RlmA-inactivated filamentous fungal host cell

10550398 ยท 2020-02-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to RImA-inactivated filamentous fungal cells secreting a polypeptide of interest and methods of producing a secreted polypeptide of interest in said cells as well as methods of producing said cells.

Claims

1. An Aspergillus host cell comprising a heterologous polynucleotide encoding a secreted polypeptide of interest and comprising an inactivated rImA gene or homologue thereof, wherein said rImA gene or homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3.

2. The host cell of claim 1, wherein the secreted polypeptide of interest is an enzyme.

3. The host cell of claim 1, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO: 1.

4. The host cell of claim 1, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO: 2.

5. A method of producing a secreted polypeptide of interest, said method comprising the steps of: a) cultivating an Aspergillus host cell comprising a heterologous polynucleotide encoding the secreted polypeptide of interest and comprising an inactivated rImA gene or homologue thereof under conditions conducive to the expression of the secreted polypeptide of interest, wherein said rImA gene or homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO: 3; and, optionally, b) recovering the secreted polypeptide of interest.

6. The method of claim 5, wherein the secreted polypeptide of interest is an enzyme.

7. The method of claim 5, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO: 1.

8. The method of claim 5, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO: 2.

9. A method of producing an Aspergillus host cell having an improved yield of a secreted heterologous polypeptide of interest, said method comprising the following steps in no particular order: a) transforming a filamentous fungal host cell with a heterologous polynucleotide encoding the secreted polypeptide of interest; and b) inactivating an rImA gene or a homologue thereof in the filamentous fungal host cell, wherein said rImA gene or a homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO: 3.

10. The method of claim 9, wherein the secreted polypeptide of interest is an enzyme.

11. The method of claim 9, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO: 1.

12. The method of claim 9, wherein the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO: 2.

13. The host cell of claim 1, wherein the Aspergillus cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae cell.

14. The host cell of claim 2, wherein the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase.

15. The host cell of claim 2, wherein the enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.

16. The host cell of claim 1, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 85% identical to the amino acid sequence shown in SEQ ID NO: 3.

17. The host cell of claim 1, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 3.

18. The host cell of claim 1, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 95% identical to the amino acid sequence shown in SEQ ID NO: 3.

19. The method of claim 5, wherein the Aspergillus cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or an Aspergillus oryzae cell.

20. The method of claim 6, wherein the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase.

21. The method of claim 6, wherein the enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.

22. The method of claim 5, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 85% identical to the amino acid sequence shown in SEQ ID NO: 3.

23. The method of claim 5, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 3.

24. The method of claim 5, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 95% identical to the amino acid sequence shown in SEQ ID NO: 3.

25. The method of claim 10, wherein the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase.

26. The method of claim 10, wherein the enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.

27. The method of claim 9, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 85% identical to the amino acid sequence shown in SEQ ID NO: 3.

28. The method of claim 9, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 90% identical to the amino acid sequence shown in SEQ ID NO: 3.

29. The method of claim 9, wherein the RImA polypeptide comprises or consists of an amino acid sequence at least 95% identical to the amino acid sequence shown in SEQ ID NO: 3.

30. The host cell of claim 9, wherein the Aspergillus cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) Host Cells

(2) The present invention relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production and secretion of a heterologous polypeptide of interest.

(3) A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.

(4) The host cell may be a fungal cell. Fungi as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

(5) The fungal host cell of the invention is a filamentous fungal cell. Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.

(6) The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chtysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocaffimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

(7) For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chtysosporium inops, Chtysosporium keratinophilum, Chtysosporium lucknowense, Chrysosporium merdarium, Chtysosporium pannicola, Chtysosporium queenslandicum, Chtysosporium tropicum, Chtysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulaturn, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatutn, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

(8) Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787.

(9) In one aspect, the invention relates to methods of producing a filamentous fungal host cell having an improved yield of a secreted heterologous polypeptide of interest, said method comprising the following steps in no particular order: c) transforming a filamentous fungal host cell with a heterologous polynucleotide encoding the secreted polypeptide of interest; and d) inactivating an rImA gene or a homologue thereof in the filamentous fungal host cell, wherein said rImA gene or a homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3.

(10) In another aspect, the invention relates to the resulting host cells; filamentous fungal host cells comprising a heterologous polynucleotide encoding a secreted polypeptide of interest and comprising an inactivated rImA gene or homologue thereof, wherein said rImA gene or homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3.

(11) In a preferred embodiment of the aspects of the invention, the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.

(12) Preferably, the secreted polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.

(13) In a preferred embodiment of the invention, the RImA polypeptide comprises or consists of an amino acid sequence at least 80% identical to the amino acid sequence shown in SEQ ID NO:3; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the amino acid sequence shown in SEQ ID NO:3.

(14) Preferably, the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the genomic DNA sequence shown in SEQ ID NO:1. Alternatively, the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the cDNA sequence shown in SEQ ID NO:2.

(15) Nucleic Acid Constructs

(16) The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

(17) The polynucleotide may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.

(18) The control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

(19) Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Pat. No. 6,011,147.

(20) The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.

(21) Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.

(22) The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.

(23) The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader is operably linked to the 5-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.

(24) Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

(25) The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3-terminus of the polynucleotide and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.

(26) Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

(27) The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway. The 5-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide. Alternatively, the 5-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.

(28) Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

(29) The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.

(30) Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.

(31) It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.

(32) Expression Vectors

(33) The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

(34) The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

(35) The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

(36) The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

(37) Selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB (phosphoribosylaminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA, adeB, amdS, hph, and pyrG genes.

(38) The selectable marker may be a dual selectable marker system as described in WO 2010/039889. In one aspect, the dual selectable marker is an hph-tk dual selectable marker system.

(39) The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

(40) For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

(41) For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term origin of replication or plasmid replicator means a polynucleotide that enables a plasmid or vector to replicate in vivo.

(42) Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

(43) More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

(44) The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra).

(45) Removal or Reduction of RImA Activity

(46) The present invention also relates to methods of producing a mutant of a parent cell, which comprises inactivating, disrupting or deleting a polynucleotide, or a portion thereof, encoding an RImA polypeptide of the present invention, which results in the mutant cell producing less of the RImA polypeptide than the parent cell when cultivated under the same conditions.

(47) The mutant cell may be constructed by reducing or eliminating expression of the rImA polynucleotide or a homologue thereof using methods well known in the art, for example, insertions, disruptions, replacements, or deletions. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.

(48) Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.

(49) Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.

(50) When such agents are used, the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.

(51) Modification or inactivation of the rImA polynucleotide or homologue thereof may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.

(52) Methods for deleting or disrupting a targeted gene are described, for example, by Miller, et al (1985. Mol. Cell. Biol. 5:1714-1721); WO 90/00192; May, G. (1992. Applied Molecular Genetics of Filamentous Fungi. J. R. Kinghorn and G. Turner, eds., Blackie Academic and Professional, pp. 1-25); and Turner, G. (1994. Vectors for Genetic Manipulation. S. D. Martinelli and J. R. Kinghorn, eds., Elsevier, pp. 641-665).

(53) An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed. In an aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.

(54) The present invention also relates to methods of inhibiting the expression of a polypeptide having RImA activity in a cell, comprising administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence of an rImA polynucleotide or homologue thereof. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.

(55) The dsRNA is preferably a small interfering RNA (siRNA) or a micro RNA (miRNA). In a preferred aspect, the dsRNA is small interfering RNA for inhibiting transcription. In another preferred aspect, the dsRNA is micro RNA for inhibiting translation.

(56) The present invention also relates to such double-stranded RNA (dsRNA) molecules, comprising a portion of the mature polypeptide coding sequence of SEQ ID NO: 1 for inhibiting expression of the polypeptide in a cell. While the present invention is not limited by any particular mechanism of action, the dsRNA can enter a cell and cause the degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi); see, for example, U.S. Pat. No. 5,190,931.

(57) The dsRNAs of the present invention can be used in gene-silencing. In one aspect, the invention provides methods to selectively degrade RNA using a dsRNAi of the present invention. The process may be practiced in vitro, ex vivo or in vivo. In one aspect, the dsRNA molecules can be used to generate a loss-of-function mutation in a cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Pat. Nos. 6,489,127; 6,506,559; 6,511,824 and 6,515,109.

(58) The RImA polypeptide-deficient mutant cells are particularly useful as host cells for expression of heterologous secreted polypeptides.

(59) The methods used for cultivation and purification of the product of interest may be performed by methods known in the art.

(60) Methods of Production

(61) The host cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.

(62) The polypeptide may be detected using methods known in the art that are specific for the polypeptides. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide.

(63) The polypeptide may be recovered using methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, a fermentation broth comprising the polypeptide is recovered.

(64) The polypeptide may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.

(65) In an alternative aspect, the polypeptide is not recovered, but rather a host cell of the present invention expressing the polypeptide is used as a source of the polypeptide.

(66) One aspect of the invention relates to methods of producing a secreted polypeptide of interest, said method comprising the steps of: a) cultivating a filamentous fungal host cell comprising a heterologous polynucleotide encoding the secreted polypeptide of interest and comprising an inactivated rImA gene or homologue thereof under conditions conducive to the expression of the secreted polypeptide of interest, wherein said rImA gene or homologue thereof encodes an RImA polypeptide having at least 80% amino acid sequence identity with SEQ ID NO:3; and, optionally, b) recovering the secreted polypeptide of interest.

(67) In a preferred embodiment, the filamentous fungal host cell is of a genus selected from the group consisting of Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes and Trichoderma; even more preferably the filamentous fungal host cell is an Aspergillus cell; preferably an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or an Aspergillus oryzae cell.

(68) Preferably, the secreted polypeptide of interest is an enzyme; preferably the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, xylanase, or beta-xylosidase.

(69) In a preferred embodiment of the invention, the RImA polypeptide comprises or consists of an amino acid sequence at least 80% identical to the amino acid sequence shown in SEQ ID NO:3; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the amino acid sequence shown in SEQ ID NO:3.

(70) Preferably, the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence at least 80% identical to the genomic DNA sequence shown in SEQ ID NO:1; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the genomic DNA sequence shown in SEQ ID NO:1. Alternatively, the rImA gene or homologue thereof comprises or consists of a genomic nucleotide sequence, the cDNA sequence of which is at least 80% identical to the cDNA sequence shown in SEQ ID NO:2; preferably at least 85%, 90%, 95%, 96%, 97%, 98% or most preferably at least 99% identical to the cDNA sequence shown in SEQ ID NO:2.

EXAMPLES

(71) Materials and Methods

(72) Unless otherwise stated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, N.Y.; Ausubel, F. M. et al. (eds.) Current protocols in Molecular Biology, John Wiley and Sons, 1995; Harwood, C. R., and Cutting, S. M. (eds.) Molecular Biological Methods for Bacillus. John Wiley and Sons, 1990.

(73) Purchased Material (E. coli and Kits)

(74) E. coli DH5 (Toyobo) is used for plasmid construction and amplification. Amplified plasmids are recovered with Qiagen Plasmid Kit (Qiagen). Ligation is done with DNA ligation kit (Takara) or T4 DNA ligase (Boehringer Mannheim). Polymerase Chain Reaction (PCR) is carried out with Expand PCR system (Boehringer Mannheim). QIAquick Gel Extraction Kit (Qiagen) is used for the purification of PCR fragments and extraction of DNA fragment from agarose gel.

(75) Enzymes

(76) Enzymes for DNA manipulations (e.g. restriction endonucleases, ligases etc.) are obtainable from New England Biolabs, Inc. and were used according to the manufacturer's instructions.

(77) Plasmids

(78) pBluescript II SK- (Stratagene #212206).

(79) The pHUda801 harbouring A. nidulans pyrG gene and herpes simplex virus (HSV) thymidine kinase gene (TK) driven by A. nidulans glyceraldehyde-3-phosphate dehydrogenase promoter (Pgpd) and A. nidulans tryptophane synthase terminator (TtrpC) are described in example 4 in WO2012/160093.

(80) The sequence information for Gs AMG harboring the amyloglucosidase from Gloeophyllum sepiarium is disclosed in Example 1 (SEQ ID NO:2) in WO2011/068803.

(81) Microbial Strains

(82) The expression host strain Aspergillus niger M1412 (pyrG-phenotype/uridine auxotrophy) was isolated by Novozymes and is a derivative of Aspergillus nigerNN049184 which was isolated from soil described in example 14 in WO2012/160093. M1412 is a strain which can produce the glucoamylase (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) from Gloeophyllum sepiarium (Gs AMG).

(83) Medium

(84) COVE trace metals solution was composed of 0.04 g of NaB.sub.4O7.10H2O, 0.4 g of CuSO4.5H2O, 1.2 g of FeSO4.7H2O, 0.7 g of MnSO4.H2O, 0.8 g of Na2MoO2.2H2O, 10 g of ZnSO4.7H2O, and deionized water to 1 liter.

(85) 50COVE salts solution was composed of 26 g of KCl, 26 g of MgSO4.7H2O, 76 g of KH2PO4, 50 ml of COVE trace metals solution, and deionized water to 1 liter.

(86) COVE medium was composed of 342.3 g of sucrose, 20 ml of 50COVE salts solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl2, 25 g of Noble agar, and deionized water to 1 liter.

(87) COVE-N-Gly plates were composed of 218 g of sorbitol, 10 g of glycerol, 2.02 g of KNO3, 50 ml of COVE salts solution, 25 g of Noble agar, and deionized water to 1 liter.

(88) COVE-N (tf) was composed of 342.3 g of sucrose, 3 g of NaNO3, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.

(89) COVE-N top agarose was composed of 342.3 g of sucrose, 3 g of NaNO3, 20 ml of COVE salts solution, 10 g of low melt agarose, and deionized water to 1 liter.

(90) COVE-N was composed of 30 g of sucrose, 3 g of NaNO3, 20 ml of COVE salts solution, 30 g of Noble agar, and deionized water to 1 liter.

(91) STC buffer was composed of 0.8 M sorbitol, 25 mM Tris pH 8, and 25 mM CaCl.sub.2).

(92) STPC buffer was composed of 40% PEG 4000 in STC buffer.

(93) LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to 1 liter.

(94) LB plus ampicillin plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto agar, ampicillin at 100 g per ml, and deionized water to 1 liter.

(95) YPG medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, 20 g of glucose, and deionized water to 1 liter.

(96) SOC medium was composed of 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCl, 10 ml of 250 mM KCl, and deionized water to 1 liter.

(97) TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8.0, and deionized water to 1 liter.

(98) Transformation of Aspergillus

(99) Transformation of Aspergillus species can be achieved using the general methods for yeast transformation. The preferred procedure for the invention is described below.

(100) Aspergillus niger host strain was inoculated to 100 ml of YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32 C. at 80 rpm. Pellets were collected and washed with 0.6 M KCl, and resuspended 20 ml 0.6 M KCl containing a commercial -glucanase product (GLUCANEX, Novozymes NS, Bagsvrd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32 C. at 80 rpm until protoplasts were formed, and then washed twice with STC buffer.

(101) The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.510.sup.7 protoplasts/ml. Approximately 4 g of plasmid DNA was added to 100 l of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37 C. After the addition of 10 ml of 50 C. Cove or Cove-N top agarose, the reaction was poured onto Cove or Cove-N (if) agar plates and the plates were incubated at 32 C. for 5 days.

(102) PCR Amplifications in Example 1

(103) TABLE-US-00001 Component Volume Final Concentration 10x Buffer for KOD -Plus- 5 l 1x 2 mM dNTPs 5 l 0.2 mM each 25 mM MgSO.sub.4 2 l 1.0 mM 10 pmol/l Primer #1 1.5 l 0.3 M 10 pmol/l Primer #2 1.5 l 0.3 M Template DNA X l Genomic DNA Plasmid DNA 10-200 ng/50 l 1-50 ng/50 l PCR grade water Y l KOD-Plus- (1.0 U/l) 1 l 1.0 U/50 l Total reaction volume 50 l
3-Step Cycle:

(104) Pre - denaturation : 94 C . , 2 min . Denaturation : 94 C . , 15 sec . Annealing : Tm - [ 5 - 10 ] C . * , 30 sec . Extension : 68 C . , 1 min . / kb } 35 cycles
Lab-Scale Tank Cultivation for Gs AMG Production

(105) Fermentation was done as fed-batch fermentation (H. Pedersen 2000, Appl Microbiol Biotechnol, 53: 272-277). Selected strains were pre-cultured in liquid media then grown mycelia were transferred to the tanks for further cultivation of enzyme production. Cultivation was done at pH 4.75 at 34 C. for 7 days with the feeding of glucose and ammonium without over-dosing which prevents enzyme production. Culture supernatant after centrifugation was used for enzyme assay.

(106) Sequences

(107) TABLE-US-00002 SEQIDNO:1: AspergillusnigerrlmAgenomicDNAsequence SEQIDNO:2: AspergillusnigerrlmAcodingsequence SEQIDNO:3: AspergillusnigerrlmAaminoacidsequence SEQIDNO:4: PrimerHTJP-520 5 accgcggtggcggccgcattgggaaacataccgcctc SEQIDNO:5: PrimerHTJP-521 5 ggttcgctccactagttttccgggacgcgattagag SEQIDNO:6: PrimerHTJP-523 5 gcctacaggagaattcttaattaaacgaactagatctttcacctg SEQIDNO:7: PrimerHTJP-525 5 ctcgtaagcttctagaattgacgaccgaggctccg SEQIDNO:8: PrimerHTJP-553 5 gctaaaggtgatggaactgc SEQIDNO:9: PrimerHTJP-554 5 gagtgacggtattttggagg
Glucoamylase Activity

(108) Glucoamylase activity is measured in AmyloGlucosidase Units (AGU). The AGU is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute under the standard conditions 37 C., pH 4.3, substrate: maltose 23.2 mM, buffer: acetate 0.1 M, reaction time 5 minutes. An autoanalyzer system may be used. Mutarotase is added to the glucose dehydrogenase reagent so that any alpha-D-glucose present is turned into beta-D-glucose. Glucose dehydrogenase reacts specifically with beta-D-glucose in the reaction mentioned above, forming NADH which is determined using a photometer at 340 nm as a measure of the original glucose concentration.

(109) Amyloglycosidase Incubation:

(110) TABLE-US-00003 Substrate: maltose 23.2 mM Buffer: acetate 0.1M pH: 4.30 0.05 Incubation temperature: 37 C. 1 Reaction time: 5 minutes Enzyme working range: 0.5-4.0 AGU/mL
Color Reaction:

(111) TABLE-US-00004 GlucDH: 430 U/L Mutarotase: 9 U/L NAD: 0.21 mM Buffer: phosphate 0.12M; 0.15M NaCl pH: 7.60 0.05 Incubation temperature: 37 C. 1 Reaction time: 5 minutes Wavelength: 340 nm

Example 1 Disruption of the rImA Gene in Aspergillus niger

(112) Construction of the rImA Gene Disruption Plasmid pHiTe177

(113) Plasmid pHiTe177 was constructed to contain 5 and 3 flanking regions for the Aspergillus niger rImA gene separated by the A. nidulans orotidine-5-phosphate decarboxylase gene (pyrG) as a selectable marker with its terminator repeats, and the human Herpes simplex virus 1 (HSV-1) thymidine kinase gene. The HSV-1 thymidine kinase gene lies 3 of the 3 flanking region of the rImA gene, allowing for counter-selection of Aspergillus nigertransformants that do not correctly target to the rImA gene locus. The plasmid was constructed in several steps as described below.

(114) A PCR product containing the 5 flanking region of A. niger rImA was generated using the following primers:

(115) TABLE-US-00005 SEQIDNO:4: PrimerHTJP-520: 5 accgcggtggcggccgcattgggaaacataccgcctc SEQIDNO:5: PrimerHTJP-521: 5 ggttcgctccactagttttccgggacgcgattagag

(116) The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad C1000 Touch Thermal Cycler programmed for 1 cycle at 94 C. for 2 minutes; 35 cycles each at 94 C. for 15 seconds, 55 C. for 30 seconds, and 68 C. for 2 minutes; and a 4 C. hold. The resulting 1,495 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit.

(117) Plasmid pHUda801 (Example 4 in WO 2012160093 A1) was digested with NotI-HF and SpeI-HF (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,558 bp fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit. The 9,558 bp fragment was ligated to the 1,495 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50 C. for 15 minutes. 1 l of the reaction mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37 C. overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe177-5rImA

(118) A PCR product containing the 3 flanking region of A. niger rImA was generated using the following primers:

(119) TABLE-US-00006 SEQIDNO:6: PrimerHTJP-523: 5 gcctacaggagaattcttaattaaacgaactagatctttcacctg SEQIDNO:7: PrimerHTJP-555: 5 ctcgtaagcttctagaattgacgaccgaggctccg

(120) The desired fragment was amplified by PCR in a reaction composed of approximately 100 ng of genome DNA of Aspergillus niger M1412 as described in material and method. The reaction was incubated in a Bio-Rad C1000 Touch Thermal Cycler programmed for 1 cycle at 94 C. for 2 minutes; 35 cycles each at 94 C. for 15 seconds, 55 C. for 30 seconds, and 68 C. for 2 minutes; and a 4 C. hold. The 1,915 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit.

(121) Plasmid pHiTe177-5rImA was digested with XbaI and EcoRI-HF (New England Biolabs Inc.), and purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 8,997 bp fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit. The 8,997 bp fragment was ligated to the 1,915 bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.) according to the manufactory instructions. The reaction was performed at 50 C. for 10 minutes. Five l of the ligation mixture were transformed into DH5a chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37 C. overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHiTe177.

(122) The rImA-Disruption in Aspergillus niger Strain M1412

(123) Protoplasts of Aspergillus niger strain M1412 were prepared by cultivating the strain in 100 ml of YPG medium supplemented with 10 mM uridine at 32 C. for 16 hours with gentle agitation at 80 rpm. Pellets were collected and washed with 0.6 M KCl, and resuspended 20 ml 0.6 M KCl containing a commercial -glucanase product (GLUCANEX, Novozymes A/S, Bagsvrd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32 C. at 80 rpm until protoplasts were formed. Protoplasts were filtered through a funnel lined with MIRACLOTH into a 50 ml sterile plastic centrifuge tube and were washed with 0.6 M KCl to extract trapped protoplasts. The combined filtrate and supernatant were collected by centrifugation at 2,000 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 10-25 ml of STC and centrifuged again at 2,000 rpm for 10 minutes and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.510.sup.7 protoplasts/ml.

(124) Approximately 10 g of pHiTe177 was added to 0.4 ml of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. Three ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37 C. After the addition of 12 ml of 50 C. COVE-N top agarose, the mixture was poured onto the COVE-N plates and the plates were incubated at 30 C. for 7 days. The grown transformants were transferred with sterile toothpicks to Cove-N JP plates supplemented with 1.5 M 5-Flouro-2-deoxyuridine (FdU), an agent which kills cells expressing the herpes simplex virus (HSV) thymidine kinase gene (TK) harboring in pHiTe177. Single spore isolates were transferred to COVE-N-gly plates.

(125) Possible transformants of Aspergillus niger strain M1412 containing the pHiTe177 to disrupt rImA gene were screened by Southern blot analysis. Each of the spore purified transformants were cultivated in 3 ml of YPG medium and incubated at 30 C. for 2 days with shaking at 200 rpm. Biomass was collected using a MIRACLOTH lined funnel. Ground mycelia were subject to genome DNA preparation using FastDNA SPIN Kit for Soil (MP Biomedicals) follows by manufacture's instruction.

(126) Southern blot analysis was performed to confirm the disruption of the rImA gene locus. Five g of genomic DNA from each transformant were digested with NcoI-HF. The genomic DNA digestion reactions were composed of 5 g of genomic DNA, 1 l of NcoI-HF, 2 l of 10NEB CutSmart buffer, and water to 20 l. Genomic DNA digestions were incubated at 37 C. for approximately 16 hours. The digestions were submitted to 0.8% agarose gel electrophoresis using TAE buffer and blotted onto a hybond N+(GE Healthcare Life Sciences, Manchester, N.H., USA) using a TURBOBLOTTER for approximately 1 hour following the manufacturer's recommendations. The membrane was hybridized with a 479 bp digoxigenin-labeled Aspergillus niger rImA probe, which was synthesized by incorporation of digoxigenin-11-dUTP by PCR using primers HTJP-553 (sense) and HTJP-554 (antisense) shown below:

(127) TABLE-US-00007 SEQIDNO:8: PrimerHTJP-553: 5 gctaaaggtgatggaactgc SEQIDNO:9: PrimerHTJP-554: 5 gagtgacggtattttggagg

(128) The amplification reaction (50 l) was composed of 200 M PCR DIG Labeling Mix (Roche Applied Science, Palo Alto, Calif., USA), 0.5 M primers by KOD-Plus (TOYOBO) using pHiTe177 as template in a final volume of 50 l. The amplification reaction was incubated in a Bio-Rad C1000 Touch Thermal Cycler programmed for 1 cycle at 94 C. for 2 minutes; 30 cycles each at 94 C. for 15 seconds, 55 C. for 30 seconds, and 68 C. for 30 seconds and a 4 C. hold. PCR products were separated by 0.8% agarose gel electrophoresis using TAE buffer where a 0.5 kb fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit. The denatured probe was added directly to the DIG Easy Hyb buffer and an overnight hybridization at 42 C. was done. Following the post hybridization washes (twice in 2 SSC, room temperature, 5 min and twice in 0.1SSC, 68 C., 15 min. each), chemiluminescent detection using the DIG detection system and CPD-Star (Roche) was done followed by manufacture's protocol. The DIG-labeled DNA Molecular Weight Marker II (Roche) was used for the standard marker. The strains, 177-M1412-1 and 177-M1412-7, giving the correct integration at the rImA loci (a hybridized band shifted from 2981 bp to 5236 bp) were selected for the subsequent experiments.

Example 2: Effect of the rImA Gene Disruption on Glucoamylase Production

(129) Two strains from M1412 were fermented in lab-scale tanks and their enzyme activities (AGU activities) were measured followed by the materials and methods described above; results are shown in the table below. The rImA-disrupted strains showed around 1.2 times higher glucoamylase (AGU) activity than the reference rImA-wildtype strain M1412 in jar fermenters.

(130) TABLE-US-00008 TABLE 1 The average AGU activity of the selected three strains from each host strain, wherein the average Gs AMG yields from M1412 is normalized to 1.00. Strain AGU relative activity A. niger M1412 1.00 A. niger 177-M1412-1 (rlmA) 1.19 A. niger 177-M1412-7 (rlmA) 1.22

Example 3: Construction of Plasmids pHUda1260 and pIhar243

(131) Materials and Methods

(132) Plasmids

(133) pBluescript II SK- (Stratagene #212206). The plasmid pRika147 is described in example 9 in WO2012160093. The sequence information for PLC harboring the phospholipase C from Kionochaeta sp. is disclosed in WO 2015/173426 (SEQ ID NO: 2).

(134) Microbial Strains

(135) The expression host strain Aspergillus niger C3085 was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 which was isolated from soil described in example 14 in WO2012/160093. The strain 177-M1412-1 is described in Example 1 (NZ 14148-EP-EPA).

(136) Medium

(137) MSS is composed of 70 g Sucrose, 100 g Soybean powder (pH 6.0), water to 1 litre. MU-1glu+Zn-Suc is composed 260 g of glucose, 3 g of MgSO.sub.4.7H.sub.2O, 5 g of KH.sub.2PO.sub.4, 6 g of K.sub.2SO.sub.4, 23.6 g of succinic acid, amyloglycosidase trace metal solution 0.5 ml and 100 mM ZnSO.sub.4 7H.sub.2O 1 ml and urea 2 g (pH 4.5), water to 1 litre.
Phopspholipase C Expression in Shake Flask Fermentation.

(138) Shake flasks containing 100 ml of the seed medium MSS (70 g Sucrose, 100 g Soybean powder (pH 6.0), water to 1 litre) were inoculated with spores from the A. niger strain 127-C3085-16 and incubated at 30 C., with shaking (220 rpm) for 3 days. Ten ml of the seed culture was transferred to shake flasks containing 100 ml of the main medium MU-1glu+Zn-Suc and incubated at 30 C., with shaking (220 rpm) for 6 days. The culture supernatants were collected by centrifugation and used for sub-sequent assay.

(139) PLC Activity

(140) PLC activity was measured by following method.

(141) pNPPC substrate solution: 5 mM p-Nitrophenylphosphorylcholine (Sigma), 50 mM NaOAc,

(142) 0.5 mM zinc sulfate, pH 4.75

(143) Temperature: 30 C.

(144) Assay buffer: 50 mM NaOAc, 0.5 mM zinc sulfate, 0.1% Triton X-100, pH 4.75\

(145) Stop solution: 1M Tris-HCl, pH 8.5

(146) Fifty ul of diluted PLC samples (The supernatants were diluted in Assay buffer) were prepared. The assay was then started by adding 50 l of pNPPC substrate solution into the samples and the reaction mixture was incubated at 30 C. for 15 min. The reaction was terminated by adding 100 ul of stop solution. OD values are measured by microplate reader at 410 nm as the PLC activity.

(147) Construction of pHUda1260

(148) The plasmid pHUda1260 was constructed by changing from the A. nidulans orotidine-5-phosphate decarboxylase gene (pyrG) to the A. nidulans acetamidase gene (amdS) in pRika147.

(149) Plasmid pRika147 (described in example 9 in WO2012160093) was digested with SphI and SpeI, and its ends were filled-in by use of T4 DNA polymerase followed by manufacture's protocol (NEB, New England Biolabs, Inc.). The fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 9,241 bp fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit.

(150) Plasmid pHUda1019 (described in example 2 in WO2012160093) was digested with XbaI and AvrII, and its ends were filled-in by use of T4 DNA polymerase followed by manufacture's protocol (NEB, New England Biolabs, Inc.). The fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, where a 3,114 bp fragment containing amdS gene, A. oryzae tef1 (translation elongation factor 1) promoter and A. oryzae niaD (nitrate reductase) terminator was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit. The 9,241 bp fragment was ligated to the 3,114 bp fragment in a reaction composed of 1 l of the 9,241 bp fragment, 3 l of the 3,114 bp fragment, 1 l of 5 ligase Buffer, 5 l of 2 Ligase Buffer and 1 l of Ligase (Roche Rapid DNA Ligation Kit). The ligation reaction was incubated at room temperature for 10 minutes. Five l of the ligation mixture were transformed into DH5-alpha chemically competent E. coli cells. Transformants were spread onto LB plus ampicillin plates and incubated at 37 C. overnight. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The plasmid DNA was screened for proper ligation by use of proper restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was designated as pHUda1260.

(151) Construction of the PLC Gene Expression Plasmid PIhar243

(152) The codon-optimized PLC gene from Kionochaeta sp. designed by Novozymes (SEQ ID NO:10) was synthesized by GeneArt services (Thermo Fisher Scientific). The coding region was amplified from the GeneArt plasmid with the primers (SEQ ID NOs: 11 and 12) and ligated by In-Fusion HD Cloning Kit (Clontech Laboratories, Inc) into the pHUda1260 digested with BamHI and PmII to create pIhar243.

(153) TABLE-US-00009 SEQIDNO:11: agtcttgatcggatccaccatgagggcctcctccatctt SEQIDNO:12: cgttatcgtacgcaccacgtgctaaacggccatccggcgtttc
Transformation of PLC Gene in A. niger

(154) Chromosomal insertion into either A. niger C3085 or 177-M1412-1 of the PLC gene (pIhar243) with amdS selective marker was performed as described in WO 2012/160093. Strains which grew well were purified and subjected to southern blotting analysis to confirm whether the PLC gene in pHiTe243 was introduced at NA1, NA2, SP288 or PAY loci correctly or not. The following set of primers to make non-radioactive probe was used to analyze the selected transformants for the PLC coding region:

(155) TABLE-US-00010 SEQIDNO:13primerIH198: gtcactgccgcgcttgctgc SEQIDNO:14primerHTJP-375: ccgcacgtgctaaacggccatccggcgtttc

(156) Genomic DNA extracted from the selected transformants was digested by SpeI and PmII, then hybridized with a 334-bp digoxigenin-labeled PLC probe. By the right gene introduction event, hybridized signals at the size of 6.4 kb (NA1), 4.3 kb (NA2), 3.1 kb (SP288) and 5.3 kb (PAY) by SpeI and PmII digestion was observed probed described above.

(157) Among the strains given the right integration events of 4-copies of the genes at NA1, NA2, SP288 and PAY loci, one strain with the Kionochaeta PLC from C3085 (+rImA) was selected and designated as C3294. Three strains with the Kionochaeta PLC from 177-M1412-1 (rImA) were selected and designated as 169-C4572-1, 169-C4572-3 and 169-C4572-5.

Example 4 Effect of the rImA Gene Deletion on Phospholipase C Production

(158) Shaking flasks fermentation was done on the selected strains as described in materials and methods. Selected strains were pre-cultured in seed media then grown mycelia were transferred to the main medium for further cultivation of enzyme production. Cultivation was done at 30 C. for 6 days. Culture supernatants after centrifugation were used for enzyme assay.

(159) As anticipated, the rImA-disrupted strains showed around 1.2-times higher PLC activity than the reference rImA-wildtype strain C3294 under the conditions.

(160) TABLE-US-00011 TABLE 2 The average PLC activity of the selected strains from each host strain, wherein the average PLC yields from C3294 (reference) is normalized to 1.00. Strain PLC relative activity A. niger C3294 (+rlmA) 1.00 A. niger 169-C4572-1 (rlmA) 1.18 A. niger 169-C4572-3 (rlmA) 1.23 A. niger 169-C4572-5 (rlmA) 1.16