

[0052] FIG. 7 is a flowchart of a method of producing a nanoparticle device according to the present disclosure, including molding transfer by which a solution to be hardened is poured onto a hydrogel and the hardened solution is detached therefrom;

[0053] FIG. 8 is a flowchart of a method of producing a nanoparticle device according to the present disclosure, including multi-stacking;

[0054] FIG. 9 is a diagram illustrating a nanoparticle device produced in a triple layered structure (101, 106, 107) by repeating printing three times;

[0055] FIG. 10 is a flowchart of a method of producing a nanoparticle device according to the present disclosure, including floating transferring;

[0056] FIG. 11 is a diagram illustrating a floating transfer method by which a pattern is transferred from a hydrogel (104) to a final substrate (105) with a stacking order maintained;

[0057] FIG. 12 shows an image of an agarose-based hydrogel prepared according to an embodiment.

[0058] FIG. 13 shows an image of an acrylamide-based hydrogel prepared according to an embodiment.

[0059] FIG. 14 shows images of ejected ink solutions for printing, which are colloidal compositions (Preparation Examples 3 to 5);

[0060] FIG. 15 shows images of microstructures in which mono-layered, double-layered, and triple-layered circular patterns are formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto an agarose-based hydrogel according to an embodiment, observed through an optical microscope;

[0061] FIG. 16 shows an image of a microstructure in which a penta-layered line pattern is formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto a hydrogel according to another embodiment, observed through an optical microscope;

[0062] FIG. 17 shows an exemplary image of a triple-layered circular pattern formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto an acrylamide-based hydrogel according to an embodiment;

[0063] FIG. 18 shows images of square mono-layered, double-layered, and triple-layered square patterns formed by printing an ink solution (Preparation Example 5), which is a colloidal composition, onto an agarose-based hydrogel, and transferred to a quartz substrate according to another embodiment;

[0064] FIG. 19 shows an image of a penta-layered line pattern formed by printing an ink solution (Preparation Example 4), which is a colloidal composition, onto an agarose-based hydrogel, and contact transferred to a PET substrate according to another embodiment;

[0065] FIG. 20 shows images of a triple-layered circular pattern formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto an acrylamide-based hydrogel, and transferred to a quartz substrate according to an embodiment;

[0066] FIG. 21 shows images of a triple-layered circular pattern formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto an acrylamide-based hydrogel, and molding transferred by pouring a PDMS solution and hardening the solution according to an embodiment;

[0067] FIG. 22 shows images a mono-layered square pattern formed by printing an ink solution (Preparation Example 3), which is a colloidal composition, onto a hydrogel, and immersed in and floated in water for transfer thereof according to an embodiment;

[0068] FIG. 23 shows images of a triple-layered circular pattern formed by printing an ink solution (Preparation Example 4) according to an embodiment, which is a colloidal composition, onto a hydrogel, and stamp transferred to a commercial electrode (Dropsense, BT250) by directly contacting a final substrate with the pattern;

[0069] FIG. 24 shows an image of an enzyme electrode formed by printing a colloidal composition, a polymer electrolyte, and an enzyme onto an agarose-based hydrogel, and floating transferred to a commercial electrode;

[0070] FIG. 25 is a graph illustrating sheet resistance of a transparent electrode prepared by printing an ink solution (Preparation Example 5), which is a colloidal composition, onto a hydrogel in a penta-layered or deca-layered structure and contact transferring the printed pattern to a quartz substrate according to an embodiment;

[0071] FIG. 26 is a graph illustrating transmittance of a transparent electrode prepared by printing an ink solution (Preparation Example 5), which is a colloidal composition, onto a hydrogel, in a penta-layered or deca-layered structure and stamp transferring the printed pattern to a quartz substrate according to an embodiment;

[0072] FIG. 27 is a graph illustrating direct-electron-transfer (DET) peaks of a glucose sensor (Preparation Example 11) including a nanoparticle device according to an embodiment;

[0073] FIG. 28 is a graph illustrating redox curves of a glucose sensor (Preparation Example 11) including a nanoparticle device according to an embodiment, with respect to glucose concentration;

[0074] FIG. 29 is a graph illustrating changes of reduction current peaks of a glucose sensor (Preparation Example 11) including a nanoparticle device according to an embodiment, with respect to glucose concentration;

[0075] FIG. 30 is a graph illustrating real-time monitoring characteristics of a glucose sensor (Preparation Example 11) according to an embodiment, and selectivity for uric acid;

[0076] FIG. 31 is a graph illustrating sensitivity of real-time monitoring characteristics of a glucose sensor (Preparation Example 11) according to an embodiment;

[0077] FIG. 32 is a graph illustrating redox curves of an all-printed enzyme electrode (Preparation Example 12) according to an embodiment, with respect to glucose concentration;

[0078] FIG. 33 is a graph illustrating changes of reduction current peaks of an all-printed enzyme electrode (Preparation Example 12) according to an embodiment, with respect to glucose concentration;

[0079] FIG. 34 is a graph illustrating selectivity for glucose of an all-printed enzyme electrode (Preparation Example 12) according to an embodiment;

[0080] FIG. 35 shows an image of a serpentine pattern formed by printing an ink composition (Preparation Example 3), which is a colloidal composition, onto an agarose-based hydrogel, and contact transferred to a polymer glove to produce a strain sensor device according to an embodiment; and

[0081] FIG. 36 is a graph illustrating changes of resistance of a nanoparticle device formed on a polymer glove according to an embodiment, with respect to various hand motions.

DETAILED DESCRIPTION

[0082] A method of producing a nanoparticle device according to the present disclosure may be economical by using a hydrogel, may be easy to design a mass production process, and may reduce manufacturing time to 1/100 to 1/10 of conventional technology. In addition, a nanoparticle device may be produced in various designs by stably realizing a 3D pattern and stacking a pattern and may have excellent uniformity of nanoparticles and excellent electrical activity by removing a surfactant without damaging the pattern.

[0083] The nanoparticle device according to the present disclosure may have excellent homogeneity, high binding affinity and excellent electrical activity due to accuracy of a pattern and may be applied to stacking of pattern which could not be implemented by conventional methods.

[0084] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, these examples are for illustrative purposes only, and the present disclosure is not intended to be limited by these examples.

PREPARATION EXAMPLES

Preparation Example 1_Preparation of Agarose-based Hydrogel

[0085] According to an embodiment of the present disclosure, an agarose-based hydrogel was prepared according to the following method.

[0086] A homogenous agarose aqueous solution was prepared at a concentration of 0.8 wt % to 20 wt % using a microwave oven. The solution was cooled to a temperature of 60 C. or less by storing the solution at room temperature, and then poured into a mold and maintained at room temperature for 3 hours or more for hardening. The hydrogel prepared in this manner is shown in FIG. 12.

Preparation Example 2_Preparation of Acrylamide-based Hydrogel

[0087] According to an embodiment of the present disclosure, an acrylamide-based hydrogel was prepared according to the following method.

[0088] As a raw material, an acrylamide/bisacrylamide aqueous solution was prepared at a ratio of 19:1 to 37.5:1. Water was added thereto to prepare an aqueous solution at a concentration of 0.1% to 25% based on acrylamide. 10% ammonium persulfate solution was prepared as a hardener. After mixing the acrylamide/bisacrylamide aqueous solution and the ammonium persulfate solution, both prepared as described above, tetramethylethylenediamine, as a catalyst, was added to the mixture and mixed. The mixture was poured into a mold and maintained at room temperature for 30 minutes or more for hardening. The acrylamide-based hydrogel prepared in this manner is shown in FIG. 13.

Preparation Example 3 Preparation of Ink Solution Including Carbonaceous Material

[0089] First, an aqueous solution was prepared by adding sodium-cholate, as a surfactant, to distilled water at a concentration of 1% or 2% w/v, and a colloidal solution was prepared by stabilizing single-walled carbon nanotubes (manufacturer: Nanointegris, SuperPure SWNTs, solution, concentration: 250 g/mL or 1000 g/mL), as a graphitic material, with the sodium-cholate by dialysis of the single-walled carbon nanotubes for 48 hours.

[0090] In this regard, assuming that an average length and an average diameter of the carbon nanotubes (CNTs) were 1 m and 1.4 nm, respectively, the number of the single-walled carbon nanotubes in the colloidal solution is calculated according to the following equation.

[00001]$\begin{array}{cc}\mathrm{Number}.Math..Math.\mathrm{of}.Math..Math.\mathrm{single}.Math.\text{-}.Math.\mathrm{walled}.Math..Math.\mathrm{carbon}.Math..Math.\mathrm{nanotubes}.Math..Math..Math.\left(\frac{\mathrm{Number}}{\mathrm{mL}}\right)=\mathrm{concentration}.Math..Math.\left(\frac{\mathrm{.Math.g}}{\mathrm{mL}}\right)3{10}^{14}.Math.\left(\frac{\mathrm{Number}}{\mathrm{.Math.g}}\right)& \mathrm{Equation}.Math..Math.1\end{array}$

[0091] According to Equation 1, the number of the single-walled carbon nanotubes included in 1000 g/ml of the colloidal solution was 310.sup.14 CNT/mL. The number of the single-walled carbon nanotubes per unit volume was adjusted using the sodium-cholate aqueous solution having the same concentration as that of the dialyzed solution.

Preparation Example 4 Preparation of Ink Solution Including Carbonaceous Material and Biomaterial

[0092] 4-1. Preparation of Biomaterial

[0093] As M13 phages having a strong binding affinity to the graphitic surface, a M13phage (GP1) displaying a peptide SWAADIP (SEQ ID NO: 7) having a strong binding affinity to the graphitic surface and a phage (GP2) displaying NPIQAVP (SEQ ID NO: 8) were prepared according to the following method.

[0094] First, an M13HK vector was prepared by site-directed mutation of the 1381.sup.st base pair C of an M13KE vector (NEB, product # N0316S, SEQ ID NO: 13) to G.

[0095] Here, the prepared M13KE vector (NEB, product # N0316S) was a cloning vector consisting of a 7222 bp DNA (Cloning vector M13KE), and genetic information thereof is available from the Internet (https://www.neb.com//media/NebUs/Page %20Images/Tools %20and %20Resource s/Interactive %20Tools/DNA %20Sequences %20and %20Maps/Text %20Documents/m13kegbk.txt). Base sequences of oligonucleotides used for the site-directed mutation are as follows:

TABLE-US-00001 (SEQIDNO:14) 5-AAGGCCGCTTTTGCGGGATCCTCACCCTCAGCAGCG AAAGA-3, and (SEQIDNO:15) 5-TCTTTCGCTGCTGAGGGTGAGGATCCCGCAAAAGCG GCCTT-3.

[0096] Phage display p8 peptide libraries were prepared from the prepared M13HK vector using restriction enzymes BspHI (NEB, product # R0517S) and BamHl (NEB, product # R3136T).

[0097] The base sequences of oligonucleotides used for the preparation of the phage display p8 peptide libraries are as follows:

TABLE-US-00002 (SEQIDNO:16) 5-TTAATGGAAACTTCCTCATGAAAAAGTCTTTAGTCC TCAAAGCCTCTGTAGCCGTTGCTACCCTCGTTCCGA TGCTGTCTTTCGCTGCTG-3, and (SEQIDNO:17) 5-AAGGCCGCTTTTGCGGGATCCNNMNNMNNMNNMNNM NNMNNMNCAGCAGCGAAAGACAGCATCGGAACGAGG GTAGCAACGGCTACAGAGGCTTT-3.

[0098] The nucleotide sequences of the prepared phage display p8 peptide libraries have a diversity of 4.810.sup.7 plaque-forming units (PFU) and each sequence has a copy number of about 1.310.sup.5. Then, the prepared phage display p8 peptide libraries were bound to a graphitic surface by biopanning to screen a phage displaying a peptide to be used as the biomaterial according to the present disclosure. The biopanning was conducted as follows.

[0099] First, a fresh surface of a highly oriented pyrolytic graphite (HOPG, SPI, product #439HP-AB) that has a graphitic surface was obtained before an experiment by attaching a tape thereto and detaching the tape therefrom to minimize defects caused by oxidation of a sample surface. In this regard, a HOPG substrate with a relatively large grain size of 100 m or smaller was used.

[0100] Then, the prepared 4.810.sup.11 (4.810.sup.7 diversities, 1000 copies per each sequence) phage display p8 peptide libraries were prepared in 100 L of Tris-buffered saline (TBS) and conjugated with the HOPG surface in a shaking incubator for 1 hour at 100 rpm. 1 hour later, the solution was removed and the HOPG surface was washed 10 times with TBS. The washed HOPG surface was reacted with pH 2.2 Tris-HCl as an acidic buffer for 8 minutes to elute non-selectively reacting peptides and then XL-1 blue E. coli culture in mid-log state was eluted for 30 minutes. A portion of the eluted culture was left for DNA sequencing and peptide identification and the remainder was amplified to prepare sub-libraries for the next round. The above procedure was repeated using the prepared sub-libraries. Meanwhile, the left plaques were subjected to DNA analysis to identify the p8 peptide sequence. As a result, the phage (GP1) displaying the peptide SWAADIP (SEQ ID NO: 7) and the phage (GP2) displaying the peptide NPIQAVP(SEQ ID NO: 8), wherein the peptides have strong ability to bind to a graphitic surface, were obtained.

[0101] 4-2. Preparation of Ink Solution Including Biomaterial

[0102] M13 phage (GP1) having a strong binding affinity to the surface of the graphitic material was dispersed in Tris-Buffered saline (TBS) at a concentration of 610.sup.13 number/mL. The colloidal solution prepared in Preparation Example 2 was mixed with the M13 phage solution at a volume ratio of 2:1 to mix the graphitic material with the M13 phage (GP1) at a molar ratio of 10:1. In this regard, the number of M13 particles included in the M13 phage solution was calculated according to the following equation. A.sub.269 nm and A.sub.320 nm indicate absorbances of the solution at wavelength of 269 nm and 320 nm, respectively.

[00002]$\begin{array}{cc}\mathrm{Number}.Math..Math.\mathrm{of}.Math..Math.M.Math..Math.13.Math..Math.\mathrm{phage}.Math..Math.\left(\mathrm{number}.Math.\text{/}.Math.\mathrm{mL}\right)=\frac{\begin{array}{c}\begin{array}{c}{A}_{269.Math.\mathrm{nm}}-\\ A_{320.Math.\mathrm{nm}}\end{array}\\ 6{10}^{17}\end{array}}{7234}& \mathrm{Equation}.Math..Math.2\end{array}$

Preparation Example 5 Preparation of Ink Solution Including Carbonaceous Material with High Aspect Ratio

[0103] Single-walled carbon nanotubes having an average length of 15 m were dispersed in a 2 wt % aqueous solution of sodium-cholate using a homogenizer. The solution was dispersed by a tip sonicator at a power of 1% for 15 minutes. The solution was centrifuged using a centrifuge at a relative centrifugal force of 90,000 g for 15 minutes, and a supernatant was extracted therefrom to prepare an ink solution including a carbonaceous nanomaterial with a high aspect ratio.

Preparation Example 6 Preparation of Pattern on Agarose-based Hydrogel by Printing Ink Solution Including Carbonaceous Material and Ink Solution Including Carbonaceous Material and Biomaterial

[0104] Each of the ink solutions prepared according to Preparation Examples 3 to 5 was printed on the hydrogel prepared in Preparation Example 1 in multiple layers to prepare an electrode for analysis of characteristics. Images of ejecting solutions are shown in FIG. 14. Subsequently, the hydrogel used as a substrate was immersed in water for 30 minutes or more to remove a surfactant and other materials used to prepare the ink solution, thereby preparing a pattern for transfer. A circular pattern prepared using the ink solution of Preparation Example 3 is shown in FIG. 15. A linear pattern prepared using the ink solution of Preparation Example 3 is shown in FIG. 16.

Preparation Example 7 Preparation of Pattern on Acrylamide-based Hydrogel by Printing Ink Solution Including Carbonaceous Material and Ink Solution Including Carbonaceous Material and Biomaterial

[0105] Each of the ink solutions prepared according to Preparation Examples 3 to 5 was printed on the hydrogel prepared in Preparation Example 2 in multiple layers to prepare an electrode for analysis of characteristics. Subsequently, the hydrogel used as a substrate was immersed in water for 30 minutes or more to remove a surfactant and other materials used to prepare the ink solution, thereby preparing a pattern for transfer. A circular pattern prepared using the ink solution of Preparation Example 3 is shown in FIG. 17.

Preparation Example 8 Preparation of Device by Contact Transfer of Pattern Prepared by Printing Process

[0106] Each of the patterns formed on the hydrogel and prepared in Preparation Examples 6 and 7 was dried at room temperature for 30 minutes to be transferred to a final substrate. After the surface was dried, the printed pattern was transferred from the hydrogel to the substrate by contacting the substrate with the dried surface of the pattern and detaching the substrate therefrom. An image of a square pattern prepared in Preparation Example 6 and transferred to a quartz substrate is shown in FIG. 18. An image of a linear pattern prepared in Preparation Example 6 and transferred to a PET substrate is shown in FIG. 19. An image of a circular pattern prepared in Preparation Example 7 and transferred to the quartz substrate is shown in FIG. 20.

Preparation Example 9 Preparation of Device by Molding Transfer Using Solution Capable of Hardening Pattern Prepared by Printing Process

[0107] Each of the ink solutions prepared according to Preparation Examples 3 to 5 was printed on the hydrogel prepared in Preparation Example 2 in multiple layers to prepare an electrode for analysis of characteristics. Subsequently, a polydimethylsiloxane solution was poured thereonto and hardened to transfer the printed pattern to a moldable polymer. An image of the pattern transferred by this method is shown in FIG. 21.

Preparation Example 10 Preparation of Device by Floating Transfer of Pattern Formed by Printing Process

[0108] The pattern formed on the hydrogel and prepared in Preparation Example 6 was dried at room temperature for 30 minutes to be transferred to a final substrate. After the surface was dried, water was added thereto until the surface was immersed in water to separate the pattern from the surface of the hydrogel. Imagers before and after the separation are shown in FIG. 22.

Preparation Example 11 Preparation of Biosensor Using Transferred Device

[0109] The ink solution prepared in Preparation Example 4 was printed on the hydrogel prepared in Preparation Example 1 by inkjet printing. The printed pattern was transferred to a commercial electrode (Manufactured by Dropsense, 250BT) according to the method described in Preparation Example 7, and an image thereof is shown in FIG. 23. After the electrode was transferred, 5 L of a 5 w/v % polyethyleneimine (PEI) aqueous solution was dropped on a working electrode of the printed electrode and dried. After drying was completed, the excess PEI was washed away using distilled water. Subsequently, 5 L of an aqueous solution of glucose oxidase (GOx) at a concentration of 100 mg/ml was additionally dropped on the working electrode and dried to prepare a 3rd-generation glucose sensor.

Preparation Example 12 Preparation of All-printed Enzyme Electrode

[0110] The ink solution prepared in Preparation Example 4 was printed on the hydrogel prepared in Preparation Example 1 by inkjet printing. The hydrogel used as a substrate was immersed in water to remove a surfactant and other materials used to prepare the ink solution. The 5 w/v % polyethyleneimine (PEI) aqueous solution was printed on the printed electrode. By immersing the hydrogel in water, PEI was attached to the electrode by charge interaction, and the excess PEI was removed through the hydrogel substrate. A 25 mg/mL GOx aqueous solution was printed on the electrode. By immersing the hydrogel in water, GOx was attached to the electrode by charge interaction, and excess GOx was removed through the hydrogel substrate. The electrode was dried at room temperature for 30 minutes to be transferred to a final substrate. After the surface was dried, water was added thereto until the surface was immersed in water to separate the prepared electrode from the surface of the hydrogel. The separated electrode was transferred to a commercial electrode and an image thereof is shown in FIG. 24.

Experimental Example

[0111] Evaluation of Electrical Characteristics of Pattern Prepared Using Ink Solution Including Carbonaceous Material with High Aspect Ratio

[0112] The ink solution prepared in Preparation Example 5 was printed 5 times or 10 times on the hydrogel prepared in Preparation Example 1 by inkjet printing. The printed pattern was contact transferred to a quartz substrate according to the method described in Preparation Example 8 to prepare a pattern for evaluation of electrical characteristics. Then, sheet resistance was measured by the van der Pauw method and the results are shown in FIG. 25.

[0113] As a result, as shown in FIG. 25, it was confirmed that sheet resistance decreases as the number of printing increases or a printing interval (p) is narrowed. That is, a low sheet resistance of 100 /sq or less may be easily obtained.

[0114] Evaluation of Optical Characteristics of Pattern Formed Using Ink Solution Including Carbonaceous Material with High Aspect Ratio

[0115] The ink solution prepared in Preparation Example 5 was printed 5 times or 10 times on the hydrogel prepared in Preparation Example 1 by inkjet printing. The printed pattern was transferred to a quartz substrate according to the method described in Preparation Example 8 to prepare a pattern for evaluation of optical characteristics. Then, absorbance was measured in a wavelength range of 230 nm to 990 nm and converted using Equation 3 below to calculate transmittance, and the results are shown in FIG. 26.

Transmittance(%)=.sup.10Absorbance(@ar 550 nm)Equation 3

[0116] Measurement of Electrochemical Activity of GOx Enzyme Electrode Prepared Using Ink Solution Including Biomaterial

[0117] A negative voltage of 0.6 V to 0.2 V was applied to the glucose sensor prepared in Preparation Example 11 in 10 mM PBS buffer (pH=7.4, 79383, Sigma Aldrich) solution at a scan rate of 200 mV/s, and the results are shown in FIG. 27.

[0118] As shown in FIG. 27, the prepared glucose sensor showed strong redox peaks in a region of about 400 mV in cyclic voltammetry (CV) with respect to an Ag/AgCl reference electrode (3 M KCl saturated, PAR, K0260). These results indicate that an FAD redox center of GOx efficiently/directly formed electric pairs with the single-walled carbon nanotubes to cause a direct-electron-transfer (DET) as shown in a reaction scheme below.

FAD+2H++2e.sup.->FADH.sub.2

[0119] Based on this reaction, it may be seen that the enzyme present in the biosensor electrode prepared using a bio-adhesive may efficiently exchange electrons directly with the electrode.

[0120] Evaluation of Reactivity, to Glucose, of GOx Enzyme Electrode Prepared Using Ink Solution Including Biomaterial

[0121] CV was performed while a voltage was applied to the glucose sensor prepared in Preparation Example 11 at a scan rate of 200 mV/s in 10 mM PBS buffer (pH=7.4, 79383, Sigma Aldrich) solution including 10 M to 500 M of glucose, and the results are shown in FIG. 28. Reduction currents were extracted in respective CV graphs and shown in FIG. 29.

[0122] As a result, as shown in FIG. 29, it was confirmed that the reduction currents increased linearly in the positive direction up to the glucose concentration of 500 M as the concentration of glucose contained in the 10 mM PBS buffer increased while applying a voltage of 0.6 V to 0.2 V thereto. A sensitivity of the glucose sensor measured as described above was about 93.7 A/mM cm.sup.2 or less. Based on the results, because the reduction current is linearly proportional to the glucose concentration with high sensitivity in a concentration range of 100 M to 500 M of glucose contained in non-invasively collectable body fluids (sweat, tear, saliva, etc.,) in the DET-based glucose sensor according to the present disclosure, the glucose sensor may be used as a DET-based 3.sup.rd-generation wearable biosensor.

[0123] Evaluation of Real-time Monitoring Characteristics and Specificity of GOx Enzyme Electrode Prepared Using Ink Solution Including Biomaterial for Glucose

[0124] After applying a voltage of 0.4 V was applied to a working electrode of the GOx enzyme-based biosensor prepared in Preparation Example 11, and current flowing from each electrode was measured. Particularly, 200 M glucose was injected 5 times in divided amounts, and 1 mM uric acid was injected twice in divided amounts. The results are shown in FIG. 30.

[0125] As a result, as shown in FIG. 30, an increase in current in a positive direction was observed in the GOx enzyme working electrode when glucose was added thereto. Changes in current with respect to glucose concentration are shown in FIG. 31. A measured sensitivity by real-time monitoring was about 52.8 pA/mM cm.sup.2 or less. On the contrary, it was confirmed that the current did not change significantly when uric acid was injected thereinto. This allowed us to evaluate the specificity of the glucose sensor. As shown in FIG. 30, the 3rd-generation biosensor including the GOx enzyme electrode prepared according to an embodiment may operate in a non-invasively collectable body fluid such as saliva, tear, and sweat because the biosensor stably operates in an environment including not only the buffer solution of the 10 mM PBS solution but also interfering substances such as uric acid.

[0126] Evaluation of Reactivity and Specificity of All-printed Enzyme Electrode to Glucose

[0127] CV was performed while a voltage was applied to the enzyme electrode prepared in Preparation Example 12 at a scan rate of 200 mV/s in 10 mM PBS buffer (pH=7.4, 79383, Sigma Aldrich) solution including 0 M to 1000 M of glucose, and the results are shown in FIG. 32. Reduction currents were extracted in respective CV graphs and shown in FIG. 33.

[0128] As a result, as shown in FIG. 33, it was confirmed that the reduction currents increased linearly in the positive direction up to the glucose concentration of 1000 M as the concentration of glucose contained in the 10 mM PBS buffer increased while applying a voltage of 0.6 V to 0 V. A sensitivity of the glucose sensor measured as described above was about 240 A/mM cm.sup.2 or less.

[0129] CV was performed while a voltage was applied to the enzyme electrode prepared in Preparation Example 12 at a scan rate of 200 mV/s in each of 10 mM PBS buffer (pH=7.4, 79383, Sigma Aldrich) solution including 0 M of glucose, 10 mM PBS buffer solution including 1000 M of glucose, and 10 mM PBS buffer solution including 1000 M of acetaminophene, and the results are shown in FIG. 34.

[0130] As a result, as shown in FIG. 34, it was confirmed that the reduction peak did not change significantly although acetaminophen was added thereto. Thus, high specificity of the enzyme electrode was confirmed.

[0131] Application of Nanoparticle Device Transferred to Polymer Glove to Produce Strain Sensor

[0132] The ink solution prepared in Preparation Example 3 was printed on the hydrogel prepared in Preparation Example 1 by inkjet printing. The printed pattern was transferred to a polymer glove according to the method described in Preparation Example 8 to prepare a nanoparticle device, and the results are shown in FIG. 35. A glove to which the nanoparticle device is transferred was worn on a hand, and changes of resistance of the nanoparticle device corresponding to each finger was measured when each of the thumb, index finger, and middle finger was bent, and the results are shown in FIG. 36.

[0133] As a result, as shown in FIG. 36, it may be seen that resistance of the device corresponding to each finger changes in accordance with various hand motions. This allows us to confirm not only diversity of the substrate to which the nanoparticle device may be transferred but also excellent properties of the nanoparticle device.