Corynebacterium glutamicum for use in producing 2′-fucosyllactose

Abstract

Disclosed are a recombinant Corynebacterium glutamicum (C. glutamicum) for producing fucosyllactose which is transformed to express -1,2-fucosyltransferase, GDP-D-mannose-4,6-dehydratase (Gmd), GDP-L-fucose synthase (WcaG) and lactose permease (LacY), wherein the Corynebacterium glutamicum has phosphomannomutase and GTP-mannose-1-phosphate guanylyltransferase, and a method for producing fucosyllactose using the same. According to the recombinant Corynebacterium glutamicum and the method for producing fucosyllactose according to the present invention, with use of a GRAS Corynebacterium glutamicum strain, which is safer than conventional Escherichia coli, 2-fucosyllactose can be produced at a high concentration while overcoming drawbacks of conventional methods associated with industrial inapplicability resulting from low production concentrations.

Claims

1. A recombinant Corynebacterium glutamicum transformed to express -1,2-fucosyltransferase, transformed to express GDP-D-mannose-4,6-dehydratase, transformed to express GDP-L-fucose synthase, and transformed to express lactose permease, wherein the recombinant Corynebacterium glutamicum has phosphomannomutase and GTP-mannose-1-phosphate guanylyltransferase, and wherein the -1,2-fucosyltransferase is encoded by fucT2 genes consisting of the nucleic acid sequence of SEQ ID NO: 6.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

(2) FIG. 1 shows a metabolic pathway to bio-synthesize GDP-L-fucose and fucosyllactose in Corynebacterium glutamicum (C. glutamicum) strain;

(3) FIG. 2 is a graph showing effects of incorporation of lacZ-removed lac operon (lacYA) on production of 2-fucosyllactose in Corynebacterium glutamicum (C. glutamicum). FIG. 2A shows results of culture of Corynebacterium glutamicum (C. glutamicum) strain that overexpress only ManB, ManC, Gmd and WcaG (Control Group), FIG. 2B shows culture results of the strain that overexpresses ManB, ManC, Gmd and WcaG, and allows for further incorporation of FucT2 (Comparative Example 1), FIG. 2C shows culture results of the strain in which lac operon (lacYA), ManB, ManC, Gmd, WcaG, FucT2 and lacZ genes of which are removed, is incorporated (Example 1). Symbols in the graphs have the following meanings: .circle-solid.: dried cell weight, .square-solid.: glucose, .box-tangle-solidup.: lactose, .Math.: lactate, .diamond-solid.: 2-fucosyllactose;

(4) FIG. 3 is a graph showing results of batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT. FIG. 3A shows results of flask batch culture and FIG. 3B shows results of fermenter batch culture. When optical density (OD.sub.600) reaches about 0.8, IPTG and lactose are added to allow final concentrations to become 1.0 mM, and 10 g/L (arrows). Symbols in the graphs have the following meanings: .circle-solid.: Dried cell weight, .square-solid.: Glucose, .box-tangle-solidup.: Lactose, .Math.: Lactate, .diamond-solid.: 2-Fucosyllactose;

(5) FIG. 4 shows results confirming production of 2-fucosyllactose through LC-MS/MS analysis of a batch culture medium solution of recombinant Corynebacterium glutamicum. FIG. 4A is a graph showing production of fucosyllactose through molecular weight analysis in a cation mode using MALDI-TOP MS and FIG. 4B is a graph showing structural composition of fucosyllactose identified by tandem mass spectrometry (MS/MS);

(6) FIG. 5 is a graph showing results of fed-batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT. After 40 g/L glucose supplied at an initial stage was completely consumed, glucose started to be supplied by a continuous feeding method. At the same time, IPTG and lactose were added (large arrows). Symbols in the graphs have the following meanings: .circle-solid.: Dried cell weight, .square-solid.: Glucose, .box-tangle-solidup.: Lactose, .Math.: Lactate, .diamond-solid.: 2-Fucosyllactose;

(7) FIG. 6 shows results of codon-optimization of fucT2 genes to be suited to Corynebacterium glutamicum (C. glutamicum) in order to improve translation efficiency of fucT2 genes; and

(8) FIG. 7 is a graph showing effects of incorporation of codon-optimized fucT2 genes (COfucT2) into Corynebacterium glutamicum (C. glutamicum) on production of 2-fucosyllactose. FIG. 7A is a graph showing results of flask batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT (CO). When optical density (OD.sub.600) reached about 0.8, IPTG and lactose were added to allow final concentrations to become 1.0 mM, and 10 g/L (arrows). FIG. 7B is a graph showing results of fermenter fed-batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT (CO). After 40 g/L glucose supplied at an initial stage was completely consumed, glucose started to be supplied by a continuous feeding method. At the same time, IPTG and lactose were added (large arrows). Symbols in the graphs have the following meanings: .circle-solid.: Dried cell weight, .square-solid.: Glucose, .box-tangle-solidup.: Lactose, .Math.: Lactate, .diamond-solid.: 2-Fucosyllactose.

BEST MODE

(9) Hereinafter, the present invention will be described in more detail with reference to the following examples, and the scope of the present invention is not limited to the examples and includes variations of technical concepts equivalent thereto.

EXAMPLE 1: Production of Recombinant Strains and Plasmids

(10) Escherichia coli TOP10 and Corynebacterium glutamicum (C. glutamicum) ATCC 13032 were used to produce plasmids and 2-fucosyllactose (2-FL), respectively.

(11) In order to establish pVBCL plasmids, manB genes were amplified through PCR reaction using two DNA primers (F_PstI-manB and R_BamHI-SpeI-XbaI-manB) from the genomic DNAs of Corynebacterium glutamicum ATCC 13032, treated with restriction enzymes PstI and BamHI, and inserted into pVWEx2 plasmids which had been treated with the same restriction enzymes. manC genes were amplified again by PCR reaction using two DNA primers (F_XbaI-manC and R_SpeI-manC) from the genomic DNAs of Corynebacterium glutamicum ATCC 13032, treated with restriction enzymes XbaI and SpeI, and inserted into the established plasmid to establish pVmBC. In addition, lacYA gene clusters were amplified by PCR reaction using two DNA primers (F_inf_AsiSI_lacYA and R_inf_AsiSI_lacYA) from the pGlacYA plasmid established in the prior art (Korean Patent No. 10-1544184), treated with the restriction enzyme AsiSI and was inserted into the pVmBC plasmid which had been treated with the same restriction enzyme, to establish pVBCL plasmids.

(12) In addition, in order to establish pEGWT plasmids, gmd-wcaG gene clusters were amplified by PCR reaction using two DNA primers (F_KpnI-gmd and R_SacI-wcaG) from the genomic DNAs of Escherichia coli K-12 MG1655, treated with restriction enzymes KpnO and SacI, and inserted into the pEKEx2 plasmid which had been treated with the same restriction enzymes to establish pEGW.

(13) In addition, fucT2 genes were amplified by PCR reaction using two DNA primers (F_inf_SacI_RBS_fucT2 and R_inf_SacI_fucT2) from the genomic DNAs of Helicobacter pylori ATCC 700392, treated with the restriction enzyme SacI and inserted into the pEGW plasmid which had been treated with the same restriction enzyme to establish pEGWT.

(14) In addition, codon-optimized fucT2 genes (COfucT2) were amplified by PCR reaction using two DNA primers (F_SacI_RBS_COfucT2 and R_SacI_COfucT2) designed from the pBHA (COfucT2) plasmid, and the amplified COfucT2 genes were treated with the restriction enzyme SacI and were inserted into the pEGW plasmid which had been treated with the same restriction enzyme, to establish pEGWT(CO) (FIG. 1). FIG. 1 shows a metabolic route to biosynthesize GDP-L-fucose and fucosyllactose in the Corynebacterium glutamicum strain.

(15) The gene sequences, strains, plasmids and oligonucleotides used in the present Example are shown in the following Tables 1 to 4.

(16) TABLE-US-00001 TABLE1 Genesandgenesequences Namesofgenes Sequencenumbers manB SEQIDNO:1 manC SEQIDNO:2 gmd-wcaG SEQIDNO:3 fucT2 SEQIDNO:4 lacYA SEQIDNO:5 COfucT2 SEQIDNO:6

(17) TABLE-US-00002 TABLE 2 Strains Strains Related properties E. coli TOP10 F.sup., mcrA (mrr-hsdRMS-mcrBC) f80lacZM15 lacX74 recA1 araD139 (ara-leu)7697 galU galK rpsL (Str.sup.R) endA1 nupG C. glutamicum Wild-type strain, ATCC 13032

(18) TABLE-US-00003 TABLE 3 Plasmids Plasmids Related properties pEKEx2 Km.sup.R; C. glutamicum/E. coli shuttle vector for regulated gene expression (P.sub.tac, lacIq, pBL1, oriVC.g., oriVE.c.) pVWEx2 Tc.sup.R; C. glutamicum/E. coli shuttle vector for regulated gene expression (P.sub.tac, lacIq, pHM1519, oriVC.g., oriVE.c.) pGRG36 Tn7 insertion vector, pSC101 replicon, Amp.sup.R pBHA Cloning vector, pUC replicon, Amp.sup.R pGlacYA pGRG36 + lacYA pBHA(COfucT2) pBHA + COfucT2 pEGW pEKEx2 + gmd-wcaG pVmBC pVWEx2 + manB + manC pEGWT pEGW + fucT2 pVBCL P-VmBC + lacYA pEGWT(CO) pEGW + COfucT2

(19) TABLE-US-00004 TABLE4 Primers Primer Sequence names Sequence(5.fwdarw.3) numbers F_KpnI-gmd GGGGTACCAAGGAGATATACAATGTCAAAAGTCGCTCT SEQID CATCACC NO:7 R_SacI-wcaG CGAGCTCTTACCCCCGAAAGCGGTCTTG SEQID NO:8 F_PstI-manB AACTGCAGAAGGAGATATACAATGCGTACCCGTGAATC SEQID TGTCAC NO:9 R_BamHI- CGGGATCCGGACTAGTGCTCTAGATTATGCGCGGATAA SEQID SpeI-XbaI- TCCCTA NO:10 manB F_XbaI-manC GCTCTAGAAAGGAGATATACAATGACTTTAACTGACAA SEQID C NO:11 R_SpeI-manC GGACTAGTCTACTGATCAGACGAAAA SEQID NO:12 F_inf_AsiSI_ GTCCTTTTAACAGCGATCGCACCATCGAATGGCGCAAA SEQID lacYA ACCTTTCG NO:13 R_inf_AsiSI_ GAGACGAAATACGCGATCGCGCTGTGGGTCAAAGAGGC SEQID lacYA ATGATG NO:14 F_inf_SacI_ GGGGGTAACTTAAGGAGCTCAAGGAGATATACAATGGC SEQID RBS_fucT2 TTTTAAGGTGGTGCAAATTTGCG NO:15 R_inf_SacI_ CGGCCAGTGAATTCGAGCTCTTAAGCGTTATACTTTTG SEQID fucT2 GGATTTTACCTCAAAATG NO:16 F_SacI_RBS_ CGAGCTCAAGGAGATATACAATGG SEQID COfucT2 NO:17 R_SacI_ CGAGCTCTTATGCGTTATACTTCTG SEQID COfucT2 NO:18 Sequences represented in italics mean RBSs (ribosome binding sites) and spacers. Sequences represented in bold type mean recognition sites of specific restriction enzymes

EXAMPLE 2: Conditions and Methods for Culturing Recombinant Corynebacterium glutamicum

(20) Seed culture was carried out using a test tube containing 5 mL of BHI (brain heart infusion) medium supplemented with an appropriate antibiotic (kanamycin 25 g/mL, tetracycline 5 g/mL) at a temperature of 30 C. and a constant stirring rate of 250 rpm for 12 hours.

(21) Batch culture was carried out at 30 C. in a 500 mL bioreactor (Kobiotech, Incheon, Korea) containing 100 mL or 1 L of minimum medium (containing (NH.sub.4).sub.2SO.sub.4 20 g/L, urea 5 g/L, KH.sub.2PO.sub.4 1 g/L, K.sub.2HPO.sub.4 1 g/L, MgSO.sub.4 0.25 g/L, MOPS 42 g/L, CaCl.sub.2 10 mg/L, Biotin 0.2 mg/L, protocatechuic acid 30 mg/L, FeSO.sub.47H.sub.2O 10 mg/L, MnSO.sub.4H.sub.2O 10 mg/L, ZnSO.sub.47H.sub.2O 1 mg/L, CuSO.sub.4 0.2 mg/L, NiCl.sub.26H.sub.2O 0.02 mg/L, pH 7.0). The stirring rate during culture was maintained at 250 rpm for the flask and 1000 rpm and 2 vvm for the bioreactor. In case of batch culture, IPTG (isopropyl--D-thiogalactopyranoside) and lactose were added such that final concentrations were adjusted to 1.0 mM and 10 g/L, respectively, when optical density (OD.sub.600) reached 0.8.

(22) The fed-batch culture for high-concentration cell culture application was carried out in a 2.5 L bioreactor (Kobiotech, Incheon, Korea) containing 1.0 L of a minimum medium supplemented with 40 g/L of glucose and appropriate antibiotic (25 g/mL of kanamycin, 5 g/mL of tetracycline).

(23) After the glucose added at an initial stage was completely consumed, a feeding solution including 800 g/L of glucose was supplied by a continuous feeding method at a rate of 5.7 g/L/h. At the same time, IPTG and lactose were added such that final concentrations were adjusted to 1.0 mM and 10 g/L, respectively in order to induce expression of tac promoter-mediated genes and thereby produce 2-fucosyllactose.

(24) When pH of the medium was lower than a set point during fermentation, 28% NH.sub.4OH was automatically supplied and when pH was higher than the set point, 2N HCl was added, so that pH could be maintained within a predetermined range of (pH 6.98 to 7.02). The pH of the medium was measured in real-time using a pH electrode (Mettler Toledo, USA). Stirring rate and aeration rate were maintained at 1,000 rpm and 2 vvm to prevent lack of oxygen.

EXAMPLE 3: Determination of Concentrations of Cells and Metabolites

(25) The dried cell weight was determined by multiplying the optical density (OD) by a pre-measured transmutation constant of 0.3. The optical density (OD) was adjusted to the range of 0.1 to 0.5 by diluting a sample at an appropriate level and absorbance at 600 nm was measured using a spectrophotometer (Ultrospec 2000, Amersham Pharmacia Biotech, USA).

(26) The concentrations of 2-fucosyllactose, lactose, lactate, glucose and acetic acid were measured using a high-performance liquid chromatography (HPLC) device (Agilent 1100LC, USA) equipped with a carbohydrate analysis column (Rezex ROA-organic acid, Phenomenex, USA) and a refractive index (RI) detector. 20 l of the culture medium diluted (10) was analyzed using a column pre-heated at 60 C. 5 mM of a H.sub.2SO.sub.4 solution was used as a mobile phase at a flow rate of 0.6 mL/min.

TEST EXAMPLE 1: Identification of Incorporation of lacZ Genes-removed Lac Operon (lacYA) on Production of 2-Fucosyllactose in Corynebacterium glutamicum (C. Glutamicum)

(27) In the present Test Example, in order to bio-synthesize 2-fucosyllactose in Corynebacterium glutamicum (C. glutamicum), a lactose carrier was incorporated and effects thereof were identified.

(28) For this purpose, lac operon (lacYA), E. coli K-12-derived lacZ genes of which are removed, established in the prior art (Korean Patent No. 10-1544184), was incorporated into Corynebacterium glutamicum to produce 2-fucosyllactose.

(29) In the prior art, in order to establish Escherichia coli that has no activity of -galactosidase and has only activity of the lactose carrier, lac operon (lacYA) in which lac operon on the chromosome of Escherichia coli is removed and lacZ genes encoding -galactosidase are removed is incorporated into the chromosome of Escherichia coli again, to produce 2-fucosyllactose (Korean Patent No. 10-1544184).

(30) Experimentation was conducted using the recombinant Corynebacterium glutamicum strain that overexpressed only ManB, ManC, Gmd, and WcaG, which are GDP-L-fucose biosynthesis enzymes (Control Group), the strain that overexpressed ManB, ManC, Gmd and WcaG, which are GDP-L-fucose biosynthesis enzymes, and to which FucT2 was further incorporated (Comparative Example 1), and the strain in which lac operon (lacYA) obtained by removing ManB, ManC, Gmd, WcaG, FucT2 and lacZ genes, which are GDP-L-fucose biosynthesis enzymes, was incorporated (Example 1). By comparing Control Group, Comparative Example 1 and Example 1 through batch culture in the flask, the effects of incorporation of lacYA operon and fucose transferase on production of 2-fucosyllactose were evaluated.

(31) As a result of experimentation, the Corynebacterium glutamicum strain that overexpressed only GDP-L-fucosebiosynthesis enzymes, ManB, ManC, Gmd and WcaG (Control Group), and the strain that overexpressed ManB, ManC, Gmd and WcaG, which are GDP-L-fucose biosynthesis enzymes, and in which FucT2 was further incorporated (Comparative Example 1), did not produce 2-fucosyllactose at all.

(32) However, only the strain in which lac operon (lacYA) obtained by removing ManB, ManC, Gmd, WcaG, FucT2 and lacZ genes, which are GDP-L-fucose biosynthesis enzymes, was incorporated (Example 1) produced 2-fucosyllactose (Table 5 and FIG. 2). FIG. 2 is a graph showing effects of incorporation of lacZ-removed lac operon (lacYA) on production of 2-fucosyllactose in Corynebacterium glutamicum. FIG. 2A shows culture results of Control Group, FIG. 2B shows culture results of Comparative Example 1 and FIG. 2C shows culture results of Test Example 1.

(33) The results indicate that, as a lactose carrier is incorporated, lactose is incorporated into the strain and is used to produce 2-fucosyllactose, which means that incorporation of lacZ genes-removed lac operon (lacYA) is essential for the production of 2-fucosyllactose.

(34) TABLE-US-00005 TABLE 5 Identification of effects of incorporation of lacZ- removed lac operon (lacYA) on production of 2- fucosyllactose in Corynebacterium glutamicum (C. glutamicum) Yield Maximum 2- (moles of 2- Final dried Lactose fucosyllactose fucosyllactose/ cell weight consumption.sup.a concentration.sup.a moles of Productivity.sup.a Plasmid (g/L) (g/L) (mg/L) lactose) (mg/L/h) pVBC 13.5 0.02 N.D. pEGW pVBC 12.9 0.02 N.D. pEGWT pVBCL 13.4 0.78 246 0.22 5.0 pEGWT

TEST EXAMPLE 2: Production of 2-fucosyllactose Through Batch Culture

(35) In order to find the capability of the recombinant Corynebacterium glutamicum (C. glutamicum) established in Test Example 1, to produce 2-fucosyllactose and fermentation features thereof, recombinant Corynebacterium glutamicum, in which lac operon (lacYA) from which ManB, ManC, Gmd, WcaG, FucT2 and lacZ were removed was incorporated was batch-cultured in a flask and a fermenter. IPTG and lactose were added such that final concentrations were adjusted to 1.0 mM and 10 g/L, respectively, when the optical density (OD.sub.600) reached 0.8.

(36) As a result of flask batch culture, 246 mg/L of 2-fucosyllactose was produced. The yield (ratio of moles of 2-fucosyllactose to moles of lactose) was 0.22 mole/mole, and productivity was 4.97 mg/L/h (FIG. 3 and Table 6).

(37) Meanwhile, in case of fermenter batch culture, 274 mg/L of 2-fucosyllactose was produced, the yield (ratio of moles of 2-fucosyllactose to moles of lactose) was 0.34 mole/mole and productivity was 5.6 mg/L/h. Compared to the flask culture, the final concentration, yield and productivity of 2-fucosyllactose were increased by about 11%, 55% and 12%, respectively. This is due to the fact that the fermenter could efficiently control conditions such as temperature, pH and oxygen supply compared to the flask culture.

(38) Results of the batch culture are shown in the following Table 6, FIG. 3 is a graph showing results of batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT, FIG. 3A shows results of flask batch culture and FIG. 3B shows results of fermenter batch culture.

(39) TABLE-US-00006 TABLE 6 Results of batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL + pEGWT Yield Maximum 2- (moles of 2- Final dried Lactose fucosyllactose fucosyllactose/ cell weight consumption.sup.a concentration.sup.a moles of Productivity.sup.a (g/L) (g/L) (mg/L) lactose) (mg/L/h) Flask 13.4 0.78 246 0.22 4.97 Fermenter 13.0 0.57 274 0.34 5.6 .sup.aConcentrations of lactose and 2-fucosyllactose are calculated from only lactose and 2-fucosyllactose present in medium.

TEST EXAMPLE 3: Identification of Production of 2-fucosyllactose Through LC-MS/MS Analysis

(40) Qualitative analysis was conducted by LC-MS/MS in order to identify 2-fucosyllactose produced by batch culture of Test Example 2.

(41) As a result of measurement of molecular weight in a cation mode using MALDI-TOP MS, the peak of 511.164 m/z, which corresponds to the molecular weight of 2-fucosyllactose having one sodium molecule bonded thereto was observed.

(42) In addition, as a result of tandem mass spectrometry (MS/MS) analysis to identify the structural composition of the peak, glucose, galactose and fucose that constitute 2-fucosyllactose were found (FIG. 4). FIG. 4 shows results identifying production of 2-fucosyllactose through LC-MS/MS analysis of the culture solution of recombinant Corynebacterium glutamicum. FIG. 4A shows results identifying production of fucosyllactose through molecular weight analysis of ingredients contained in the culture solution in a cation mode using MALDI-TOP MS, and FIG. 4B shows tandem mass spectrometry (MS/MS) results structurally identifying the fact that the peak of 511.134 m/z corresponds to 2-fucosyllactose.

(43) As a result of experimentation, 2-fucosyllactose was produced in the batch culture.

TEST EXAMPLE 4: Production of 2-fucosyllactose Through Fed-batch Culture

(44) In order to produce high-concentration 2-fucosyllactose through high-concentration cell culture, fed-batch culture was conducted in a 2.5 L fermenter using recombinant Corynebacterium glutamicum (C. glutamicum) in which pVBCL and pEGWT plasmids were incorporated.

(45) When 40 g/L glucose supplied at an initial stage was completely consumed, a feeding solution started to be supplied at a rate of 5.7 g/L/h by a continuous feeding method in order to maintain cell growth. At the same time, IPTG and lactose were added to induce production of 2-fucosyllactose.

(46) As a result of experimentation, acetic acid was not produced at all during fermentation, and the cells had a dried cell weight of 57.3 g/L through metabolism of glucose. In addition, maximum concentration of 2-fucosyllactose was 5.8 g/L, the yield (ratio of moles of 2-fucosyllactose to moles of lactose) was 0.55 mole/mole and productivity was 0.06 g/L/h (FIG. 5 and Table 7).

(47) Results of fed-batch culture to produce 2-fucosyllactose are shown in the following Table 7, and FIG. is a graph showing results of fed-batch culture using recombinant Corynebacterium glutamicum pVBCL+pEGWT.

(48) TABLE-US-00007 TABLE 7 Results of fed-batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL + pEGWT Yield Maximum 2- (moles of 2- Final dried Lactose fucosyllactose fucosyllactose/ cell weight consumption.sup.a concentration.sup.a moles of Productivity.sup.a Plasmid (g/L) (g/L) (g/L) lactose) (g/L/h) pVBCL 57.3 7.3 5.8 0.55 0.06 pEGWT .sup.a2-FL productivity was calculated after IPTG induction. .sup.bconcentrations of lactose and 2-fucosyllactose were calculated from only lactose and 2-fucosyllactose present in medium.

[TEST EXAMPLE 5: Effects of Incorporation of Codon-Optimized fucT2 Genes (COfucT2) on Production of 2-fucosyllactose by Recombinant Corynebacterium glutamicum (C. glutamicum)]

(49) (1) Production of Codon-optimized fucT2 Genes (COfuct2)

(50) In order to improve translation efficiency of fucT2 genes which are Helicobacter pylori (H. pylori)-derived -1,2-fucosetransferase in recombinant Corynebacterium glutamicum (C. glutamicum), the fucT2 genes were codon-optimized depending on codon usage of Corynebacterium glutamicum.

(51) As a result of experimentation, when compared with conventional fucT2 genes, about 17.1% of the sequence was mutated (FIG. 6). FIG. 6 shows results of codon-optimization of fucT2 genes to be suited to Corynebacterium glutamicum (C. glutamicum).

(52) (2) Identification of Effects of Incorporation of Codon-Optimized fucT2 Genes (COfucT2) on Production of 2-fucosyllactose

(53) In order to find the capability of the recombinant Corynebacterium glutamicum (C. glutamicum) established using codon-optimized fucT2 genes (COfucT2) to produce 2-fucosyllactose, and fermentation features thereof, batch culture and fed-batch culture were carried out in a flask and a fermenter, respectively.

(54) In case of batch culture, IPTG and lactose were added such that final concentrations were adjusted to 1.0 mM and 10 g/L, respectively, when the optical density (OD.sub.600) reached 0.8. In case of fed-batch culture, when 40 g/L glucose supplied at an initial stage was completely consumed, a feeding solution started to be supplied at a rate of 5.7 g/L/h by a continuous feeding method to maintain cell growth. At the same time, IPTG and lactose were added to induce production of 2-fucosyllactose.

(55) As a result of batch culture, 370 mg/L of 2-fucosyllactose was produced, the yield (ratio of moles of 2-fucosyllactose to moles of lactose) was 0.28 mole/mole and productivity was 7.18 mg/L/h (FIG. 7A and Table 8). Compared to results of Test Example 2, the final concentration, yield and productivity of 2-fucosyllactose were increased by about 50%, 27% and 44%, respectively.

(56) Meanwhile, as a result of fed-batch culture, 8.1 g/L of 2-fucosyllactose was produced, the yield (ratio of moles of 2-fucosyllactose to moles of lactose) was 0.42 mole/mole and productivity was 0.07 g/L/h (FIG. 7B and Table 8). Compared to results when wild-type fucT2 was incorporated (Test Example 4), the final concentration and productivity of 2-fucosyllactose were increased by about 39% and 17%, respectively.

(57) The results of culture are shown in the following Table 8, FIG. 7A is a graph showing results of flask batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT (CO), and FIG. 7B is a graph showing results of fermenter fed-batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL+pEGWT(CO).

(58) TABLE-US-00008 TABLE 8 Results of batch and fed-batch culture using recombinant Corynebacterium glutamicum (C. glutamicum) pVBCL + pEGWT(CO) Yield (moles of 2- Final dried Lactose Maximum 2- fucosyllactose/ cell consumption.sup.a fucosyllactose moles of weight (g/L) (g/L) concentration.sup.a lactose) Productivity.sup.a Batch 14.2 0.94 370 (mg/L) 0.28 7.18 (mg/L/h) (flask) Fed-batch 62.1 13.6 8.1 (g/L) 0.42 0.07 (g/L/h) (fermenter) .sup.a2-FL productivity was calculated after IPTG induction. .sup.bConcentrations of lactose and 2-fucosyllactose were calculated from only lactose and 2-fucosyllactose present in medium.