Abstract
A method for identifying an AhR-phospho-RORt protein complex inhibitor, comprising: (a) providing a cell culture, in which cells in the culture express AhR protein and phospho-RORt protein; (b) incubating the cell culture in the presence of a test agent; (c) assaying the level of the AhR-phospho-RORt protein complex in the presence of the test agent; (d) comparing the level of the AhR-phospho-RORt protein complex in the presence of the test agent with a control; and (e) identifying the test agent as the inhibitor of the AhR-phospho-RORt protein complex when the comparing step indicates that there is a reduction in the level of the AhR-phospho-RORt protein complex in the presence of the test agent as compared with the control. A method for identifying a GLKIQGAP1 protein complex inhibitor is also disclosed. Use of identified inhibitors in the manufacture of a medicament for treating a disease is also disclosed.
Claims
1. A method for identifying an inhibitor of AhR-phospho-RORt protein complex, comprising: (a) providing a cell culture, in which cells in the culture express Aryl hydrocarbon Receptor (AhR) protein and phospho-Retinoic-acid-receptor-related orphan nuclear receptor gamma t (RORt) protein; (b) incubating the cell culture in the presence of a test agent; (c) assaying the level of the AhR-phospho-RORt protein complex in the presence of the test agent; (d) comparing the level of the AhR-phospho-RORt protein complex in the presence of the test agent with a control; and (e) identifying the test agent as the inhibitor of the AhR-phospho-RORt protein complex when the comparing step indicates that there is a reduction in the level of the AhR-phospho-RORt protein complex in the presence of the test agent as compared with the control.
2. The method of claim 1, wherein the assaying step performs immunoblotting using an anti-phospho-RORt [Ser489] antibody.
3. The method of claim 1, wherein the cells are selected from the group consisting of T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, TCR-activated T cells, and AhR+RORt+IKK overexpressing cells.
4. The method of claim 1, wherein: (i) the providing step provides cells that are co-transfected with CFP-AhR, YFP-RORt, and IKK plasmids; (ii) the assaying step performs a fluorescence resonance energy transfer (FRET) assay; and (iii) the identifying step identifies the test agent as the inhibitor of the AhR-phospho-RORt protein complex when the comparing step indicates that there is a reduction of fluorescence intensity emitted by the YFP-RORt in the presence of the test agent as compared with the control.
5. The method of claim 1, wherein: (i) the providing step provides cells that are co-transfected with an epitope tagged AhR, Myc-RORt, and IKK plasmids; (ii) the assaying step is performed using ALPHA assay with anti-Myc antibody-conjugated acceptor beads and anti-epitope antibody-coated donor beads; and (iii) the identifying step identifies the test agent as the inhibitor of the AhR-phospho-RORt protein complex when the comparing step indicates there is a reduction of signal emitted by the anti-Myc antibody-conjugated acceptor beads in the presence of the test agent as compared with the control; wherein the epitope consists of the sequence of SEQ ID NO: 1.
6. The method of claim 1, wherein: (i) the providing step provides cells selected from the group consisting of T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, TCR-activated T cells and AhR+RORt+IKK overexpressing cells; (ii) toe assaying step performs an in situ proximity ligation assay (PLA) using anti-AhR antibody and anti-RORt or anti-phospho-RORt [Ser489] antibody as primary antibodies, secondary antibodies as PLA probes, and fluorescent-labeled complementary oligonucleotide probes for signal detection; and (iii) the identifying step identifies the test agent as the inhibitor of the AhR-phospho-RORt protein complex when toe comparing step indicates there is a fluorescence signal reduction in the presence of the test agent as compared with the control.
7. The method of claim 1, wherein: (i) the providing step provides cells that are co-transfected with Myc-AhR, an epitope tagged RORt, and IKK plasmids; (ii) toe assaying step performs a co-immunoprecipitation assay by incubating cell extracts with anti-epitope agarose beads or anti-Myc agarose beads to precipitate the AhR-phospho-RORt protein complex and immunoblotting the AhR-phospho-RORt complex immunoprecipitated with an anti-Myc or an anti-epitope antibody; and (iii) the identifying step identifies the test agent as the inhibitor of the AhR-phospho-RORt protein complex when the comparing result indicates there is a reduction of signal in the presence of the test agent as compared with the control; wherein the epitope consists of the sequence of SEQ ID NO: 1.
8. The method of claim 1, wherein: (i) the providing step provides cells selected from the group consisting of T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, TCR-activated T cells and AhR+RORt+IKK overexpressing cells; (ii) the assaying step performs a chromatin immunoprecipitation (ChIP)-DNA sequencing assay using an anti-RORt antibody to immunoprecipitate the AhR-phospho-RORt protein complex and performing a PCR using a pair of primers comprising an AhR-binding site nucleotide sequence in IL-17A promoter DNA sequence to obtain a PCR product; and (iii) the identifying step identifies the test agent as the inhibitor of the AhR-phospho-RORt complex when the comparing step indicates there is a reduction in the quantity of the PCR product in the presence of the test agent as compared with the control.
9. A method for identifying an inhibitor of GLKIQGAP1 protein complex, comprising: (a) providing a cell culture, in which cells in the culture express GLK protein and IQGAP1 protein; (b) incubating the cell culture in the presence of a test agent; (c) assaying the level of the GLKIQGAP1 protein complex in the presence of the test agent; (d) comparing the level of the GLKIQGAP1 protein complex in the presence of the test agent with a control; and (e) identifying the test agent as the inhibitor of the GLKIQGAP1 protein complex when the comparing step indicates that there is a reduction in foe level of the GLKIQGAP1 protein complex in the presence of the test agent as compared with the control.
10. The method of claim 9, wherein: (i) the providing step provides cells selected from the group consisting of GLK transgenic mice, GLK-overexpressing cells, and GLK+IQGAP1-overexpressing cells; (ii) the assaying step performs an in situ proximity ligation assay (PLA) using anti-IQGAP1 antibody and anti-GLK or anti-phospho-IQGAP1 [Ser480] antibody as primary antibodies, secondary antibodies as PLA probes, and fluorescent-labeled complementary oligonucleotide probes for signal detection; and (iii) the identifying step identifies the test agent as the inhibitor of the GLKIQGAP1 protein complex when the comparing step indicates that there is a fluorescence signal reduction in the presence of the test agent as compared with the control.
11. The method of claim 9, wherein the assaying step performs immunoblotting using an anti-phospho-IQGAP1 [Ser480] antibody.
12. A method for treating an IL-17A associated disease, comprising: administering an effective amount of an AhR-phospho-RORt protein complex inhibitor identified by the method of claim 1 to a subject in need thereof to treat the IL-17A associated disease in the subject in need thereof.
13. The method of claim 12, wherein the AhR-phospho-RORt protein complex inhibitor is selected from the group consisting of verteporfin and alexidine dihydrochloride.
14. The method of claim 12, wherein the IL-17A associated disease is selected from the group consisting of an autoimmune disease, GLK-overexpressing cancer cell metastasis, and GLK-overexpressing cancer cell recurrence.
15. The method of claim 14, in which the method treats the autoimmune disease in the subject in need thereof and the administering step administers the AhR-phospho-RORt protein complex inhibitor verteporfin or alexidine dihydrochloride.
16. The method of claim 14, in which the method treats GLK-overexpressing cancer cell metastasis in the subject in need thereof and the administering step administers the AhR-phospho-RORt protein complex inhibitor verteporfin or alexidine dihydrochloride.
17. The method of claim 14, in which the method treats GLK-overexpressing cancer cell metastasis in the subject in need thereof and the administering step administers the AhR-phospho-RORt protein complex inhibitor verteporfin.
18. A method for treating GLK-overexpressing cancer cell metastasis, comprising: administering an effective amount of an inhibitor of GLKIQGAP1 protein complex identified by the method of claim 9 to a subject in need thereof to treat the GLK-overexpressing cancer cell metastasis in the subject in need thereof.
19. The method of claim 18, wherein the inhibitor of GLKIQGAP1 protein complex is verteporfin or alexidine dihydrochloride.
20. The method of claim 18, wherein the inhibitor of GLKIQGAP1 protein complex is verteporfin.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] FIG. 1 shows that Lck-GLK transgenic mice display autoimmune phenotypes and selectively increased serum IL-17A levels. (A) Hematoxylin and eosin-stained sections of indicated organs from mice. Arrows, infiltrating immune cells. Bar, 100 m. (B) Levels of serum autoantibodies from mice were determined by ELISA assays. The levels are presented relative to the value from one of wild-type mice. (C) The serum levels of cytokines in mice were determined by ELISA assays. (D) The serum levels of autoantibodies in Lck-GLK and Lck-GLK/IL-17A KO mice were determined by ELISA assays. The levels are presented relative to the value from one of Lck-GLK mice. (E) IL-17A expression was attenuated by GLK shRNA. Murine primary splenic T cells were transfected with GFP-human GLK shRNA and a control GFP vector. The transfected T cells were stimulated with anti-mouse CD3 antibodies for 3 h and then determined by flow cytometry at day 3 post-transfection. Data show the events of IL-17A-producing T cells (green fluorescent protein (GFP)-gated). WT, wild-type littermate controls; Lck-GLK, T-cell-specific GLK transgenic mice. Lck-GLK/IL-17A KO, Lck-GLK; IL-17A-deficient mice. ANA, anti-nuclear antibody; -dsDNA, anti-dsDNA antibody; RF, rheumatoid factor. *, P value<0.05; **, P value<0.01 (two-tailed Student's t-test).
[0025] FIG. 2 shows that GLK enhances IL-17A expression through inducing AhR and RORt. (A) Murine IL-17A mRNA levels in peripheral blood T cells from mice were analyzed by real-time PCR. The expression levels of IL-17A were normalized to Mrpl32 levels. The fold changes are presented relative to the value of wild-type mice. MeansSEM are shown. (B) Luciferase reporter activity of the IL-17A promoter. Jurkat T cells were co-transfected with the plasmid encoding GLK or GLK kinase-dead (GLK-K45E) mutant plus the IL-17A promoter (2 kb) construct. MeansSEM are shown. (C) Schematic diagram of transcription factors on the IL-17A promoter. (D) The binding of AhR, RORt, STAT3, IRF4, KLF4, or BATF to the IL-17A promoter in T cells from mice was analyzed by ChIP-PCR using immunocomplexes from individual immunoprecipitation experiments. (E) Luciferase reporter activity of the IL-17A mutant promoters. Jurkat T cells were co-transfected with empty vector or GLK plasmid plus the IL-17A promoter construct containing a mutated binding element for AhR, RORt (877), or STAT3. (F) Luciferase reporter activity of AhR, RORt (877), and STAT3 response element (XRE-Luc, RORt-Luc, and SIE-Luc) in Jurkat T cells co-transfected with empty vector or plasmid encoding GLK. XRE, xenobiotic responsive element; SE, sis-inducible element. WT, wild-type littermate controls; Lck-GLK, T-cell-specific GLK transgenic mice. MeansSEM of three independent experiments are shown (b), (e), and (f). *, P value<0.05; **, P value<0.01 (two-tailed Student's t-test).
[0026] FIG. 3 shows that PKC phosphorylates AhR and induces its nuclear translocation. (A) The serum levels of cytokines from indicated mice were determined by ELISA assays. MeansSEM are shown. WT, wild-type littermate controls; Lck-GLK, T-cell-specific GLK transgenic mice. Lck-GLK;AhR.sup.f/f;CD4-Cre, T-cell-specific GLK transgenic mice bred with AhR conditional knockout (cKO) mice. *, P value<0.05; **, P value<0.01 (two-tailed Student's t-test). (B) Confocal microscopy of subcellular localization of AhR in murine splenic T cells without stimulation. Original magnification, 630; bar, 10 m. (C) Immunoblotting of AhR, GAPDH, and histone 3 in cytoplasmic and nuclear fractions of primary splenic T cells from WT and Lck-GLK Tg mice. (D) Immunoblotting of p-AhR (Ser-36), AhR, and GLK in primary splenic T cells of WT and Lck-GLK Tg mice. (E) Immunoblotting of AhR phosphorylation and indicated kinases in in vitro kinase assays using Flag-GLK, Flag-PKC, Flag-IKK, Flag-IKK, and HA-AhR (as the substrate) isolated from individually transfected HEK293T cells. (F) Co-immunoprecipitations (co-IP) of endogenous AhR with PKC from lysates of primary splenic T cells from WT and Lck-GLK mice without stimulation. (G) PLA of interaction between endogenous PKC and AhR in peripheral blood T cells from wild-type or Lck-GLK Tg mice. Each red dot represents for a direct interaction. T-cell nucleus was stained with DAPI (blue color). (H) In vitro kinase assays of purified HA-tagged AhR plus either Myc-tagged PKC WT or PKC kinase-dead (K409W) mutant proteins. (I) Immunoblotting analyses of phosphorylated AhR (Ser-36), AhR, GLK, and PKC in primary splenic T cells of WT, Lck-GLK Tg and Lck-GLK Tg mice bred with PKC KO mice. (J) Confocal microscopy of subcellular localization of AhR and PKC in primary splenic T cells of indicated mice. Original magnification, 630; bar, 10 m. WT, wild-type littermate controls; Lck-GLK, T-cell-specific GLK transgenic mice; Lck-GLK; PKC.sup./, Lck-GLK transgenic mice bred with PKC knockout mice.
[0027] FIG. 4 shows that GLK induces RORt binding to the IL-17A promoter through AhR and RORt interaction. (A) The bindings of RORt to the IL-17A promoter in T cells from indicated mice were analyzed by ChIP-PCR. (B) Co-immunoprecipitations (co-IP) of endogenous AhR with RORt using lysates of primary splenic T cells from WT and Lck-GLK mice without any stimulation. (C) Confocal microscopy of subcellular localization of AhR and RORt in primary T cells of indicated mice. Original magnification, 630; bar, 10 m. (D) The bindings of AhR and RORt to the IL-17A promoter in T cells from mice were analyzed by ChIP-PCR using anti-RORt immunocomplexes. (E) Confocal microscopy of proximity ligation assays (PLA) for the interaction between endogenous AhR and RORt in peripheral blood T cells from indicated mice. (F) Co-immunoprecipitation (IP) of HA-tagged AhR and Flag-tagged RORt using lysates of HEK293T cells co-transfected with GLK-CFP, PKC-Myc, IKK-CFP, or IKK-Myc plasmid. (G) GST-pulldown assays of purified Flag-tagged RORt and GST-tagged AhR proteins. Flag-tagged RORt proteins were eluted with Flag peptides using lysates of HEK293T cells co-transfected with Flag-RORt plus either CFP-IKK or vector. Original magnification, 630; bar, 10 m.
[0028] FIG. 5 shows that IKK phosphorylates RORt Ser-489 leading to RORt binding to AhR. (A) Confocal microscopy analyses of PLA for the interaction between endogenous AhR and RORt in peripheral blood T cells from wild-type, Lck-GLK Tg, and Lck-GLK; tKK.sup.f/f;CD4-Cre mice. (B) Confocal microscopy of subcellular localization of AhR and RORt in primary splenic T cells of wild-type, Lck-GLK Tg, and Lck-GLK;IKK.sup.f/f;CD4-Cre mice. Original magnification, 630; bar, 10 m. (C) The serum levels of cytokines in mice were determined by ELISA assays. MeansSEM are shown. *, P value<0.05 (two-tailed Student's t-test). (D) Direct interaction between recombinant proteins of RORt and IKK. GST- or His-pulldown assays of purified His-tagged RORt and GST-tagged IKK proteins. (E) In vitro kinase assays of immunoprecipitated Flag-tagged RORt and either IKK or IKK kinase-dead (K44M) mutant proteins from individual HEK293T transfectants. (F) Mass spectrometry (MS)/MS fragmentation spectra of the tryptic peptides of RORt contain the phosphorylation of Ser-489. (G) Antibody specificity of anti-phospho-RORt (Ser-489) was demonstrated by immunoblotting using HEK293T cells co-transfected with CFP-tagged IKK plus either Flag-tagged RORt WT or RORt-S489A mutant. (H) Immunoblotting of p-RORt (Ser-489), RORt, p-IKK (Ser-180/181), and IKK in primary splenic T cells of indicated mice. (I) Co-immunoprecipitation (co-IP) of HA-tagged AhR and either Flag-tagged RORt WT or RORt-S489A mutant using lysates of HEK293T cells co-transfected with vector or IKK-CFP plasmid. WT, wild-type littermate controls; Lck-GLK, T-cell-specific GLK transgenic mice. Lck-GLK;IKK.sup.f/f;CD4-Cre, T-cell-specific GLK transgenic mice bred with IKK conditional knockout mice. Original magnification, 630; bar, 10 m.
[0029] FIG. 6 shows that TCR signaling induces RORt phosphorylation and subsequent AhR-RORt interaction. (A) Immunoblotting of p-RORt (Ser-489), RORt, p-IKK (Ser-180/181), and IKK in primary splenic T cells. T cells were stimulated with anti-CD3 antibodies plus streptavidin. (B) Co-immunoprecipitations (co-IP) of endogenous AhR with RORt from lysates of murine primary splenic T cells stimulated with anti-CD3 antibodies plus streptavidin. (C) Immunoblotting of p-RORt (Ser-489), RORt, and IKK in primary splenic T cells of IKK .sup.OT or CD4-Cre;IKK.sup.f/f mice. T cells were stimulated with anti-CD3 antibodies plus streptavidin. (D) Confocal microscopy of proximity ligation assays (PLA) for the interaction between endogenous AhR and RORt (left panel) or between AhR and Ser-489-phosphorylated RORt (right panel) in primary T cells of indicated mice. T cells were stimulated as (C). Original magnification, 630; bar, 10 m. (E and F) ELISA of various cytokines in supernatants of primary splenic T cells from indicated mice. T cells were stimulated with plate-bound anti-CD3 antibodies for 3 days. MeansSD are shown. (G) Immunoblotting of RORt and GAPDH proteins from primary splenic T cells of indicated mice. (H) Schematic model of IL-17A transcription induced by the AhR-RORt complex in GLK-overexpressing or TCR-stimulated T cells. GLK overexpression in T cells of T-cell-specific GLK transgenic (Lck-GLK Tg) mice induces AhR Ser-36 phosphorylation through PKC and also induces RORt Ser-489 phosphorylation through IKK. Once RORt is phosphorylated, RORt directly interacts with AhR. Phosphorylated AhR is responsible for transporting RORt into cell nucleus. The AhR-RORt complex binds to both the RORt-binding element (877 to 872) and the AhR-binding element (254 to 249) of the IL-17A promoter, leading to induction of IL-17A transcription. In normal T cells, T-cell receptor (TCR) stimulation also induces GLK kinase activity and downstream signaling, including IKK activation, RORt Ser-489 phosphorylation, and the AhR-RORt interaction. Besides NF-B, other critical transcription factors (such as NFAT1 or AP-1) are also required for the transcriptional activation of IL-2, IFN-, IL-4, IL-6, and TNF- in T cells. Others denotes other critical transcription factors. NF-B is required for TCR-induced production of multiple cytokines; however, the GLKIKK-NF-B cascade alone is not sufficient for induction of multiple cytokines. Collectively, GLK overexpression or TCR signaling induces TL-17A transcription through AhR and RORt in T cells.
[0030] FIG. 7 shows that the frequencies of GLK.sup.+ Th17 cells are increased in SLE patients, (a-d) Flow cytometry of GLK.sup.+ and IL-17.sup.+ T cells (CD3-gated, CD3 plus CD4-gated, CD3 plus CD8-gated, or CD3 plus CD4.sup.CD8.sup.+ (double-negative (DN)-gated) from the peripheral blood leukocytes of 6 healthy controls and 18 SLE patients; the results from a representative healthy control (HC) and a representative SLE patient (SLEDAI=12) are shown in the left panel. SLEDAI denotes systemic lupus erythematosus disease activity index, (e) Statistical analyses of GLK.sup.+IL-17.sup.+ T cells in the healthy control group and the SLE patient group are shown, (f) Positive correlation and significant regression between SLEDAI and the frequencies of GLK.sup.+IL-17.sup.+ T cells in the CD4.sup.+ T subset from all SLE patients (in red) and healthy controls (in blue). (Pearson correlation coefficient: r=0.729, P=0.000053). (g) Receiver operating characteristic (ROC) curves of the frequencies of GLK.sup.+IL-17.sup.+ cells in T-cell subsets (CD3.sup.+, CD4.sup.+, CD8.sup.+, or DN subset) for detection of active SLE (SLEDAI12). The area under the curve (AUC) values of the GLK.sup.+IL-17.sup.+ subpopulation in CD3.sup.+ T cells (0.935, P=0.002), CD4.sup.+ T subset (0.944, P=0.001), CD8.sup.+ T subset (0.792, P=0.036), and DN T subset (0.759, P=0.062).
[0031] FIG. 8 shows that phosphorylated RORt interacts with AhR in human autoimmune T cells. (A) Signals of the interaction (<200 nm) between Myc-AhR and Flag-RORt in lysates of HEK293T cells determined by amplified luminescent proximity homogeneous assays (ALPHA). MeansSD are shown. p-RORt peptide denotes S489-phosphorylated RORt peptide, .sup.482LFSTDVE{pS} PEGLSK.sup.495. (B) Immunoblotting of p-RORt (Ser-489) and RORt in peripheral blood T cells freshly isolated from 3 SLE patients, 1 RA patient, and 3 HC. (C) Confocal microscopy of PLA for the interaction between AhR and RORt in peripheral blood T cells, which were freshly isolated from 5 SLE patients, 3 RA patients, and 2 healthy controls. (D) Confocal microscopy of PLA for the interaction between endogenous AhR and phosphorylated RORt in peripheral blood T cells from 2 SLE patients, 2 RA patients, and 1 healthy control. SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; HC, healthy control. Original magnification, 630; bar, 10 m.
[0032] FIG. 9 shows that the GLK inhibitor C1 (verteporfin) blocks the AhR-RORt complex. (A) Luciferase activity of NF-B-driven reporter assays in stable GLK-transfected CHO-K1 cells that were treated with or without the GLK inhibitor C1 (verteporfin) under the indicated concentration. The fold changes are presented relative to the value of vector control. (B) Recombinant proteins of GLK kinase domain plus recombinant proteins of GST-tagged kinase-dead PKC (K409W) were subjected to in vitro kinase assays in the presence or absence of the GLK inhibitor C1 (verteporfin). MeansSD of are shown. *, P value<0.05; **, P value<0.01 (two-tailed Student's t-test). (C) The AhR-RORt complex was inhibited by the GLK inhibitor. Confocal microscopy of proximity ligation assays (PLA) for the interaction between AhR and either RORt or phospho-RORt (S489) in peripheral blood T cells treated with C1 (verteporfin) (5 M) for 30 min. The T cells were freshly isolated from 4 SLE patients and 1 RA patients. C1 denotes verteporfin; C2 denotes alexidine dihydrochloride. (D) Quantification of the PLA signals of (C). (E) FRET assays of HEK293T cells co-transfected with CFP-AhR, YFP-RORt, and IKK plasmids.
[0033] FIG. 10 shows that the inhibitors of GLK-induced AhR-RORt complex suppress IL-17 production and autoimmune responses in mice. (A to C) Effect of the GLK inhibitor C1 (verteporfin) administration (0.556 nmole/g every 3 days for 30 days) on serum IL-17A and autoantibodies in Lck-GLK Tg mice. (B) ELISA of indicated serum cytokines in Lck-GLK Tg mice treated with C1 (verteporfin) or PBS. (C) ELISA of serum autoantibodies in Lck-GLK Tg mice treated with C1 (verteporfin) or PBS. MeansSEM are shown. (D) Experimental autoimmune encephalomyelitis (EAE) induction in wild-type mice treated with PBS, or the GLK inhibitor C1 (verteporfin) and C2. Clinical scores are presented on a scale of 1 to 5 (left panel). ELISA of IL-17A in the sera from MOG-immunized mice at day 16 (right panel). (E) Collagen-induced arthritis (CIA) induction in wild-type mice treated with the GLK inhibitor C1 (verteporfin) or PBS. Clinical scores are presented on a scale of 1 to 16 (left panel). ELISA of IL-17A in the sera from collagen-immunized mice at day 28. MeansSEM are shown. *, P value<0.05; **, P value<0.01; ***, P value<0.001 (two-tailed Student's west). C1 denotes verteporfin; C2 denotes alexidine dihydrochloride.
[0034] FIG. 11 shows that verteporfin inhibits Th17 differentiation but enhances Treg differentiation. (A) Flow cytometry of IL-17A-producing CD4.sup.+ T cells. Splenic T cells were co-treated with verteporfin (C1) (1 or 5 M) during Th17 differentiation in vitro. (B) Flow cytometry of IL-17A-producing CD4.sup.+ T cells. Murine in vitro differentiated Th17 cells were stimulated with PMA plus ionomycin and co-treated with verteporfin (C1) (1 or 5 M) for 30 min. (C) Flow cytometry of Foxp3-producing CD4.sup.f T cells. Splenic T cells were co-treated with verteporfin (C1) (5 M) during Treg differentiation in vitro. (D) Flow cytometry of Foxp3-producing CD4.sup.+ T cells, which were differentiated from CD4.sup.+ T cells of wild-type or Lck-GLK transgenic mice.
[0035] FIG. 12 shows that the inhibitors of GLK-induced AhR-RORt complex block IL-17 production of human T cells, (a) ELISA of various cytokines in supernatants of murine primary T cells stimulated with anti-CD3/CD28 and treated with C1 (verteporfin) (5 M or 10 M) for 3 days. MeansSD are shown, (b) ELISA of IL-17A in supernatants of human T cells. T cells were stimulated with anti-CD3/CD28 and treated with C1 (verteporfin) (1 M or 5 M) or C2 (1 M or 5 M) for 3 days. HC, healthy control; SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; AS, ankylosing spondylitis; PsA, psoriatic arthritis; PSS, primary Sjgren's syndrome. MeansSD are shown. C1 denotes verteporfin; C2 denotes alexidine dihydrochloride.
[0036] FIG. 13 shows that GLK induces distant metastasis of lung cancer. (A) Schematic diagram of the PolII-GLK transgenic construct. In GLK transgenic mice, human GLK cDNA was driven by the mouse RNA polymerase H (PolII) promoter. (B) Real-time PCR of transgenic human GLK (hGLK) mRNA levels in murine peripheral blood cells from mice. The human GLK mRNA levels were normalized to mouse Srp72 mRNA levels. MeansSEM are shown. WT, wild-type littermate controls; PolII-GLK, PolII-GLK transgenic mice. (C) Representative immunohistochemistry of a lung cancer maker proliferating cell nuclear antigen (PCNA) or H&E staining in lung tissues from 8-month-old wild-type (WT), SPA-EGFR.sup.del transgenic, or SPA-EGFR.sup.del;PolII-GLK transgenic mice. Scale bar, 100 m. (D and E) Representative immunohistochemistry of EGFR-deletion mutant expression or H&E staining in the lung (D), cervical lymph nodes (E), brain (E), or liver (E) from 1-year-old indicated mice. LN, cervical lymph nodes. Scale bar, 100 m.
[0037] FIG. 14 shows that GLK inhibitors block the migration of cells from indicated cancers. Transwell migration assays of human glioma U87 cells, human pancreatic cancer Panc-1 cells, mouse lung cancer LL2 cells, or human hepatoma Huh-7 cells treated with the GLK inhibitor C1 (verteporfin) (a; 2 uM or 5 uM) or C2 (alexidine dihydrochloride) (b; 2 uM or uM). C1 denotes verteporfin; C2 denotes alexidine dihydrochloride.
[0038] FIG. 15 shows that GLK inhibitors suppress the tumor growth in lung cancer xenograft model. (A) Murine TC-1 lung cancer cells were subcutaneously inoculated into the right flank of wild-type mice for establishing a TC-1 xenograft model. TC-1 cells inoculated mice were intravenously injected with PBS, C1 (verteporfin) (10 uM), or C2 (alexidine dihydrochloride) (17 uM) every 3 days for 15 days. (B) Photographs of excised TC-1 lung cancers after receiving PBS, C1 (verteporfin) (10 uM), or C2 (17 uM) treatment. (C) The growth (mean tumor volume) of tumor was measured for 15 days. The TC-1 tumor size progression as a function of time post-administration with C1 or C2. N.D., not detectable. C1 denotes verteporfin; C2 denotes alexidine dihydrochloride.
[0039] FIG. 16 shows that GLK inhibitors suppress lung cancer metastasis in mice. (A) The molecular docking of GLK kinase domain structure with C1 (verteporfin). A three-dimensional structure model depicts the binding of C1 to the predicted GLK kinase domain containing phosphorylated Ser-170. The putative binding affinity was 7.4 kcal/mol. (B) The molecular docking of GLK kinase domain structure with C2 (alexidine dihydrochloride). A three-dimensional structure model depicts the binding of C2 to the predicted GLK kinase domain containing phosphorylated Ser-170. The putative binding affinity was 7.0 kcal/mol. (C) Co-immunoprecipitation (co-IP) of Flag-tagged GLK and GFP-fusion GLK using lysates of HEK293T cells co-transfected with Flag-GLK and GFP-GLK plasmids. Cells were treated with C1 (verteporfin) or C2 (alexidine dihydrochloride). (D) Administration of the GLK inhibitor C1 (0.556 nmole/g) or C2 (0.085 nmole/g) every 3 days for 30 days in the LLC/luc metastatic lung cancer mouse model. (E) The luciferase activity in mice treated with C1 (verteporfin), C2 (alexidine dihydrochloride), or vehicle was detected by IVIS Spectrum. (F) Luminescent intensity of photons emitted from LLC/luc cells in the images in (e) was quantified. (G) Representative immunohistochemistry of H&E in lung tissues from mice treated with C1 (verteporfin), C2, or vehicle. Scale bar, 0.5 cm. (H) In situ PLA assays of the interaction between GLK and IQGAP1 (upper panel) or phosphorylated IQGAP1 Ser-480 (lower panel) in lung tissues from mice treated with C1 (verteporfin), C2 (alexidine dihydrochloride), or vehicle in the LLC/luc metastatic lung cancer mouse model. Original magnification, 40.
[0040] FIG. 17 shows that GLK-deficient mice display an increased lifespan. (A) Survival curves of 10 wild-type or 15 GLK-deficient mice were calculated by the life-table method. GLK-deficient mice exhibited a significant extension of lifespan relative to wild-type mice (Wilcoxon test, P=0.001). (B) 16-month-old wild-type mice displayed gray hair, whereas 38-month-old GLK-deficient mice still displayed healthy hair. (C) ELISA of various cytokines in the sera of 4.5-month-old wild-type, 20-month-old wild-type, or 20-month-old GLK-deficient mice. MeansSEM are shown. WT, wild-type mice; GLK KO, GLK-deficient mice. *, P value<0.05; **, P value<0.01 (two-tailed Student's t-test).
[0041] FIG. 18 shows that GLK interacts directly with IQGAP1. (A) Silver-stained gel of anti-Flag immunoprecipitates from HEK293T cells transfected with empty vector or Flag-tagged GLK in the presence or absence of the tyrosine phosphatase inhibitor pervanadate (25 M). Arrows indicate the positions of GLK or GLK-interacting proteins. (B) Four pervanadate-induced tyrosine phosphorylation residues of GLK proteins were listed. (C and D) Co-immunoprecipitation of anti-Flag (C) or anti-Myc (D) immunocomplexes from lysates of HEK293T cells transfected with Flag-tagged GLK, Myc-tagged IQGAP1, or both plasmids. The whole-cell lysate immunoblots before immunoprecipitation (Pre-IP) are shown at the bottom of each panel. -Tubulin was used as the loading control. (E) Co-immunoprecipitation of anti-Flag immunocomplexes from lysates of HEK293T cells transfected with either Flag-tagged GLK or Flag-tagged GLK mutant (Y366F, Y379F, Y574F, or Y735F). HEK293T cells were treated with 25 M pervanadate for 2 h (F) In situ PI A of HEK293T cells transfected with empty vector, 3 Flag-tagged GLK, Myc-tagged IQGAP1, or GLK together with IQGAP1 plasmids. Arrows indicate the PLA signals (red spots). Original magnification, 40. Scale bar, 10 m. (G) The relative PLA signal of each group per field is shown on the plot. (H) FRET assays of HEK293T cells transfected with the indicated plasmids encoding CFP- and YFP-fused GLK and IQGAP1 proteins. The FRET signals were inhibited by the treatment of C1 (verteporfin) or C2 (alexidine dihydrochloride) (tight panel). (I) Co-immunoprecipitation (Co-IP) of purified Flag-tagged GLK and Myc-tagged IQGAP1 proteins. Flag-tagged GLK and Myc-tagged IQGAP1 proteins from HEK293T cell lysates were eluted with Flag and Myc peptides, respectively. **, P value<0.01; ***, P value<0.001.
[0042] FIG. 19 shows that phosphorylation of IQGAP1 at Ser-480 by GLK controls lung cancer cell migration. (A) In vitro kinase assay and immunoblotting of purified wild-type GLK, kinase-dead GLK, and IQGAP1. Phosphorylation of IQGAP1 was then quantified by a Typhoon scanner (GE). (B) Active (GTP-binding) Cdc42 proteins were immunoprecipitated from lysates of HEK293T cells co-transfected with Cdc42 and GLK plus either IQGAP1 or IQGAP1 (S480A) mutant, followed by immunoblotting analyses. Lower panel showed the co-immunoprecipitation (interaction) between IQGAP1 and Cdc42. (C) Active (GTP-binding) Rac1 proteins were immunoprecipitated from lysates of HEK293T cells co-transfected with Rac1 and GLK plus either IQGAP1 or IQGAP1 (S480A) mutant, followed by immunoblotting analyses. Lower panel showed the co-immunoprecipitation (interaction) between IQGAP1 and Rac1. (D and E) Cdc42 or Rac1 enzymatic activity the cell lysates as in (B) or (C) was determined using G-LISA Activation Assay Biochem Kit. Positive, positive controls from the assay kit. SA, IQGAP1 (S480A) mutant. (F) Migration assays of HCC827 cells transfected with Flag-tagged GLK or GLK (P436/437A;P478/479A) plasmid plus the plasmid expressing Myc-tagged IQGAP1, IQGAP1 (S480A), or IQGAP1 (WW). Original magnification, 10. Scale bar, 20 m. (G) The relative number of migrated cells per field is shown on the plot. (H) Immunoblotting of GLK and IQGAP1 proteins from HCC827 cells transfected with the indicated plasmids. (I) Immunoblotting of phospho-IQGAP1 (Ser-480) in HEK293T cells co-transfected with Flag-tagged active-form GLK (E351K) plus either Myc-tagged IQGAP1 WT or IQGAP1-S480A mutant. *, P value<0.05.
[0043] FIG. 20 shows that GLK induces distant metastasis of lung cancer. (A) Constitutively activated GLK (E351K) mutant induces higher phosphorylation levels of IKK than wild-type GLK. Immunoblotting of phospho-IKK and GLK proteins from Jurkat T cells transfected with the indicated plasmids. Tubulin was used as the loading control. (B) ADP-based kinase assays of GLK or GLK (E351K) mutant proteins. Flag-tagged GLK or GLK (E351K) proteins were immunoprecipitated from transfected HEK293T cell lysates. (C) Schematic diagram of the Pol II-GLK-E351K transgenic construct. Constitutively activated human GLK (E351K) mutant cDNA was driven by the mouse RNA polymerase II (Pol II) promoter. (D) Real-time PCR of transgenic human GLK-E351K (hGLK.sup.E351K) mRNA levels in murine peripheral blood cells from mice. The human GLK mRNA levels were normalized to mouse Srp72 mRNA levels. WT, n=4; Pol II-GLK.sup.E351K, n=4. MeansSEM are shown. WT, wild-type littermate controls; Pol II-GLK.sup.E351k, GLK.sup.E351K transgenic mice. (E) Immunohistochemistry of GLK expression in the lung cancer from SPA-EGFR.sup.del transgenic mice and SPA-EGFR.sup.del;Pol II-GLK.sup.E351K transgenic mice. Scale bar, 100 m. (F) Representative immunohistochemistry of EGFR-deletion mutant expression and H&E staining in the lung cancer from 7-month-old SPA-EGFR.sup.del;Pol II-GLK.sup.E351K transgenic mice and SPA-EGFR.sup.del;Pol II-GLK.sup.E351K;IQGAP1.sup./ mice. Scale bar, 100 m. (G) Representative immunohistochemistry of EGFR-deletion mutant expression or H&E staining in the brain and liver from 7-month-old SPA-EGFR.sup.del;Pol II-GLK.sup.E351K transgenic mice and SPA-EGFR.sup.del;Pol II-GLK.sup.E351K;IQGAP1.sup./ mice. Scale bar, 100 m. Comparison of EGFR-deletion mutant expression in tissues from individual groups (lower panel).
[0044] FIG. 21 shows that GLKIQGAP1 complex is correlated with poor survival of human NSCLC. (A) In situ PLA assays of the interaction between GLK and IQGAP1 in normal adjacent tissues, squamous cell carcinoma (one type of NSCLC) tissues, adenocarcinoma (one type of NSCLC) tissues, and small cell lung carcinoma (SCLC) tissues from representative patients. Original magnification, 40. (B) The PLA signals of the interaction between GLK and IQGAP1 each group per tissue are shown on the plot. NSCLCs included squamous cell carcinoma (SCC, n=56), adenocarcinoma (ADC, n=17), bronchioloalveolar carcinoma (BC, n=11), and large cell carcinoma (LCC, n=8). Normal adjacent (NA) tissues, n=68. Small cell lung carcinoma (SCLC), n=3. (C) Kaplan-Meier estimates of survival according to GLKIQGAP1 PLA signals (PLA signal-High versus PLA signal-Low) of NSCLCs (n=66). P values were calculated using the log-rank test (D) In situ PLA of the interaction between GLK and IQGAP1 in metastatic NSCLC cells of the lung, the lymph node, and the bone tissues. PCNA staining (in green, FITC) was used to label lung cancer cells. Dotted lines indicate the vascular wall of blood vessels in the lung tissue. (E) In situ PLA of phosphorylated IQGAP1 Ser-480 in the tumor tissues from a representative squamous cell carcinoma patient and a representative adenocarcinoma patient using a combination of paired PLA probes corresponding to IQGAP1 and phospho-IQGAP1 (Ser-480). PCNA staining (in green, FITC) was used to label lung cancer cells. Original magnification, 40. (F) The PLA signals of the interaction between GLK and IQGAP1 each group per tissue are shown on the plot. NSCLCs included squamous cell carcinoma (SCC, n=53), adenocarcinoma (ADC, n=17), bronchioloalveolar carcinoma (BC, n=11), and large cell carcinoma (LCC, n=8). Normal adjacent (NA) tissues, n=68. Small cell lung carcinoma (SCLC), n=3. (G) Kaplan-Meier estimates of survival according to p-IQGAP1 (Ser-480) PLA signals (PLA signal-High versus PLA signal-Low) of NSCLCs (n=63). Among the tissue arrays, three SCC tissues on the tissue array slide were damaged; therefore, only 63 of 66 tissues were analyzed. P values were calculated using the log-rank test.
DETAILED DESCRIPTION OF THE INVENTION
[0045] The term anti-phospho-RORt [Ser489] antibody refers to an antibody against phosphorylated RORt serine-489, which may be generated by immunization of a rabbit with phospho-peptides (for example, murine RORt epitope:.sup.483FSTDVE[pS]PEGLSK.sup.495; SEQ ID NO. 5).
[0046] The term AhR+RORt+IKK overexpressing cells refer to cells that are co-transfected with 3 different plasmids encoding AhR, RORt, and IKK, respectively, and exhibit overexpression of the three proteins in the cells.
[0047] The term secondary antibodies as PLA probes refers to a pair of oligonucleotide-labeled secondary antibodies, which are DUOLINK anti-rabbit PLUS and anti-mouse MINUS PLA probes. These probes are anti-mouse IgG and anti-Rabbit IgG.
[0048] Abbreviations: Cyan Fluorescent Protein (CFP); Yellow fluorescent protein (YFP); DYKDDDDK (SEQ ID NO: 1; FLAG peptide); Aryl Hydrocarbon Receptor (AhR; SEQ ID NO: 29); Retinoic-acid-receptor-related orphan nuclear receptor gamma t (RORt) (or RAR-related orphan receptor gamma, transcript variant 2; SEQ ID NO.: 30); ras GTPase-activating-like protein IQGAP1 (SEQ ID NO: 28); Mus IL17A promoter sequence (SEQ ID NO: 31).
[0049] We have discovered that GLK signaling induces a novel interaction between AhR and phospho-RORt through PKC and IKK, leading to IL-17A transcriptional activation and autoimmune responses. The invention has made the following contributions to the art: (1) RORt serine-489 phosphorylation site; (2) AhR/phospho-RORt complex; (3) IKK phosphorylates RORt serine-489; (4) GLK-PKC-IKK-AhR/RORt-IL-17A; (5) GLK signaling selectively induces IL-17A transcription; (6) TCR stimulation also induces RORt serine-489 phosphorylation; (7) GLK overexpression-induced RORt serine-489 phosphorylation and AhR/phospho-RORt complex in human autoimmune patient T cells; and (8) Identification of 2 small-molecule GLK inhibitors that suppress AhR/phospho-RORt complex, IL-17A production, or autoimmune responses. Our findings suggest that inhibitors (such as verteporfin or alexidine dihydrochloride) of GLK or AhR/RORt complex formation could be used as IL-17A-blocking agents for IL-17A-mediated autoimmune diseases.
EXAMPLES
Methods
[0050] Mice.
[0051] All animal experiments were performed in the AAALAC-accredited animal housing facilities at National Health Research Institutes (NHRI). All mice were used according to the protocols and guidelines approved by the Institutional Animal Care and Use Committee of NHRI. Floxed AhR mice (JAX 0062003), IL-17A-deficient mice (JAX 016879), floxed RORt mice (JAX 008771), and floxed IKK mice (EMMA 001921) were purchased from Jackson Laboratory or European Mouse Mutant Archive (EMMA). The three aforementioned mouse lines were backcrossed for 10 generations onto the C57BL/6 background. The data presented in this study were performed on sex-matched, 4- to 26-week-old littermates. For T-cell development analyses, 5-week-old, sex-matched mice were used. All mice used in this study were maintained in temperature-controlled and pathogen-free cages.
[0052] Generation of Lck-GLK Transgenic Mice and PKC Knockout Mice.
[0053] A full-length human GLK coding sequence was placed downstream of the proximal lck promoter. Lck-GLK Tg mice in C57BL/6 background were generated using pronuclear microinjection. Two independent Lck-GLK Tg mouse lines were used. PKC knockout mice were generated by TA LEN-mediated gene targeting. The nucleotides 5-GGTGGAACACTAAAAATAATATGTCTTAGAGCCCCATACATACAGTGTTTGTCTTTTGTCAT TTTTCTAGGGAACAACCATGTCACCGTTTC-3 (SEQ ID NO: 2) of the PKC intron 1 and exon 2 were deleted in the mutated allele. For TALEN-mediated gene targeting in mice, embryo microinjection of TALEN mRNA was performed.
[0054] Generation of Pol II-GLK Transgenic Mice and IQGAP1 Knockout Mice.
[0055] Pol II-GLK Tg mice and Pol II-GLKE351K Tg mice in C57BL/6 background were generated using pronuclear microinjection by NHRI Transgenic Mouse Core. A full-length human GLK coding region (wild-type or E351K mutant) was placed downstream of the RNA polymerase II (Pol II) promoter. IQGAP1 knockout mice in C57BL/6 background were generated using embryo microinjection of TALEN mRNA by NHRI Transgenic Mouse Core. The nucleotide (nt) 161 guanine of the IQGAP1 exon 1 was deleted in the mutated allele.
[0056] Cells.
[0057] Human Jurkat T leukaemia cells (TIB-152) were cultured in RPMI-1640 medium (Invitrogen) containing 10% fetal calf serum plus penicillin (10 units per ml) and streptomycin (10 mg per ml). HEK293T cells were cultured in Dulbecco's modified Eagle's medium containing 10% FCS plus penicillin (10 units per ml) and streptomycin (10 mg per ml). All cell lines used were tested and confirmed to be negative for mycoplasma. Primary murine T cells were negatively selected from the spleen, lymph nodes, or peripheral bloods of mice using magnetically coupled antibodies against CD11b, B220, CD49b, CD235, and TER-1 19 (MACS). To induce IL-17A production of 3-day-cultured T cells (FIG. 1E), the primary T cells were stimulated with Biotin-conjugated anti-CD3 antibodies (3 g per ml) plus streptavidin (3 g per ml) for 3 h at 37 C.
[0058] Reagents and Antibodies.
[0059] GLK antibody (-GLK-N) was generated by immunization of rabbits with peptides (murine GLK epitope: .sup.4GFDLSRRNPQEDFELI.sup.19: SEQ ID NO: 3; identical to human GLK protein sequences 4-19) and was used for FIGS. 2E, 3D-E and 4F. Anti-GLK monoclonal antibody (clone C3) was generated by immunization of mice with peptides (murine GLK epitope: .sup.514EQRGTNLSRKEKKDVPKPI.sup.533; SEQ ID NO: 4) and was used for FIGS. 3F, 3I. The antibody for phosphorylated RORt Ser-489 was generated by immunization of a rabbit with phospho-peptides (murine RORt epitope: .sup.483FSTDVE[pS]PEGLSK.sup.495; SEQ ID NO: 5; corresponding to the human RORt protein sequences .sup.485FSTETE[pS]PVGLSK.sup.497; SEQ ID NO: 6). Anti-Myc (clone 9E10), anti-Flag (clone M2), and anti-HA (clone 12CA5) antibodies were purchased from Sigma. Anti-p-AhR (Ser-36; # A0765) antibody was purchased from Assay Biotechnology. Anti-AhR (clone RPT9), anti-p-IKK (Ser-180/181; # ab55341), and antiGAPDH (clone mAbcam 9484, catalog # ab9482) antibodies were purchased from Abeam. Anti-PKC (#3551-1) and anti-Actin (clone E184) antibodies were purchased from Epitomics. Anti-p-PKC (Thr-538; # ab63365), anti-p-STAT3 (Tyr-705; clone D3A7), anti-IKK (#2682), anti-IKK (#2678), anti-p-SGK1 (Thr-256; #2939), anti-SGK1 (clone D27C11), anti-Histone 3 (#97158), anti-IRF4 (#49648), and anti-BATF (#86388) antibodies were purchased from Cell Signaling. Anti-STAT3 (#06-596) and anti-RORt (clone 6F3.1) antibodies were purchased from Millipore. Anti-KLF4 (# AF3158) and anti-IL-23 receptor (# bs-1460) antibodies were purchased from R&D and Bioss, respectively.
[0060] Plasmids and Recombinant Proteins.
[0061] The expression plasmids for GLK and GLK kinase-dead mutant (GLK-K45E) were reported previously. CFP-tagged PKC, YFP-tagged AhR, CFP-tagged AhR, Myc-tagged PKC, HA-tagged AhR, and Flag-tagged PKC plasmids were constructed by subcloning individual cDNAs into pCMV6-AC-CFP, pCMV6-AC-YFP, pCMV6-AC-Myc, pCMV6-AC-HA, or pCMV6-AC-Flag vector. FLAG-tagged RORt and YFP-tagged RORt plasmids were constructed by subcloning RORt cDNA into pCMV6-AN-Flag or pCMV6-AN-YFP vector. HA-tagged IKK plasmid was constructed by subcloning IKK cDNA into pRC-HA vector. HA-tagged AhR-S36A mutant and Myc-tagged PKC-K409W (kinase-dead) mutant plasmids were generated by site-directed mutagenesis. GST-tagged PKC and GST-tagged PKC-K409W plasmids were also individually constructed by subcloning into pGFX4T vector. The human GLK shRNA (5-GTGCCACTTAGAATGTTTGAAA-3 SEQ ID NO: 7) was subcloned into pSUPER-GFP vector (OligoEngine). The IL-17A reporter plasmid was a gift from Dr. Warren Strober (Addgene plasmid #20124). The IL-17A promoter constructs containing a mutated binding element for AhR, RORt (877), RORt (120), or STAT3 were generated by site-directed mutagenesis using PHUSION DNA polymerase (Thermo Fisher) according to the manufacturer's protocol. The following primers were used for mutagenesis (mutated nucleotides are shown in bold font):
AhR-binding site, 5-ATGTCCATACATACATGATACTGAATCACAGC-3 (SEQ ID NO: 8); RORt-binding site (887), 5-CTCAAAGACATAAAGGCAACCGTGA TCTCATGG AGAGGAGAG-3 (SEQ ID NO. 9), RORt-binding site (120), 5-GGTTCTGTGCTGCAATCATTTGAGG (SEQ ID NO. 10); STAT3-binding site, 5-AGACAGATGTTGCCTGTCATAAAGGGGTGGTT-3 (SEQ ID NO:11). The mutant constructs were verified by DNA sequencing. The plasmids pGL4.43-Luc2P-XRE (AhR responsive XRE-Luc), pGL4.47-Luc2P-SIE (STAT3 responsive SIE-Luc), pGL4.32-Luc2P-NF-B-RE-Hygro, and pGL4 luciferase reporter vector were purchased from Promega. The plasmid for RORt (877) response element-driven reporter was constructed by cloning four copies of RORt (877) response element into pGL4.43 luciferase reporter vector. For in vitro binding assays, purified AhR proteins were isolated from HA-AhR-transfected HEK293T cells, followed by HA-peptide elution. Purified recombinant GST-PKC and GST-IKK proteins were purchased from SignalChem. Purified recombinant 6His-ROR proteins were purchased from MyBioSource. Recombinant proteins of GST-tagged PKC K409W proteins were isolated from E. coli (BL21) and then purified by GST-pulldown assays. Purified Flag-tagged RORt protein was immunoprecipitated and then eluted with Flag peptides from lysates of HEK293T cells that were co-transfected with Flag-RORt plus either CFP-IKK or vector. Purified recombinant protein of GST-tagged AhR was purchased from Abnova.
[0062] Luciferase Reporter Assays.
[0063] The 2-kb IL-17A promoter-driven firefly-luciferase reporter plasmid and a renilla-luciferase control plasmid (pRL-TK) were co-transfected into Jurkat T cells. After 24 h, 10.sup.6 cells were harvested, washed with PBS, and resuspended in 60 l RPMI medium plus 60 l lysis buffers. Data represent the mean of the ratios of the firefly-luciferase activity to the renilla-luciferase activity.
[0064] Enzyme-Linked Immunosorbent Assays (ELISAs).
[0065] Serum levels of IL-1, IL-4, IL-6, IL-12, IL-17F, IL-21, IL-22, IL-23, IFN-, TNF-, and TGF- were analyzed by individual ELISA kits purchased from eBioscience. The IL-17A levels were determined using an ELISA kit from Biolegend. The serum levels of anti-nuclear antibodies (ANA), anti-dsDNA antibody, and rheumatoid factor (RF) were analyzed by ELISA kits purchased from Alpha Diagnostic International.
[0066] Amplified Luminescent Proximity Homogeneous Assays (ALPHA).
[0067] ALPHA technology/protein-protein interaction assays were performed according to the manufacturer's protocol from Perkin Elmer Life Sciences. When the protein-donor pair was within 200 nm, a luminescent signal was detected by EnVision 2104 Multilabel Reader.
[0068] Fluorescence Resonance Energy Transfer (FRET) Assays.
[0069] FRET signal in live cells was detected by EnVision 2104 Multilabel Plate Reader (Perkin Elmer). The reaction was excited by light passing through a 430-nm filter (with 8 nm bandwidth), and the intensity of emitted fluorescence passing through a 530-nm filter (with 8 nm bandwidth) was recorded. If the protein-protein pair is in close proximity (1-10 nm), a 530-nm signal will be detected. The FRET efficiency was calculated using the following equation: FRET efficiency=((FRETCFPaYFPb)/YFP)100%, where FRET, CFP, and YFP correspond to the fluorescent intensities acquired through FRET, CFP, and YFP filter sets, respectively; a and b are the donor emission and acceptor excitation crosstalk ratios, respectively.
[0070] In Situ Proximity Ligation Assay (PLA) for AhR-RORt Complex.
[0071] PLA assays were performed using the DUOLINK In Situ Red Starter kit (Sigma) according to the manufacturer's instructions. Briefly, cells were incubated with rabbit or mouse primary antibodies for each molecule pair (AhR plus PKC, AhR plus RORt, or Flag plus Myc), followed by species-specific secondary antibodies-conjugated with oligonucleotides (PLA probes). After ligation and amplification reactions, the PLA signals from each pair of PLA probes in close proximity (<40 nm) were visualized as individual red dots by a fluorescence microscope (Leica DM2500) or a confocal microscope (Leica TCS SP5II). Each red dot represents for a direct interaction.
[0072] In Situ Proximity Ligation Assay (PLA) for GLKIQGAP1 Complex and Phosphorylated IQGAP1.
[0073] Cells seeded on sterile cover slides were co-transfected with Flag-tagged GLK and Myc-tagged IQGAP1 expression plasmids, followed by fixation, permeabilization, and blocking. In situ PLA assays of GLKIQGAP1 complex were performed using the DUOLINK In Situ-Red kit (Sigma) according to the manufacturer's instructions.
[0074] For experiments using human pulmonary tissues, tissue sections were deparafinized, antigen retrieved, and nonspecific-binding blocked, followed by in situ PLA assays using primary antibodies for IQGAP1 (1:4,000, CUSABIO) plus either GLK (1:3,000, mAb clone C3) or phospho-IQGAP1 Ser-480 (1:2,000, Allbio Science). The monoclonal antibody for phosphorylated IQGAP1 Ser-480 was generated by immunization of a mouse with phospho-peptides (human IQGAP1 epitope: .sup.473NTVWKQL[pS] SSVTGLT.sup.487; SEQ ID NO: 32). The tissue sections were then incubated with species-specific secondary antibodies conjugated with oligonucleotides (PI A probes), followed by ligation and amplification reactions. The number of PLA signals for GLKIQGAP1 complex or phosphorylated IQGAP1 per tissue (3.14 mm.sup.2) was counted.
[0075] Chromatin Immunoprecipitation (ChIP) Assays.
[0076] Peripheral blood T cells of mice were cross-linked with 1% formaldehyde for 10 min at room temperature. The lysates were sonicated (39 sec) on ice to generate random DNA fragments (200-1,000 bp). The cell extracts were immunoprecipitated with 5 g of anti-RORt, anti-AhR, or anti-STAT3 antibodies plus protein G DYNABEADS (Invitrogen) for 4 h at 4 C. on a rotating wheel. After washing for 3 times, immunocomplexes between random DNA fragments (including IL-17A promoter fragments) and transcription factors (such as RORt, AhR, or STAT3) were incubated at 94 C. for 15 min for reverse cross-linking, and then treated with protease K. The DNA fragments were purified using PCR purification kit and subjected to PCR for 35 cycles. The primers for the IL-17A promoter containing the RORt-binding sites (877872) and (120115), AhR-binding site (254249), STAT3-binding site (150145), IRF4-binding site (429421), KLF4-binding site (10971083), or BATF (243 to 176) were. RORt (877 to 872), forward 5-CTGAAGAGCTGGGACCTAATG-3 (SEQ ID NO: 12), reverse 5-GACTACTAACAGGAGGAGATG-3 (SEQ ID NO. 13), RORt (120 to 115), forward 5-GGTTCTGTGCTGACCTCATTTGAG-3 (SEQ ID NO: 14), reverse 5-CACAGATGAAGCTCTCCCTGG-3 (SEQ ID NO. 15); AhR, forward 5-GAGACTCACAAACCATTACTATG-3 (SEQ ID NO: 16), reverse 5-CACAGATGAAGCTCTCCCTGG-3 (SEQ ID NO: 17); STAT3, forward 5-GAGACTCACAAACCATTACTATG-3 (SEQ ID NO: 18), reverse 5-CACAGATGAAGCTCTCCCTGG-3(SEQ ID NO; 19); IRF4, forward 5-GGGCAAGGGATGCTCTCTAG-3(SEQ ID NO: 20), reverse 5-CTGAAGCTGCTGCAGAGCTG-3(SEQ ID NO: 21); KLF4, forward: 5-GGGTATTATCCCAAGGGTATCC-3(SEQ ID NO: 22), reverse, 5-ATGCAGCATGAGGTGGACCGAT-3(SEQ ID NO: 23); BATF, forward: 5-GAACTTCTGCCCTTCCCATCT-3 (SEQ ID NO: 24), reverse, 5-CAGCACAGAACCACCCCTTT 3 (SEQ ID NO; 25).
[0077] Immunoprecipitation, GST/his Pulldown, and Immunoblotting Analyses.
[0078] Immunoprecipitation was performed by preincubation of 0.5-1 mg protein lysates with 1 g antibody for 1 h at 4 C., followed by addition of 20 l of protein A/G-SEPHAROSE beads for 3 h. For GST- and His-pulldown assays, GST-tagged proteins and His-tagged proteins plus their interacting proteins were incubated for 3 h with glutathione-SEPHAROSE beads and Ni-SEPHAROSE beads, respectively. The immunocomplexes or GST/His-pulldown complexes were washed with lysis buffer (1.5 mM MgCl.sub.3, 0.2% NP40, 125 mM NaCl, 5% glycerol, 25 mM NaF, 50 mM Tris-HCl, and 1 mM Na.sub.3VO.sub.4) three times at 4 C., followed by boiling in 5 loading buffer at 95 C. for 3 min. The immunoblotting analyses were performed.
[0079] In Vitro GLK Kinase Assays.
[0080] GLK kinase activity was determined by measuring the rate of ADP production in the in vitro kinase reaction using ADP-GLO Kinase Assay kit. For the kinase reaction, recombinant proteins of the GLK kinase-domain (1 g) were incubated with recombinant proteins of kinase-dead PKC (K409W; 0.15 g) plus ATP (0.1 mM) or myelin basic protein (MBP) plus ATP (0.1 mM) in kinase buffer (40 mM Tris-HCl, pH7.5.20 mM MgCl.sub.2, 0.1 mg/ml BSA, 10 mM DTT and 0.1 mM Na.sub.3VO.sub.4) for 30 min at room temperature.
[0081] Cell-Based High-Throughput Screening and In Vitro Kinase Screening for GLK Inhibitors.
[0082] Cell-based high-throughput screening was conducted against a representative library of 100,000 molecules at 10 M. CHO-GLK-Luc cells expressing GLK and NF-B-luciferase reporter were used. The reaction volume was 5 l (500 cells) per well in 1,536-well plates. There was no positive control. This high-throughput screening campaign was successful with a determined Z factor of 0.570.60. However, the cells are very sensitive, and the screening resulted in a total of 17,884 potential hits, which were picked, re-screened, and confirmed. At the end, 1,392 compounds were identified for high inhibition (>80%) of the GLK-induced NF-B-luciferase activity of CHO-GLK-Luc cells. These 1,392 compounds were further screened for the inhibition of GLK kinase activity by in vitro kinase assays using the kinase-dead PKC protein as the substrate. From the screening, two potential small-molecule GLK inhibitors (IC.sub.50<M) were identified.
[0083] Besides the above 100,000 molecules, 1,200 compounds of an FDA-approved drug library were also tested using the same cell-based (>90% inhibition) and in vitro screening approaches. From both libraries (101,200 compounds), the most effective inhibitor is verteporfin (hereinafter also called C1), which is an FDA-approved drug for macular degeneration of eyes (Newman, 2016). The formula of verteporfin is C.sub.41H.sub.42N.sub.4O.sub.8. Verteporfin is a light-activated drug for the retinal treatments, whereas verteporfin (C1) was used without any photochemical process in this study.
[0084] Cell Transfections, T-Cell Stimulation, In Vitro Kinase Assays for PKC or IKK, and Flow Cytometry Analyses.
[0085] These experiments were performed as described previously.
[0086] Immunofluorescence and Confocal Imaging.
[0087] Cells were fixed in cold methanol for 2 min. After permeation with 0.25% Triton X-100 for 1 h, the cells were blocked with 5% bovine serum albumin (BSA) for 2 h. The cells were incubated with primary antibodies (1:200 dilution) for 24 h and then with secondary antibodies (1:500 dilution) for 2 h. The secondary antibodies donkey anti-rabbit IgG-Alexa Fluor 568 and goat anti-mouse IgG-Alexa Fluor 488 were purchased from Abeam and life technologies, respectively. The cover slides were mounted in FLUOROSHIELD with DAPI (GeneTex) and analysed using a Leica TCS SP5 confocal microscope.
[0088] In Vitro T-Cell Differentiation Assays.
[0089] CD4.sup.+ splenic T cells were purified from mice. Cells (510.sup.5) were cultured in 1 ml RPMI medium in 48-well plates coated with anti-CD3 (2 g/ml) and anti-CD28 (3 g/ml) antibodies. For Th17 differentiation, splenic CD4.sup.+ cells were cultured in the medium containing IL-23 recombinant proteins (50 ng/ml, R&D), IL-6 recombinant proteins (20 ng/ml, R&D), TGF- recombinant proteins (5 ng/ml, R&D), anti-IL-4 (5 g/ml, Biolegend), and anti-IFN- (5 g/ml, Biolegend) antibodies. For Th1 differentiation, CD4.sup.+ splenic cells were cultured in the medium containing IL-12 recombinant proteins (5 ng/ml, R&D) and anti-IL-4 antibodies (1 g/ml, Biolegend).
[0090] Cell Migration Assays.
[0091] For primary cell migration assays, 210.sup.5 cells in 200 ml of IMDM with 10% FBS were seeded into the upper chamber of transwells (8 m pore size, Corning), and the lower chamber was loaded with 500 m of IMDM with 20% FBS. For cancer cell migration assays, 510.sup.4 cells in 200 l of RPMI 1640 with 10% FBS were seeded into the upper chamber of transwells (8 m pore size, Corning), and the lower chamber was loaded with 500 mm of RPMI 1640 with 10% FBS. After incubation at 37 C. for 24 h, cells migrating to the lower chamber were imaged and counted by bright-field microscopy following fixation with absolute methanol and staining with 1% crystal violet solution.
[0092] Liquid Chromatography-Mass Spectrometry.
[0093] After in vitro kinase assays, protein bands of Flag-tagged RORt were collected from INSTANTBLUE-stained SDS-PAGE gels. Proteins were digested with trypsin and subjected to LC-MS/MS analyses by LTQ-Orbitrap Elite hybrid mass spectrometer as described previously.
[0094] Statistical Analyses.
[0095] All experiments were repeated at least three times. Data are presented as meanSEM. The statistical significance between two unpaired groups was analyzed using two-tailed Student's t-test. P values of less than 0.05 were considered statistically significant. Cell cultures and various assays may be used in making and practice of the invention such as follows:
[0096] Cell-Based Assays:
[0097] drug screening using T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, or activated T cells determined by IL-17A ELISA, IL-17A transcription reporter assays, or immunoblotting.
[0098] Establish GLK-Overexpressing Stable Cells.
[0099] Jurkat cells were transfected with GLK plasmid and the 2-kb IL-17A promoter-driven firefly-luciferase reporter plasmid using Neon Transfection System (Invitrogen Corporation). To select GLK-overexpressing stable cells, cells were cultured in RPMI-1640 containing neomycin at least for 2 weeks.
[0100] IL-17A Enzyme-Linked Immunosorbent Assay.
[0101] T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, or TCR-activated T cells were incubated in RPMI medium (200 ml) for 72 h. The levels of IL-17A in the supernatants were determined by enzyme-linked immunosorbent assay (ELISA) for IL-17A.
[0102] Luciferase Reporter Assay for IL-17A Promoter Activity.
[0103] 10.sup.6 GLK-overexpressing stable Jurkat cells were resuspended in 60 l RPMI medium plus 60 l lysis/Luciferase buffers. Data represent the mean of firefly-luciferase activity with standard error of the mean (SEM) error bar.
[0104] RORt Serine-489 Phosphorylation.
[0105] T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, or TCR-activated T cells were subjected to immunoblotting using the anti-phospho-RORt [S489] antibody.
[0106] Protein-Protein Interaction Assays:
[0107] fluorescence resonance energy transfer (FRET) assays, amplified luminescent proximity homogeneous assays (ALPHA; PerkinElmer), proximity ligation assay (PLA), and chromatin immunoprecipitation (ChIP) assays.
[0108] Fluorescence Resonance Energy Transfer (FRET) Assays.
[0109] HEK293T cells were co-transfected with CFP-AhR, YFP-RORt, and IKK plasmids and the fluorescence intensities were detected using ENSPIRE 2300 Multilabel Reader 24 h later. The CFP was excited at 432 nm; the resulting fluorescence intensity emitted at 485 nm was measured. The YFP was excited at 485 nm; the resulting fluorescence intensity emitted at 540 nm was measured. The FRET signal was excited at 432 nm; the resulting fluorescence intensity emitted at 540 nm was measured.
[0110] Amplified Luminescent Proximity Homogeneous Assays (ALPHA).
[0111] The AlphaScreen binding assay was carried out in 384-well, white Proxiplates in a total volume of 20 l. The AlphaScreen Flag detection kit was from PerkinElmer Life Science. The AlphaScreen donor beads were supplied as Flag-coated, and the acceptor beads were conjugated to an anti-Myc antibody. Flag-tagged AhR proteins and phosphorylated Myc-tagged RORt proteins were mixed together in 384-well plates (5 l/well). When using HEK293T transfectants (cells co-transfected with Flag-AhR, Myc-RORt, and IKK plasmids), 0.2 g lysates were added per well. For detecting GLKIQGAP1 interaction, cells were co-transfected with Flag-GLK and Myc-IQGAP1. Acceptor beads (5 l/well) were added and incubated for 30 min. Donor beads (5 l/well) were subsequently added and incubated for 3 h before measuring with an EnVision multilabel reader (PerkinElmer life Science). The final concentration of donor and acceptor beads was 20 g/ml. All dilutions were made in HEPES buffer (10 mM HEPES, 150 mM NaCl, 0.05% Tween-20, 0.5 mM DTT).
[0112] In Situ Proximity Ligation Assay (PLA).
[0113] T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, activated T cells or AhR+RORt-IKK-overexpressing cells were used. PLA assays were performed using the DUOLINK In Situ Red Starter kit according to the manufacturer's instructions. Briefly, cells were incubated with rabbit or mouse primary antibodies for each molecule pair (anti-AhR antibody+anti-RORt antibody or anti-AhR antibody+anti-phospho-RORt [Ser489] antibody), followed by species-specific secondary antibodies-conjugated with oligonucleotides (PLA probes). After ligation and amplification reactions, the PLA signals from each pair of PLA probes in close proximity (<nm) were visualized as individual red dots by a fluorescence or a confocal microscope. Each red dot represents for a direct interaction.
[0114] Co-Immunoprecipitation Assays.
[0115] HEK293T cells were co-transfected with Myc-AhR, Flag-RORt, and IKK plasmids. For immunoprecipitation, cell extracts were incubated with anti-Flag agarose beads, or anti-Myc agarose beads in lysis buffer with continuous rotation at 4 C. for 2 h. The resultant immunoprecipitates were washed three times with lysis buffer and immunoblotted with the anti-Myc or anti-Flag.
[0116] Chromatin Immunoprecipitation (ChIP) Assays
[0117] (For detecting RORt binding to the AhR-binding site on the IL-17A promoter). T cells of Lck-GLK transgenic mice, GLK-overexpressing T cells, activated T cells, or AhR+RORIKK-overexpressing cells were cross-linked with 1% formaldehyde for 10 min at room temperature. The lysates were sonicated (39 sec) on ice to generate 200-1,000 bp DNA fragments. The cell extracts were immunoprecipitated with 5 g of anti-RORt antibody plus protein G DYNABEADS for 4 h at 4 C. on a rotating wheel. After washing for 3 times, immunocomplexes were incubated at 94 C. for 15 min for reverse cross-linking, and then treated with protease K. The DNA fragments were purified using PCR purification kit and subjected to PCR for 35 cycles. The primers for the IL-17A promoter containing the AhR-binding site (254249) were forward 5-GAGACTCACAAACCATTACTATG-3 (SEQ ID NO: 26), reverse 5-CACAGATGAAGCTCTCCCTGG-3 (SEQ ID NO: 27).
Results
Lck-GLK Transgenic Mice Develop Autoimmune Diseases Through IL-17A
[0118] To study the consequence of GLK overexpression in vivo, we generated T-cell-specific GLK transgenic (Lck-GLK Tg) mice. Lck-GLK Tg mice displayed normal development of T cells and B cells; however, the mice displayed paralyses of the hind-limb and tail, clouding of the eye, or symptoms of proctitis and dermatitis between 8 and 16 weeks of age. Lck-GLK Tg mice also showed hepatosplenomegaly and enlargements of lymph nodes and kidneys. Histology staining showed the induction of pneumonia, nephritis, and spleen abnormality in these mice (FIG. 1A). Induction of serum autoantibodies in Lck-GLK Tg mice (FIG. 1B) also suggests the development of autoimmune responses in these mice. To study which proinflammatory cytokines contribute to autoimmune diseases in Lck-GLK Tg mice, the serum cytokines were determined by ELISA. Surprisingly, only IL-17A was selectively induced in the sera of 4-week-old Lck-GLK Tg mice (FIG. 1C), whereas the proinflammatory cytokines IFN- and TNF- were not induced. Consistently, in vitro Th17 differentiation of Lck-GLK Tg T cell was increased compared to that of wild-type T cell, whereas in vitro Th1 differentiation of Lck-GLK Tg T cell was unaffected. Moreover, IL-17A production was induced in unstimulated T cells of Lck-GLK Tg mice compared to that of wild-type mice. To rule out the potential position effect of the transgene, the second Lck-GLK Tg mouse line (Lck-GLK #2) was also characterized. The second line of Lck-GLK Tg mice also displayed GLK overexpression in T cells and induction of serum IL-17A levels. These data suggest that GLK overexpression in T cells induces IL-17A production in mice.
[0119] To demonstrate that pathogenic role of IL-17A in Lck-GLK Tg mice, Lck-GLK Tg mice were bred with IL-17A-deficient mice. GLK-induced serum IL-17A levels were significantly decreased by IL-17A deficiency, while other inflammatory cytokine levels were unaffected. Moreover, the autoantibodies levels were also significantly reduced in Lck-GLK Tg/IL-17A-deficient mice compared to those in Lck-GLK Tg mice (FIG. 1D). Lck-GLK Tg/IL-17A-deficient mice displayed reduction of infiltrating inflammatory cells in the kidneys, the liver, and the lung, while showing normal distribution of white pulp and red pulp in the spleen, compared to those in Lck-GLK Tg mice. The data suggest that IL-17A contributes to autoimmune responses in Lck-GLK Tg mice. To further demonstrate that the induction of IL-17A is due to GLK overexpression, we treated Lck-GLK T cells with GLK shRNA. The IL-17A overproduction was abolished by GLK shRNA knockdown in T cells purified from Lck-GLK Tg mice (FIG. 1E). These results demonstrate that GLK overexpression induces IL-17A overproduction and subsequent autoimmune phenotypes in mice.
GLK Induces IL-17A Transcription Through Activating AhR and RORt
[0120] The levels of IL-23 receptor and phosphorylated STAT3 were not increased in T cells of Lck-GLK Tg mice, suggesting that IL-17A overexpression is not due to enhancement of IL-23 signaling or IL-6/STAT3 signaling. Consistent with the IL-17A protein levels, mRNA levels of IL-17A were significantly increased in the purified T cells of Lck-GLK Tg mice compared to those of wild-type mice (FIG. 2A). We studied whether IL-17A overexpression is due to transcriptional activation of the IL-17A promoter. IL-17A promoter activities in Jurkat T cells were enhanced by GLK overexpression but not by GLK kinase-dead (K45E) mutant (FIG. 2B). Next, the bindings of individual IL-17A transcription factors to the IL-17A promoter were studied (FIGS. 2C-D). Chromatin immunoprecipitation (ChIP) analyses showed that bindings of AhR and RORt (877) to the IL-17A promoter were induced in T cells of Lck-GLK Tg mice (FIG. 2D), whereas bindings of STAT3,1RF4, KLF4, and BATF to the IL-17A promoter were not enhanced (FIG. 2D). Interestingly, the binding of RORt to the 120 region of the IL-17A promoter was not significantly induced (FIG. 2D); similar findings were reported by others (Jain et al., 2016; Zhang et al., 2008). Consistent with ChIP data, the GLK-enhanced IL-17A reporter activity was abolished by mutation of the AhR-binding element or the RORt-binding site (877), whereas the GLK-induced IL-17A reporter activity was unaffected by mutation of the STAT3-binding site (FIG. 2E) or the RORt (120)-binding site. Notably, AhR response element-driven reporter (XRE-Luc) activity was induced by GLK overexpression (FIG. 2F), whereas RORt (877) or STAT3 response element-driven reporter (RORt-Luc or SIE-Luc) activity was unaffected (FIG. 2F). These results suggest that GLK signaling induces IL-17A transcription through activating AhR and maybe RORt.
GLK Controls IL-17A Production and Autoimmune Responses Through AhR
[0121] To further demonstrate the role of AhR in promoting IL-17A production in Lck-GLK Tg mice, we bred Lck-GLK Tg mice with T-cell-specific AhR knockout (AhR cKO: AhR.sup.f/f;CD4-Cre) mice. Serum IL-17A levels were drastically reduced in Lck-GLK/T-AhR cKO (Lck-GLK;AhR.sup.f/f;CD4-Cre) mice, whereas serum TNF- and IFN- levels were unaffected by AhR deficiency (FIG. 3A). Levels of anti-nuclear antibody (ANA), anti-dsDNA antibody, and rheumatoid factor (RF) were also decreased in Lck-GLK/AhR cKO mice compared to those in Lck-GLK Tg mice (Chuang Huai-Chia et al. MAP4K3/GLK promotes lung cancer metastasis by phosphorylating and activating IQGAP1 Cancer Research, 2019, FIG. S5A). Histology staining showed that induction of nephritis and spleen abnormality in Lck-GLK Tg mice was abolished by AhR knockout. Infiltration of inflammatory immune cells in the liver of Lck-GLK Tg mice was also suppressed by AhR knockout. The data indicate that AhR plays a critical role in the IL-17A overproduction and autoimmune responses in Lck-GLK Tg mice.
PKC Phosphorylates AhR at Ser-36 and Induces AhR Nuclear Translocation
[0122] The confocal images (using two different anti-AhR antibodies; FIG. 3B) and subcellular fractionation experiments (FIG. 3C) showed that AhR nuclear translocation was enhanced in T cells of Lck-GLK Tg mice. In addition, we examined whether GLK signaling induces AhR nuclear translocation through enhancing phosphorylation of AhR. There is only one commercial anti-phospho-AhR antibody, which detects phospho-Ser-36 AhR; however, the role of Ser-36 phosphorylation in AhR nuclear translocation has not been demonstrated. Interestingly, immunoblotting analyses using the anti-phospho-AhR antibody for AhR phosphorylation showed that AhR Ser-36 phosphorylation was enhanced in T cells of Lck-GLK Tg mice, as well as in anti-CD3-stimulated T cells (FIG. 3D). These data suggest that GLK overexpression (and TCR signaling) may induce AhR activity through enhancing AhR Ser-36 phosphorylation and nuclear translocation in T cells.
[0123] We studied which kinase is responsible for phosphorylation and nuclear translocation of AhR in T cells of GLK Tg mice. SGK1 can stabilize Th17 population (Wu et al., 2013). The basal or TCR-induced SGK1 activation was unchanged in Lck-GLK T cells, suggesting that SGK1 is not involved in GLK-induced AhR phosphorylation. GLK signaling in T cells induces kinase activities of PKC, IKK, and IKK. To determine which kinase phosphorylates AhR, GLK, PKC, IKK, IKK, and AhR were each immunoprecipitated from individually transfected HEK293T cells and subjected to in vitro kinase assays. The data showed that AhR Ser-36 phosphorylation was drastically induced by PKC in vitro (FIG. 3E). The specificity of the antibody for AhR Ser-36 phosphorylation was confirmed using a wild-type AhR or a S36A mutant transfectant by immunoblotting. Immunofluorescence and confocal imaging analyses showed that PKC overexpression enhanced AhR nuclear translocation in Jurkat T cells and HEK293T cells, whereas AhR-S36A mutation stayed in the cytoplasm even in PKC-overexpressing cells. The data indicate that PKC-mediated Ser-36 phosphorylation of AhR stimulates AhR nuclear translocation. The interaction between PKC and AhR was induced in purified T cells of Lck-GLK Tg mice (FIG. 3F). Moreover, the protein-protein interaction/ALPHA technology assays showed an interaction (<200 nm) between PKC and AhR, but not between GLK and AhR. Furthermore, the fluorescence resonance energy transfer (FRET) analysis showed a direct interaction (1-10 nm) between PKC and AhR in PKC/AhR co-transfected Jurkat T cells. To study the subcellular localization and protein interaction (<40 nm) in vivo, we performed in situ proximity ligation assay (PLA) using probes corresponding to PKC and AhR. The PLA data showed strong signals in the cytoplasm of T cells from Lck-GLK Tg mice (FIG. 3G). In situ PLA using probes corresponding to Myc and Flag tags showed similar results in Myc-PKC and Flag-AhR-overexpressing HEK293T cells. In vitro binding assays with purified PKC and AhR proteins further confirmed this direct interaction. Furthermore, purified PKC indeed phosphorylated AhR at Ser-36, whereas purified kinase-dead (K409W) mutant of PKC did not (FIG. 3H). These data demonstrate that PKC directly interacts with and phosphorylates AhR at Ser-36, leading to AhR nuclear translocation.
[0124] To verify the role of PKC in AhR nuclear translocation and its in vivo function, we generated PKC knockout (KO) mice using TALEN technology. Lck-GLK Tg mice were then bred with PKC KO mice to generate Lck-GLK;PKC.sup./ mice. As expected, GLK-induced AhR Ser-36 phosphorylation in T cells was abolished by PKC knockout (FIG. 3I). Immunofluorescence and confocal imaging analyses showed that AhR was detected abundantly in the nucleus of T cells from Lck-GLK Tg mice (FIG. 3J). In contrast, AhR expression was detected in the cytoplasm, but not in the nucleus, of T cells from wild-type and Lck-GLK transgenic/PKCknockout (Lck-GLK;PKC.sup./) mice (FIG. 3J). The serum levels of IL-17A and autoantibodies were significantly decreased in Lck-GLK;PKC.sup./ mice compared to those in Lck-GLK Tg mice. Moreover, the inflammatory phenotypes were abolished in Lck-GLK transgenic/PKC knockout mice. Taken together, these results indicate that GLK induces IL-17A production through activating PKC-AhR signaling in T cells.
AhR Interacts with RORt and Transports RORt into the Nucleus
[0125] Paradoxically, both AhR-binding and RORt-binding elements are required for the GLK-induced IL-17A reporter activity (FIG. 2E); however, GLK induced the activity of AhR, but not RORt, response element (FIG. 2F). We suspected that AhR may facilitate induction of RORt activity. We first studied whether GLK induces RORt binding to the IL-17A promoter through AhR. Chromatin immunoprecipitation (ChIP) data indeed showed that the GLK-induced RORt binding to the IL-17A promoter was abolished in AhR knockout T cells (FIG. 4A). The data suggest that AhR facilitates the binding of RORt to the IL-17A promoter. Next, we studied whether AhR interacts with RORt. The interaction between endogenous AhR and RORt was drastically enhanced in T cells of Lck-GLK Tg mice (FIG. 48). Confocal imaging analyses showed a co-localization of AhR and RORt in the nucleus of T cells from Lck-GLK Tg mice (FIG. 4C). ChIP analyses using an anti-RORt antibody also showed the binding of RORt to the AhR-binding element of the IL-17A promoter in T cells of Lck-GLK mice (FIG. 4D), suggesting that RORt binds to the AhR-binding element through the AhR-RORt complex formation. Moreover, in situ proximity ligation assay (PLA) with probes corresponding to AhR and RORt showed strong interaction signals in the nucleus of T cells from Lck-GLK Tg mice than those from wild-type mice (FIG. 4E). These data indicate a direct interaction between AhR and RORt in the nucleus of T cells from Lck-GLK Tg mice. In addition, similar to AhR nuclear translocation, GLK-induced RORt nuclear translocation was abolished by PKC knockout (FIG. 4C). The data support that PKC-phosphorylated AhR recruits RORt into the nucleus. AhR-mediated RORt nuclear translocation is further confirmed by AhR knockout; RORt localized exclusively in the cytoplasm in T cells of Lck-GLK;AhR.sup.f/f;CD4-Cre mice even in the presence of functional PKC (FIG. 4C, bottom panel). Thus, this result rules out the possibility that PKC directly regulates RORt nuclear translocation. Collectively, these results indicate that AhR directly interacts with and transports RORt into the nucleus in GLK-overexpressing T cells.
AhR-RORt Interaction is Induced by IKK-Mediated RORt Ser-489 Phosphorylation
[0126] Surprisingly, in situ proximity ligation assay (PLA) showed an interaction between AhR and RORt even in the cytoplasm of Lck-GLK;PKC.sup./ T cells (FIG. 4E). This result suggests that the interaction between AhR and RORt is not regulated by AhR phosphorylation. The interaction between AhR and RORt is still detectable in Lck-GLK;PKC.sup./ T cells (FIG. 4E); this result may be due to a compensatory signaling event in PKC knockout mice. To identify the kinase that stimulates the interaction between AhR and RORt, we initially tested the potential role of GLK, IKK, or IKK in the induction of AhR-RORt interaction. The kinase GLK, PKC, IKK, or IKK was co-transfected with AhR plus RORt into HEK293T cells, followed by co-immunoprecipitation assays. The data showed that IKK overexpression enhanced the interaction between AhR and RORt, whereas overexpression of GLK, PKC, and IKK did not (FIG. 4F). Next, we tested whether IKK stimulates RORt phosphorylation, which then induces the interaction of RORt with AhR. Flag-tagged RORt was purified from HEK293T cells co-transfected with RORt plus either IKK or vector. GST-pulldown assays showed that purified GST-tagged AhR recombinant proteins strongly interacted with the purified RORt proteins from RORt plus IKK-co-transfected cells (FIG. 4G). The data suggest that IKK stimulates a direct interaction between AhR and RORt through inducing RORt phosphorylation. Conversely, PLA data showed that the GLK-induced interaction between AhR and RORt in T cells of Lck-GLK Tg mice was abolished by IKK knockout (FIG. 5A). In addition, confocal imaging analyses showed that IKK knockout specifically abolished nuclear translocation of RORt, but not AhR, in GLK transgenic T cells (FIG. 5B). Consistently, serum IL-17A levels were also decreased in Lck-GLK;IKK.sup.f/f;CD4-Cre mice compared to those in Lck-GLK Tg mice (FIG. 5C). Next, we studied whether IKK directly interacts with RORt. GST-pulldown and His-pulldown assays using purified recombinant GST-tagged IKK and His-tagged RORt proteins showed a direct interaction between IKK and RORt (FIG. 5D).
[0127] To study whether IKK phosphorylates RORt, Flag-tagged RORt, IKK, and IKK kinase-dead (K44M) mutant were individually immunoprecipitated from HEK293T transfectants and then subjected to in vitro kinase assays. The data showed that RORt phosphorylation was induced in vitro by IKK, but not by IKK-K44M mutant (FIG. 5E). To identify the IKK-targeted RORt phosphorylation site, in vitro phosphorylated Flag-tagged RORt was isolated, followed by mass spectrometry analyses. Ser-489 was identified as the RORt phosphorylation site by IKK (FIG. 5F). To demonstrate the phosphorylation of RORt Ser-489 site, we generated an anti-phospho-RORt (Ser-489) antibody, which specifically recognized RORt WT but not S489A mutant when co-transfected with IKK (FIG. 5G). Immunoblotting using this phospho-antibody showed that RORt Ser-489 phosphorylation was induced in T cells of Lck-GLK Tg mice, and the phosphorylation was abolished by IKK knockout (FIG. 5H). Consistently, RORt-S489A mutant failed to interact with AhR under IKK overexpression (FIG. 5I). Taken together, in GLK-overexpressing T cells, IKK phosphorylates RORt at Ser-489 and induces its interaction with AhR, which then transports RORt into the nucleus and cooperates with RORt to stimulate IL-17A transcription.
Phosphorylated RORt Interacts with AhR in TCR-Induced or Human Autoimmune T Cells
[0128] We asked whether phosphorylated RORt-mediated AhR-RORt interaction is also induced by TCR signaling. We found that following IKK activation, RORt Ser-489 phosphorylation in murine T cells was indeed induced by anti-CD3 stimulation (FIG. 6A). Moreover, co-immunoprecipitation assay and PLA showed that the interaction between endogenous RORt and AhR was induced by TCR signaling (FIG. 6B). The interaction between AhR and Ser-489-phosphorylated RORt was also stimulated by TCR signaling. Conversely, the TCR-induced RORt Ser-489 phosphorylation (FIG. 6C) and the AhR-RORt interaction (FIG. 6D) in T cells were abolished by IKK conditional knockout. These data suggest that IKK-mediated RORt phosphorylation and subsequent AhR-RORt interaction are induced during T-cell activation. To study whether IKK-mediated RORt phosphorylation indeed regulates IL-17A production after TCR stimulation, secreted cytokines from anti-CD3-stimulated T cells were determined by ELISA. Consistent with previous reports (Gomez-Rodriguez et al., 2009; Liu et al., 2005), TCR signaling induced IL-17A production in T cells (FIGS. 6E-F). The TCR-induced IL-17A production in T cells was abolished by IKK conditional knockout (FIG. 6E), supporting that TCR-activated IKK induces IL-17A production in normal T cells. As expected, TCR-induced levels of several IKK/NF-B-mediated cytokines (IL-2, IFN-, IL-4, IL-6, and TNF-) were also reduced in T cells of IKK conditional knockout mice (FIG. 6E). To further verify the IKK-RORt-IL-17A pathway, primary splenic T cells from T-cell-specific RORt conditional knockout mice were used. Unlike IKK conditional knockout, RORt conditional knockout only abolished IL-17A production upon TCR stimulation (FIG. 6F). The abolishment of RORt expression in T cells of RORt cKO mice was verified by immunoblotting analysis (FIG. 6G). The data suggest that IKK-RORt activation mainly induces IL-17A production during TCR signaling, while IKK-NF-B activation regulates the production of multiple cytokines, including IL-2, IFN-, IL-4, IL-6, and TNF- (FIG. 6H).
GLK.sup.+IL-17A.sup.+ T Cells are Diagnostic Biomarkers for Active SLE
[0129] To confirm that GLK overexpression induces IL-17A production in T cells of SLE patients, we characterized T cells from 18 SLE patients and 6 healthy controls (Table 1) using flow cytometry. The flow cytometry data showed that GLK overexpression co-existed exclusively with IL-17A production in T cells of all SLE patients (FIG. 7A). Moreover, the frequencies of GLK.sup.+IL-17A.sup.+ cells in CD4.sup.+ T cells were drastically increased in all 18 SLE patients compared to those in healthy controls (FIGS. 7B, E), while those in CD8.sup.+ T cells were modestly increased (FIGS. 7C, E). In contrast, the frequencies of GLK.sup.+IL-17A.sup.+ cells in CD4.sup.CD8.sup. (double-negative, DN) T cells were not significantly increased in the SLE group compared to the healthy control group; only three SLE patients showed very slight increase (FIGS. 7D-E). These results showed that GLK IL-17A T cells in SLE patients were mainly CD4 T cells, thus, these CD4.sup.+ T cells were GLK.sup.+IL-17 cells. Moreover, to study whether GLK.sup.+IL-17A.sup.+ T cell population is a useful diagnostic biomarker for active SLE (SLEDAI12), the diagnostic utility of the frequencies of GLK.sup.+IL-17A.sup.+ T-cell subsets were analyzed by liner regression and receiver operating characteristic (ROC) curve analyses (FIGS. 7F-G). The frequencies of GLK.sup.+IL-17A.sup.+ cells in CD4.sup.+ T cells were correlated (r=0.729, P=0.00053) with SLEDAI (FIG. 7F). According to the coordinates of the ROC curve, the best cutoff value for the frequencies of GLK.sup.+IL-17A.sup.+ cells in CD4.sup.+ T cell population was 15.5%. Moreover, the frequencies of GLK.sup.+IL-17A.sup.+ cells in CD4.sup.+ T cells had a sensitivity of 100% and a specificity of 88.9% for identifying active SLE patients (FIG. 7G). Thus, GLK.sup.+ Th17 cell is a diagnostic biomarker for active SLE. Notably, the area under the curve (AUC) value (0.939, P<0.001) of GLK+IL-17A.sup.+ frequencies in CD4.sup.+ T cells was significantly higher than that in CD8.sup.+ or DNT cells. Collectively, these results suggest that GLK overexpression in T cells induces IL-17A production and pathogenic Th17 cells, contributing to the pathogenesis of an SLE patient subpopulation.
[0130] Table 1 shows demographic and disease characteristics of SLE patients and healthy controls used in FIG. 1. Demographic characteristics were determined only at the beginning of SLE diagnosis. Durations refer to the length of the disease time after SLE diagnosis. Plus-minus values are meansSD. Abbreviations: SLE, systemic lupus erythematosus; HC, healthy controls; SLEDAI, SLE disease activity index; WBC, white blood cell; HgB, hemoglobin; dsDNA, double-stranded DNA; WHO, World Health Organization; C3 and C4, complement component 3 and component 4; NA, not applicable.
TABLE-US-00001 TABLE 1 Characteristic SLE (n = 18) HC (n = 6) Age at study entry (years) 38.2 16.0 31.0 6.0 Gender (female, %) 17 (94.4) 6 (100) Disease duration (years) 8.0 5.8 NA SLEDAI 7.1 5.4 NA Fever (%) 1 (5.6) NA Arthritis (%) 7 (38.9) NA Nephritis (%) 10 (55.6) NA Malar rash (%) 7 (38.9) NA Serositis (%) 2 (11.1) NA Neurologic disorders (%) 5 (27.8) NA WBC (/mm.sup.3) 6322 2364 NA HgB (g/dl) 12.3 1.9 NA Platelet (100/mm.sup.3) 271.5 90.6 NA Creatinine (mg/dl) 0.86 0.2 NA Anti-dsDNA antibody 213.7 185.7 NA (WHO Units/ml) C3 (mg/dl) 84.8 31.1 NA C4 (mg/dl) 20.9 14.1 NA
GLK Induces RORt Ser-489 Phosphorylation and the AhR-RORt Complex in Human Autoimmune Patient T Cells
[0131] Our previous report demonstrates that GLK overexpression induces RORt Ser-489 phosphorylation and the AhR-RORt complex. We also found that the interaction between AhR and RORt could be blocked by a S489-phosphorylated RORt peptide (FIG. 8A). The data further support that RORt S489 phosphorylation controls the formation of AhR-RORt complex. Next, we further studied whether RORt Ser-489 phosphorylation and the AhR-RORt complex occur in T cells of human autoimmune patients using immunoblotting and PLA. Immunoblotting data showed that RORt Ser-489 phosphorylation was drastically enhanced in unstimulated peripheral blood T cells freshly isolated from SLE and RA patients (FIG. 8B). Furthermore, unstimulated peripheral blood T cells from human SLE and RA patients displayed numerous PLA interaction signals between AhR and RORt (FIG. 8C) or between AhR and phosphorylated RORt (FIG. 8D). Thus, the GLK-PKC/IKK-AhR/RORt signaling cascade is a general mechanism of IL-17A induction in TCR-stimulated or autoimmune T cells.)
Identification of Small Molecule Inhibitors for GLKInduced AhR-RORt Complex in Human Autoimmune Patient T Cells
[0132] Since the AhR-RORt complex is induced by GLK signaling, we tested whether inhibitors of GLK-PKC-IKK signaling block AhR-RORt complex. We used the GLK inhibitor treatment as an example. Because there is no commercial GLK inhibitor, we screened 101,200 compounds to identify GLK inhibitors using both luciferase reporter assays and in vitro kinase assays. Among these compounds that efficiently inhibited GLK signaling in cell lines, two compounds (verteporfin and alexidine dihydrochloride, named C1 and C2, respectively) efficiently inhibited both GLK signaling in cell lines and GLK kinase activity in vitro (FIGS. 9A-B). We found that the GLK inhibitor C1 indeed blocked the AhR-RORt complex in T cells from SLE and RA patients (FIG. 9C). The PLA signals (FIG. 9D) and FRET signals (FIG. 9E) were inhibited by C1 (verteporfin) treatment.
The Inhibitors of GLKInduced AhR-RORt Complex Suppress IL-17 Production and Autoimmune Responses in Mice
[0133] Because GLK-induced AhR-RORt complex controls IL-17 production and autoimmune responses in mice, we studied whether the GLK inhibitor C1 (verteporfin) that blocks AhR-RORt complex also inhibits IL-17 production and autoimmune responses in T-cell-specific GLK transgenic (Lck-GLK Tg) mice. After the GLK inhibitor C1 (verteporfin) treatment (0.556 nmole/g) by intravenous injection every 3 days for 30 days (FIG. 10A), the serum IL-17A levels in Lck-GLK Tg mice were significantly decreased by C1 (verteporfin) treatment compared to those of PBS treatment (FIG. 10B). Moreover, overproduction of autoantibodies in Lck-GLK Tg mice were also abolished by C1 (verteporfin) treatment (FIG. 10C). These results demonstrate that GLK overexpression induces IL-17A overproduction and autoantibody production. To further verify that the GLK inhibitors also works in IL-17A-mediated animal models, we challenged wild-type mice with C1 (verteporfin) or C2 (alexidine dihydrochloride) during EAE and CIA induction. Both C1 (verteporfin) treatment (0.556 nmole/g) and C2 (alexidine dihydrochloride) treatment (0.085 nmole/g) significantly suppressed the diseases severity and serum IL-17A levels of mice in the EAE induction (FIG. 10D). C1 (verteporfin) treatment also inhibited the diseases severity and serum IL-17A levels of mice in the CIA induction (FIG. 10E). The data showed that the verteporfin (C1) treatment preferentially inhibited IL-17A overproduction in all three autoimmune disease models. In addition, the verteporfin (C1) treatment inhibited both Th17 differentiation and IL-17A production from in vitro differentiated Th17 cells (FIGS. 11A-B). In contrast, the verteporfin (C1) treatment enhanced in vitro Treg (Foxp3-expressing CD4.sup.+ T cell) differentiation (FIG. 11C); consistently, Treg differentiation of Lgk-GLK transgenic mice was decreased compared to that of wild-type mice (FIG. 11D). These results indicate that GLK inhibitors decreases Th17 cell population but increases Treg cell population.
The Inhibitors of GLKInduced AhR-RORt Complex Block IL-17 Production of Human T Cells
[0134] We further studied whether IL-17A production is abolished by the inhibitors of GLK-induced AhR-RORt complex in human and murine T cells. We first tested the inhibitor experiment using murine T cells stimulated with TCR signaling (anti-CD3 plus anti-CD28 antibodies). We found that TCR-induced IL-17A production of murine T cells was drastically abolished by the C1 (verteporfin) treatment, whereas TCR-induced IL-17B, IL-17E, and IL-17F levels were not decreased (FIG. 12A). TCR-induced TNF- and IFN- levels were partially reduced by the C1 (verteporfin) treatment (FIG. 12A); this reduction is likely due to the inhibition of NF-B activation by the C1 (verteporfin) treatment. Next, we studied the blocking effect of IL-17 production by the treatment of C1 (verteporfin) or C2 (alexidine dihydrochloride) using human peripheral blood T cells. TCR-induced IL-17A production was significantly reduced by the C1 (verteporfin) treatment in peripheral blood T cells from healthy controls (FIG. 12B). The IL-17A production in anti-CD3/CD28-stimulated T cells of human autoimmune disease patients was drastically inhibited by C1 (verteporfin) treatment or C2 (alexidine dihydrochloride) treatment (FIG. 12B). Taken together, GLK inhibitors (verteporfin and alexidine dihydrochloride) inhibit GLK-induced AhR-RORt complex and IL-17A production in human autoimmune patient T cells, as well as the disease severity of autoimmune animal models. Thus, GLK, GLK signaling, or GLK-induced AhR-RORt complex can be a promising therapeutic target for autoimmune diseases.
GLK Inhibitors Block Cancer Cell Migration and Cancer Metastasis/Recurrence
[0135] To study the role of GLK in cancer metastasis/recurrence, we generated the whole-body GLK transgenic (Pol II-GLK Tg) mice using RNA polymerase II (Pol II) promoter-driven human GLK cDNA (FIG. 13A). GLK overexpression was confirmed by real-time PCR (FIG. 13B). To study the effect of GLK on cancer progression, Pol II-GLK Tg mice were bred with a genetically modified lung cancer mouse line, the lung-specific pulmonary surfactant protein A (SPA) promoter-driven EGFR-deletion mutant transgenic (SPA-EGFRdel Tg) mouse line. All 1-year-old SPA-EGFR.sup.del Tg mice (9/9) indeed developed lung cancer (PCNA positive) (FIG. 13C), and so did SPA-EGFR.sup.del; Pol II -GLK Tg mice (15/15) (FIG. 13C). Immunohistochemistry analysis using anti-EGFR-deletion mutant antibodies showed that EGFR.sup.del-expressing cells are detected in the lung cancer of both SPA-EGFR.sup.del Tg mice and SPA-EGFR.sup.del;Pol II -GLK Tg mice (FIG. 13D). We next studied whether GLK transgene induces lung cancer (EGFR.sup.del-positive) metastasis to other organs in SPA-EGFR.sup.del;Pol II -GLK Tg mice. We performed immunohistochemistry using anti-EGFR-deletion mutant antibodies on the tissues of the cervical lymph nodes, the liver, and the brain from wild-type and three different transgenic mice. For regional metastasis to cervical lymph nodes, all but one (14/15) SPA-EGFR.sup.del; Pol II -GLK Tg mice displayed numerous metastatic EGFR.sup.del-expressing lung cancer cells in cervical lymph nodes. In contrast, only three of nine SPA-EGFR.sup.del Tg mice showed a few metastatic EGFR.sup.del-expressing lung cancer cells in cervical lymph nodes (FIG. 12E). For distant metastasis, all SPA-EGFR.sup.del; Pol II-GLK Tg mice displayed metastasis of EGFR.sup.del-expressing lung cancer cells to the brain (14/15) or liver (15/15) (FIG. 13E and Table 2). In the 9 control SPA-EGFR.sup.del Tg mice, only one SPA-EGFR.sup.del Tg mouse (1/9) developed both brain metastasis and liver metastasis, only one (1/9) developed liver metastasis, and remaining 7 mice did not develop any detectable distant metastasis (FIG. 13E and Table 2). These results suggest that GLK induces distant metastasis of lung cancer to the brain and liver. Table 2 shows Comparison of EGFR-deletion mutant expression in indicated tissues from individual groups.
TABLE-US-00002 TABLE 2 EGFR.sup.del Positive LN Brain Liver EGFR.sup.del (n = 9) .sup.3.sup. 1 2 PolII-GLK (n = 11) 0 0 0 EGFR.sup.del; PolII-GLK (n = 15) 14 14 15 Fisher's exact test: P = P = P = EGFR.sup.del vs. EGFR.sup.del; PolII-GLK 0.0037** 0.0001*** 0.0001*** The symbol .sup. denotes that only three of nine SPA-EGFR.sup.del Tg mice showed a few metastatic EGFR.sup.del-expressing lung cancer cells in cervical lymph nodes.
[0136] We studied whether GLK inhibitors also suppress cancer cell migration. The transwell migration assays showed that migration of the cells from glioma, pancreatic cancer, lung cancer, or hepatoma was inhibited by the treatment of C1 (verteporfin) or C2 (alexidine dihydrochloride) (FIG. 14). Moreover, both C1 (verteporfin) and C2 (alexidine dihydrochloride) treatments suppressed tumor growth in the xenograft mouse model using TC-1 lung cancer cells (FIG. 15). To study whether GLK deficiency results in a reduction of lung cancer metastasis, we used a metastatic Lewis lung carcinoma (LLC) mouse model by tail vein injection of luciferase-expressing LLC (LLC/luc) cells. We identified two GLK inhibitors (verteporfin and alexidine dihydrochloride)) using cell-based assays and in vitro kinase assays. The IC50 of C1 (verteporfin) and C2 for GLK kinase activity was 1.15 and 10.05 nM, respectively (Table 3). The molecular docking analyses showed that the GLK inhibitors C1 (verteporfin) and C2 (alexidine dihydrochloride) stably bound to active GLK kinase domain (phospho-GLK [Ser-170]) at the interlace of GLK dimers and the active site of GLK kinase domain, respectively (FIG. 16A-B). The dimerization of Flag-tagged GLK protein and GFP-GLK fusion protein was indeed blocked by the C1 (verteporfin) treatment (FIG. 16C). We treated the LLC/luc cells-containing mice with the GLK inhibitor C1 (verteporfin) or C2 (alexidine dihydrochloride) by intravenous injection every 3 days for 30 days (FIG. 16D). The luciferase activity of LLC/luc cells in the mice was detected by In Vivo Imaging System. The excised lungs were weighed and subjected to H&E staining. The luciferase activity of LLC/luc cells in the lung of injected mice was reduced by the treatment of C1 (verteporfin) or C2 (alexidine dihydrochloride) (FIGS. 16E-F). Consistently, immunohistochemistry analyses also showed a reduction of cancer colony in the C1 (verteporfin) or C2 (alexidine dihydrochloride)-treated mice (FIG. 16G). Moreover, the interaction between GLK and IQGAP1 in the lung tissues were inhibited by the treatment of C1 (verteporfin) or C2 (alexidine dihydrochloride) (FIG. 16H, upper panel), and IQGAP1 phosphorylation was in the lung tissues were inhibited (FIG. 16H, lower panel). Collectively, the data suggest that GLK plays a crucial role in lung cancer metastasis. These results indicate that GLK inhibitors block cancer metastasis and cancer progression. Table 3 shows the half maximal inhibitory concentration (IC50) of verteporfin or alexidine dihydrochloride for MAP4Ks. Inhibition of kinase activity of GLK (MAP4K3) or other MAP4Ks was determined by in vitro kinase assays using myelin basic protein (MBP) as a substrate. Recombinant proteins of kinase domains of various MAP4Ks were used. C1, verteporfin: C2.sub.T alexidine dihydrochloride.
TABLE-US-00003 TABLE 3 GLK HPK1 HGK KHS IC50 (MAP4K3) (MAP4K1) (MAP4K4) (MAP4K5) C1 1.15 nM 7.91 nM 4.92 nM 43.88 nM C2 10.05 nM 6.14 nM 21.82 nM 18.27 nM
GLK-Deficient Mice Display Prolonged Lifespan
[0137] To study whether inhibition of GLK may result in any spontaneous diseases, we monitored both wild-type and GLK-deficient mice during their lifetime. Surprisingly, GLK-deficient mice displayed a significant extension of lifespan compared to wild-type mice (FIG. 17A). The oldest GLK-deficient mouse was 40.8 months of age. The aged GLK-deficient mice (26.0-40.8 months) did not develop any tumor or discernible diseases. Interestingly, the aged GLK-deficient mice still displayed healthy hair, whereas the aged wild-type mice displayed gray hair (FIG. 17B). A previous publication indicates that T-cell-mediated immune responses, including antigen-induced IFN-, IL-2, IL-17A production, are decreased in GLK-deficient T cells. Moreover, Th1/Th2/Th17 differentiation is reduced by GLK deficiency. GLK-deficient mice are also resistant to the induction of MOG-induced experimental autoimmune encephalomyelitis. The longevity of GLK-deficient mice may be due to the inhibition of inflammatory responses by GLK deficiency. This notion is supported by the data that serum levels of the proinflammatory cytokine IL-6, IL-17A, TNF, IFN-, and IL-1 in 20-month-old GLK-deficient mice were drastically decreased compared to those of age-matched wild-type mice (FIG. 17C). Besides Th1 cytokine (IFN-) and Th17 cytokine (IL-17A), Th2 cytokine (IL-4) levels were also decreased in the sera of aged GLK-deficient mice (FIG. 17C). The data suggest that inhibition of GLK would not lead to any adverse effects, instead may prevent inflammation.
[0138] Our findings indicate that GLK-induced AhR-RORt complex is a biomarker and therapeutic target for IL-17A-mediated autoimmune disease. In addition, GLK inhibitors (verteporfin and alexidine dihydrochloride) are potential therapeutics.
GLK Interacts Directly with IQGAP1
[0139] Following immunoprecipitation of GLK, the GLK-interacting proteins were resolved by SDS-PAGE and visualized by silver staining (FIG. 18A). The seven most prominent protein bands enhanced in GLK-transfected cells were sliced and then digested by trypsin, and the resulting protein peptides were subjected to mass spectrometry analysis. Moreover, four pervanadate-induced tyrosine phosphorylation sites (Tyr-366, Tyr-379, Tyr-574, and Tyr-735) on GLK proteins were identified by mass spectrometry analysis (FIG. 18B). We identified several putative GLK-interacting proteins, including myosin, IQGAP1, vimentin, drebrin, and heat shock protein 70 (HSP70) (ordered by database search scores from highest to lowest). Among these proteins, IQGAP1, a positive regulator of cell migration, was selected for further study, whereas myosins, heat-shock proteins, and cytoskeletal proteins are common contaminant proteins detectable by mass spectrometry. Next, we confirmed the interaction between GLK and IQGAP1 using reciprocal co-immunoprecipitation assays (FIGS. 18C-D). GLK was co-immunoprecipitated with Flag-tagged IQGAP1 proteins with an anti-Flag antibody (FIGS. 18C-D). This co-immunoprecipitation between GLK and IQGAP1 was abolished by GLK (Y735F) mutation (FIG. 18E), suggesting that Tyr-735 phosphorylation of GLK protein is important for the interaction between GLK with IQGAP1. In situ proximity ligation assay (PLA) with a combination of PLA probes corresponding to Flag (Flag-tagged GLK) and Myc (Myc-tagged IQGAP1) showed strong PLA signals in cells overexpressing both proteins than those overexpressing each alone (FIGS. 18F-G). The PLA signals suggest a direct interaction (<40 nm) between GLK and IQGAP1. Moreover, the fluorescence resonance energy transfer (FRET) assay using CFP-tagged GLK and YFP-tagged IQGAP1 fusion proteins showed a direct interaction (1-10 nm) between these two molecules (FIG. 18H). The FRET signals of GLKIQGAP interaction were inhibited by the treatment of either C1 (verteporfin) (FIG. 18H, right panel). To further confirm the direct interaction, co-immunoprecipitation experiments were performed using purified proteins. Flag-tagged GLK and Myc-tagged IQGAP1 proteins from HEK293T cell lysates were purified by eluting immunocomplexes with Flag and Myc peptides, respectively. The co-immunoprecipitation assays showed an interaction between purified GLK and IQGAP1 proteins (FIG. 18I). The data from different approaches (PLA, FRET, and purified proteins) suggest that GLK interacts directly with IQGAP1.
GLK Promotes Cell Migration by Phosphorylating IQGAP1 at Ser-480
[0140] Because GLK directly binds to IQGAP1, we speculated that GLK may be a kinase that regulates IQGAP1-mediated cell migration. To determine whether GLK phosphorylates IQGAP1, in vitro kinase assay was conducted using purified proteins of GLK, GLK kinase-dead (K45E) mutant, and IQGAP1. IQGAP1 phosphorylation was induced by GLK but not GLK kinase-dead (K45E) mutant (FIG. 19A). Following SDS-PAGE fractionation and mass spectrometry analysis, Ser-480 was identified as the GLK-phosphorylated residue on IQGAP1. Next, we tested whether the GLK-induced IQGAP1 Ser-480 phosphorylation regulates the activation of Cdc42 or Rac1, as well as the interaction of IQGAP1 with Cdc42 or Rac1. Immunoprecipitation data showed that active (GTP-binding) Cdc42 proteins were increased in GLK plus IQGAP1-overexpressing cells; conversely, active Cdc42 protein levels were attenuated by overexpression of GLK plus IQGAP1 (S480A) mutant (FIG. 19B, lower panel). In contrast, active (GTP-binding) Rac1 protein levels were not increased by GLK plus IQGAP1 overexpression (FIG. 19C, lower panel). These results were further supported by ELISA results of Cdc42 and Rac1 activation (FIG. 19D-E). In addition, co-immunoprecipitation data showed that the interaction of IQGAP1 with either Cdc42 or Rac1 was not affected by the IQGAP1 (S480A) mutation (upper panel of FIGS. 19B-C). To evaluate the role of IQGAP1 Ser-480 phosphorylation in IQGAP1-mediated cell migration, HCC827 cells were co-transfected with IQGAP1 (S480A) phosphorylation-defective mutant and GLK plasmids. The transwell migration assays showed that the migrated cell number of GLK-overexpressing cell was decreased by overexpression of IQGAP1 (S480A) mutant (FIG. 19F, top-right panel; FIGS. 19G-H). Conversely, overexpression of two IQGAP1 Ser-480 phosphomimetic (S480D and S480E) mutants induced a higher cell migration ability than that of overexpression of IQGAP1 or IQGAP1 (S480A) mutant in HCC827 lung cancer cells. These results suggest that IQGAP1 Ser-480 phosphorylation is responsible for IQGAP1 activation and IQGAP1/Cdc42-mediated cell migration.
[0141] Our results suggest that GLK interacts with and phosphorylates IQGAP1. We next studied the interaction between GLK proline regions and IQGAP1 WW domain indeed controls the GLKIQGAP1-induced cell migration. HCC827 lung cancer cells co-transfected with GLK and IQGAP1 displayed enhancement of migration than that of vector control cells, whereas co-transfection of GLK plus IQGAP1 (WW) mutant abrogated the enhanced cell migration (FIGS. 19F-G). Overexpression of GLK (P436/437A), (P478/479A), or (P436/437A;P478/479A) mutant attenuated GLK-induced cell migration (FIGS. 19F-G). Overexpression of GLK and IQGAP1 was confirmed by immunoblotting analysis (FIG. 19H). To demonstrate the phosphorylation of IQGAP1 Ser-480 residue, we generated an anti-phospho-IQGAP1 (Ser-480) monoclonal antibody, which specifically recognized IQGAP1 WT but not S480A mutant (FIG. 19I).
IQGAP1 Mediates GLKInduced Cancer Metastasis
[0142] We next studied whether GLK promotes metastasis of lung cancer through IQGAP1-mediated cancer cell migration. To shorten the time (12 months) required for the development of lung cancer metastasis in SPA-EGFR.sup.del;Pol II -GLK Tg mice, we generated a GLK mutant transgenic mouse line (Pol II -GLK.sup.E351KTg), which expressed a constitutively activated GLK (E351K) mutant (FIGS. 20A-C). Notably, the GLK (E351K) mutation was reported in the supplementary information of a previous publication; however, the functional consequence of GLK (E351K) mutation has not been demonstrated until this study (FIGS. 20A-B). Overexpression of GLK (E351K) mutant was confirmed by real-time PCR (FIG. 20D). Next, we bred Pol II -GLK.sup.E351K Tg mice with SPA-EGFR.sup.del Tg mice to generate SPA-EGFR.sup.del;Pol II -GLK.sup.K351K Tg mice, which displayed enhanced GLK protein levels in the lung compared to those of SPA-EGFR.sup.del Tg mice (FIG. 20E). SPA-EGFR.sup.del;Pol II -GLK.sup.E351K Tg mice (8/8) indeed developed lung cancer (FIG. 20F) and regional/distant metastasis at a younger age (7-month-old) than that of SPA-EGFR.sup.del;Pol II -GLK Tg mice. All 7-month-old SPA-EGFR.sup.del;Pol II -GLK.sup.E351K Tg mice displayed distant metastasis of EGFR.sup.del-expressing lung cancer cells to the brain and/or liver (both brain and liver [6/8], brain only [1/8], and liver only [1/8] (FIG. 19G and Table 4). In contrast, all SPA-EGFR.sup.delPol II -GLK.sup.E351K;IQGAP1.sup./ mice did not develop any distant metastasis (3/3) at 7-month-old age (FIG. 20G and Table 4). These data suggest that GLK induces distant metastasis through IQGAP1 in SPA-EGFR.sup.del lung cancer model. To verify this notion, we studied the interaction between GLK and IQGAP1, as well as IQGAP1 Ser-480 phosphorylation in tissues of human non-small cell lung cancer (NSCLC).
TABLE-US-00004 TABLE 4 EGFR.sup.del Positive LN Brain Liver EGFR.sup.del; PolII-GLK.sup.E351K (n = 8) 8 7 7 EGFR.sup.del; PolII-GLK.sup.E251K; 0 0 0 IQGAP1.sup./ (n = 6) Fisher's exact test: P = P = P = EGFR.sup.del; PolII-GLK.sup.E251K vs. 0.0003*** 0.0047** 0.0047** EGFR.sup.del; PolII-GLK.sup.E251K; IQGAP1.sup./
GLKIQGAP1 Complex is Correlated with Poor Survival of Human NSCLC
[0143] To study the interaction of GLK with IQGAP1 in NSCLC tissues, we collected clinical lung tissues from 7 human NSCLC patients who underwent pulmonary resection. We also employed a commercially available pulmonary tissue array containing 85 NSCLC tissues (including 49 squamous cell carcinoma, 17 adenocarcinoma, 11 bronchioloalveolar carcinoma, and 8 large cell carcinoma) and 68 normal adjacent tissues, as well as 3 small cell lung carcinoma tissues. These tissues were subjected to in situ proximity ligation assay (PLA) with a combination of paired PLA probes corresponding to GLK and IQGAP1. The data showed multiple strong PLA signals in most (81/92) of NSCLC tissues but not in any small cell carcinoma tissues (FIGS. 21A-B). Most (61/68) of normal adjacent tissues from NSCLC patients did not display any PLA signals, while 7 of 68 normal adjacent tissues showed much less PLA signals. The few PLA signals in the normal adjacent tissues of NSCLC patients may be metastatic cancer cells migrating from original lesion. These results suggest that the GLKIQGAP1 complex in pulmonary tissue may be a diagnostic biomarker for NSCLC. Next, we studied whether the GLKIQGAP1 complex could act as a potential prognostic biomarker for NSCLCs. NSCLC (squamous cell carcinoma and adenocarcinoma) patients, whose survival data were available, were divided into four PLA-signal subgroups after cluster analyses. The two subgroups with highest PLA signals contained only one and two patients, respectively, thus, these two subgroups were excluded from further analysis. The remaining two subgroups (n=63) were subjected to Kaplan-Meier survival analysis using the survival data (available from the provider). NSCLC patients with high PLA signals showed poor survival during follow-up periods (n=63, PLA signal-High versus PLA signal-Low, P=0.069) (FIG. 21C). The higher P value (P=0.069) may be due to the exclusion of three data with highest PLA signals. Nevertheless, NSCLC patients with more GLKIQGAP1 complexes have a lower survival rate than that of the patients with less GLKIQGAP1 complexes. Because 40% to 60% of NSCLC patients the of cancer recurrence after cancer resection, we studied whether the GLKIQGAP1 complex is associated with NSCLC metastasis. The cancer cells with the GLKIQGAP1 complex particularly accumulated on/near the vascular wall in the lung (FIG. 21D); GLKIQGAP1 complex-positive cells also existed in lumen of the blood vessel (FIG. 21D). Moreover, the bone, lymph node, or soft tissue section with metastatic carcinoma displayed GLKIQGAP1 complex-positive cells (FIG. 21D), the cancer cells was verified using (proliferating cell nuclear antigen) PCNA staining (FIG. 21D). Merged images show that the GLKIQGAP1 complex-positive cells in these tissues were indeed cancer cells (FIG. 21D). The data suggest that lung cancer cells with the GLKIQGAP1 complex tend to be metastatic. Next, we examined the GLK-induced IQGAP1 Ser-480 phosphorylation in human NSCLC tissues. After several failed attempts, we finally obtained a monoclonal antibody (mAb) against IQGAP1 Ser-480 phosphorylation. However, the immunostaining signal using phospho-IQGAP1 mAb was not strong enough to provide a discernible signal. To enhance the specificity and staining signal of anti-phospho-IQGAP1 mAb, we performed PLA that amplifies phosphorylation signals like a polymerase chain reaction with a combination of paired PLA probes corresponding to IQGAP1 and phospho-IQGAP1 Ser-480. The antibody specificity was demonstrated using IQGAP1 S480A mutant-expressing cells and IQGAP1-knockout lung cancer tissues (SPA-EGFR.sup.del;Pol II-GLK.sup.E351K;IQGAP1.sup./). Using human NSCLC tissues, we found multiple PEA signals of IQGAP1 Ser-480 phosphorylation in 82.7% (72/87) of tumor tissues tested (FIGS. 21E-F). The phospho-IQGAP1 PLA signals coexisted with PCNA staining in the same cells (FIG. 21E). Moreover, NSCLC (squamous cell carcinoma and adenocarcinoma) patients were divided into PLA signal-High and PLA signal-Low subgroups after cluster analyses. Kaplan-Meier survival analysis showed that NSCLC patients with high phospho-IQGAP1 PLA signals had poor survival during follow-up periods (n=63, PLA signal-High versus PLA signal-Low, P=0.037) (FIG. 21G). Collectively, our findings suggest that GLK promotes cell migration and cancer metastasis by direct binding to and phosphorylating IQGAP1.
[0144] All references cited and discussed in this specification are incorporated herein by reference in their entireties and to the same extent as if each reference was individually incorporated by reference.