Humanized non-human animals with restricted immunoglobulin heavy chain loci
10542735 ยท 2020-01-28
Assignee
Inventors
- Lynn Macdonald (Harrison, NY)
- Naxin Tu (Pleasantville, NY, US)
- Sean Stevens (Del Mar, CA)
- Andrew J. Murphy (Croton-on-Hudson, NY)
- Margaret Karow (Santa Rosa Valley, NY)
Cpc classification
A01K2217/15
HUMAN NECESSITIES
C07K16/461
CHEMISTRY; METALLURGY
A01K67/0278
HUMAN NECESSITIES
C12P21/02
CHEMISTRY; METALLURGY
International classification
Abstract
Mice, embryos, cells, and tissues having a restricted immunoglobulin heavy chain locus and an ectopic sequence encoding one or more ADAM6 proteins are provided. In various embodiments, mice are described that have humanized endogenous immunoglobulin heavy chain loci and are capable of expressing an ADAM6 protein or ortholog or homolog or functional fragment thereof that is functional in a male mouse. Mice, embryos, cells, and tissues having an immunoglobulin heavy chain locus characterized by a single human V.sub.H gene segment, a plurality of human D.sub.H gene segments and a plurality of human J.sub.H gene segments and capable expressing an ADAM6 protein or ortholog or homolog or functional fragment thereof are also provided.
Claims
1. A mouse having in its germline: (a) an insertion comprising an unrearranged human genomic sequence comprising a single human V.sub.H gene segment, one or more D.sub.H gene segments, and one or more J.sub.H gene segments, wherein the single human V.sub.H gene segment, one or more D.sub.H gene segments, and one or more J.sub.H gene segments are operably linked to a mouse immunoglobulin heavy chain constant region gene at the endogenous immunoglobulin heavy chain locus, and wherein the single human V.sub.H gene segment is V.sub.H1-2 or a polymorphic variant thereof, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; and b) an insertion comprising a nucleic acid sequence that encodes a mouse ADAM6 protein that is functional in a male mouse, wherein the mouse ADAM6 protein is expressed if the mouse is a male mouse such that the male mouse has wild-type fertility, wherein the nucleic acid sequence that encodes the mouse ADAM6 protein is located upstream of the single human V.sub.H gene segment; wherein B cells of the mouse express antibodies in response to exposure to an antigen, wherein each antibody includes two immunoglobulin light chains paired with two immunoglobulin heavy chains, wherein each heavy chain comprises a human heavy chain variable domain expressed from a human heavy chain variable region sequence including a V.sub.H gene segment that is identical to, or a somatically hypermutated version of, the single human V.sub.H gene segment.
2. The mouse of claim 1, wherein the single human V.sub.H gene segment is a polymorphic variant of V.sub.H1-2.
3. The mouse of claim 1, wherein the mouse comprises a deletion of all functional endogenous V.sub.H gene segments.
4. The mouse of claim 1, wherein the unrearranged human genomic sequence comprises a human V.sub.H1-2 gene segment, 27 human D.sub.H gene segments, and six human J.sub.H gene segments.
5. The mouse of claim 1, further comprising one or more human V gene segments and one or more human J gene segments.
6. The mouse of claim 5, wherein the one or more human V gene segments and one or more human J gene segments are present at an endogenous immunoglobulin light chain locus.
7. The mouse of claim 1, wherein the mouse is a male mouse.
8. A cell or tissue derived from the mouse of claim 1 or 7.
9. A method of generating a rearranged human immunoglobulin heavy chain variable region sequence that encodes a human immunoglobulin heavy chain variable domain, the method comprising: (a) immunizing the mouse of claim 1 with an antigen of interest; (b) allowing said mouse to mount an immune response with respect to the antigen of interest; and (c) identifying or isolating a rearranged human immunoglobulin heavy chain variable region sequence that encodes a heavy chain variable domain of an antibody from the mouse that binds the antigen of interest.
10. The method of claim 9, wherein the heavy chain variable domain includes an amino acid sequence encoded by the single human V.sub.H gene segment, wherein the amino acid sequence encoded by the single human V.sub.H gene segment is at least 75% identical to SEQ ID NO: 64.
11. The method of claim 9, wherein the heavy chain variable domain includes an amino acid sequence encoded by the single V.sub.H gene segment, wherein the amino acid sequence encoded by the single human V.sub.H gene segment encodes an amino acid sequence identical to SEQ ID NO: 64.
12. A method for modifying an immunoglobulin heavy chain locus of a mouse, comprising: (a) making a first modification of the mouse immunoglobulin heavy chain locus, wherein the first modification comprises an insertion of one or more unrearranged human immunoglobulin gene sequences at the mouse immunoglobulin heavy chain locus, including a single human V.sub.H gene segment, one or more D.sub.H gene segments, and one or more J.sub.H gene segments, wherein the single human V.sub.H gene segment, one or more D.sub.H gene segments, and one or more J.sub.H gene segments are operably linked with a mouse immunoglobulin heavy chain constant region gene at the endogenous immunoglobulin heavy chain locus, wherein the single human V.sub.H gene segment is V.sub.H1-2 or a polymorphic variant thereof, wherein the insertion disrupts the function of an endogenous ADAM6 protein, and wherein the disruption of the endogenous ADAM6 function is associated with a reduction in fertility in male mice; and (b) making a second modification of the mouse which comprises an insertion of a mouse ADAM6 sequence upstream of the single human V.sub.H gene segment, wherein the mouse ADAM6 sequence encodes a mouse ADAM6 protein that is functional in a male mouse, wherein the functional mouse ADAM6 protein is expressed if the mouse is a male mouse such that the male mouse has wild-type fertility.
13. The method of claim 12, wherein the first modification comprises the replacement of one or more sequences in the mouse immunoglobulin heavy chain locus with the one or more unrearranged human immunoglobulin gene sequences.
14. The method of claim 12, wherein the first modification comprises the replacement of one or more endogenous V.sub.H gene segments with the single human V.sub.H gene segment in the endogenous immunoglobulin heavy chain locus.
15. The method of claim 12, wherein the first modification comprises the replacement of an endogenous heavy chain variable gene sequence with the one or more unrearranged human immunoglobulin gene sequences, including the single V.sub.H gene segment, operably linked with the mouse immunoglobulin heavy chain constant region gene in the endogenous immunoglobulin heavy chain locus.
16. The method of claim 12, wherein the first and the second modification are made simultaneously.
17. A method for generating an antibody specific against an antigen comprising the steps of: (a) immunizing the mouse of claim 1 with the antigen; (b) isolating at least one cell from the mouse producing an antibody specific against the antigen; and (c) culturing the at least one cell producing an antibody of step (b); and (d) obtaining said antibody.
18. The method of claim 17, wherein the culturing in step (c) is performed on at least one hybridoma cell generated from the at least one cell obtained in step (b).
19. The method of claim 17, wherein the at least one cell obtained in step (b) is derived from the spleen, a lymph node or bone marrow of the mouse from step (a).
20. The method of claim 17, wherein immunizing with the antigen of step (a) is carried out with protein, DNA, a combination of DNA and protein, or cells expressing the antigen.
21. The method of claim 9, wherein the heavy chain variable domain includes an amino acid sequence encoded by the single human V.sub.H gene segment, wherein the amino acid sequence encoded by the single human V.sub.H gene segment is at least 90% identical to SEQ ID NO: 64.
22. The method of claim 9, wherein the heavy chain variable domain includes an amino acid sequence encoded by the single human V.sub.H gene segment, wherein the amino acid sequence encoded by the single human V.sub.H gene segment is at least 95% identical to SEQ ID NO: 64.
23. The method of claim 9, wherein the heavy chain variable domain includes an amino acid sequence encoded by the single human V.sub.H gene segment, wherein the amino acid sequence encoded by the single human V.sub.H gene segment is at least 98% identical to SEQ ID NO: 64.
24. A method for making a human antigen-binding protein, comprising the steps of: (a) exposing a mouse of claim 1 to an antigen of interest; (b) allowing the mouse to mount an immune response to the antigen; and (c) obtaining from the mouse a heavy chain variable region nucleic acid sequence encoding a human heavy chain variable domain of an antibody that specifically binds the antigen of interest.
25. The method of claim 24, further comprising the step of (d) linking the human heavy chain variable region nucleic acid sequence to a human heavy chain constant region nucleic acid sequence.
26. The method of claim 25, further comprising the step of (e) expressing in a mammalian cell an antibody comprising the human heavy chain variable region nucleic acid sequence and the human heavy chain constant region nucleic acid sequence.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION
(11) This invention is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention is defined by the claims.
(12) Unless defined otherwise, all terms and phrases used herein include the meanings that the terms and phrases have attained in the art, unless the contrary is clearly indicated or clearly apparent from the context in which the term or phrase is used. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, particular methods and materials are now described. All publications mentioned are hereby incorporated by reference.
(13) The phrase substantial or substantially when used to refer to an amount of gene segments (e.g., substantially all V gene segments) includes both functional and non functional gene segments and include, in various embodiments, e.g., 80% or more, 85% or more, 90% or more, 95% or more 96% or more, 97% or more, 98% or more, or 99% or more of all gene segments; in various embodiments, substantially all gene segments includes, e.g., at least 95%, 96%, 97%, 98%, or 99% of functional (i.e., non-pseudogene) gene segments.
(14) The term replacement includes wherein a DNA sequence is placed into a genome of a cell in such a way as to replace a sequence within the genome with a heterologous sequence (e.g., a human sequence in a mouse), at the locus of the genomic sequence. The DNA sequence so placed may include one or more regulatory sequences that are part of source DNA used to obtain the sequence so placed (e.g., promoters, enhancers, 5- or 3-untranslated regions, appropriate recombination signal sequences, etc.). For example, in various embodiments, the replacement is a substitution of an endogenous sequence for a heterologous sequence that results in the production of a gene product from the DNA sequence so placed (comprising the heterologous sequence), but not expression of the endogenous sequence; the replacement is of an endogenous genomic sequence with a DNA sequence that encodes a protein that has a similar function as a protein encoded by the endogenous genomic sequence (e.g., the endogenous genomic sequence encodes an immunoglobulin gene or domain, and the DNA fragment encodes one or more human immunoglobulin genes or domains). In various embodiments, an endogenous gene or fragment thereof is replaced with a corresponding human gene or fragment thereof. A corresponding human gene or fragment thereof is a human gene or fragment that is an ortholog of, a homolog of, or is substantially identical or the same in structure and/or function, as the endogenous gene or fragment thereof that is replaced.
(15) The mouse as a genetic model has been greatly enhanced by transgenic and knockout technologies, which have allowed for the study of the effects of the directed over-expression or deletion of specific genes. Despite all of its advantages, the mouse still presents genetic obstacles that render it an imperfect model for human diseases and an imperfect platform to test human therapeutics or make them. First, although about 99% of human genes have a mouse homolog (Waterston et al. 2002, Initial sequencing and comparative analysis of the mouse genome, Nature 420:520-562), potential therapeutics often fail to cross-react, or cross-react inadequately, with mouse orthologs of the intended human targets. To obviate this problem, selected target genes can be humanized, that is, the mouse gene can be eliminated and replaced by the corresponding human orthologous gene sequence (e.g., U.S. Pat. Nos. 6,586,251, 6,596,541 and 7,105,348, incorporated herein by reference). Initially, efforts to humanize mouse genes by a knockout-plus-transgenic humanization strategy entailed crossing a mouse carrying a deletion (i.e., knockout) of the endogenous gene with a mouse carrying a randomly integrated human transgene (see, e.g., Bril at al., 2006, Tolerance to factor VIII in a transgenic mouse expressing human factor VIII cDNA carrying an Arg(593) to Cys substitution, Thromb Haemost 95:341-347; Homanics et al., 2006, Production and characterization of murine models of classic and intermediate maple syrup urine disease, BMC Med Genet 7:33; Jamsai et al., 2006, A humanized BAC transgenic/knockout mouse model for HbE/beta-thalassemia, Genomics 88(3):309-15; Pan et al., 2006, Different role for mouse and human CD3delta/epsilon heterodimer in preT cell receptor (preTCR) function:human CD3delta/epsilon heterodimer restores the defective preTCR function in CD3gamma- and CD3gammadelta-deficient mice, Mol Immunol 43:1741-1750). But those efforts were hampered by size limitations; conventional knockout technologies were not sufficient to directly replace large mouse genes with their large human genomic counterparts. A straightforward approach of direct homologous replacement, in which an endogenous mouse gene is directly replaced by the human counterpart gene at the same precise genetic location of the mouse gene (i.e., at the endogenous mouse locus), is rarely attempted because of technical difficulties. Until now, efforts at direct replacement involved elaborate and burdensome procedures, thus limiting the length of genetic material that could be handled and the precision with which it could be manipulated.
(16) Exogenously introduced human immunoglobulin transgenes rearrange in precursor B cells in mice (Alt et al., 1985, Immunoglobulin genes in transgenic mice, Trends Genet 1:231-236). This finding was exploited by engineering mice using the knockout-plus-transgenic approach to express human antibodies (Green et al., 1994, Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs, Nat Genet 7:13-21; Lonberg et al., 1994, Antigen-specific human antibodies from mice comprising four distinct genetic modifications, Nature 368:856-859; Jakobovits et al., 2007, From XenoMouse technology to panitumumab, the first fully human antibody product from transgenic mice, Nat Biotechnol 25:1134-1143). The mouse immunoglobulin heavy chain and light chain loci were inactivated in these mice by targeted deletion of small but critical portions of each endogenous locus, followed by introducing human immunoglobulin gene loci as randomly integrated large transgenes, as described above, or minichromosomes (Tomizuka et al., 2000, Double trans-chromosomic mice: maintenance of two individual human chromosome fragments containing Ig heavy and kappa loci and expression of fully human antibodies, PNAS USA 97:722-727). Such mice represented an important advance in genetic engineering; fully human monoclonal antibodies isolated from them yielded promising therapeutic potential for treating a variety of human diseases (Gibson et al., 2006, Randomized phase III trial results of panitumumab, a fully human anti-epidermal growth factor receptor monoclonal antibody, in metastatic colorectal cancer, Clin Colorectal Cancer 6:29-31; Jakobovits et al., 2007; Kim et al., 2007, Clinical efficacy of zanolimumab (HuMax-CD4): two Phase II studies in refractory cutaneous T-cell lymphoma, Blood 109(11):4655-62; Lonberg, 2005, Human antibodies from transgenic animals, Nat Biotechnol 23:1117-1125; Maker et al., 2005, Tumor regression and autoimmunity in patients treated with cytotoxic T lymphocyte-associated antigen 4 blockade and interleukin 2: a phase I/II study, Ann Surg Oncol 12:1005-1016; McClung et al., 2006, Denosumab in postmenopausal women with low bone mineral density, New Engl J Med 354:821-831). But, as discussed above, these mice exhibit compromised B cell development and immune deficiencies when compared to wild type mice. Such problems potentially limit the ability of the mice to support a vigorous humoral response and, consequently, generate fully human antibodies against some antigens. The deficiencies may be due to inefficient functionality due to the random introduction of the human immunoglobulin transgenes and resulting incorrect expression due to a lack of upstream and downstream control elements (Garrett et al., 2005, Chromatin architecture near a potential 3 end of the IgH locus involves modular regulation of histone modifications during B-Cell development and in vivo occupancy at CTCF sites, Mol Cell Biol 25:1511-1525; Manis et al., 2003, Elucidation of a downstream boundary of the 3 IgH regulatory region, Mol Immunol 39:753-760; Pawlitzky et al., 2006, Identification of a candidate regulatory element within the 5 flanking region of the mouse IgH locus defined by pro-B cell-specific hypersensitivity associated with binding of PU.1, Pax5, and E2A, J Immunol 176:6839-6851), inefficient interspecies interactions between human constant domains and mouse components of the B-cell receptor signaling complex on the cell surface, which may impair signaling processes required for normal maturation, proliferation, and survival of B cells (Hombach et al., 1990, Molecular components of the B-cell antigen receptor complex of the IgM class, Nature 343:760-762), and inefficient interspecies interactions between soluble human immunoglobulins and mouse Fc receptors that might reduce affinity selection (Rao et al., 2002, Differential expression of the inhibitory IgG Fc receptor FcgammaRIIB on germinal center cells: implications for selection of high-affinity B cells, J Immunol 169:1859-1868) and immunoglobulin serum concentrations (Brambell et al., 1964, A Theoretical Model of Gamma-Globulin Catabolism, Nature 203:1352-1354; Junghans and Anderson, 1996, The protection receptor for IgG catabolism is the beta2-microglobulin-containing neonatal intestinal transport receptor, PNAS USA 93:5512-5516; Rao et al., 2002; Hjelm et al., 2006, Antibody-mediated regulation of the immune response, Scand J Immunol 64:177-184; Nimmerjahn and Ravetch, 2007, Fc-receptors as regulators of immunity, Adv Immunol 96:179-204). These deficiencies can be corrected by in situ humanization of only the variable regions of the mouse immunoglobulin loci within their natural locations at the endogenous heavy and light chain loci. This would effectively result in mice that make reverse chimeric (i.e., human V:mouse C) antibodies which would be capable of normal interactions and selection with the mouse environment based on retaining mouse constant regions. Taking this approach, a particular version of a humanized locus can be constructed based on the complexity of the chimeric locus that is desired. Further such reverse chimeric antibodies may be readily reformatted into fully human antibodies for therapeutic purposes.
(17) Genetically modified animals that comprise an insertion or a replacement at the endogenous immunoglobulin heavy chain locus with heterologous (e.g., from another species) immunoglobulin sequences can be made in conjunction with insertions or replacements at endogenous immunoglobulin light chain loci or in conjunction with immunoglobulin light chain transgenes (e.g., chimeric immunoglobulin light chain transgenes or fully human fully mouse, etc.). The species from which the heterologous immunoglobulin heavy chain sequences are derived can vary widely; as with immunoglobulin light chain sequences employed in immunoglobulin light chain sequence replacements or immunoglobulin light chain transgenes. Exemplary heterologous immunoglobulin heavy chain sequences include human sequences.
(18) Immunoglobulin variable region nucleic acid sequences, e.g., V, D, and/or J segments, are in various embodiments obtained from a human or a non-human animal. Non-human animals suitable for providing V, D, and/or J segments include, for example bony fish, cartilaginous fish such as sharks and rays, amphibians, reptiles, mammals, birds (e.g., chickens). Non-human animals include, for example, mammals. Mammals include, for example, non-human primates, goats, sheep, pigs, dogs, bovine (e.g., cow, bull, buffalo), deer, camels, ferrets and rodents and non-human primates (e.g., chimpanzees, orangutans, gorillas, marmosets, rhesus monkeys baboons). Suitable non-human animals are selected from the rodent family including rats, mice, and hamsters. In one embodiment, the non-human animals are mice. As clear from the context, various non-human animals can be used as sources of variable domains or variable region gene segments (e.g., sharks, rays, mammals, e.g., camels, rodents such as mice and rats).
(19) According to the context, non-human animals are also used as sources of constant region sequences to be used in connection with variable sequences or segments, for example, rodent constant sequences can be used in transgenes operably linked to human or non-human variable sequences (e.g., human or non-human primate variable sequences operably linked to, e.g., rodent, e.g., mouse or rat or hamster, constant sequences). Thus, in various embodiments, human V, D, and/or J segments are operably linked to rodent (e.g., mouse or rat or hamster) constant region gene sequences. In some embodiments, the human V, D, and/or J segments (or one or more rearranged VDJ or VJ genes) are operably linked or fused to a mouse, rat, or hamster constant region gene sequence in, e.g., a transgene integrated at a locus that is not an endogenous immunoglobulin locus.
(20) In a specific embodiment, a mouse is provided that comprises a replacement of V.sub.H, D.sub.H, and J.sub.H gene segments at an endogenous immunoglobulin heavy chain locus with a single human V.sub.H, one or more D.sub.H, and one or more J.sub.H gene segments, wherein the single human V.sub.H, One or more D.sub.H, and one or more J.sub.H gene segments are operably linked to an endogenous immunoglobulin heavy chain gene; wherein the mouse comprises a transgene at a locus other than an endogenous immunoglobulin locus, wherein the transgene comprises an unrearranged or rearranged human V.sub.L and human J.sub.L gene segment operably linked to a mouse or rat or human constant region. In various embodiments, the single human V.sub.H gene segment is a polymorphic gene segment. In one embodiment, the single human V.sub.H gene segment is a human V.sub.H1-69 gene segment or a human V.sub.H1-2 gene segment.
(21) A method for an in situ genetic replacement of the mouse germline immunoglobulin heavy chain variable gene locus with a restricted human germline immunoglobulin heavy chain locus and replacement of the mouse germline immunoglobulin light chain variable gene loci with human germline immunoglobulin light chain loci, while maintaining the ability of the mice to generate offspring, is described. Specifically, the precise replacement of six megabases of both the mouse heavy chain and light chain immunoglobulin variable gene loci with human immunoglobulin heavy and light chain sequences, while leaving the mouse constant regions intact, is described. As a result, mice have been created that have a precise replacement of their entire germline immunoglobulin variable repertoire with human germline immunoglobulin variable sequences, while maintaining mouse constant regions. The human variable regions are linked to mouse constant regions to form chimeric human-mouse immunoglobulin loci that rearrange and express at physiologically appropriate levels. The antibodies expressed are reverse chimeras, i.e., they comprise human variable region sequences and mouse constant region sequences.
(22) The genetically modified mice described herein exhibit a fully functional humoral immune system and provide a plentiful source of naturally affinity-matured human immunoglobulin variable region sequences for making pharmaceutically acceptable antibodies and other antigen-binding proteins that are effective for combating pathogenic antigens, e.g., viral antigens.
(23) The engineering of human immunoglobulin sequences in the genome of a mouse, even at precise locations, e.g., at the endogenous mouse immunoglobulin loci, may present certain challenges due to divergent evolution of the immunoglobulin loci between mouse and man. For example, intergenic sequences interspersed within the immunoglobulin loci are not identical between mice and humans and, in some circumstances, may not be functionally equivalent. Differences between mice and humans in their immunoglobulin loci can still result in abnormalities in humanized mice, particularly when humanizing or manipulating certain portions of endogenous mouse immunoglobulin heavy chain loci. Some modifications at mouse immunoglobulin heavy chain loci are deleterious. Deleterious modifications can include, for example, loss of the ability of the modified mice to mate and produce offspring. In various embodiments, engineering human immunoglobulin sequences in the genome of a mouse includes methods that maintain endogenous sequences that when absent in modified mouse strains are deleterious. Exemplary deleterious effects may include inability to propagate modified strains, loss of function of essential genes, inability to express polypeptides, etc. Such deleterious effects may be directly or indirectly related to the modification engineered into the genome of the mouse.
(24) Notwithstanding the near wild-type humoral immune function observed in mice with humanized immunoglobulin loci, there are other challenges encountered when employing a direct replacement of immunoglobulin sequences that is not encountered in some approaches that employ randomly integrated transgenes. Differences in the genetic composition of the immunoglobulin loci between mice and humans has lead to the discovery of sequences beneficial for the propagation of mice with replaced immunoglobulin gene segments. Specifically, mouse ADAM genes located within the endogenous immunoglobulin locus are optimally present in mice with replaced immunoglobulin loci, due to their role in fertility.
(25) A precise, in situ replacement of six megabases of the variable regions of the mouse heavy chain immunoglobulin loci (V.sub.H-D.sub.H-J.sub.H) with a restricted human immunoglobulin heavy chain locus was performed, while leaving the flanking mouse sequences intact and functional within the hybrid loci, including all mouse constant chain genes and locus transcriptional control regions (
(26) Mice With Restricted Immunoglobulin Heavy Chain Variable Gene Segments
(27) Non-human animals comprising immunoglobulin loci that comprise a restricted number of V.sub.H genes, and one or more D genes and one or more J genes, are provided, as are methods of making and using them. When immunized with an antigen of interest, the non-human animals generate B cell populations with antibody variable regions derived only from the restricted, pre-selected V.sub.H gene or set of V.sub.H genes (e.g., a pre-selected V.sub.H gene and variants thereof). In various embodiments, non-human animals are provided that generate B cell populations that express human antibody variable domains that are human heavy chain variable domains, along with cognate human light chain variable domains. In various embodiments, the non-human animals rearrange human heavy chain variable gene segments and human light chain variable gene segments from modified endogenous mouse immunoglobulin loci that comprise a replacement or insertion of the non-human unrearranged variable region sequences with human unrearranged variable region sequences.
(28) Early work on the organization, structure, and function of the immunoglobulin genes was done in part on mice with disabled endogenous loci and engineered to have transgenic loci (randomly placed) with partial human immunoglobulin genes, e.g., a partial repertoire of human heavy chain genes linked with a human constant gene, randomly inserted into the genome, in the presence or absence of a human light chain transgene. Although these mice were somewhat less than optimal for making useful high affinity antibodies, they facilitated certain functional analyses of immunoglobulin loci. Some of these mice had as few as two or three, or even just a single, heavy chain variable gene.
(29) Mice that express fully human immunoglobulin heavy chains derived from a single human V.sub.H5-51 gene and 10 human D.sub.H genes and six human J.sub.H genes, with human and 1 constant genes, on a randomly inserted transgene (and disabled endogenous immunoglobulin loci) have been reported (Xu and Davis, 2000, Diversity in the CDR3 Region of V.sub.H Is Sufficient for Most Antibody Specificities, Immunity 13:37-45). The fully human immunoglobulin heavy chains of these mice are mostly expressed with one of just two fully mouse light chains derived from the endogenous mouse light chain locus (V1-J1 or V2-J2 only), and can express no light chain (the mice are Ig.sup./). These mice exhibit severely abnormal dysfunction in B cell development and antibody expression. B cell numbers are reportedly 5-10% of wild-type, IgM levels 5-10% of wild-type, and IgG1 levels are only 0.1-1% of wild-type. The observed IgM repertoire revealed highly restricted junctional diversity. The fully human heavy chains display largely identical CDR3 length across antigens, the same J.sub.H (J.sub.H2) usage across antigens, and an initial junctional Q residue, thus reflecting a certain lack of CDR3 diversity. The fully mouse light chains nearly all had a W96L substitution in J1 as initial junctional residue. The mice are reportedly unable to generate any antibodies against bacterial polysaccharide. Because the human variable domains couple with mouse light chains, the utility of the human variable regions is highly limited.
(30) Other mice that have just a single human V.sub.H3-23 gene, human D.sub.H and J.sub.H genes, and mouse light chain genes have been reported, but they exhibit a limited diversity (and thus a limited usefulness) due in part to mispairing potential between human V.sub.H and mouse V.sub.L domains (see, e.g., Mageed et al., 2001, Rearrangement of the human heavy chain variable region gene V3-23 in transgenic mice generates antibodies reactive with a range of antigens on the basis of V.sub.HCDR3 and residues intrinsic to the heavy chain variable region, Clin. Exp. Immunol. 123:1-5). Similarly, mice that bear two V.sub.H genes (3-23 and 6-1) along with human D.sub.H and J.sub.H genes in a transgene containing the human constant gene (Bruggemann et al., 1991, Human antibody production in transgenic mice: expression from 100 kb of the human IgH locus, Eur. J. Immmunol. 21:1323-1326) and express them in human IgM chains with mouse light chains may exhibit a repertoire limited by mispairing (Mackworth-Young et al., 2003, The role of antigen in the selection of the human V3-23 immunoglobulin heavy chain variable region gene, Clin. Exp. Immunol. 134:420-425).
(31) Other transgenic mice that express V.sub.H-restricted fully human heavy chains from a human transgene randomly inserted in the genome, with a limited human repertoire expressed from a fully human randomly inserted transgene, have also been reported (see, e.g., Taylor et al., 1992, A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins, Nucleic Acids Res. 20(23):6287-6295; Wagner et al., 1994, Antibodies generated form human immunoglobulin miniloci in transgenic mice, Nucleic Acids Res. 22(8):1389-1393). However, transgenic mice that express fully human antibodies from transgenes randomly integrated into the mouse genome, and that comprise damaged endogenous loci, are known to exhibit substantial differences in immune response as compared with wild-type mice that affect the diversity of the antibody variable domains obtainable from such mice.
(32) Useful non-human animals that generate a diverse population of B cells that express human antibody variable domains from a restricted V.sub.H gene repertoire and one or more D genes and one or more J genes will be capable of generating, preferably in some embodiments, repertoires of rearranged variable region genes that will be sufficiently diverse. In various embodiments, diversity includes junctional diversity, somatic hypermutation, and polymorphic diversity in V.sub.H gene sequence (for embodiments where V.sub.H genes are present in polymorphic forms). Combinatorial diversity occurs in the pairing of the V.sub.H gene with one of a plurality of cognate human light chain variable domains (which, in various embodiments, comprise junctional diversity and/or somatic hypermutations).
(33) Non-human animals comprising a restricted human V.sub.H gene repertoire and a complete or substantially complete human V.sub.L gene repertoire will in various embodiments generate populations of B cells that reflect the various sources of diversity, such as junctional diversity (e.g., VDJ, VJ joining, P additions, N additions), combinatorial diversity (e.g., cognate V.sub.H-restricted human heavy, human light), and somatic hypermutations. In embodiments comprising a restriction of the V.sub.H repertoire to one human V.sub.H gene, the one human V.sub.H gene can be present in two or more variants. In various embodiments, the presence of two or more polymorphic forms of a V.sub.H gene will enrich the diversity of the variable domains of the B cell population.
(34) Variations in the germline sequences of gene segments (e.g., V genes) contribute to the diversity of the antibody response in humans. The relative contribution to diversity due to V gene sequence differences varies among V genes. The degree of polymorphism varies across gene families, and is reflected in a plurality of haplotypes (stretches of sequence with coinherited polymorphisms) capable of generating further diversity as observed in V.sub.H haplotype differences between related and unrelated individuals in the human population (see, e.g., Souroujon et al., 1989, Polymorphisms in Human H Chain V Region Genes from the V.sub.HIII Gene Family, J. Immunol. 143(2):706-711). Some have suggested, based on data from particularly polymorphic human V.sub.H gene families, that haplotype diversity in the germline is a major contributor to V.sub.H gene heterogeneity in the human population, which is reflected in the large diversity of different germline V.sub.H genes across the human population (see, Sasso et al., 1990, Prevalence and Polymorphism of Human V.sub.H3 Genes, J. Immunol. 145(8):2751-2757).
(35) Although the human population displays a large diversity of haplotypes with respect to the V.sub.H gene repertoire due to widespread polymorphism, certain polymorphisms are reflected in prevalent (i.e., conserved) alleles observed in the human population (Sasso et al., 1990). V.sub.H polymorphism can be described in two principle forms. The first is variation arising from allelic variation associated with differences among the nucleotide sequence between alleles of the same gene segment. The second arises from the numerous duplications, insertions, and/or deletions that have occurred at the immunoglobulin heavy chain locus. This has resulted in the unique situation in which V.sub.H genes derived by duplication from identical genes differ from their respective alleles by one or more nucleotide substitutions. This also directly influences the copy number of V.sub.H genes at the heavy chain locus.
(36) Polymorphic alleles of the human immunoglobulin heavy chain variable gene segments (V.sub.H genes) have largely been the result of insertion/deletion of gene segments and single nucleotide differences within coding regions, both of which have the potential to have functional consequences on the immunoglobulin molecule. Table 1 sets forth the functional V.sub.H genes listed by human V.sub.H gene family and the number of identified alleles for each V.sub.H gene in the human immunoglobulin heavy chain locus. There are some findings to suggest that polymorphic V.sub.H genes have been implicated in susceptibility to certain diseases such as, for example, rheumatoid arthritis, whereas in other cases a linkage between V.sub.H and disease has been less clear. This ambiguity has been attributed to the copy number and presence of various alleles in different human populations. In fact, several human V.sub.H genes demonstrate copy number variation (e.g., V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, and V.sub.H3-23). In various embodiments, humanized mice as described herein with restricted V.sub.H repertoires comprise multiple polymorphic variants of an individual V.sub.H family member (e.g., two or more polymorphic variants of V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, or V.sub.H3-23, replacing all or substantially all functional mouse V.sub.H segments at an endogenous mouse locus). In a specific embodiment, the two or more polymorphic variants of mice described herein are in number up to and including the number indicated for the corresponding V.sub.H family member in Table 1 (e.g., for V.sub.H1-69, 13 variants; for V.sub.H1-2, five variants; etc.).
(37) Commonly observed variants of particular human V.sub.H genes are known in the art. For example, one of the most complex polymorphisms in the V.sub.H locus belongs to the V.sub.H1-69 gene. The human V.sub.H1-69 gene has 13 reported alleles (Sasso et al., 1993, A fetally expressed immunoglobulin V.sub.H1 gene belongs to a complex set of alleles, Journal of Clinical Investigation 91:2358-2367; Sasso et al., 1996, Expression of the immunoglobulin V.sub.H gene 51p1 is proportional to its germline gene copy number, Journal of Clinical Investigation 97(9):2074-2080) and exists in at least three haplotypes that carry duplications of the V.sub.H1-69 gene, which results in multiple copies of the V.sub.H gene at a given locus. These polymorphic alleles include differences in the complementarity determining regions (CDRs), which may dramatically influence antigen specificity. Table 2 sets for the reported alleles for human V.sub.H1-69 and human V.sub.H1-2 genes and the SEQ ID NOs for the DNA and protein sequences of the mature heavy chain variable regions.
(38) Representative genomic DNA and full-length protein sequences of a V.sub.H1-69 gene are set forth in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
(39) TABLE-US-00001 TABLE 1 V.sub.H Family V.sub.H Gene Alleles V.sub.H 1-2 5 Family 1 1-3 2 1-8 2 1-18 3 1-24 1 1-45 3 1-46 3 1-58 2 1-69 13 V.sub.H 2-5 10 Family 2 2-26 1 2-70 13 V.sub.H 3-7 3 Family 3 3-9 2 3-11 4 3-13 4 3-15 8 3-16 2 3-20 1 3-21 4 3-23 5 3-30 19 3-30-3 2 3-30-5 1 3-33 6 3-35 1 3-38 2 3-43 2 3-48 4 3-49 5 3-53 4 3-64 5 3-66 4 3-72 2 3-73 2 3-74 3 V.sub.H 4-4 7 Family 4 4-28 6 4-30-1 1 4-30-2 5 4-30-4 6 4-31 10 4-34 13 4-39 7 4-59 10 4-61 8 V.sub.H 5-51 5 Family 5 V.sub.H 6-1 2 Family 6 V.sub.H 7-4-1 5 Family 7 7-81 1
(40) TABLE-US-00002 TABLE 2 Accession SEQ ID NO: number (DNA/Protein) IgHV1-69 Allele IgHV1-69*01 L22582 37/38 IgHV1-69*02 Z27506 39/40 IgHV1-69*03 X92340 41/42 IgHV1-69*04 M83132 43/44 IgHV1-69*05 X67905 45/46 IgHV1-69*06 L22583 47/48 IgHV1-69*07 Z29978 49/50 IgHV1-69*08 Z14309 51/52 IgHV1-69*09 Z14307 53/54 IgHV1-69*10 Z14300 55/56 IgHV1-69*11 Z14296 57/58 IgHV1-69*12 Z14301 59/60 IgHV1-69*13 Z14214 61/62 IgHV1-2 Allele IgHV1-2*01 X07448 63/64 IgHV1-2*02 X62106 65/66 IgHV1-2*03 X92208 67/68 IgHV1-2*04 Z12310 69/70 IgHV1-2*05 HM855674 71/72
Antigen-Dependent Heavy Chain Variable Gene Usage
(41) Antigen-dependent preferential usage of V.sub.H genes can be exploited in the development of human therapeutics targeting clinically significant antigens. The ability to generate a repertoire of antibody variable domains using a particular V.sub.H gene can provide a significant advantage in the search for high-affinity antibody variable domains to use in human therapeutics. Studies on naive mouse and human V.sub.H gene usage in antibody variable domains reveal that most heavy chain variable domains are not derived from any particularly single or dominantly used V.sub.H gene. On the other hand, studies of antibody response to certain antigens reveal that in some cases a particular antibody response displays a biased usage of a particular V.sub.H gene in the B cell repertoire following immunization.
(42) Although the human V.sub.H repertoire is quite diverse, by some estimates the expected frequency of usage of any given V.sub.H gene, assuming random selection of V.sub.H genes, is about 2% (Brezinschek et al., 1995, Analysis of the Heavy Chain Repertoire of Human Peripheral B Cells Using Single-Cell Polymerase Chain Reaction, J. Immunol. 155:190-202). But V.sub.H usage in peripheral B cells in humans is skewed. In one study, functional V gene abundance followed the pattern V.sub.H3>V.sub.H4>V.sub.H1>V.sub.H2>V.sub.H5>V.sub.H6 (Davidkova et al., 1997, Selective Usage of V.sub.H Genes in Adult Human Lymphocyte Repertoires, Scand. J. Immunol. 45:62-73). One early study estimated that V.sub.H3 family usage frequency was about 0.65, whereas V.sub.H1 family usage frequency was about 0.15; these and other observations suggest that the germline complexity of the human V.sub.H repertoire is not precisely reflected in the peripheral B cell compartment in humans that have a normal germline V.sub.H repertoire, a situation that is similar to that observed in the mousei.e., V.sub.H gene expression is non-stochastic (Zouali and These, 1991, Probing V.sub.H Gene-Family Utilization in Human Peripheral B Cells by In Situ Hybridization, J. Immunol. 146(8):2855-2864). According to one report, V.sub.H gene usage in humans, from greatest to least, is V.sub.H3>V.sub.H4>V.sub.H1>V.sub.H5>V.sub.H2>V.sub.H6; rearrangements in peripheral B cells reveal that V.sub.H3 family usage is higher than to be expected based on the relative number of germline V.sub.H3 genes (Brezinschek et al., 1995). According to another report V.sub.H usage in humans follows the pattern V.sub.H3>V.sub.H5>V.sub.H2>V.sub.H1>V.sub.H4>V.sub.H6, based on analysis of pokeweed mitogen-activated peripheral small immunocompetent B cells (Davidkova et al., 1997, Selective Usage of V.sub.H Genes in Adult Human B Lymphocyte Repertoires, Scand. J. Immunol. 45:62-73). One report asserts that among the most frequently used V.sub.H3 family members are 3-23, 3-30 and 3-54 (Brezinschek et al., 1995). In the V.sub.H4 family, member 4-59 and 4-4b were found relatively more frequently (Id.), as well as 4-39 and 4-34 (Brezinscheck et al., 1997, Analysis of the Human V.sub.H Gene Repertoire, J. Clin. Invest. 99(10):2488-2501). Others postulate that the activated heavy chain repertoire is skewed in favor of high V.sub.H5 expression and lower V.sub.H3 expression (Van Dijk-Hard and Lundkvist, 2002, Long-term kinetics of adult human antibody repertoires, Immunology 107:136-144). Other studies assert that the most commonly used V.sub.H gene in the adult human repertoire is V.sub.H4-59, followed by V.sub.H3-23 and V.sub.H3-48 (Arnaout et al., 2001, High-Resolution Description of Antibody Heavy-Chain Repertoires in Humans, PLoS ONE 6(8):108). Although usage studies are based on relatively small sample numbers and thus exhibit high variance, taken together the studies suggest that V gene expression is not purely stochastic. Indeed, studies with particular antigens have established thatin certain casesthe deck is firmly stacked against certain usages and in favor of others.
(43) Over time, it became apparent that the observed repertoire of human heavy chain variable domains generated in response to certain antigens is highly restricted. Some antigens are associated almost exclusively with neutralizing antibodies having only certain particular V.sub.H genes, in the sense that effective neutralizing antibodies are derived from essentially only one V.sub.H gene. Such is the case for a number of clinically important human pathogens.
(44) V.sub.H1-69-derived heavy chains have been observed in a variety of antigen-specific antibody repertoires of therapeutic significance. For instance, V.sub.H1-69 was frequently observed in heavy chain transcripts of an IgE repertoire of peripheral blood lymphocytes in young children with atopic disease (Bando et al., 2004, Characterization of V.sub.H gene expressed in PBL from children with atopic diseases: detection of homologous V.sub.H1-69 derived transcripts from three unrelated patients, Immunology Letters 94:99-106). V.sub.H1-69-derived heavy chains with a high degree of somatic hypermutation also occur in B cell lymphomas (Perez et al., 2009, Primary cutaneous B-cell lymphoma is associated with somatically hypermutated immunoglobulin variable genes and frequent use of V.sub.H1-69 and V.sub.H4-59 segments, British Journal of Dermatology 162:611-618), whereas some V.sub.H1-69-derived heavy chains with essentially germline sequences (i.e., little to no somatic hypermutation) have been observed among autoantibodies in patients with blood disorders (Pos et al., 2008, V.sub.H1-69 germline encoded antibodies directed towards ADAMTS13 in patients with acquired thrombotic thrombocytopenic purpura, Journal of Thrombosis and Haemostasis 7:421-428).
(45) Further, neutralizing antibodies against viral antigens such as HIV, influenza and hepatitis C (HCV) have been found to utilize germline and/or somatically mutated V.sub.H1-69-derived sequences (Miklos et al., 2000, Salivary gland mucosa-associated lymphoid tissue lymphoma immunoglobulin V.sub.H genes show frequent use of V1-69 with distinctive CDR3 features, Blood 95(12):3878-3884; Kunert et al., 2004, Characterization of molecular features, antigen-binding, and in vitro properties of IgG and IgM variants of 4E10, an anti-HIV type I neutralizing monoclonal antibody, Aids Research and Human Retroviruses 20(7):755-762; Chan et al., 2001, V.sub.H1-69 gene is preferentially used by hepatitis C virus-associated B cell lymphomas and by normal B cells responding to the E2 viral antigen, Blood 97(4):1023-1026; Carbonari et al., 2005, Hepatitis C virus drives the unconstrained monoclonal expansion of V.sub.H1-69-expressing memory B cells in type II cryoglobulinemia: A model of infection-driven lymphomagenesis, Journal of Immunology 174:6532-6539; Wang and Palese, 2009, Universal epitopes of influenza virus hemagglutinins?, Nature Structural & Molecular Biology 16(3):233-234; Sui et al., 2009, Structural and functional bases for broad-spectrum neutralization of avian and human influenza A viruses, Nature Structural & Molecular Biology 16(3):265-273; Marasca et al., 2001, Immunoglobulin Gene Mutations and Frequent Use of V.sub.H1-69 and V.sub.H4-34 Segments in Hepatitis C Virus-Positive and Hepatitis C Virus-Negative Nodal Marginal Zone B-Cell Lymphoma, Am. J. Pathol. 159(1):253-261).
(46) V.sub.H usage bias is also observed in the humoral immune response to Haemophilus influenzae type b (Hib PS) in humans. Studies suggest that the V.sub.HIII family (the V.sub.HIIIb subfamily in particular, V.sub.H9.1) exclusively characterizes the human humoral response to Hib PS, with diverse D and J genes (Adderson et al., 1991, Restricted Ig H Chain V Gene Usage in the Human Antibody Response to Haemophilus influenzae Type b Capsular Polysaccharide, J. Immunol. 147(5):1667-1674; Adderson et al., 1993, Restricted Immunoglobulin V.sub.H Usage and VDJ Combinations in the Human Response to Haemophilus influenzae Type b Capsular Polysaccharide, J. Clin. Invest. 91:2734-2743). Human J.sub.H genes also display biased usage; J.sub.H4 and J.sub.H6 are observed at about 38-41% in peripheral B cells in humans (Brezinschek et al., 1995).
(47) V.sub.H usage in HIV-1-infected humans is biased against V.sub.H3 usage and in favor of V.sub.H1 and V.sub.H4 gene families (Wisnewski et al., 1996, Human Antibody Variable Region Gene Usage in HIV-1 Infection, J. Acquired Immune Deficiency Syndromes & Human Retroviology 11(1):31-38). However, cDNA analysis of bone marrow from affected patients revealed significant V.sub.H3 usage not expressed in the functional B cell repertoire, where Fabs reflecting the V.sub.H3 usage exhibited effective in vitro neutralization of HIV-1 (Id.). It might be postulated that the humoral immune response to HIV-1 infection is possibly attenuated due to the V.sub.H restriction; modified non-human animals as described herein (not infectable by HIV-1) might thus be useful for generating neutralizing antibody domains derived from particular V.sub.H genes present in the genetically modified animals described herein, but derived from different V.sub.H genes than those observed in the restricted repertoire of affected humans.
(48) Thus, the ability to generate high affinity human antibody variable domains in V.sub.H-restricted mice, e.g., (restricted, e.g., to a V.sub.H3 family member and polymorph(s) thereof) immunized with HIV-1 might provide a rich resource for designing effective HIV-1-neutralizing human therapeutics by thoroughly mining the restricted (e.g., restricted to a V.sub.H3 family member or variant(s) thereof) repertoire of such an immunized mouse.
(49) Restriction of the human antibody response to certain pathogens may reduce the likelihood of obtaining antibody variable regions from affected humans that can serve as springboards for designing high affinity neutralizing antibodies against the pathogen. For example, the human immune response to HIV-1 infection is clonally restricted throughout HIV-1 infection and into AIDS progression (Muller et al., 1993, B-cell abnormalities in AIDS: stable and clonally restricted antibody response in HIV-1 infection, Scand. J. Immunol. 38:327-334; Wisnewski et al., 1996). Further, V.sub.H genes are in general not present in all polymorphic forms in individuals; certain individuals in certain populations possess one variant, whereas individuals in other populations possess a different variant. Thus, the availability of a biological system that is restricted to a single V.sub.H gene and its variants will in various embodiments provide a hitherto unexploited source of diversity for generating antibody variable regions (e.g., human heavy and light cognate domains) based on a restricted V.sub.H gene.
(50) Genetically modified mice that express human heavy chain variable regions with restricted V.sub.H gene segment usage are useful to generate a relatively large repertoire of junctionally diverse, combinatorially diverse, and somatically mutated high affinity human immunoglobulin heavy chain variable regions from an otherwise restricted repertoire. A restricted repertoire, in this instance, refers to a predetermined limitation in germline genes that results in the mouse being unable to form a rearranged heavy chain gene that is derived from any V gene other than a preselected V gene. In embodiments that employ a preselected V gene but not a preselected D and/or J gene, the repertoire is restricted with respect to the identity of the V gene but not the D and/or J gene. The identity of the preselected V gene (and any preselected D and/or J genes) is not limited to any particular V gene.
(51) Designing a mouse so that it rearranges a single V.sub.H gene (present as a single segment or a set of variants) with a variety of human D and J gene segments (e.g., D.sub.H and J.sub.H segments) provides an in vivo junctional diversity/combinatorial diversity/somatic hypermutation permutation machine that can be used to iterate mutations in resulting rearranged heavy chain variable region sequences (e.g., V/D/J or V/J, as the case may be). In such a mouse, the clonal selection process operates to select suitable variable regions that bind an antigen of interest that are based on a single preselected V.sub.H gene (or variants thereof). Because the mouse's clonal selection components are dedicated to selection based on the single preselected V.sub.H gene segment, background noise is largely eradicated. With judicious selection of the V.sub.H gene segment, a relatively larger number of clonally selected, antigen-specific antibodies can be screened in a shorter period of time than with a mouse with a large diversity of V segments.
(52) Preselecting and restricting a mouse to a single V segment provides a system for permuting V/D/J junctions at a rate that is in various embodiments higher than that observed in mice that otherwise have up to 40 or more V segments to recombine with D and J regions. Removal of other V segments frees the locus to form more V/D/J combinations for the preselected V segment than otherwise observed. The increased number of transcripts that result from the recombination of the preselected V with one of a plurality of D and one of a plurality of J segments will feed those transcripts into the clonal selection system in the form of pre-B cells, and the clonal selection system is thus dedicated to cycling B cells that express the preselected V region. In this way, more unique V regions derived from the preselected V segment can be screened by the organism than would otherwise be possible in a given amount of time.
(53) In various aspects, mice are described that enhance the junctional diversity of V/D recombinations for the preselected V region, because all or substantially all recombinations of the immunoglobulin heavy chain variable locus will be of the preselected V segment and the D and J segments that are placed in such mice. Therefore, the mice provide a method for generating a diversity of CDR3 segments using a base, or restricted V.sub.H gene repertoire.
(54) Genomic Location and Function of Mouse ADAM6
(55) Male mice that lack the ability to express any functional ADAM6 protein surprisingly exhibit a defect in the ability of the mice to mate and to generate offspring. The mice lack the ability to express a functional ADAM6 protein by virtue of a replacement of all or substantially all mouse immunoglobulin variable region gene segments with human variable region gene segments. The loss of ADAM6 function results because the ADAM6 locus is located within a region of the endogenous mouse immunoglobulin heavy chain variable region gene locus, proximal to the 3 end of the V.sub.H gene segment locus that is upstream of the D.sub.H gene segments. In order to breed mice that are homozygous for a replacement of all or substantially all endogenous mouse heavy chain variable sequences with a restricted human heavy chain sequence, it is generally a cumbersome approach to set up males and females that are each homozygous for the restricted human heavy chain sequence and await a productive mating. Successful litters are low in frequency and size. Instead, males heterozygous for the restricted human heavy chain sequence have been employed to mate with females homozygous for the replacement to generate progeny that are heterozygous for the restricted human heavy chain sequence, then a homozygous mouse is bred therefrom. The inventors have determined that the likely cause of the loss in fertility in the male mice is the absence in homozygous male mice of a functional ADAM6 protein.
(56) In various aspects, male mice that comprise a damaged (i.e., nonfunctional or marginally functional) ADAM6 gene exhibit a reduction or elimination of fertility. Because in mice (and other rodents) the ADAM6 gene is located in the immunoglobulin heavy chain locus, the inventors have determined that in order to propagate mice, or create and maintain a strain of mice, that comprise a humanized immunoglobulin heavy chain locus, various modified breeding or propagation schemes are employed. The low fertility, or infertility, of male mice homozygous for a humanized immunoglobulin heavy chain variable gene locus renders maintaining such a modification in a mouse strain difficult. In various embodiments, maintaining the strain comprises avoiding infertility problems exhibited by male mice homozygous for the humanized heavy chain locus.
(57) In one aspect, a method for maintaining a strain of mouse as described herein is provided. The strain of mouse need not comprise an ectopic ADAM6 sequence, and in various embodiments the strain of mouse is homozygous or heterozygous for a knockout (e.g., a functional knockout) of ADAMS.
(58) The mouse strain comprises a modification of an endogenous immunoglobulin heavy chain locus that results in a reduction or loss in fertility in a male mouse. In one embodiment, the modification comprises a deletion of a regulatory region and/or a coding region of an ADAM6 gene. In a specific embodiment, the modification comprises a modification of an endogenous ADAM6 gene (regulatory and/or coding region) that reduces or eliminates fertility of a male mouse that comprises the modification; in a specific embodiment, the modification reduces or eliminates fertility of a male mouse that is homozygous for the modification.
(59) In one embodiment, the mouse strain is homozygous or heterozygous for a knockout (e.g., a functional knockout) or a deletion of an ADAM6 gene.
(60) In one embodiment, the mouse strain is maintained by isolating from a mouse that is homozygous or heterozygous for the modification a cell, and employing the donor cell in host embryo, and gestating the host embryo and donor cell in a surrogate mother, and obtaining from the surrogate mother a progeny that comprises the genetic modification. In one embodiment, the donor cell is an ES cell. In one embodiment, the donor cell is a pluripotent cell, e.g., an induced pluripotent cell.
(61) In one embodiment, the mouse strain is maintained by isolating from a mouse that is homozygous or heterozygous for the modification a nucleic acid sequence comprising the modification, and introducing the nucleic acid sequence into a host nucleus, and gestating a cell comprising the nucleic acid sequence and the host nucleus in a suitable animal. In one embodiment, the nucleic acid sequence is introduced into a host oocyte embryo.
(62) In one embodiment, the mouse strain is maintained by isolating from a mouse that is homozygous or heterozygous for the modification a nucleus, and introducing the nucleus into a host cell, and gestating the nucleus and host cell in a suitable animal to obtain a progeny that is homozygous or heterozygous for the modification.
(63) In one embodiment, the mouse strain is maintained by employing in vitro fertilization (IVF) of a female mouse (wild-type, homozygous for the modification, or heterozygous for the modification) employing a sperm from a male mouse comprising the genetic modification. In one embodiment, the male mouse is heterozygous for the genetic modification. In one embodiment, the male mouse is homozygous for the genetic modification.
(64) In one embodiment, the mouse strain is maintained by breeding a male mouse that is heterozygous for the genetic modification with a female mouse to obtain progeny that comprises the genetic modification, identifying a male and a female progeny comprising the genetic modification, and employing a male that is heterozygous for the genetic modification in a breeding with a female that is wild-type, homozygous, or heterozygous for the genetic modification to obtain progeny comprising the genetic modification. In one embodiment, the step of breeding a male heterozygous for the genetic modification with a wild-type female, a female heterozygous for the genetic modification, or a female homozygous for the genetic modification is repeated in order to maintain the genetic modification in the mouse strain.
(65) In one aspect, a method is provided for maintaining a mouse strain that comprises a replacement of an endogenous immunoglobulin heavy chain variable gene locus with one or more human immunoglobulin heavy chain sequences, comprising breeding the mouse strain so as to generate heterozygous male mice, wherein the heterozygous male mice are bred to maintain the genetic modification in the strain. In a specific embodiment, the strain is not maintained by any breeding of a homozygous male with a wild-type female, or a female homozygous or heterozygous for the genetic modification.
(66) The ADAM6 protein is a member of the A Disintegrin And Metalloprotease (ADAM) family of proteins, which is a large family of proteins having diverse functions including cell adhesion. Some members of the ADAM family are implicated in spermatogenesis and fertilization. For example, ADAM2 encodes a subunit of the protein fertilin, which is implicated in sperm-egg interactions. ADAM3, or cyritestin, appears necessary for sperm binding to the zona pellucida. The absence of either ADAM2 or ADAM3 results in infertility. It has been postulated that ADAM2, ADAM3, and ADAM6 form a complex on the surface of mouse sperm cells. The human counterpart gene (human ADAM6), normally found between human V.sub.H gene segments V.sub.H1-2 and V.sub.H6-1 in the human immunoglobulin heavy chain locus, appears to be a pseudogene. In mice, there are two ADAM6 genesADAM6a and ADAM6bthat are found in an intergenic region between mouse V.sub.H and D.sub.H gene segments, and in the mouse the ADAM6a and ADAM6b genes are oriented in opposite transcriptional orientation to that of the surrounding immunoglobulin gene segments. In mice, a functional ADAM6 locus is apparently required for normal fertilization. A functional ADAM6 locus or sequence, then, refers to an ADAM6 locus or sequence that can complement, or rescue, the drastically reduced fertilization exhibited in male mice with missing or nonfunctional endogenous ADAM6 loci.
(67) The position of the intergenic sequence in mice that encodes ADAM6a and ADAM6b renders the intergenic sequence susceptible to modification when modifying an endogenous mouse heavy chain. When V.sub.H gene segments are deleted or replaced, or when D.sub.H gene segments are deleted or replaced, there is a high probability that a resulting mouse will exhibit a severe deficit in fertility. In order to compensate for the deficit, the mouse is modified to include a nucleotide sequence that encodes a protein that will complement the loss in ADAM6 activity due to a modification of the endogenous mouse ADAM6 locus. In various embodiments, the complementing nucleotide sequence is one that encodes a mouse ADAM6a, a mouse ADAM6b, or a homolog or ortholog or functional fragment thereof that rescues the fertility deficit. Alternatively, suitable methods to preserve the endogenous ADAM6 locus can be employed, while rendering the endogenous immunoglobulin heavy chain sequences flanking the mouse ADAM6 locus incapable of rearranging to encode a functional endogenous heavy chain variable region. Exemplary alternative methods include manipulation of large portions of mouse chromosomes that position the endogenous immunoglobulin heavy chain variable region loci in such a way that they are incapable of rearranging to encode a functional heavy chain variable region that is operably linked to an endogenous heavy chain constant gene. In various embodiments, the methods include inversions and/or translocations of mouse chromosomal fragments containing endogenous immunoglobulin heavy chain gene segments.
(68) The nucleotide sequence that rescues fertility can be placed at any suitable position. It can be placed in the intergenic region, or in any suitable position in the genome (i.e., ectopically). In one embodiment, the nucleotide sequence can be introduced into a transgene that randomly integrates into the mouse genome. In one embodiment, the sequence can be maintained episomally, that is, on a separate nucleic acid rather than on a mouse chromosome. Suitable positions include positions that are transcriptionally permissive or active, e.g., a ROSA26 locus (Zambrowicz et al., 1997, PNAS USA 94:3789-3794), a BT-5 locus (Michael et al., 1999, Mech. Dev. 85:35-47), or an Oct4 locus (Wallace et al., 2000, Nucleic Acids Res. 28:1455-1464). Targeting nucleotide sequences to transcriptionally active loci are described, e.g., in U.S. Pat. No. 7,473,557, herein incorporated by reference.
(69) Alternatively, the nucleotide sequence that rescues fertility can be coupled with an inducible promoter so as to facilitate optimal expression in the appropriate cells and/or tissues, e.g., reproductive tissues. Exemplary inducible promoters include promoters activated by physical (e.g., heat shock promoter) and/or chemical means (e.g., IPTG or Tetracycline).
(70) Further, expression of the nucleotide sequence can be linked to other genes so as to achieve expression at specific stages of development or within specific tissues. Such expression can be achieved by placing the nucleotide sequence in operable linkage with the promoter of a gene expressed at a specific stage of development. For example, immunoglobulin sequences from one species engineered into the genome of a host species are place in operable linkage with a promoter sequence of a CD19 gene (a B cell specific gene) from the host species. B cell-specific expression at precise developmental stages when immunoglobulins are expressed is achieved.
(71) Yet another method to achieve robust expression of an inserted nucleotide sequence is to employ a constitutive promoter. Exemplary constitutive promoters include SV40, CMV, UBC, EF1A, PGK and CAGG. In a similar fashion, the desired nucleotide sequence is placed in operable linkage with a selected constitutive promoter, which provides high level of expression of the protein(s) encoded by the nucleotide sequence.
(72) The term ectopic is intended to include a displacement, or a placement at a position that is not normally encountered in nature (e.g., placement of a nucleic acid sequence at a position that is not the same position as the nucleic acid sequence is found in a wild-type mouse). The term, in various embodiments, is used in the sense of its object being out of its normal, or proper, position. For example, the phrase an ectopic nucleotide sequence encoding . . . refers to a nucleotide sequence that appears at a position at which it is not normally encountered in the mouse. For example, in the case of an ectopic nucleotide sequence encoding a mouse ADAM6 protein (or an ortholog or homolog or fragment thereof that provides the same or similar fertility benefit on male mice), the sequence can be placed at a different position in the mouse's genome than is normally found in a wild-type mouse. In such cases, novel sequence junctions of mouse sequence will be created by placing the sequence at a different position in the mouse's genome than in a wild-type mouse. A functional homolog or ortholog of mouse ADAM6 is a sequence that confers a rescue of fertility loss (e.g., loss of the ability of a male mouse to generate offspring by mating) that is observed in an ADAM6.sup./ mouse. Functional homologs or orthologs include proteins that have at least about 89% identity or more, e.g., up to 99% identity, to the amino acid sequence of ADAM6a and/or to the amino acid sequence of ADAM6b, and that can complement, or rescue ability to successfully mate, of a mouse that has a genotype that includes a deletion or knockout of ADAM6a and/or ADAM6b.
(73) The ectopic position can be anywhere (e.g., as with random insertion of a transgene containing a mouse ADAM6 sequence), or can be, e.g., at a position that approximates (but is not precisely the same as) its location in a wild-type mouse (e.g., in a modified endogenous mouse immunoglobulin locus, but either upstream or downstream of its natural position, e.g., within a modified immunoglobulin locus but between different gene segments, or at a different position in a mouse V-D intergenic sequence). One example of an ectopic placement is maintaining the position normally found in wild-type mice within the endogenous immunoglobulin heavy chain locus while rendering the surrounding endogenous heavy chain gene segments in capable of rearranging to encode a functional heavy chain containing an endogenous heavy chain constant region. In this example, this may be accomplished by inversion of the chromosomal fragment containing the endogenous immunoglobulin heavy chain variable loci, e.g. using engineered site-specific recombination sites placed at positions flanking the variable region locus. Thus, upon recombination the endogenous heavy chain variable region loci are placed at a great distance away from the endogenous heavy chain constant region genes thereby preventing rearrangement to encode a functional heavy chain containing an endogenous heavy chain constant region. Other exemplary methods to achieve functional silencing of the endogenous immunoglobulin heavy chain variable gene locus while maintaining a functional ADAM6 locus will apparent to persons of skill upon reading this disclosure and/or in combination with methods known in the art. With such a placement of the endogenous heavy chain locus, the endogenous ADAM6 genes are maintained and the endogenous immunoglobulin heavy chain locus is functionally silenced.
(74) Another example of an ectopic placement is placement within a humanized immunoglobulin heavy chain locus. For example, a mouse comprising a replacement of one or more endogenous V.sub.H gene segments with a single human V.sub.H gene segment, wherein the replacement removes an endogenous ADAM6 sequence, can be engineered to have a mouse ADAM6 sequence located within an intergenic sequence that lies between the single human V.sub.H gene segment and a human D.sub.H gene segment. Another example of an ectopic placement is placement of the mouse ADAM6 sequence at a position 5 (with respect to the direction of transcription of the single human V.sub.H gene segment) to the human V.sub.H gene segment. A position 5 to the single human V.sub.H gene segment may be in close proximity, e.g., a few hundred base pairs to a few kb, or distant, e.g., several kb to hundreds of kb or even a megabase or greater, relative to the human V.sub.H gene segment. The resulting modification would generate a (ectopic) mouse ADAM6 sequence within or contiguous, or even on the same chromosome, with a human gene sequence, and the (ectopic) placement of the mouse ADAM6 sequence within the human gene sequence can approximate the position of the mouse ADAM6 sequence (i.e., within the V-D intergenic region). The resulting sequence junctions created by the joining of a (ectopic) mouse ADAM6 sequence within or adjacent to a human gene sequence (e.g., an immunoglobulin gene sequence) within the germline of the mouse would be novel as compared to the same or similar position in the genome of a wild-type mouse.
(75) In various embodiments, non-human animals are provided that lack an ADAM6 or ortholog or homolog thereof, wherein the lack renders the non-human animal infertile, or substantially reduces fertility of the non-human animal. In various embodiments, the lack of ADAM6 or ortholog or homolog thereof is due to a modification of an endogenous immunoglobulin heavy chain locus. A substantial reduction in fertility is, e.g., a reduction in fertility (e.g., breeding frequency, pups per litter, litters per year, etc.) of about 50%, 60%, 70%, 80%, 90%, or 95% or more. In various embodiments, the non-human animals are supplemented with a mouse ADAM6 gene or ortholog or homolog or functional fragment thereof that is functional in a male of the non-human animal, wherein the supplemented ADAM6 gene or ortholog or homolog or functional fragment thereof rescues the reduction in fertility in whole or in substantial part. A rescue of fertility in substantial part is, e.g., a restoration of fertility such that the non-human animal exhibits a fertility that is at least 70%, 80%, or 90% or more as compared with an unmodified (i.e., an animal without a modification to the ADAM6 gene or ortholog or homolog thereof) heavy chain locus.
(76) The sequence that confers upon the genetically modified animal (i.e., the animal that lacks a functional ADAM6 or ortholog or homolog thereof, due to, e.g., a modification of a immunoglobulin heavy chain locus) is, in various embodiments, selected from an ADAM6 gene or ortholog or homolog thereof. For example, in a mouse, the loss of ADAM6 function is rescued by adding, in one embodiment, a mouse ADAM6 gene. In one embodiment, the loss of ADAM6 function in the mouse is rescued by adding an ortholog or homolog of a closely related specie with respect to the mouse, e.g., a rodent, e.g., a mouse of a different strain or species, a rat of any species, a rodent; wherein the addition of the ortholog or homolog to the mouse rescues the loss of fertility due to loss of ADAM6 function or loss of an ADAM6 gene. Orthologs and homologs from other species, in various embodiments, are selected from a phylogenetically related species and, in various embodiments, exhibit a percent identity with the endogenous ADAM6 (or ortholog) that is about 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, or 97% or more; and that rescue ADAMS-related or (in a non-mouse) ADAM6 ortholog-related loss of fertility. For example, in a genetically modified male rat that lacks ADAM6 function (e.g., a rat with an endogenous immunoglobulin heavy chain variable region replaced with a human immunoglobulin heavy chain variable region, or a knockout in the rat immunoglobulin heavy chain region), loss of fertility in the rat is rescued by addition of a rat ADAM6 or, in some embodiments, an ortholog of a rat ADAM6 (e.g., an ADAM6 ortholog from another rat strain or species, or, in one embodiment, from a mouse).
(77) Thus, in various embodiments, genetically modified animals that exhibit no fertility or a reduction in fertility due to modification of a nucleic acid sequence encoding an ADAM6 protein (or ortholog or homolog thereof) or a regulatory region operably linked with the nucleic acid sequence, comprise a nucleic acid sequence that complements, or restores, the loss in fertility where the nucleic acid sequence that complements or restores the loss in fertility is from a different strain of the same species or from a phylogenetically related species. In various embodiments, the complementing nucleic acid sequence is an ADAM6 ortholog or homolog or functional fragment thereof. In various embodiments, the complementing ADAM6 ortholog or homolog or functional fragment thereof is from a non-human animal that is closely related to the genetically modified animal having the fertility defect. For example, where the genetically modified animal is a mouse of a particular strain, an ADAM6 ortholog or homolog or functional fragment thereof can be obtained from a mouse of another strain, or a mouse of a related species. In one embodiment, where the genetically modified animal comprising the fertility defect is of the order Rodentia, the ADAM6 ortholog or homolog or functional fragment thereof is from another animal of the order Rodentia. In one embodiment, the genetically modified animal comprising the fertility defect is of a suborder Myomoropha (e.g., jerboas, jumping mice, mouse-like hamsters, hamsters, New World rats and mice, voles, true mice and rats, gerbils, spiny mice, crested rats, climbing mice, rock mice, white-tailed rats, malagasy rats and mice, spiny dormice, mole rats, bamboo rats, zokors), and the ADAM6 ortholog or homolog or functional fragment thereof is selected from an animal of order Rodentia, or of the suborder Myomorpha.
(78) In one embodiment, the genetically modified animal is from the superfamily Dipodoidea, and the ADAM6 ortholog or homolog or functional fragment thereof is from the superfamily Muroidea. In one embodiment, the genetically modified animal is from the superfamily Muroidea, and the ADAM6 ortholog or homolog or functional fragment thereof is from the superfamily Dipodoidea.
(79) In one embodiment, the genetically modified animal is a rodent. In one embodiment, the rodent is selected from the superfamily Muroidea, and the ADAM6 ortholog or homolog is from a different species within the superfamily Muroidea. In one embodiment, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors); and the ADAM6 ortholog or homolog is selected from a different species of the same family. In a specific embodiment, the genetically modified rodent is selected from a true mouse or rat (family Muridae), and the ADAM6 ortholog or homolog is from a species selected from a gerbil, spiny mouse, or crested rat. In one embodiment, the genetically modified mouse is from a member of the family Muridae, and the ADAM6 ortholog or homolog is from a different species of the family Muridae. In a specific embodiment, the genetically modified rodent is a mouse of the family Muridae, and the ADAM6 ortholog or homolog is from a rat, gerbil, spiny mouse, or crested rat of the family Muridae.
(80) In various embodiments, one or more rodent ADAM6 orthologs or homologs or functional fragments thereof of a rodent in a family restores fertility to a genetically modified rodent of the same family that lacks an ADAM6 ortholog or homolog (e.g., Cricetidae (e.g., hamsters, New World rats and mice, voles); Muridae (e.g., true mice and rats, gerbils, spiny mice, crested rats)).
(81) In various embodiments, ADAM6 orthologs, homologs, and fragments thereof are assessed for functionality by ascertaining whether the ortholog, homolog, or fragment restores fertility to a genetically modified male non-human animal that lacks ADAM6 activity (e.g., a rodent, e.g., a mouse or rat, that comprises a knockout of ADAM6 or its ortholog). In various embodiments, functionality is defined as the ability of a sperm of a genetically modified animal lacking an endogenous ADAM6 or ortholog or homolog thereof to migrate an oviduct and fertilize an ovum of the same specie of genetically modified animal.
(82) In various aspects, mice that comprise deletions or replacements of the endogenous heavy chain variable region locus or portions thereof can be made that contain an ectopic nucleotide sequence that encodes a protein that confers similar fertility benefits to mouse ADAM6 (e.g., an ortholog or a homolog or a fragment thereof that is functional in a male mouse). The ectopic nucleotide sequence can include a nucleotide sequence that encodes a protein that is an ADAM6 homolog or ortholog (or fragment thereof) of a different mouse strain or a different species, e.g., a different rodent species, and that confers a benefit in fertility, e.g., increased number of litters over a specified time period, and/or increased number of pups per litter, and/or the ability of a sperm cell of a male mouse to traverse through a mouse oviduct to fertilize a mouse egg.
(83) In one embodiment, the ADAMS is a homolog or ortholog that is at least 89% to 99% identical to a mouse ADAM6 protein (e.g., at least 89% to 99% identical to mouse ADAM6a or mouse ADAM6b). In one embodiment, the ectopic nucleotide sequence encodes one or more proteins independently selected from a protein at least 89% identical to mouse ADAM6a, a protein at least 89% identical to mouse ADAM6b, and a combination thereof. In one embodiment, the homolog or ortholog is a rat, hamster, mouse, or guinea pig protein that is or is modified to be about 89% or more identical to mouse ADAM6a and/or mouse ADAM6b. In one embodiment, the homolog or ortholog is or is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to a mouse ADAM6a and/or mouse ADAM6b.
(84) Ectopic ADAM6 in Humanized Heavy Chain Mice
(85) Developments in gene targeting, e.g., the development of bacterial artificial chromosomes (BACs), now enable the recombination of relatively large genomic fragments. BAC engineering has allowed for the ability to make large deletions, and large insertions, into mouse ES cells.
(86) Mice that make human antibodies have been available for some time now. Although they represent an important advance in the development of human therapeutic antibodies, these mice display a number of significant abnormalities that limit their usefulness. For example, they display compromised B cell development. The compromised development may be due to a variety of differences between the transgenic mice and wild-type mice.
(87) Human antibodies might not optimally interact with mouse pre B cell or B cell receptors on the surface of mouse cells that signal for maturation, proliferation, or survival during clonal selection. Fully human antibodies might not optimally interact with a mouse Fc receptor system; mice express Fc receptors that do not display a one-to-one correspondence with human Fc receptors. Finally, various mice that make fully human antibodies do not include all genuine mouse sequences, e.g., downstream enhancer elements and other locus control elements, which may be required for wild-type B cell development.
(88) Mice that make fully human antibodies generally comprise endogenous immunoglobulin loci that are disabled in some way, and human transgenes that comprise variable and constant immunoglobulin gene segments are introduced into a random location in the mouse genome. As long as the endogenous locus is sufficiently disabled so as not to rearrange gene segments to form a functional immunoglobulin gene, the goal of making fully human antibodies in such a mouse can be achieved-albeit with compromised B cell development.
(89) Although compelled to make fully human antibodies from the human transgene locus, generating human antibodies in a mouse is apparently an unfavored process. In some mice, the process is so unfavored as to result in formation of chimeric human variable/mouse constant heavy chains (but not light chains) through the mechanism of trans-switching. By this mechanism, transcripts that encode fully human antibodies undergo isotype switching in trans from the human isotype to a mouse isotype. The process is in trans, because the fully human transgene is located apart from the endogenous locus that retains an undamaged copy of a mouse heavy chain constant region gene. Although in such mice trans-switching is readily apparent the phenomenon is still insufficient to rescue B cell development, which remains frankly impaired. In any event, trans-switched antibodies made in such mice retain fully human light chains, since the phenomenon of trans-switching apparently does not occur with respect to light chains; trans-switching presumably relies on switch sequences in endogenous loci used (albeit differently) in normal isotype switching in cis. Thus, even when mice engineered to make fully human antibodies select a trans-switching mechanism to make antibodies with mouse constant regions, the strategy is still insufficient to rescue normal B cell development.
(90) A primary concern in making antibody-based human therapeutics, e.g., anti-pathogen antibodies, is identifying useful variable domains that specifically recognize particular epitopes and bind them with a desirable affinity, usuallybut not alwayswith high affinity. Mice as described herein, which contain a precise replacement of mouse immunoglobulin heavy chain variable regions with a restricted number of human immunoglobulin heavy chain variable gene segments at the endogenous mouse loci, display near wild-type B cell development and the variable regions generated in response to immunization are fully human, wherein the heavy chains are derived from a single human V.sub.H gene segment. Thus, such mice provide a platform to generate a panel of heavy chain complementary determining regions (CDRs) that are specifically directed to bind a given antigen, e.g., a pathogenic virus.
(91) Mice as described herein contain a precise, large-scale replacement of germline variable gene loci of mouse immunoglobulin heavy chain (IgH) with a restricted human immunoglobulin heavy chain variable locus, and immunoglobulin light chain (e.g., light chain, Ig) with an equivalent human immunoglobulin light chain variable gene locus, at the endogenous loci. This precise replacement results in a mouse with hybrid immunoglobulin loci that make heavy and light chains that have a human variable regions and a mouse constant region. The precise replacement of mouse V.sub.H-D.sub.H-J.sub.H and V-J segments leave flanking mouse sequences intact and functional at the hybrid immunoglobulin loci. The humoral immune system of the mouse functions like that of a wild-type mouse. B cell development is unhindered in any significant respect and a somatically mutated panel of human heavy chain CDRs is generated in the mouse upon antigen challenge.
(92) Mice as described herein are possible because immunoglobulin gene segments for heavy and light chains rearrange similarly in humans and mice, which is not to say that their loci are the same or even nearly soclearly they are not. However, the loci are similar enough that humanization of the heavy chain variable gene locus can be accomplished by replacing about three million base pairs of contiguous mouse sequence that contains all the V.sub.H, D.sub.H, and J.sub.H gene segments with a contiguous human genomic sequence containing a restricted human heavy chain locus.
(93) In some embodiments, further replacement of certain mouse constant region gene sequences with human gene sequences (e.g., replacement of mouse C.sub.H1 sequence with human C.sub.H1 sequence, and replacement of mouse C.sub.L sequence with human C.sub.L sequence) results in mice with hybrid immunoglobulin loci that make antibodies that have human variable regions and partly human constant regions, suitable for, e.g., making fully human antibody fragments, e.g., fully human Fab's. Mice with hybrid immunoglobulin loci exhibit normal variable gene segment rearrangement, normal somatic hypermutation frequencies, and normal class switching. These mice exhibit a humoral immune system that is indistinguishable from wild type mice, and display normal cell populations at all stages of B cell development and normal lymphoid organ structureseven where the mice lack a full repertoire of human variable region gene segments. Immunizing these mice results in robust humoral responses that display a wide diversity of heavy chain CDRs and light chain variable gene segment usage.
(94) The precise replacement of mouse germline variable region gene segments allows for making mice that have partly human immunoglobulin loci. Because the partly human immunoglobulin loci rearrange, hypermutate, and class switch normally, the partly human immunoglobulin loci generate antibodies in a mouse that comprise human variable regions. Nucleotide sequences that encode the variable regions can be identified and cloned, then fused (e.g., in an in vitro system) with any sequences of choice, e.g., any immunoglobulin isotype suitable for a particular use, resulting in an antibody or antigen-binding protein derived wholly from human sequences.
(95) Large-scale humanization by recombineering methods were used to modify mouse embryonic stem (ES) cells to precisely replace up to three megabases of the mouse heavy chain immunoglobulin locus that included essentially all of the mouse V.sub.H, D.sub.H, and J.sub.H gene segments with a human genomic sequence containing a restricted human heavy chain locus including a single human V.sub.H gene segment, 27 human D.sub.H gene segments, and six human J.sub.H gene segments. Up to a one-half megabase segment of the human genome comprising one of two repeats encoding essentially all human V and J gene segments was used to replace a three megabase segment of the mouse immunoglobulin light chain locus containing essentially all of the mouse V and J gene segments.
(96) Mice with such replaced immunoglobulin loci can comprise a disruption or deletion of the endogenous mouse ADAM6 locus, which is normally found between the 3-most V.sub.H gene segment and the 5-most D.sub.H gene segment at the mouse immunoglobulin heavy chain locus. Disruption in this region can lead to reduction or elimination of functionality of the endogenous mouse ADAM6 locus. If one, or both, of the 3-most V.sub.H gene segments of the human heavy chain repertoire are used in construction of the restricted human heavy chain locus, an intergenic region containing a pseudogene that appears to be a human ADAM6 pseudogene is present between these V.sub.H gene segments, i.e., between human V.sub.H1-2 and V.sub.H1-6. However, male mice that comprise this human intergenic sequence exhibit a reduction in fertility (see U.S. Ser. No. 13/404,075, herein incorporated by reference).
(97) Mice are described that comprise the restricted human heavy chain and equivalent human light chain loci as described above, and that also comprise an ectopic nucleic acid sequence encoding a mouse ADAM6, where the mice exhibit essentially normal fertility. In one embodiment, the ectopic nucleic acid sequence comprises a mouse ADAM6a and/or a mouse ADAM6b sequence or functional fragments thereof placed between a human V.sub.n1-69 and a human D.sub.H1-1 at a modified endogenous heavy chain locus. In one embodiment, the ectopic nucleic acid sequence is SEQ ID NO: 77, placed between a human V.sub.H1-69 and a human D.sub.H1-1 at a modified endogenous heavy chain locus. The direction of transcription of the ADAM6 genes of SEQ ID NO: 77 are opposite with respect to the direction of transcription of the surrounding human gene segments. In one embodiment, the ectopic nucleic acid sequence comprises a mouse ADAM6a and/or a mouse ADAM6b sequence or functional fragments thereof placed upstream (or 5) of a human V.sub.H1-2 gene segment at a modified endogenous heavy chain locus. In one embodiment, the ectopic nucleic acid sequence is SEQ ID NO: 73, placed upstream (or 5) of a human V.sub.H1-2 gene segment at a modified endogenous heavy chain locus. The direction of transcription of the ADAM6 genes of SEQ ID NO: 73 are opposite with respect to the direction of transcription of the surrounding human gene segments (e.g. a human V.sub.H1-2 gene segment).
(98) Although examples herein show rescue of fertility by placing the ectopic sequence between the indicated human gene segments, skilled persons will recognize that placement of the ectopic sequence at any suitable transcriptionally-permissive locus in the mouse genome (or even extrachromosomally) will be expected to similarly rescue fertility in a male mouse.
(99) The phenomenon of complementing a mouse that lacks a functional ADAM6 locus with an ectopic sequence that comprises a mouse ADAM6 gene or ortholog or homolog or functional fragment thereof is a general method that is applicable to rescuing any mice with nonfunctional or minimally functional endogenous ADAM6 loci. Thus, a great many mice that comprise an ADAM6-disrupting modification of the immunoglobulin heavy chain locus can be rescued with the compositions and methods of the invention. Accordingly, the invention comprises mice with a wide variety of modifications of immunoglobulin heavy chain loci that compromise endogenous ADAM6 function. Some (non-limiting) examples are provided in this description. In addition to the mice described, the compositions and methods related to ADAM6 can be used in a great many applications, e.g., when modifying a heavy chain locus in a wide variety of ways.
(100) In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with a single human V.sub.H gene segments, a replacement of all or substantially all mouse D.sub.H gene segments and J.sub.H gene segments with human D.sub.H and human J.sub.H gene segments; wherein the mouse lacks a C.sub.H1 and/or hinge region. In one embodiment, the mouse makes a single variable domain binding protein that is a dimer of immunoglobulin chains selected from: (a) human V.sub.H-mouse C.sub.H1-mouse C.sub.H2-mouse C.sub.H3; (b) human V.sub.H-mouse hinge-mouse C.sub.H2-mouse C.sub.H3; and, (c) human V.sub.H-mouse C.sub.H2-mouse C.sub.H3.
(101) In one aspect, the nucleotide sequence that rescues fertility is placed upstream (or 5) of a human immunoglobulin heavy chain variable region sequence (e.g., upstream of a human V.sub.H1-2 or V.sub.H1-69 gene segment) in a mouse that has a replacement of one or more mouse immunoglobulin heavy chain variable gene segments (mV.sub.H's, mD.sub.H'S, and/or mJ.sub.H'S) with one or more human immunoglobulin heavy chain variable gene segments (hV.sub.H's, hD.sub.H's, and/or hJ.sub.H's), and the mouse further comprises a replacement of one or more mouse immunoglobulin light chain variable gene segments (mV's and/or mJ's) with one or more human immunoglobulin light chain variable gene segments (hV's and/or hJ's).
(102) In one aspect, the nucleotide sequence that rescues fertility is placed within a human immunoglobulin heavy chain variable region sequence (e.g., between human V.sub.H1-69 or human V.sub.H1-2 and a human D.sub.H1-1 gene segment) in a mouse that has a replacement of one or more mouse immunoglobulin heavy chain variable gene segments (mV.sub.H's, mD.sub.H's, and/or mJ.sub.H's) with one or more human immunoglobulin heavy chain variable gene segments (hV.sub.H's, hD.sub.H's, and/or hJ.sub.H's), and the mouse further comprises a replacement of one or more mouse immunoglobulin light chain variable gene segments (mV's and/or mJ's) with one or more human immunoglobulin light chain variable gene segments (hV's and/or hJ's).
(103) In one embodiment, the one or more mouse immunoglobulin heavy chain variable gene segments comprises about three megabases of the mouse immunoglobulin heavy chain locus. In one embodiment, the one or more mouse immunoglobulin heavy chain variable gene segments comprises at least 89 V.sub.H gene segments, at least 13 D.sub.H gene segments, at least four J.sub.H gene segments or a combination thereof of the mouse immunoglobulin heavy chain locus. In one embodiment, the one or more human immunoglobulin heavy chain variable gene segments comprises a restricted number of (e.g., one, two or three) V.sub.H gene segments, at least 27 D.sub.H gene segments, at least six J.sub.H gene segments or a combination thereof of a human immunoglobulin heavy chain locus. In a specific embodiment, the restricted number of human V.sub.H gene segments is one.
(104) In one embodiment, the one or more mouse immunoglobulin light chain variable gene segments comprises about three megabases of the mouse immunoglobulin light chain locus. In one embodiment, the one or more mouse immunoglobulin light chain variable gene segments comprises at least 137 V gene segments, at least five J gene segments or a combination thereof of the mouse immunoglobulin light chain locus. In one embodiment, the one or more human immunoglobulin light chain variable gene segments comprises about one-half megabase of a human immunoglobulin light chain locus. In a specific embodiment, the one or more human immunoglobulin light chain variable gene segments comprises the proximal repeat (with respect to the immunoglobulin constant region) of a human immunoglobulin light chain locus. In one embodiment, the one or more human immunoglobulin light chain variable gene segments comprises at least 40V gene segments, at least five J gene segments or a combination thereof of a human immunoglobulin light chain locus.
(105) In one embodiment, the nucleotide sequence is place between two human immunoglobulin gene segments. In a specific embodiment, the two human immunoglobulin gene segments are heavy chain gene segments. In one embodiment, the nucleotide sequence is placed between a human V.sub.H1-69 gene segment and a human D.sub.H1-1 gene segment. In one embodiment, the nucleotide sequence is placed between a human V.sub.H12 gene segment and a human D.sub.H1-1 gene segment. In one embodiment, the mouse so modified comprises a replacement of mouse immunoglobulin heavy chain variable gene segments with a single human V.sub.H gene segments, 27 human D.sub.H gene segments and six human J.sub.H gene segments, and a replacement of mouse immunoglobulin light chain variable gene segments with at least 40 human V gene segments and five human J gene segments.
(106) In one aspect, a functional mouse ADAM6 locus (or ortholog or homolog or functional fragment thereof) is present in the midst of mouse gene segments that are present at the endogenous mouse heavy chain variable region locus, said locus incapable of rearranging to encode a functional heavy chain containing an endogenous heavy chain constant region. In one embodiment, the endogenous mouse heavy chain locus comprises at least one and up to 89 V.sub.H gene segments, at least one and up to 13 D.sub.H gene segments, at least one and up to four J.sub.H gene segments and a combination thereof. In various embodiments, a functional mouse ADAM6 locus (or ortholog or homolog or functional fragment thereof) encodes one or more ADAM6 proteins that are functional in the mouse, wherein the one or more ADAM6 proteins comprise SEQ ID NO: 1, SEQ ID NO: 2 and/or a combination thereof.
(107) In one aspect, a functional mouse ADAM6 locus (or ortholog or homolog or functional fragment thereof) is present in the midst of human gene segments that replace endogenous mouse gene segments. In one embodiment, at least 89 mouse V.sub.H gene segments are removed and replaced with one, two or three human V.sub.H gene segments, and the mouse ADAM6 locus is present immediately adjacent to the 3 end of the human V.sub.H gene segments, or between two human V.sub.H gene segments. In one embodiment, at least 89 mouse V.sub.H gene segments are removed and replaced with a single human V.sub.H gene segment, and the mouse ADAM6 locus is present immediately adjacent to the 3 end of the human V.sub.H gene segment. In a specific embodiment, the mouse ADAM6 locus is present 3 of the V.sub.H gene segment within about 20 kilo bases (kb) to about 40 kilo bases (kb) of the 3 terminus of the inserted human V.sub.H gene segment. In a specific embodiment, the mouse ADAM6 locus is present 3 of the V.sub.H gene segment within about 29 kb to about 31 kb of the 3 terminus of the inserted human V.sub.H gene segment. In a specific embodiment, the mouse ADAM6 locus is present within about 30 kb of the 3 terminus of the inserted human V.sub.H gene segment. In a specific embodiment, the mouse ADAM6 locus is present within about 30,184 bp of the 3 terminus of the inserted human V.sub.H gene segment.
(108) In a specific embodiment, the replacement includes human gene segments V.sub.H1-69 and D.sub.H-1, and the mouse ADAM6 locus is present downstream of the V.sub.H1-69 gene segment and upstream of the D.sub.H1-1 gene segment. In a specific embodiment, the mouse ADAM6 locus is present between a human V.sub.H1-69 gene segment and a human D.sub.H1-1 gene segment, wherein the 5 end of the mouse ADAM6 locus is about 258 bp from the 3 terminus of the human V.sub.H1-69 gene segment and the 3 end of the ADAM6 locus is about 3,263 bp 5 of the human D.sub.H1-1 gene segment. In a specific embodiment, the mouse ADAM6 locus comprises SEQ ID NO:3 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the mouse ADAM6 locus comprises SEQ ID NO: 73 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the mouse ADAM6 locus comprises SEQ ID NO: 77 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the arrangement of human gene segments is then the following (from upstream to downstream with respect to direction of transcription of the human gene segments): human V.sub.H1-69-mouse ADAM6 locus-human D.sub.H1-1. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b of the mouse ADAM6 locus is opposite with respect to direction of transcription as compared with the orientation of the human gene segments. Alternatively, the mouse ADAM6 locus is present 5 to, or upstream of, the single human V.sub.H gene segment.
(109) In a specific embodiment, the replacement includes human gene segments V.sub.H1-2 and D.sub.H1-1, and the mouse ADAM6 locus is present upstream of the V.sub.H1-2 gene segment and upstream of the D.sub.H1-1 gene segment. In a specific embodiment, the mouse ADAM6 locus is present upstream, or 5, of a human V.sub.H1-2 gene segment and a human D.sub.H1-1 gene segment, wherein the 5 end of the mouse ADAM6 locus is about 32,833 bp from the 5 terminus of the human V.sub.H1-2 gene segment and the 3 end of the ADAM6 locus is about 18,078 bp from the 5 terminus of the human V.sub.H1-2 gene segment. In a specific embodiment, the mouse ADAMS locus comprises SEQ ID NO:3 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the mouse ADAM6 locus comprises SEQ ID NO: 73 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the mouse ADAM6 locus comprises SEQ ID NO: 77 or a fragment thereof that confers ADAM6 function within cells of the mouse. In a specific embodiment, the arrangement of human gene segments is then the following (from upstream to downstream with respect to direction of transcription of the human gene segments): mouse ADAM6 locus-human V.sub.H1-2-human D.sub.H1-1. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b of the mouse ADAM6 locus is opposite with respect to direction of transcription as compared with the orientation of the human gene segments. Alternatively, the mouse ADAM6 locus is present 3 to, or downstream of, the single human V.sub.H gene segment.
(110) Similarly, a mouse modified with one or more human V.sub.L gene segments (e.g., V or V segments) replacing all or substantially all endogenous mouse V.sub.H gene segments can be modified so as to either maintain the endogenous mouse ADAM6 locus, as described above, e.g., by employing a targeting vector having a downstream homology arm that includes a mouse ADAM6 locus or functional fragment thereof, or to replace a damaged mouse ADAM6 locus with an ectopic sequence positioned between two human V.sub.L gene segments or between the human V.sub.L gene segments and a D.sub.H gene segment (whether human or mouse, e.g., V+m/hD.sub.H), or a J gene segment (whether human or mouse, e.g., V+J.sub.H). In one embodiment, the replacement includes two or more human V.sub.L gene segments, and the mouse ADAM6 locus or functional fragment thereof is present between the two 3-most V.sub.L gene segments. In a specific embodiment, the arrangement of human V.sub.L gene segments is then the following (from upstream to downstream with respect to direction of transcription of the human gene segments): human V.sub.L3-1-mouse ADAM6 locus-human V.sub.L3. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b of the mouse ADAM6 locus is opposite with respect to direction of transcription as compared with the orientation of the human VL gene segments. Alternatively, the mouse ADAM6 locus is present in the intergenic region between the 3-most human V.sub.L gene segment and the 5-most D.sub.H gene segment. This can be the case whether the 5-most D.sub.H segment is mouse or human.
(111) In one aspect, a mouse is provided with a replacement of one or more endogenous mouse V.sub.H gene segments, and that comprises at least one endogenous mouse D.sub.H gene segment. In such a mouse, the modification of the endogenous mouse V.sub.H gene segments can comprise a modification of one or more of the 3-most V.sub.H gene segments, but not the 5-most D.sub.H gene segment, where care is taken so that the modification of the one or more 3-most V.sub.H gene segments does not disrupt or render the endogenous mouse ADAM6 locus nonfunctional. For example, in one embodiment the mouse comprises a replacement of all or substantially all endogenous mouse V.sub.H gene segments with a single human V.sub.H gene segment, and the mouse comprises one or more endogenous D.sub.H gene segments and a functional endogenous mouse ADAM6 locus.
(112) In another embodiment, the mouse comprises the modification of endogenous mouse 3-most V.sub.H gene segments, and a modification of one or more endogenous mouse D.sub.H gene segments, and the modification is carried out so as to maintain the integrity of the endogenous mouse ADAM6 locus to the extent that the endogenous ADAM6 locus remains functional. In one example, such a modification is done in two steps: (1) replacing the 3-most endogenous mouse V.sub.H gene segments with a single human V.sub.H gene segments employing a targeting vector with an upstream homology arm and a downstream homology arm wherein the downstream homology arm includes all or a portion of a functional mouse ADAM6 locus; (2) then replacing and endogenous mouse D.sub.H gene segment with a targeting vector having an upstream homology arm that includes a all or a functional portion of a mouse ADAM6 locus.
(113) In various aspects, employing mice that contain an ectopic sequence that encodes a mouse ADAM6 protein or an ortholog or homolog or functional homolog thereof are useful where modifications disrupt the function of endogenous mouse ADAM6. The probability of disrupting endogenous mouse ADAM6 function is high when making modifications to mouse immunoglobulin loci, in particular when modifying mouse immunoglobulin heavy chain variable regions and surrounding sequences. Therefore, such mice provide particular benefit when making mice with immunoglobulin heavy chain loci that are deleted in whole or in part, are humanized in whole or in part, or are replaced (e.g., with V or V sequences) in whole or in part. Methods for making the genetic modifications described for the mice described below are known to those skilled in the art.
(114) Mice containing an ectopic sequence encoding a mouse ADAM6 protein, or a substantially identical or similar protein that confers the fertility benefits of a mouse ADAM6 protein, are particularly useful in conjunction with modifications to a mouse immunoglobulin heavy chain variable gene locus that disrupt or delete the endogenous mouse ADAM6 sequence. Although primarily described in connection with mice that express antibodies with human variable regions and mouse constant regions, such mice are useful in connection with any genetic modifications that disrupt endogenous mouse ADAM6 genes. Persons of skill will recognize that this encompasses a wide variety of genetically modified mice that contain modifications of mouse immunoglobulin heavy chain variable gene loci. These include, for example, mice with a deletion or a replacement of all or a portion of mouse immunoglobulin heavy chain gene segments, regardless of other modifications. Non-limiting examples are described below.
(115) In some aspects, genetically modified mice are provided that comprise an ectopic mouse, rodent, or other ADAM6 gene (or ortholog or homolog or fragment) functional in a mouse, and one or more human immunoglobulin variable and/or constant region gene segments. In various embodiments, other ADAM6 gene orthologs or homologs or fragments functional in a mouse may include sequences from bovine, canine, primate, rabbit or other non-human sequences.
(116) In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein, a replacement of all or substantially all mouse V.sub.H gene segments with a single human V.sub.H gene segment; a replacement of an or substantially all mouse D.sub.H gene segments with one or more human D.sub.H gene segments; and a replacement of all or substantially all mouse J.sub.H gene segments with one or more human J.sub.H gene segments.
(117) In one embodiment, the mouse further comprises a replacement of a mouse C.sub.H1 nucleotide sequence with a human C.sub.H1 nucleotide sequence. In one embodiment, the mouse further comprises a replacement of a mouse hinge nucleotide sequence with a human hinge nucleotide sequence. In one embodiment, the mouse further comprises a replacement of an immunoglobulin light chain variable locus (V.sub.L and J.sub.L) with a human immunoglobulin light chain variable locus. In one embodiment, the mouse further comprises a replacement of a mouse immunoglobulin light chain constant region nucleotide sequence with a human immunoglobulin light chain constant region nucleotide sequence. In a specific embodiment, the V.sub.L, J.sub.1, and C.sub.L are immunoglobulin light chain sequences. In a specific embodiment, the mouse comprises a mouse C.sub.H2 and a mouse C.sub.H3 immunoglobulin constant region sequence fused with a human hinge and a human C.sub.H1 sequence, such that the mouse immunoglobulin loci rearrange to form a gene that encodes a binding protein comprising (a) a heavy chain that has a human variable region, a human C.sub.H1 region, a human hinge region, and a mouse C.sub.H2 and a mouse C.sub.H3 region; and (b) a gene that encodes an immunoglobulin light chain that comprises a human variable domain and a human constant region.
(118) In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein, a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, and optionally a replacement of all or substantially all D.sub.H gene segments and/or J.sub.H gene segments with one or more human D.sub.H gene segments and/or human J.sub.H gene segments, or optionally a replacement of all or substantially all D.sub.H gene segments and J.sub.H gene segments with one or more human J.sub.L gene segments.
(119) In one embodiment, the mouse comprises a replacement of all or substantially all mouse V.sub.H, D.sub.H, and J.sub.H gene segments with one or more V.sub.L, one or more D.sub.H, and one or more J gene segments (e.g., J or J), wherein the gene segments are operably linked to an endogenous mouse hinge region, wherein the mouse forms a rearranged immunoglobulin chain gene that contains, from 5 to 3 in the direction of transcription, human V.sub.L-human or mouse D.sub.H-human or mouse J-mouse hinge-mouse C.sub.H2-mouse C.sub.H3. In one embodiment, the J region is a human J region. In one embodiment, the J region is a human J.sub.H region. In one embodiment, the J region is a human J region. In one embodiment, the human V.sub.L region is selected from a human V region and a human V region.
(120) In specific embodiments, the mouse expresses a single variable domain antibody having a mouse or human constant region and a variable region derived from a human V, a human D.sub.H and a human J; a human V, a human D.sub.H, and a human J.sub.H; a human V, a human D.sub.H, and a human J; a human V, a human D.sub.H, and a human J.sub.H; a human V, a human D.sub.H, and a human J; a human V, a human D.sub.H, and a human J. In specific embodiment, recombination recognition sequences are modified so as to allow for productive rearrangements to occur between recited V, D, and J gene segments or between recited V and J gene segments.
(121) In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, a replacement of all or substantially all mouse D.sub.H gene segment and J.sub.H gene segments with human J.sub.L gene segments; wherein the mouse lacks a C.sub.H1 and/or hinge region.
(122) In one embodiment, the mouse lacks a sequence encoding a C.sub.H1 domain, in one embodiment, the mouse lacks a sequence encoding a hinge region. In one embodiment, the mouse lacks a sequence encoding a C.sub.H1 domain and a hinge region.
(123) In a specific embodiment, the mouse expresses a binding protein that comprises a human immunoglobulin light chain variable domain ( or ) fused to a mouse C.sub.H2 domain that is attached to a mouse C.sub.H3 domain.
(124) In one aspect, a mouse is provided that comprises an ectopic ADAM6 sequence that encodes a functional ADAM6 protein (or ortholog or homolog or functional fragment thereof), a replacement of all or substantially all mouse V.sub.H gene segments with one or more human V.sub.L gene segments, a replacement of all or substantially all mouse D.sub.H and J.sub.H gene segments with human J.sub.L gene segments.
(125) In one embodiment, the mouse comprises a deletion of an immunoglobulin heavy chain constant region gene sequence encoding a C.sub.H1 region, a hinge region, a C.sub.H1 and a hinge region, or a C.sub.H1 region and a hinge region and a C.sub.H2 region.
(126) In one embodiment, the mouse makes a single variable domain binding protein comprising a homodimer selected from the following: (a) human V.sub.L-mouse C.sub.H1-mouse C.sub.H2-mouse C.sub.H3; (b) human V.sub.L-mouse hinge-mouse C.sub.H2-mouse C.sub.H3; (c) human V.sub.L-mouse C.sub.H2-mouse C.sub.H3.
(127) In one aspect, a mouse is provided with a disabled endogenous heavy chain immunoglobulin locus, comprising a disabled or deleted endogenous mouse ADAM6 locus, wherein the mouse comprises a nucleic acid sequence that expresses a human or mouse or human/mouse or other chimeric antibody. In one embodiment, the nucleic acid sequence is present on a transgene integrated that is randomly integrated into the mouse genome. In one embodiment, the nucleic acid sequence is on an episome (e.g., a chromosome) not found in a wild-type mouse.
(128) In one embodiment, the mouse further comprises a disabled endogenous immunoglobulin light chain locus. In a specific embodiment, the endogenous immunoglobulin light chain locus is selected from a kappa () and a lambda () light chain locus. In a specific embodiment, the mouse comprises a disabled endogenous light chain locus and a disabled light chain locus, wherein the mouse expresses an antibody that comprises a human immunoglobulin heavy chain variable domain and a human immunoglobulin light chain domain. In one embodiment, the human immunoglobulin light chain domain is selected from a human light chain domain and a human light chain domain.
(129) In one aspect, a genetically modified animal is provided that expresses a chimeric antibody and expresses an ADAM6 protein or ortholog or homolog thereof that is functional in the genetically modified animal.
(130) In one embodiment, the genetically modified animal is selected from a mouse and a rat. In one embodiment, the genetically modified animal is a mouse, and the ADAM6 protein or ortholog or homolog thereof is from a mouse strain that is a different strain than the genetically modified animal. In one embodiment, the genetically modified animal is a rodent of family Cricetidae (e.g., a hamster, a New World rat or mouse, a vole), and the ADAM6 protein ortholog or homolog is from a rodent of family Muridae (e.g., true mouse or rat, gerbil, spiny mouse, crested rat). In one embodiment, the genetically modified animal is a rodent of the family Muridae, and the ADAM6 protein ortholog or homolog is from a rodent of family Cricetidae.
(131) In one embodiment, the chimeric antibody comprises a human variable domain and a constant region sequence of a rodent. In one embodiment, the rodent is selected from a rodent of the family Cricetidae and a rodent of family Muridae. In a specific embodiment, the rodent of the family Cricetidae and of the family Muridae is a mouse. In a specific embodiment, the rodent of the family Cricetidae and of the family Muridae is a rat. In one embodiment, the chimeric antibody comprises a human variable domain and a constant domain from an animal selected from a mouse or rat; in a specific embodiment, the mouse or rat is selected from the family Cricetidae and the family Muridae. In one embodiment, the chimeric antibody comprises a human heavy chain variable domain, a human light chain variable domain and a constant region sequence derived from a rodent selected from mouse and rat, wherein the human heavy chain variable domain and the human light chain are cognate. In a specific embodiment, cognate includes that the human heavy chain and the human light chain variable domains are from a single B cell that expresses the human light chain variable domain and the human heavy chain variable domain together and present the variable domains together on the surface of an individual B cell.
(132) In one embodiment, the chimeric antibody is expressed from an immunoglobulin locus. In one embodiment, the heavy chain variable domain of the chimeric antibody is expressed from a rearranged endogenous immunoglobulin heavy chain locus. In one embodiment, the light chain variable domain of the chimeric antibody is expressed from a rearranged endogenous immunoglobulin light chain locus. In one embodiment, the heavy chain variable domain of the chimeric antibody and/or the light chain variable domain of the chimeric antibody is expressed from a rearranged transgene (e.g., a rearranged nucleic acid sequence derived from an unrearranged nucleic acid sequence integrated into the animal's genome at a locus other than an endogenous immunoglobulin locus). In one embodiment, the light chain variable domain of the chimeric antibody is expressed from a rearranged transgene (e.g., a rearranged nucleic acid sequence derived from an unrearranged nucleic acid sequence integrated into the animal's genome at a locus other than an endogenous immunoglobulin locus).
(133) In a specific embodiment, the transgene is expressed from a transcriptionally active locus, e.g., a ROSA26 locus, e.g., a murine (e.g., mouse) ROSA26 locus.
(134) In one aspect, a non-human animal is provided, comprising a humanized immunoglobulin heavy chain locus, wherein the humanized immunoglobulin heavy chain locus comprises a non-human ADAM6 sequence or ortholog or homolog thereof.
(135) In one embodiment, the non-human ADAM6 ortholog or homolog is a sequence that is orthologous and/or homologous to a mouse ADAM6 sequence, wherein the ortholog or homolog is functional in the non-human animal.
(136) In one embodiment, the non-human animal is a rodent selected from a mouse, a rat, and a hamster.
(137) In one embodiment, the non-human animal is selected from a mouse, a rat, and a hamster and the ADAM6 ortholog or homolog is from a non-human animal selected from a mouse, a rat, and a hamster. In a specific embodiment, the non-human animal is a mouse and the ADAM6 ortholog or homolog is from an animal that is selected from a different mouse species, a rat, and a hamster. In specific embodiment, the non-human animal is a rat, and the ADAM6 ortholog or homolog is from a rodent that is selected from a different rat species, a mouse, and a hamster. In a specific embodiment, the non-human animal is a hamster, and the ADAM6 ortholog or homolog is form a rodent that is selected from a different hamster species, a mouse, and a rat.
(138) In a specific embodiment, the non-human animal is from the suborder Myomorpha, and the ADAM6 sequence is from an animal selected from a rodent of superfamily Dipodoidea and a rodent of the superfamily Muroidea. In a specific embodiment, the rodent is a mouse of superfamily Muroidea, and the ADAM6 ortholog or homolog is from a mouse or a rat or a hamster of superfamily Muroidea.
(139) In one embodiment, the humanized heavy chain locus comprises a single human V.sub.H gene segment, one or more human D.sub.H gene segments and one or more human J.sub.H gene segments. In a specific embodiment, the human V.sub.H gene segment, one or more human D.sub.H gene segments and one or more human J.sub.H gene segments are operably linked to one or more human, chimeric and/or rodent (e.g., mouse or rat) constant region genes. In one embodiment, the constant region genes are mouse. In one embodiment, the constant region genes are rat. In one embodiment, the constant region genes are hamster. In one embodiment, the constant region genes comprise a sequence selected from a hinge, a C.sub.H2, a C.sub.H3, and a combination thereof. In specific embodiment, the constant region genes comprise a hinge, a C.sub.H2, and a C.sub.H3 sequence.
(140) In one embodiment, the non-human ADAM6 sequence is contiguous with a human immunoglobulin heavy chain sequence. In one embodiment, the non-human ADAM6 sequence is positioned within a human immunoglobulin heavy chain sequence. In a specific embodiment, the human immunoglobulin heavy chain sequence comprises a V, D and/or J gene segment.
(141) In one embodiment, the non-human ADAM6 sequence is juxtaposed with a V gene segment. In one embodiment, the non-human ADAM6 sequence is positioned between two V gene segments. In one embodiment, the non-human ADAM6 sequence is juxtaposed between a V and a D gene segment. In one embodiment, the mouse ADAM6 sequence is positioned between a V and a J gene segment. In one embodiment, the mouse ADAM6 sequence is juxtaposed between a D and a J gene segment.
(142) In one aspect, a genetically modified non-human animal is provided, comprising a B cell that expresses a human V.sub.H domain cognate with a human V.sub.L domain from an immunoglobulin locus, wherein the non-human animal expresses a non-immunoglobulin non-human protein from the immunoglobulin locus. In one embodiment, the non-immunoglobulin non-human protein is an ADAM protein. In a specific embodiment, the ADAM protein is an ADAM6 protein or homolog or ortholog or functional fragment thereof.
(143) In one embodiment the non-human animal is a rodent (e.g., mouse or rat). In one embodiment, the rodent is of family Muridae. In one embodiment, the rodent is of subfamily Murinae. In a specific embodiment, the rodent of subfamily Murinae is selected from a mouse and a rat.
(144) In one embodiment, the non-immunoglobulin non-human protein is a rodent protein. In one embodiment, the rodent is of family Muridae. In one embodiment, the rodent is of subfamily Murinae. In a specific embodiment, the rodent is selected from a mouse, a rat, and a hamster.
(145) In one embodiment, the human V.sub.H and V.sub.L domains are attached directly or through a linker to an immunoglobulin constant domain sequence. In a specific embodiment, the constant domain sequence comprises a sequence selected from a hinge, a C.sub.H2 a C.sub.H3, and a combination thereof. In a specific embodiment, the human V.sub.L domain is selected from a V or a V domain.
(146) In one aspect, a genetically modified non-human animal is provided, comprising in its germline a human immunoglobulin sequence, wherein the sperm of a male non-human animal is characterized by an in vivo migration defect. In one embodiment, the in vivo migration defect comprises an inability of the sperm of the male non-human animal to migrate from a uterus through an oviduct of a female non-human animal of the same species. In one embodiment, the non-human animal lacks a nucleotide sequence that encodes and ADAM6 protein or functional fragment thereof. In a specific embodiment, the ADAM6 protein or functional fragment thereof includes an ADAM6a and/or an ADAM6b protein or functional fragments thereof. In one embodiment, the non-human animal is a rodent. In a specific embodiment, the rodent is selected from a mouse, a rat, and a hamster.
(147) In one aspect, a non-human animal is provided, comprising a human immunoglobulin sequence contiguous with a non-human sequence that encodes an ADAM6 protein or ortholog or homolog or functional fragment thereof. In one embodiment, the non-human animal is a rodent. In a specific embodiment, the rodent is selected from a mouse, a rat, and a hamster.
(148) In one embodiment, the human immunoglobulin sequence is an immunoglobulin heavy chain sequence. In one embodiment, the immunoglobulin sequence comprises a single V.sub.H gene segments. In one embodiment, the human immunoglobulin sequence comprises one or more D.sub.H gene segments. In one embodiment, the human immunoglobulin sequence comprises one or more J.sub.H gene segments. In one embodiment, the human immunoglobulin sequence comprises a single V.sub.H gene segments, one or more D.sub.H gene segments and one or more J.sub.H gene segments.
(149) In one embodiment, the immunoglobulin sequence comprises a single V.sub.H gene segment that is associated with polymorphism in natural human repertoires. In a specific embodiment, the single V.sub.H gene segment is selected from human V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, or V.sub.H3-23. In another specific embodiment the single V.sub.H gene segment is V.sub.H1-2. In another specific embodiment, the single V.sub.H gene segment is V.sub.H1-69.
(150) In one embodiment, the immunoglobulin sequence comprises a single V.sub.H gene segment that is associated with multiple copy number in natural human repertoires. In a specific embodiment, the single V.sub.H gene segment is selected from human V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, or V.sub.H3-23. In another specific embodiment the single V.sub.H gene segment is V.sub.H1-2. In another specific embodiment, the single V.sub.H gene segment is V.sub.H1-69.
(151) In various embodiments, the V.sub.H gene segment is selected from V.sub.H6-1, V.sub.H1-2, V.sub.H1-3, V.sub.H2-5, V.sub.H3-7, V.sub.H1-8, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H1-18, V.sub.H3-20, V.sub.H3-21, V.sub.n3-23, V.sub.H1-24, V.sub.H2-26, V.sub.H4-28, V.sub.H3-30, V.sub.H4-31, V.sub.H3-33, V.sub.H4-34, V.sub.H3-35, V.sub.H3-38, V.sub.H4-39, V.sub.H3-43, V.sub.H1-45, V.sub.H1-46, V.sub.H3-48, V.sub.H3-49, V.sub.H5-51, V.sub.H3-53, V.sub.H1-58, V.sub.H4-59, V.sub.H4-61, V.sub.H3-64, V.sub.H3-66, V.sub.H1-69, V.sub.H2-70, V.sub.H3-72, V.sub.H3-73 and V.sub.H3-74.
(152) In various embodiments, the V.sub.H gene segment is selected from Table 1 and is represented in natural human repertoires by five or more alleles. In a specific embodiment the V.sub.H gene is selected from V.sub.H1-2, V.sub.H1-69, V.sub.H2-5, V.sub.H2-70, V.sub.H3-15, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-49, V.sub.H3-64, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-2, V.sub.H4- 30-4, V.sub.n4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51 and V.sub.H7-4-1.
(153) In one embodiment, the non-human animal is a mouse, and the mouse comprises a replacement of endogenous mouse V.sub.H gene segments with a single human V.sub.H gene segments, wherein the human V.sub.H gene segment is operably linked to a mouse C.sub.H region gene, such that the mouse rearranges the human V.sub.H gene segment and expresses a reverse chimeric immunoglobulin heavy chain that comprises a human V.sub.H domain and a mouse C.sub.H. In one embodiment, 90-100% of unrearranged mouse V.sub.H gene segments are replaced with one unrearranged human V.sub.H gene segment. In a specific embodiment, all or substantially all of the endogenous mouse V.sub.H gene segments are replaced with one unrearranged human V.sub.H gene segment. In one embodiment, the replacement is with an unrearranged human V.sub.H1-69 gene segment. In one embodiment, the replacement is with an unrearranged human V.sub.H1-2 gene segment. In one embodiment, the replacement is with an unrearranged human V.sub.H2-26 gene segment. In one embodiment, the replacement is with an unrearranged human V.sub.H2-70 gene segment. In one embodiment, the replacement is with an unrearranged human V.sub.H3-23 gene segment.
(154) In one embodiment, the mouse comprises a replacement of all mouse D.sub.H and J.sub.H segments with at least one unrearranged human D.sub.H segment and at least one unrearranged human J.sub.H segment. In one embodiment, the at least one unrearranged human D.sub.H segment is selected from 1-1, 1-7, 1-26, 2-8, 2-15, 3-3, 3-10, 3-16, 3-22, 5-5, 5-12, 6-6, 6-13, 7-27, and a combination thereof. In one embodiment, the at least one unrearranged human J.sub.H segment is selected from 1, 2, 3, 4, 5, 6, and a combination thereof.
(155) In various embodiments, the human immunoglobulin sequence is in operable linkage with a constant region in the germline of the non-human animal (e.g., the rodent, e.g., the mouse, rat, or hamster). In one embodiment, the constant region is a human, chimeric human/mouse or chimeric human/rat or chimeric human/hamster, a mouse, a rat, or a hamster constant region. In one embodiment, the constant region is a rodent (e.g., mouse or rat or hamster) constant region. In a specific embodiment, the rodent is a mouse or rat. In various embodiments, the constant region comprises at least a C.sub.H2 domain and a C.sub.H.sup.3 domain.
(156) In one embodiment, the human immunoglobulin heavy chain sequence is located at an immunoglobulin heavy chain locus in the germline of the non-human animal (e.g., the rodent, e.g., the mouse or rat or hamster). In one embodiment, the human immunoglobulin heavy chain sequence is located at a non-immunoglobulin heavy chain locus in the germline of the non-human animal, wherein the non-heavy chain locus is a transcriptionally active locus. In a specific embodiment, the non-heavy chain locus is a ROSA26 locus.
(157) In various aspects, the non-human animal further comprises a human immunoglobulin light chain sequence (e.g., one or more unrearranged light chain V and J sequences, or one or more rearranged VJ sequences) in the germline of the non-human animal. In a specific embodiment, the immunoglobulin light chain sequence is an immunoglobulin light chain sequence. In one embodiment, the human immunoglobulin light chain sequence comprises one or more V.sub.L gene segments. In one embodiment, the human immunoglobulin light chain sequence comprises one or more J.sub.L gene segments. In one embodiment, the human immunoglobulin light chain sequence comprises one or more V.sub.L gene segments and one or more J.sub.L gene segments. In a specific embodiment, the human immunoglobulin light chain sequence comprises at least 16 V gene segments and five J gene segments. In a specific embodiment, the human immunoglobulin light chain sequence comprises at least 30 V gene segments and five J gene segments. In a specific embodiment, the human immunoglobulin light chain sequence comprises at least 40 V gene segments and five J gene segments. In various embodiments, the human immunoglobulin light chain sequence is in operable linkage with a constant region in the germline of the non-human animal (e.g., rodent, e.g., mouse or rat or hamster). In one embodiment, the constant region is a human, chimeric human/rodent, mouse, rat, or hamster constant region. In a specific embodiment, the constant region is a mouse or rat constant region. In a specific embodiment, the constant region is a mouse constant (mC) region or a rat constant (rC) region.
(158) In one embodiment, the non-human animal is a mouse and the mouse comprises a replacement of all or substantially all V and J gene segments with at least six human V gene segments and at least one J gene segment. In one embodiment, all or substantially all V and J gene segments are replaced with at least 16 human V gene segments (human V) and at least one J gene segment. In one embodiment, all or substantially all V and J gene segments are replaced with at least 30 human V gene segments and at least one J gene segment. In one embodiment, all or substantially all V and J gene segments are replaced with at least 40 human V gene segments and at least one J gene segment. In one embodiment, the at least one J gene segment comprises two, three, four, or five human J gene segments.
(159) In one embodiment, the human V gene segments comprise V4-1, V5-2, V7-3, V2-4, V1-5, and V1-6. In one embodiment, the V gene segments comprise V3-7, V1-8, V1-9, V2-10, V3-11, V1-12, V1-13, V2-14, V3-15 and V1-16. In one embodiment, the human V gene segments comprise V1-17, V2-18, V2-19, V3-20, V6-21, V1-22, V1-23, V2-24, V3-25, V2-26, V1-27, V2-28, V2-29, and V2-30. In one embodiment, the human V gene segments comprise V3-31, V1-32, V1-33, V3-34, V1-35, V2-36, V1-37, V2-38, V1-39, and V2-40.
(160) In a specific embodiment, the V gene segments comprise contiguous human immunoglobulin gene segments spanning the human immunoglobulin light chain locus from V4-1 through V2-40, and the J gene segments comprise contiguous gene segments spanning the human immunoglobulin light chain locus from J1 through J5.
(161) In one embodiment, the human immunoglobulin light chain sequence is located at an immunoglobulin light chain locus in the germline of the non-human animal. In a specific embodiment, the immunoglobulin light chain locus in the germline of the non-human animal is an immunoglobulin light chain locus. In one embodiment, the human immunoglobulin light chain sequence is located at a non-immunoglobulin light chain locus in the germline of the non-human animal that is transcriptionally active. In a specific embodiment, the non-immunoglobulin locus is a ROSA26 locus.
(162) In one aspect, a method of making a human antibody is provided, wherein the human antibody comprises variable domains derived from one or more variable region nucleic acid sequences encoded in a cell of a non-human animal as described herein.
(163) In one aspect, a method of making an anti-idiotype antibody is provided, wherein the anti-idiotype antibody comprises variable domains derived from one or more variable region nucleic acid sequences encoded in a cell of a non-human animal as described herein, the method comprising exposing a non-human animal as described herein to an antibody comprising human variable domains. In one embodiment, the anti-idiotype antibody is specific for or is capable of binding a human heavy chain variable domain. In one embodiment, the antibody is specific for or is capable of binding a human light chain variable domain.
(164) In a specific embodiment, the anti-idiotype antibody is specific for or is capable of binding a human heavy chain variable domain, wherein the human heavy chain variable domain comprises a rearranged human V.sub.H gene segment selected from V.sub.H6-1, V.sub.H1-2, V.sub.H1-3, V.sub.H2-5, V.sub.H3-7, V.sub.H1-8, V.sub.H3-9, V.sub.H3-11, V.sub.H3-13, V.sub.H3-15, V.sub.H3-16, V.sub.H1-18, V.sub.H3-20, V.sub.H3-21, V.sub.n3-23, V.sub.H1-24, V.sub.H2-26, V.sub.H4-28, V.sub.H3-30, V.sub.H4-31, V.sub.H3-33, V.sub.H4-34, V.sub.H3-35, V.sub.H3-38, V.sub.H4-39, V.sub.H3-43, V.sub.H1-45, V.sub.H1-46, V.sub.H3-48, V.sub.H3-49, V.sub.H5-51, V.sub.H3-53, V.sub.H1-58, V.sub.H4-59, V.sub.H4-61, V.sub.H3-64, V.sub.H3-66, V.sub.H1-69, V.sub.H2-70, V.sub.H3-72, V.sub.H3-73 and V.sub.H3-74.
(165) In a specific embodiment, the anti-idiotype antibody is specific for or is capable of binding a human heavy chain variable domain, wherein the human heavy chain variable domain comprises a rearranged human V.sub.H gene segment selected from V.sub.H1-2, V.sub.H1-69, V.sub.H2-5, V.sub.H2-70, V.sub.H3-15, V.sub.H3-23, V.sub.H3-30, V.sub.H3-33, V.sub.H3-49, V.sub.H3-64, V.sub.H4-4, V.sub.H4-28, V.sub.H4-30-2, V.sub.H4-30-4, V.sub.H4-31, V.sub.H4-34, V.sub.H4-39, V.sub.H4-59, V.sub.H4-61, V.sub.H5-51 and V.sub.H7-4-1.
(166) In a specific embodiment, the anti-idiotype antibody is specific for or is capable of binding a human light chain variable domain, wherein the human light chain variable domain comprises a rearranged human V gene segment selected from V4-1, V5-2, V7-3, V2-4, V1-5, V1-6, V3-7, V1-8, V1-9, V2-10, V3-11, V1-12, V1-13, V2-14, V3-15, V1-16, V1-17, V2-18, V2-19, V3-20, V6-21, V1-22, V1-23, V2-24, V3-25, V2-26, V1-27, V2-28, V2-29, V2-30, V3-31, V1-32, V1-33, V3-34, V1-35, V2-36, V1-37, V2-38, V1-39, and V2-40.
(167) In a specific embodiment, the anti-idiotype antibody is specific for or is capable of binding a human light chain variable domain, wherein the human light chain variable domain comprises a rearranged human V1-39 gene segment.
(168) In a specific embodiment, the anti-idiotype antibody is specific for or is capable of binding a human light chain variable domain, wherein the human light chain variable domain comprises a rearranged human V gene segment selected from V3-1, V4-3, V2-8, V3-9, V3-10, V2-11, V3-12, V2-14, V3-16, V2-18, V3-19, V3-21, V3-22, V2-23, V3-25, V3-27, V3-32, V2-33, V2-34, V1-36, V1-40, V7-43, V1-44, V5-45, V7-46, V1-47, V5-48, V9-49, V1-50, V1-51, V5-52, V10-54, V1-55, V6-57, V4-60, V8-61, and V4-69.
(169) In one embodiment, a method of making an anti-idiotype antibody is provided, wherein the anti-idiotype antibody comprises variable domains derived from one or more variable region nucleic acid sequences encoded in a cell of a non-human animal that comprises a restricted immunoglobulin heavy chain locus comprising a single human V.sub.H gene segment, 27 D.sub.H gene segments, and six J.sub.H gene segments, and wherein the anti-idiotype antibody is specific for or is capable of binding a human heavy chain variable domain comprising a rearranged human V.sub.H1-69 gene segment, the method comprising exposing the non-human animal to an antibody comprising the rearranged human V.sub.H1-69 gene segment and isolating the anti-idiotype antibody from the non-human animal. In a specific embodiment, the single human V.sub.H gene segment is selected from a human V.sub.H1-2 and a human V.sub.H1-69 gene segment.
(170) In one embodiment, a method of making an anti-idiotype antibody is provided, wherein the anti-idiotype antibody comprises variable domains derived from one or more variable region nucleic acid sequences encoded in a cell of a non-human animal that comprises a restricted immunoglobulin heavy chain locus comprising a single human V.sub.H gene segment, 27 D.sub.H gene segments, and six J.sub.H gene segments, and wherein the anti-idiotype antibody is specific for or is capable of binding a human light chain variable domain comprising a rearranged human V1-39 gene segment, the method comprising exposing the non-human animal to an antibody comprising the human V1-39 gene segment and isolating the antibody from the non-human animal. In a specific embodiment, the single human V.sub.H gene segment is selected from a human V.sub.H1-2 and a human V.sub.H1-69 gene segment.
(171) In one aspect, a pharmaceutical composition is provided, comprising a polypeptide that comprises antibody or antibody fragment that is derived from one or more variable region nucleic acid sequences isolated from a non-human animal as described herein. In one embodiment, the polypeptide is an antibody. In one embodiment, the polypeptide is a heavy chain only antibody. In one embodiment, the polypeptide is a single chain variable fragment (e.g., an scFv).
(172) In one aspect, use of a non-human animal as described herein to make an antibody is provided. In various embodiments, the antibody comprises one or more variable domains that are derived from one or more variable region nucleic acid sequences isolated from the non-human animal. In a specific embodiment, the variable region nucleic acid sequences comprise immunoglobulin heavy chain gene segments. In a specific embodiment, the variable region nucleic acid sequences comprise immunoglobulin light chain gene segments.
EXAMPLES
(173) The following examples are provided so as to describe to those of ordinary skill in the art how to make and use methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Unless indicated otherwise, temperature is indicated in Celsius, and pressure is at or near atmospheric.
Example 1
(174) Construction of a Restricted Humanized IgH Locus
(175) A uniquely engineered human heavy chain locus containing a single human V.sub.H gene segment located upstream of all the human D.sub.H and J.sub.H gene segments may be constructed by homologous recombination using Bacterial Artificial Chromosome (BAC) DNA. Exemplary human V.sub.H gene segments employed for construction of such an immunoglobulin heavy chain locus include polymorphic V.sub.H gene segments and/or V.sub.H gene segments associated with a variation in copy number, such as, for example V.sub.H1-2, V.sub.H1-69, V.sub.H2-26, V.sub.H2-70, and V.sub.H3-23. VELOCIGENE genetic engineering technology can be employed for the creation of a single V.sub.H containing heavy chain locus using several targeting constructs (see, e.g., U.S. Pat. No. 6,586,251 and Valenzuela, D. M. et al., 2003, High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nature Biotechnology 21(6): 652-659).
(176) Exemplary Strategy for Construction of a Human V.sub.H1-69 Restricted IgH Locus (
(177) In the first step, a modified human BAC containing multiple distal (5) human V.sub.H gene segments, including V.sub.H1-69, an upstream selection cassette (e.g., hygromycin) and a 5 mouse homology arm was targeted by homologous recombination with a second selection cassette (e.g., spectinomycin), which also contained a modified recombination signal sequence (Step 1,
(178) Step 2 included the use of a neomycin (Neo) cassette flanked by Frt sites to delete the selection cassette (hygromycin) and additional upstream (5) human V.sub.H gene segments. This modification was targeted, by homologous recombination, 5 to the human V.sub.H1-69 gene segment to leave intact about 8.2 kb of the promoter region of human V.sub.H1-69 and the 5 mouse homology arm.
(179) Step 3 included another selection cassette (spectinomycin) flanked by uniquely engineered restriction sites (e.g., PI-SceI and AsiSI) targeted by homologous recombination to a human genomic fragment containing the first three functional human V.sub.H gene segments and all the human D.sub.H and J.sub.H gene segments (
(180) Step 4 was accomplished by using the unique restriction sites (described above) to cut followed by ligation of the two modified BACs from Step 2 and Step 3, which yielded the final targeting construct. The final targeting construct for the creation of a modified heavy chain locus containing a human V.sub.H1-69 gene segment, all the human D.sub.H, and all the human J.sub.H gene segments in ES cells contained, from 5 to 3, a 5 homology arm containing about 20 kb of mouse genomic sequence upstream of the endogenous heavy chain locus, a 5 Frt site, a neomycin cassette, a 3 Frt site, about 8.2 kb of the human V.sub.H1-69 promoter, the human V.sub.H1-69 gene segment with a modified 3 RSS, 27 human D.sub.H gene segments, six human J.sub.H segments, and a 3 homology arm containing about 8 kb of mouse genomic sequence downstream of the mouse J.sub.H gene segments including the 3 intronic enhancer and IgM gene (
(181) Exemplary Strategy for Construction of a Human V.sub.H1-2 Restricted IgH Locus (
(182) In a similar fashion, other polymorphic V.sub.H gene segments in the context of mouse heavy chain constant regions are employed to construct a series of mice having a restricted number immunoglobulin heavy chain V segments (e.g., 1, 2, 3, 4, or 5), wherein the V segments are polymorphic variants of a V gene family member. Exemplary polymorphic V.sub.H gene segments are derived from human V.sub.H gene segments including, e.g., V.sub.H1-2, V.sub.H2-26, V.sub.H2-70 and V.sub.H3-23. Such human V.sub.H gene segments are obtained, e.g., by de novo synthesis (e.g., Blue Heron Biotechnology, Bothell, Wash.) using sequences available on published databases. Thus, DNA fragments encoding each V.sub.H gene are, in some embodiments, generated independently for incorporation into targeting vectors, as described herein. In this way, multiple modified immunoglobulin heavy chain loci comprising a restricted number of V.sub.H gene segments are engineered in the context of mouse heavy chain constant regions. An exemplary targeting strategy for creating a restricted humanized heavy chain locus containing a human V.sub.H1-2 gene segment, 27 human D.sub.H gene segments, and six human J.sub.H gene segments is shown in
(183) Briefly, a modified human BAC clone containing three human V.sub.H gene segments (V.sub.H6-1, V.sub.H1-2, V.sub.H1-3), 27 human D.sub.H gene segments, and six human J.sub.H gene segments (see U.S. Ser. No. 13/404,075; filed 24 Feb. 2012, herein incorporated by reference) is used to create a restricted humanized heavy chain locus containing a human V.sub.H1-2 gene segment. This modified BAC clone functionally links the aforementioned human heavy chain gene segments with the mouse intronic enhancer and the IgM constant region. The restricted human V.sub.H1-2 based heavy chain locus is achieved by two homologous recombinations using the modified human BAC clone described above. In the first homologous recombination, 205 bp of the human V.sub.H6-1 gene segment (from about 10 bp upstream (5) of the V.sub.H6-1 start codon in exon 1 to about 63 bp downstream (3) of the beginning of exon 2) in the modified human BAC clone is deleted by bacterial homologous recombination using a spectinomycin (aadA) cassette flanked by unique PI-SceI restriction sites (
(184) Employing polymorphic V.sub.H gene segments in a restricted immunoglobulin heavy chain locus represents a novel approach for generating antibodies, populations of antibodies, and populations of B cells that express antibodies having heavy chains with diverse CDRs derived from a single human V.sub.H gene segment. Exploiting the somatic hypermutation machinery of the host animal along with combinatorial association with rearranged human immunoglobulin light chain variable domains results in the engineering of unique heavy chains and unique V.sub.H/V.sub.L pairs that expand the immune repertoire of genetically modified animals and enhance their usefulness as a next generation platform for making human therapeutics, especially useful as a platform for making neutralizing antibodies specific for human pathogens.
(185) Based on the final desired locus structure, one of the other human V.sub.H gene segments may be substituted in a similar fashion using human BAC clones containing the desired human V.sub.H gene segment. Thus, using the strategy outlined above for incorporation of additional and/or other polymorphic V.sub.H gene segments into the mouse immunoglobulin heavy chain locus allows for the generation of novel antibody repertoires for use in neutralizing human pathogens that might otherwise effectively evade the host immune system.
(186) Targeted ES cells described above are used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE method (supra). Mice bearing a humanized heavy chain locus containing a single human V.sub.H gene segment, all the human D.sub.H and J.sub.H gene segments operably linked to the mouse immunoglobulin constant region genes are identified by genotyping using a modification of allele assay (Valenzuela et al., supra) that detected the presence of the neomycin cassette, the human V.sub.H gene segment and a region within the human D.sub.H and J.sub.H gene segments as well as endogenous heavy chain sequences. Table 3 sets forth the primers and probes that are used to confirm mice harboring a restricted heavy chain locus containing a single human V.sub.H1-69 gene segment, 27 human D.sub.H gene segments and six human J.sub.H gene segments.
(187) Mice bearing an engineered heavy chain locus that contains a single human V.sub.H gene segment can be bred to a FLPe deletor mouse strain (see, e.g., Rodriguez, C. I. et al. (2000) High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nature Genetics 25: 139-140) in order to remove any Frt'ed neomycin cassette introduced by the targeting vector that is not removed, e.g., at the ES cell stage or in the embryo. Optionally, the neomycin cassette is retained in the mice.
(188) Pups are genotyped and a pup heterozygous for a humanized heavy chain locus containing a single human V.sub.H gene segment, all the human D.sub.H and J.sub.H segments operably linked to the endogenous mouse immunoglobulin constant genes is selected for characterizing the immunoglobulin heavy chain repertoire.
(189) TABLE-US-00003 TABLE3 Name SEQ (RegionDetected) Sequence(5-3) IDNO: hyg Forward: TGCGGCCGATCTTAGCC 7 (hygromycin Reverse: TTGACCGATTCCTTGCGG 8 cassette) Probe: ACGAGCGGGTTCGGCCCATTC 9 neo Forward: GGTGGAGAGGCTATTCGGC 10 (neomycin Reverse: GAACACGGCGGCATCAG 11 cassette) Probe: TGGGCACAACAGACAATCGGCTG 12 higH9T Forward: TCCTCCAACGACAGGTCCC 13 human(D.sub.H-J.sub.H Reverse: GATGAACTGACGGGCACAGG 14 genomicsequence) Probe: TCCCTGGAACTCTGCCCCGACACA 15 77h3 Forward: CTCTGTGGAAAATGGTATGGAGATT 16 humanV.sub.H1-69 Reverse: GGTAAGCATAGAAGGTGGGTATCTTT 17 genesegment) Probe: ATAGAACTGTCATTTGGTCCAGCAATCCCA 18 mIgHA7 Forward: TGGTCACCTCCAGGAGCCTC 19 (mouseD.sub.H-J.sub.H Reverse: GCTGCAGGGTGTATCAGGTGC 20 genomicsequence) Probe: AGTCTCTGCTTCCCCCTTGTGGCTATGAGC 21 88710T Forward: GATGGGAAGAGACTGGTAACATTTGTAC 22 (mouse3 V.sub.H Reverse: TTCCTCTATTTCACTCTTTGAGGCTC 23 genomicsequence) Probe: CCTCCACTGTGTTAATGGCTGCCACAA 24 mIgHd10 Forward: GGTGTGCGATGTACCCTCTGAAC 25 (mouse5 V.sub.H Reverse: TGTGGCAGTTTAATCCAGCTTTATC 26 genomicsequence) Probe: CTAAAAATGCTACACCTGGGGCAAAACACCTG 27 mIgHp2 Forward: GCCATGCAAGGCCAAGC 28 (mouseJ.sub.H Reverse: AGTTCTTGAGCCTTAGGGTGCTAG 29 genomicsequence) Probe: CCAGGAAAATGCTGCCAGAGCCTG 30
Example 2
(190) Reengineering of ADAM Genes into a Restricted Humanized IgH Locus
(191) Mice with humanized immunoglobulin heavy chain loci in which the endogenous variable region gene segments (VDJ) have been replaced and/or deleted lack expression of endogenous ADAM6 genes. In particular, male mice comprising such humanized immunoglobulin heavy chain loci demonstrate a reduction in fertility. Thus, the ability to express ADAM6 was reengineered into mice with humanized, yet restricted, heavy chain loci to perpetuate the modified mouse strains using normal breeding methods.
(192) Reengineering of ADAM6 Genes into a Human V.sub.H1-69 Restricted IgH Locus (
(193) A restricted immunoglobulin heavy chain locus containing a single human V.sub.H1-69 gene segment located upstream of all the human D.sub.H and J.sub.H gene segments was reengineered to contain a genomic fragment encoding mouse ADAM6a and ADAM6b (SEQ ID NO: 77) by homologous recombination using BAC DNA. This was accomplished by VELOCIGENE genetic engineering technology (supra) in a series of six steps that included modification of BAC DNA containing mouse and human sequences that yielded a final targeting vector containing a restricted humanized heavy chain locus contiguous with mouse heavy chain constant regions and mouse ADAM6 genes.
(194) First, a mouse genomic fragment that encoded mouse ADAM6a and ADAM6b was prepared for insertion into a humanized heavy chain locus containing a single V.sub.H gene segments by a series of three bacterial homologous recombinations involving different selection cassettes to uniquely position restriction sites around the mouse ADAM6 genes (
(195) In step four, a humanized heavy chain locus containing a human V.sub.H1-69 gene segment, 27 human D.sub.H gene segments, and six human J.sub.H gene segments was separately targeted by bacterial homologous recombination with a spectinomycin cassette containing unique I-CeuI and AscI restriction sites at 5 and 3 locations in the cassette, respectively (
(196) This step produced the final targeting vector for reinsertion of mouse ADAM6a and ADAM6b sequences into a restricted humanized heavy chain locus, which contained, from 5 to 3, a 5 homology arm containing about 20 kb of mouse genomic sequence upstream of the endogenous heavy chain locus, a 5 Frt site, a neomycin cassette, a 3 Frt site, about 8.2 kb of the human V.sub.H1-69 promoter, the human V.sub.H1-69 gene segment with a modified 3 RSS, a mouse genomic fragment containing about 17711 bp of mouse genomic sequence including mouse ADAM6a and ADAM6b genes (SEQ ID NO: 77), a human genomic fragment containing 27 human D.sub.H and six human J.sub.H gene segments, and a 3 homology arm containing about 8 kb of mouse genomic sequence downstream of the endogenous heavy chain locus including the intronic enhancer and the IgM constant region gene (Human V.sub.H1-69/A6 Targeting Vector, SEQ ID NO: 74;
(197) Reengineering of ADAM6 Genes into a Human V.sub.H1-2 Restricted IgH Locus (
(198) A restricted immunoglobulin heavy chain locus containing a single human V.sub.H1-2 gene segment located upstream of all the human D.sub.H and J.sub.H gene segments is reengineered to contain a genomic fragment encoding mouse ADAM6a and ADAM6b (SEQ ID NO: 73) by homologous recombination using BAC DNA. This was accomplished by VELOCIGENE genetic engineering technology (supra) in a series of steps that included modification of BAC DNA containing mouse and human sequences that yielded a final targeting vector containing a restricted humanized heavy chain locus contiguous with mouse heavy chain constant regions and mouse ADAM6 genes.
(199) A modified human BAC clone containing a single human V.sub.H1-2 gene segment flanked by 5 hygromycin and 3 spectinomycin cassettes, 27 human D.sub.H gene segments, six human J.sub.H gene segments, a mouse heavy chain intronic enhancer, and a mouse IgM constant region (described above in Example 1) was modified to contain a genomic fragment encoding mouse ADAM6 genes. This is accomplished by a modified isothermic DNA assembly method referred to herein as oligo-mediated isothermal assembly, which is based on the method described in Gibson et al. (2009, Enzymatic assembly of DNA molecules up to several hundred kilobases, Nature Methods 6(5):343-345; herein incorporated by reference). This modified method does not require sequence identity between the ligated fragments. Instead, sequence identity is imparted by an oligo that serves to join the two fragments. Further, the oligo serves as a template that adds sequence identity to the end of one of the fragments. The extended fragment enables hybridization with the second fragment. Specifically, oligo-mediated isothermal assembly was employed to replace the hygromycin cassette with a NotI-AscI fragment containing a 20 kb distal mouse IgH homology arm, the mouse ADAM6a gene, a neomycin cassette flanked by Frt sites, and the mouse ADAM6b gene.
(200) Briefly, the modified human BAC clone containing a restricted human V.sub.H1-2 heavy chain locus (
(201) The final targeting vector contains, from 5 to 3, a 20 kb distal mouse IgH homology arm, a mouse ADAM6a gene, a 5 Frt site, a neomycin cassette, a 3 Frt site, a mouse ADAM6b gene, a 18 kb human genomic fragment, a human V.sub.H1-2 gene segment, a 46.6 kb human genomic fragment, an inactivated human V.sub.H6-1 gene segment, 27 human D.sub.H gene segments, six human J.sub.H gene segments, and an 8 kb 3 mouse homology arm containing a mouse IgH intronic enhancer and IgM constant region (SEQ ID NO: 76)
(202) Each of the final targeting vectors (described above) were used to electroporate mouse ES cells that contained a deleted endogenous heavy chain locus to created modified ES cells comprising a mouse genomic sequence ectopically placed that comprises mouse ADAM6a and ADAM6b sequences within a restricted humanized heavy chain locus. Positive ES cells containing the ectopic mouse genomic fragment within the humanized heavy chain locus were identified by a quantitative PCR assay using TAQMAN probes (Lie and Petropoulos, 1998, Advances in quantitative PCR technology: 5nuclease assays, Curr Opin Biotechnol 9(1):43-48).
(203) Targeted ES cells described above were used as donor ES cells and introduced into an 8-cell stage mouse embryo by the VELOCIMOUSE mouse engineering method (see, e.g., U.S. Pat. Nos. 7,6598,442, 7,576,259, 7,294,754). Mice bearing a humanized heavy chain locus containing a restricted number of human gene segments and an ectopic mouse genomic sequence comprising mouse ADAM6a and ADAM6b sequences were identified by genotyping using a modification of allele assay (Valenzuela et al., 2003) that detected the presence of the mouse ADAM6a and ADAM6b genes within the restricted humanized heavy chain locus as well as human heavy chain sequences.
(204) Pups are genotyped and a pup heterozygous for a restricted humanized heavy chain locus containing an ectopic mouse genomic fragment that comprises mouse ADAM6a and ADAM6b sequences is selected for characterizing mouse ADAM6 gene expression and fertility.