CO2 profile cultivation
10513697 ยท 2019-12-24
Assignee
Inventors
Cpc classification
C12Y402/01001
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C07K1/00
CHEMISTRY; METALLURGY
C07K16/00
CHEMISTRY; METALLURGY
International classification
C07K16/00
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C07K1/00
CHEMISTRY; METALLURGY
Abstract
A dissolved CO.sub.2 change in aqueous solutions affects directly the intracellular pH (pHi) value as it does so by influencing therefore important cellular processes. The enzyme carbonic anhydrase II (CAII) catalyzes the equilibrium of CO.sub.2 in aqueous solutions and because it alters the speed at which this equilibrium is reached it was identified as a strong candidate for metabolic engineering. The cell line stably expressing hCAII presented a better initial re-alkalinization of cytoplasm after induced CO.sub.2 acid load. The most alkaline pHi value associated to the lowest pHi variations was observed for that cell line in long term increased CO.sub.2 levels. In general, the increased CO.sub.2 profile triggered the quicker progress of G0G1-cell cycle phase for both transfected and control cell lines.
Claims
1. A method for recombinantly producing a polypeptide in a mammalian host cell, comprising the following steps: a) cultivating the mammalian host cell transfected with a first polynucleotide encoding a carbonic anhydrase and a second polynucleotide encoding the polypeptide, and b) recovering the polypeptide from the host cell or the cultivation medium and thereby producing the polypeptide, wherein the carbonic anhydrase is a human carbonic anhydrase II having the amino acid sequence of SEQ ID NO:3.
2. The method according to claim 1, wherein the cultivating comprises a first period of time with a first constant pCO.sub.2 value, and thereafter a second period of time with an increasing pCO.sub.2 value from the first constant pCO.sub.2 value to a second pCO.sub.2 value.
3. The method according to claim 2, wherein the first constant pCO.sub.2 value is of from about 4% to about 9%.
4. The method according to claim 3, wherein the first constant pCO.sub.2 value is about 5%.
5. The method according to claim 2, wherein the second pCO.sub.2 value is of from about 15% to about 30%.
6. The method according to claim 5, wherein the second pCO.sub.2 value is about 25%.
7. The method according to claim 2, wherein the cultivating further comprises a third period of time after the second period of time with the same pCO.sub.2 value as the second pCO.sub.2 value.
8. The method according to claim 1, wherein the polypeptide is an antibody, or an antibody conjugate, or an antibody fragment, or an Fc-region fusion polypeptide.
9. The method according to claim 1, wherein the mammalian host cell is a CHO cell.
10. The method according to claim 9, wherein the CHO cell is a CHO K1 cell.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
EXAMPLES
(18) Molecular Biological Methods
(19) To prepare clones of CHO cells, a three step approach is taken. First, the gene of interest (GOI) is cloned into an appropriate mammalian expression vector. Second, the resulting plasmid is prepared in E. coli, and finally, the construct-bearing plasmid is introduced into the CHO cells, where the desired DNA is incorporated in the genome.
(20) Vectors
(21) The mammalian expression vector for hCAII gene (NCBI Ref. Seq.: NM000067) has a size of 4807 bp and it confers ampicillin resistance (Ampr) in E. coli. The pJRC36 vector construction is described by STERLING, D. AND CASEY, J. R., Biochem. J. 344 (1999) 221-229.
(22) Plasmid DNA Restriction
(23) For the preparation of linear DNA for nucleofection, 20 g of DNA were incubated in a reaction mixture with a total volume of 200 l containing 100 units of the restriction enzyme ApaLI. The restriction occurred by incubation for 4 h at 37 C. Afterwards, a 100 ng sample was analyzed by gel electrophoresis. After confirmation of DNA linearization, additional purification steps with Phenol-Chloroform extraction and ethanol precipitation were done in order to remove enzyme and salts from the DNA.
(24) Primer Design
(25) Primers for sequencing purposes were chosen to have a length of 20 to 22 nucleotides and a GC content of about 50%. The melting temperature of a primer is defined as the temperature at which 50% of the double strand DNA (dsDNA) has denatured. The annealing temperature (TA) is the temperature at which the primer anneals to a single-stranded DNA template and is considered as 5 C. lower than the TM. The melting temperature was between 60 C. and 80 C. and did not differ more than 5 C. between primer pairs. Primers were designed with no intra-primer homology beyond 3 base pairs. It was also considered the inclusion of more than one G or C residue at 3 end of primers to ensure correct binding.
(26) All primers were designed with the program Clone Manager Suite 7 (Sci-Ed Software). The following Table gives an overview of the resulting primers used for sequencing of hCAII gene in the vector. These primers were purchase from Invitrogen, dissolved in LAL-H2O to a final concentration of 10 pmol/l and stored at 20 C. The orientation of a primer is indicated by + for a sense primer and for an antisense primer. The location of the primers hybridization region is also indicated. The melting temperatures (TM) were calculated with the program Clone Manager Suite 7 (Sci-Ed Software).
(27) TABLE-US-00002 TABLE Location in Sequence T.sub.M Primer +/ phCAII-ZsGreen1 (5.fwdarw.3) [C.] PR07 + 569 GGTTTAGTGAACCGTCAGATCC 60 SEQ ID NO: 04 PR08 + 1251 AAAGGGCAAGAGTGCTGACTTC 62 SEQ ID NO: 05
Sequencing
(28) The sequencing of hCAII was performed at the Center for Biotechnology (CeBiTec, Bielefeld, Germany).
(29) Nucleofection of Mammalian Cells
(30) Nucleofection was performed with linearized DNA. Nucleofection of CHO cells was performed with the Nucleofector II according to the protocol provided by the manufacturer (Amaxa Biosystems, Cologne, Germany). In short, 510.sup.6 cells were harvested, gently mixed in 100 l of Cell Line Nucleofector Solution V and 4 g of linear DNA and transferred into a 0.1 cm gap cuvette. Immediately after, the cells were pulsed with the program U-024 of the Nucleofector II (Amaxa Biosystems), then pipetted into a 15 ml falcon tube containing 10 ml pre-warmed HyQ medium and spun down at 200g for 10 min. at RT. The pellet was resuspended in 5 ml pre-warmed HyQ medium and transferred into a T-25 flask. After 24 h incubation at 37 C. and 5% CO.sub.2, the cells were assayed for both viability and expression (transfection efficiency). After 48 h, the clone mixture was submitted to a limited dilution for single clone isolation.
(31) Mammalian Cells
(32) A Chinese Hamster Ovary (CHO) cell line producing an antibody was used. The cell line was created by transfecting the dihydrofolate reductase (DHFR) negative parent CHO cell line with a recombinant vector containing genes for both a DHFR and the antibody. The transfected genes were amplified by the DHFR inhibitor and methotrexate (MTX). A high producer was selected and cloned. The final cell line also contains resistance against hygromycin.
(33) Media for Cultivation of Mammalian Cells
(34) Pre-culture medium containing methotrexate was used for inoculum preparation and the main cultivations were performed in production medium. The different components were dissolved in MilliQ-H.sub.2O. The pH value of the medium was adjusted to pH 7.2 with 25% (v/v) HCl. After sterile filtration (0.2 m) and supplementing, the medium was stored at 4 C. A sterile test was performed for 48 h at 37 C. and the medium was used no longer than 4 weeks after production. The commercial available HyQ SFM4CHO-Utility medium (Hyclone) was used as outgrowth medium after nucleofection.
(35) Monod Kinetic
(36) Following are the formulas for calculating the specific rates. Since for this type of cultivation strategy there is no flow in or out from the bioreactor the volume is considered constant (Equation 10.2). The cell concentration (X) of a growing culture is changing with time (t) according to Equation 10.2, which after integration and taking the logarithm originates the equation for calculating the specific growth rate (). The medium culture substrates are consumed as result from cell growth. They are used by cells for the maintenance of metabolic processes and for product formation. The specific substrate consumption (qS) and product formation rates (qP) are calculated by Equations 10.4 and 10.5, respectively, with the mean cell concentration (Xm) calculated according to Equation 10.6.
(37)
Establishing of Working Cell Bank (WCB)
(38) A working cell bank (WCB) for the original cell line (Control) was setup to ensure sufficient cell resources for all experiments. Therefore, cell density and viability were measured for an exponential growing culture. Afterwards, cells were harvested and cell pellet was resuspended in a defined volume of chilled pre-culture medium with 5% DMSO (dimethyl sulfoxide) in such a way, that the final cell concentration was 110.sup.7 cells/ml. Four milliliters of this cell suspension were aliquoted in cold 4.5 ml nominal volume cryovials (Nunc) and cell suspension was frozen with the IceCube 1800 (SY-LAB GmbH) according to manufacturer's instructions (Instructions Manual for Ice Cube 1800, V4.01 from Aug. 1, 2001, SY-LAB). The cryovials were transferred to the gas phase of the liquid nitrogen for long time preservation.
(39) The WCB of the hCAII-clones or control cell line in HyQ medium, were done either with HyQ freezing medium or with pre-culture freezing medium, both containing 5% DMSO. Therefore, 110.sup.7 cells/vial were frozen overnight at 80 C. in the 5100 Cryo 1_C Freezing Container (Nalgene) which induces a cooling rate of 1 C./min. Afterwards, the cryovials were transferred to the gas phase of the liquid nitrogen.
(40) Cultivation
(41) Back-up or inoculum cultures and parallel test batches were carried out in disposable cultivation systems, such as bioreactor tubes and shaking flasks. 50 ml conical polypropylene bioreactor tubes (TPP) and different nominal volume (125 ml, 250 ml and 500 ml) polycarbonate Erlenmeyer flasks (Corning) were used. Both were equipped with polyethylene plug seal caps with integrated 0.22 m hydrophobic membrane to maintain sterility and facilitate gas exchange. For bioreactor tubes the working volume ranged between 10 ml and 20 ml and for shaking flasks between 40% and 60% of the nominal volume. The cultivations were performed in an incubator (Mytron) at 37 C., 5% CO.sub.2 and 80% humidity. Agitation was achieved by orbital shaking at 125 rpm (Innova 2300, New Brunswick Scientific) or 185 rpm (ES-X, Kuhner), and 0 inclination angle for bioreactor tubes.
(42) Back-Up Cultures
(43) One WCB cryovial of the control cell line was quickly thaw in a 37 C. water bath and the cell suspension was mixed with 10 ml pre-culture medium (RT). After centrifugation (200g, 10 min) to remove the DMSO, the pellet was resuspended in 10 ml pre-culture medium at room temperature. After cell density and viability determination, a 125 ml shaking flask was inoculated at 510.sup.5 cells/ml.
(44) Clones or control cell line in HyQ medium thawing procedure was similar to the one described for the control cell line, except that after pellet resuspension in 15 ml fresh pre-culture medium, cells were cultured in 50 ml bioreactor tubes at 185 rpm (ES-X, Kuhner), and 0 inclination angle. After 2 days, cells were transferred to a 125 ml shaking flask.
(45) Sub-culturing was performed every 3 days from an initial cell density of 410.sup.5 cells/ml for control cell line or 610.sup.5 cells/ml for the hCAII over-expressing clones and control cell line in HyQ medium. Back-up cultures were run for 1 month at most.
(46) Parallel Batches
(47) Cells were seeded at 610.sup.5 cells/ml and cultivated in pre-culture medium in 250 ml shaking flasks with 90 ml working volume at 185 rpm. After a 2 day adaptation phase, the main culture was inoculated in production medium. Samples of 2 ml were taken daily for cell density analysis, 1 ml was centrifuged (200g) for 10 min. at RT. The ammonium concentration in the cell free-sample was measured and the remaining supernatant was aliquoted and stored at 20 C. for glucose, lactate, and product analysis. The cultivations were aborted when viability dropped below 40%. The cells were harvested and 40 ml of the cell-free supernatant were stored at 20 C.
(48) Clone Screening
(49) For the generation of clonal cell lines, the clone pool was diluted in such a way that single cells were obtained by cultivation in 96-well plates under selective cultivation conditions (selective pressure). Forty eight hours after nucleofection, cell density and viability were checked. The clone pool was spun down and the pellet resuspended to a concentration of 210.sup.3 viable cells/ml in selective medium (HyQ medium with 5% FBS and 400 g/ml G418). Further dilutions were performed in order to inoculate 96-well plates (flat-bottom, Nunclon, Nunc) with 100, 20, 10 and 5 viable cells in each well with 150 l selective medium. The plates were incubated at 37 C. and 5% CO.sub.2 for formation of colonies. After 7 days, 50 l of selective medium was added to the wells. Between 8 and 12 days and selection conditions plates were checked regularly and wells containing single colonies were marked. Seventeen days after the selection procedure had started, single colonies were trypsinized by first aspiring medium and after a washing step with PBS, the cells were incubated for 5 min at 37 C. with 50 l 1 trypsin (Invitrogen). Afterwards, trypsinized cells were transferred to 24-well plates for further cultivation without selective pressure. When the colony size permitted it, the clones were further cultivated in 35 mm dishes. Once 90% confluency was reached, part of the cells were harvested and prepared for hCAII-expression analysis, the other part was further expanded in t-25 flasks, t-75 flasks, bioreactor tubes and, finally in 125 ml Erlenmeyer flasks. In the middle of the exponential growth phase cells were split, half of which were cryopreserved in HyQ medium with 5% DMSO. The other half was centrifuged down, resuspended in pre-culture medium and further cultivated until middle exponential phase. Cryopreservations were performed in pre-culture medium with 5% DMSO. The control cell line was cultivated throughout the screening process in HyQ medium and cryopreserved accordingly.
(50) Bioreactor Cultivations
(51) Batch cultivations were performed in the multi-bioreactor system Biostat B-DCU (Sartorius AG) with 1.5 l working volume. The on-line monitoring of the process parameters was performed with in-place sensors, such as: pH electrode, pO.sub.2 electrode, pCO.sub.2 electrode and temperature electrode. The process parameters were controlled through the DCU local controller (Sartorius AG). The pH value was automatically adjusted to 7.200.01 by addition of 1 M NaOH or 1 M HCl. Bioreactor gassing was performed with a sterile gas mix (0.2, inlet sterile filter) by a ring sparger, immersed in the culture liquid under the impeller. Exhaust gas was cooled down by an exhaust gas cooler and left the bioreactor through an outlet sterile filter. The bioreactor was equipped with two 4-bladed Rushton type impellers. For pO.sub.2 controlling, a cascade with gas flow rate (GAFR) and agitation (STIR) was used in the ratio mode with total flow rate of 60 ml. A mixed gas containing air and nitrogen was used to maintain the dissolved oxygen concentration at 30.00.1% air saturation. When the air flow rate reached the maximum value, the agitation (second cascade parameter), was controlled according to cells oxygen demands. The initial agitation value was 80 rpm. An additional mix of CO.sub.2 and N.sub.2 was used to control the pCO.sub.2 at the desired concentrations (constant 5% CO.sub.2 or continuous CO.sub.2 profile from 5% to 25% CO.sub.2). The bioreactor temperature was maintained at 37 C. and controlled through the jacket water temperature. To exclude osmolality differences between the CO.sub.2-controlled cultivation modus, this parameter was manually compensated with addition of 1 M NaCl (equivalent to 1843 mOsmol/kg) through a calibrated peristaltic pump. To avoid formation of foam, 1% anti-foam solution was added when necessary. The reactors with the probes in place and filled with 1.5 l PBS was submitted to a pressure test. Afterwards, steam-sterilized at 121 C. for 50 min.
(52) The inoculum for the main-culture was prepared in the bioreactor at 5% CO.sub.2 and in production medium until it reached the middle exponential growth phase. The main cultures were inoculated at 610.sup.5 cells/ml. For sampling, the sterile coupling system with Luer-Lock (DASGIP GmbH) was used. Samples were taken every 24 h for cell growth, productivity, cellular metabolism, cell physiology etc. For sampling, syringes with the Luer-Lock system were used together with the Luer-Lock system built up in the bioreactor. To take a representative sample of the culture, a pre-flow sample (about 5 ml sample) was taken, after which, enough volume of cell suspension was removed and directly measured in the blood gas analyzer (ca. 100 l) for off-line analytic (pH, pCO.sub.2) and for cell density determination. Part of the remaining cell suspension was used for generation of samples for cell cycle analysis (210.sup.6 cells) and hCAII expression level (110.sup.6 cells) during the cultivation, the other part was centrifuged at 200g for 10 min. at RT. The ammonium concentration in the cell free-sample was measured and the remaining volume was aliquoted and stored at 20 C. for glucose, lactate and product analysis. For pHi measurement, about 2.5 ml cell suspension was taken. Finally, the sampling system was sterilized with 70% ethanol.
(53) The cultivations were performed until viability decreased below 40%. At this time, the cells were sterilely harvested from the bioreactor and 40 ml supernatant were frozen for glycan analysis. The pCO.sub.2, pO.sub.2 and pH probes were removed and the bioreactor was filled with 0.2 M NaOH. Inactivation was done overnight (45 C., 100 rpm). Finally the reactor was cleaned with MilliQ-H.sub.2O.
(54) Determination of Viable Cell Density and Viability
(55) Cell densities and viability of the cultures were determined with the automated cell counting system Cedex (Cell Density Examination System, Roche Innovatis GmbH). The measurement is based on the well-established Trypan Blue dye exclusion method for determination of living and dead cells. Sample handling, staining, cell counting, image acquisition and analysis were performed automatically by the Cedex. For better accuracy, two measurements each of 1 ml were performed for each sample (30 images). The samples from disposable bioreactors experiments were diluted 1:2 with PBS before measurement.
(56) Determination of Metabolites Glucose and Lactate
(57) The automatic Glucose-Lactate Analyzer YSI 2700D Select was used for the measurement of these parameters in supernatant. The instrument calibrates automatically with glucose and lactate solutions of defined concentrations. A repeat determination was performed, for each of which 150 l sample was necessary. All samples were diluted in PBS buffer in such a way that measured concentrations were below the concentrations of the standard solutions.
(58) Determination of Ammonium
(59) A specific and sensitive determination of ammonium is achieved by its derivatisation in the alkaline environment to fluorescent derivatives. For the measurement, 1.3 ml of RT reagent (25 mg OPA, 25 mg thioglycolate in 1 ml methanol, pH to 10.4 with 10 ml 0.4 M sodium borate buffer) were pipetted into the 1.5 ml fluorescence cuvette (Plastibrand, Brand) the base line/value was adjusted to zero. Subsequently, 20 l of cell-free sample were mixed with the reagent and the reaction process was followed. The maximum emission intensity valued was noted. In order to determine ammonium concentration in the sample, a reference value (standard solution 5.56 mM ammonium) was measured, accordingly. The concentration of the ammonium in the sample was determined with the following relation:
(60)
Determination of Osmolality
(61) The osmolality of supernatants were measured using the freezing point depression osmometer (Osmomat Auto, Gonotech GmbH). The samples measurement was performed with 150 l cell-free supernatant. Osmolality values were expressed in mOsmol Kg. A two point calibration was done with MilliQ-H.sub.2O (0 mOsmol/kg) and a standard solution with predefined osmolality (280 mOsmol/kg or 320 mOsmol/kg; Gonotech GmbH).
(62) Determination of Product Concentration
(63) The concentration of the recombinant protein was carried out by size-exclusion-high performance-liquid-chromatography (SEC-HPLC) by the technical personal from AG Cell Culture Technology.
(64) Dissolved Gas Analysis
(65) The quantitative measurement of pH value and CO.sub.2 concentrations was performed with the automatic blood gas analyzer AVL COMPACT 3 (Roche Diagnostics GmbH, Mannheim, Germany). A volume of 100 l sample is necessary for the measurement. The CO.sub.2 (%) was calculated by the Equation 10.10.
(66)
Flow Cytometry
(67) The flow cytometric analyses was carried out with a FACSCALIBUR flow cytometer (Becton Dickinson) using an argon laser with an excitation wavelength of 488 nm. Data acquisition and analysis was carried out using a G4 Apple Macintosh computer with the CELLQUEST Pro software. Forward light scatter (FCS) and sideward scatter (SSC) were used to examine the size and granularity of the cells.
(68) Intracellular pH Measurement
(69) pHi measurements were carried out by flow cytometry with the available pHi fluorescent indicator, Carboxy SNARF-1 AM (Molecular Probes Inc.). This dye is an acetoxymethyl (AM) ester that enter the cells readily and is hydrolyzed by non-specific esterases to yield the free fluorescent dye. SNARF-1 AM is very sensitive to pHi changes within the physiological range. It is excited between 488 nm and 530 nm and the fluorescence emission is monitored at two wavelengths, typically about 580 nm (FL2-H) and 640 nm (FL3-H). This is particularly interesting as the fluorescence emission wavelength ratio can be calculated foe a more accurate determination of the pHi. With the use of this ratiometric technique, a number of fluorescence measurement artifacts are eliminated, such as photobleaching, cell thickness and leakage and non-uniform loading of the indicator (SNARF pH indicators, Product information, 2003, Molecular Probes Inc.). Herein the Pseudo-Null calibration method was used. The method is based on the assumption that (i) only the non-ionized forms of the weak acid or base can cross the cell membrane, (ii) the dissociation constants, pKa and pKb, are the same inside and outside of the cell, and (iii) mechanisms that regulate pHi do not influence the critical changes in pHi (or fluorescence) observed. A simplification can be considered if the calibration solutions are prepared in such a way that a concentration of weak base and a concentration of weak acid produce an equal but opposite change in pHi (i.e., pHa=pHb). The derived relationship for pHi determination is presented in Equation 10.11.
(70)
(71) Where the pHi is dependent on the extracellular pH value (pHe) and on the ratio of concentration of weak base (B) and weak acid (A) present in the solution. The ratio of weak acid and base that gives no change in pHi could be extrapolated between those that lead to the smallest increase in pHi (Null Point). If the molar concentration of the acid-base ratio is sufficient, then no further addition of acid to base in the same ratio causes a change in the pHi, so that value reflected a new null value (designated Pseudo-Null) that satisfies Equation 10.11. Therefore, a calibration curve can be obtained from the plot of pseudo-null pH value vs. fluorescence ratio by exposing cells to a series of acid-to-base mixtures at sufficient molar concentration. Those mixtures were done with butyric acid (BA) and trimethylamine (TMA) (Table 3). The preparation of calibration solutions was done in HEPES buffer containing FBS (named HDFBS buffer; following Table). The addition of FBS aids maintenance of the cells physiological conditions.
(72) TABLE-US-00003 TABLE Buffer/Solution Composition Carboxy SNARF-1 AM dissolve in DMSO at 2 M store at 4 C. HEPES buffer 10 mM HEPES 133.5 mM NaCl 4 mM KCl 1.2 mM NaH.sub.2PO.sub.4H.sub.2O 1.2 mM MgSO.sub.4 11 mM -D-glucose 2 mM CaCl.sub.22H.sub.2O adjust pH to 7.4 HDFBS buffer 90% (v/v) HEPES buffer 10% (v/v) FBS Butyric acid (BA) 1M n-butyric acid (pKa 4.82) adjust pH to 7.4 Trimethylamine (TMA) 1M trimethylamine (pkb 9.8) adjust pH to 7.4
(73) A 5 ml disposable syringe was pre-loaded with 22 l of SNARF-1 AM (2 mM in DMSO). Subsequently, 2.5 ml samples were taken from a bioreactor, the syringe was closed with a Luer-stopper (Rotilabo) and cells were stained for 25 min. at 37 C. Afterwards, 200 l of stained cells were mixed with 200 l of 37 C. HDFBS buffer and measured with the FACS. Samples were analyzed in replicates. Emission fluorescence was measured at 580 nm (FL2-H) and 640 nm (FL3-H).
(74) Calibration curves were established with the same sampled stained cells. Hence, six times concentrated standard solutions were prepared by adding different amounts of butyric acid (BA) and trimethylamine (TMA) to the HBFBS buffer, as shown in the following Table.
(75) TABLE-US-00004 TABLE 6x concentration Buffer BA/TMA (mM) in HDFBS Buffer, pH 7.4 Pseudo Null pH S1 6/96 8.0 S2 6/24 7.7 S3 6/6 7.4 S4 24/6 7.1 S5 96/6 6.8
(76) A volume of 200 l of each solution was pipetted into the polypropylene tubes, closed with a cap to avoid evaporation and incubated at 37 C. Calibration was achieved by mixing 200 l of dye-loaded cells and 200 l of aliquoted and pre-warmed 6 calibration solution. Flow cytometry acquisition began after 20 sec. in HIGH RUN modus and 10,000 total events were analyzed. Prior to flow cytometric analysis, two calibration mixtures with cells were measured with the blood gas analyzer to obtain the exact external pH value. The emission fluorescence ratios, 640 nm/580 nm, were calculated with the program FCSassist 1.0. Further data analysis was executed with the CellQuest Pro software. Cells that failed to retain SNARF-1 fluorescence were gated out on the fluorescence histograms. From the histogram FL3-H/FL2-H vs. counts analysis a histogram statistic was made and the mean fluorescence value was noted. With the information of the true external pH of the calibration samples, the induced pHi was calculated using the Equation 10.11. The mean fluorescence ratio of each standard was plotted against calculated induced pHi. The samples pHi was derived from the curve.
(77) Re-Alkalinization Experiment
(78) The regulation of the pHi was studied by flow cytometric analysis during intracellular acidification with bicarbonate. The kinetic of the transporters were examined. This test was made at physiological conditions. Therefore medium was used instead of buffer to account for influences of other medium components. To eliminate the activity of other cellular pHi-regulation systems, cells were pre-incubated in bicarbonate-free medium buffered with HEPES. A closed system was built to avoid CO.sub.2 degassing that could cause pHe changes and, hence ensuing pHi alterations. This system consisting of two disposable 5 ml Luer-Lock syringes (B. Braun AG, Melsungen, Germany) connected by a short tubing and two Luer tubing connectors (Rotilabo). These Luer connectors permitted the rapid and easy connection/disconnection of the 2 syringes.
(79) Syringe A contained stained cells in bicarbonate-free production medium and syringe B production medium with 4.2 g/l NaHCO.sub.3 (corresponding to 25% CO.sub.2 at pH 7.2). Both media contained 20 mM HEPES and were adjusted to pH 7.2 at 37 C. Acid-load was achieved by pressing bicarbonate-containing medium from syringe B into syringe A. A 5 ml syringe was pre-loaded with 22 l of SNARF-1 AM (2 mM stock solution; Table 3). 110.sup.6 cells, from the exponential phase, were harvested and washed once with 4 ml medium without bicarbonate. After which, the cell suspension was sucked (without air bubbles) into the pre-loaded fluorescence dye syringe, which was them closed with the Luer-stopper and gently mixed. After a 25 min. period of incubation at 37 C. in the dark, with regularly mixing to avoid cell settling, followed dissolved gas and flow cytometric analysis. Three measurements of loaded cells in bicarbonate-free medium were made before acidification of cells cytoplasm. Afterwards, the syringe B was connected to syringe A and the double volume of NaHCO.sub.3-containing medium was added. The syringe B was discarded, syringe A was closed and after short mixing, the acid-loaded cells were analyzed by flow cytometry. Additionally, some samples were measured with the blood gas analyzer to determine the content of CO.sub.2 in medium during the experiment.
(80) To test if the re-alkalinization effect was due to the hCAII-overexpression, the hCAII inhibitor ethoxyzolamide (ACTZ) was used. For the hCAII inhibited experiments, media with 100 M ethoxyzolamide (stock solution: 100 mM ACTZ in DMSO stored at 4 C.) was used. The experiment procedure was the same as described above.
(81) Cell Cycle
(82) Herein the deoxyribonucleic acid (DNA) content has been determined for cell cycle analysis. Samples were taken every 24 h until viability decreased below 60%. Approximately 110.sup.6 cells were harvested and two times washed with cold-PBS by centrifugation (200g, 10 min., RT). Cells were then fixed and permeabilized with 1 ml ice-cold 70% ethanol and kept at 20 C. until staining Before staining, cells were spun down followed by washing with PBS/0.1% Saponin. Cells were then stained with 1 ml staining solution (PBS/0.1% Saponin, 40 g/ml RNAse S, 20 g/ml PI) by incubation in the dark for 45 min. at room temperature. The RNA degradation reaction was stopped by incubating the stained cells on ice until flow cytometric analysis. Data was acquired with LOW RUN modus at a flow rate <200 cells/sec. The G0G1 cell fraction was acquired on channel 200 of FL3-H (640 nm) histogram. The integral fluorescence of the cells was analyzed by the computer software ModFit LT (Becton Dickinson) to obtain the percentages of cells in the G0G1-, S-, and G2M-phase.
(83) Protein Extraction
(84) For Western Blot
(85) About 110.sup.7 cells were harvested and washed two times with cold PBS. The cell pellet was resuspended in 600 l lysis buffer (RIPA buffer, see following Table) and incubated for 5 min. on ice. The lysis proceeds with a 5 min. sonication step followed by a 30 min. incubation step on ice. The lysate was subsequently centrifuged for 30 min. at 16,200g and 4 C. to remove cell debris. The protein solution was stored at 20 C.
(86) TABLE-US-00005 TABLE Buffer/Solution Composition Lyse buffer 50 mM Tris-HCl (pH 7.2) 2 mM EDTA 150 mM NaCl 1% (v/v) NP-40 1 mM PMSF (add freshly from stock solution) 0.1% (w/v) SDS RIPA buffer 50 mM Tris-HCl (pH 8.0) 150 mM NaCl 5 mM EDTA 1 mM PMSF (add freshly from stock solution) TE buffer 10 mM Tris-HCl (pH 8.8) 1 mM EDTA 2 mM PMSF (add freshly) PMSF stock solution 100 mM phenylmethylsulphonyl fluoride in isopropanol DNase/RNase-mix stock 1 mg/mL DNase solution 0.25 mg/mL RNase 50 mM MgCl.sub.2
For hCAII Activity
(87) Protein extraction was performed with RIPA Buffer (see previous Table). About 110.sup.7 cells were harvested and two times washed with cold PBS. The resulting pellet was resuspended in 2 ml RIPA buffer and solution was frozen at 80 C. for 2 h. After thawing on ice, cell suspension was treated for 15 sec. with an Ultrasonic finger (Sonifier 250, Branson). Cell debris was spun down (17,000g, 1 h, 4 C.) and cytosolic proteins were stored at 20 C. until carbonic anhydrase activity measurements.
(88) For Proteomic Analysis
(89) 110.sup.8 cells were harvested from the bioreactor at cultivation day 2 (before CO.sub.2 profile) and 4 (two days after CO.sub.2 profile had started) for both cell lines (clone E11 and control cell line in HyQ medium). Cells were washed with cold PBS (200g, 10 min.) and pellet was stored at 80 C. until cell lysis. The frozen cell pellet was resuspended in 1 ml TE-buffer (see Table above). Subsequently, 20 l of a serine protease inhibitor stock solution, phenyl methylsulphonyl fluoride (PMSF), and 100 l of a DNAse/RNAse-mix stock solution was added (see Table above). After transferring the cells in solution to a 2 ml vessels containing 1 g glass beads (about 0.15 mm; BioSpec Products Inc.), the mechanical cell disruption was carried out with four homogenization cycles performed in a vortex, from 30 sec. each. Between each cycle, the cells were stored on ice. Afterwards, proteins in solution were separated from the cells debris and glass beads by a centrifugation step (16,200g, 20 min., 4 C.). For the separation of the proteins in solution and cells compartments, an ultracentrifugation at 106,000g for 1 h at 4 C. (Optima L-90K, Beckman Coulter Inc., USA) was performed. To determine the protein content of the supernatant part of the protein extract was removed to perform a BCA assay. The rest of the protein solution was stored at 20 C.
(90) Determination of Protein Concentration
(91) The determination of protein concentration was performed by the bicinchoninic acid (BCA) method using the protein quantification kit (Uptima/Interchim). It involves the reduction of Cu(II) to Cu(I) by peptidic bounds of proteins. The bicinchoninic acid chelates Cu(I) ions with very high specificity to form a water soluble purple colored complex. The reaction is measured at 562 nm, corresponding to the high optical absorbance of the final Cu(I) complex. The protein concentration is proportional to the absorbance. It was followed the protocol described by the manufacturer with a standard curve between 20 and 2,000 g/ml of Bovine Serum Albumin (BSA). Samples and standard were diluted in the corresponding lysis buffer. The absorption was measured with the Photospectrometer PowerWave HT (BioTek Instruments). The quantification was performed with the Software KC4 (BioTek Instruments).
(92) Acetone Precipitation
(93) Aliquots of 10 g or 40 g and 150 g or 450 g were prepared for western blotting. Therefore, one volume of sample was mixed with 9 volumes of ice cold acetone. Subsequently, the sample was incubated overnight at 20 C. After centrifugation (16,200g, 30 min., 4 C.) to pellet the precipitated protein, the supernatant was removed and the undesired acetone was allowed to evaporate at RT. The dried protein pellet was stored at 20 C.
(94) SDS-PAGE
(95) Preparation of gel electrophoresis module and gel cassette was performed according to manufacturers' instructions (Invitrogen). The protein sample pellets to be analyzed and 20 g the positive control (carbonic anhydrase isozyme II from human erythrocytes, 1 mg/ml, Sigma Aldrich) were mixed with sample buffer (4, NuPAGE), reducing agent (10, Invitrogen) and MilliQ-H.sub.2O to a final volume of 20 l. The denaturation of the secondary and tertiary structures and the reduction (cleaving of disulphide bonds between cysteine residues) of proteins was achieved by incubating samples at 70 C. for 10 min. in a thermoblock. Finally, the samples and 5 l of the molecular weight marker (SeeBlue Plus2 Pre-stained standard, 4 kDa to 250 kDa; Invitrogen) were loaded into the 10% NuPAGE Novex Bis-Tris Gel (Invitrogen) slots. The gel was run with NuPAGE MOPS SDS running buffer, furthermore, reducing condition were achieved with 0.25% (v/v) antioxidant reagent in running buffer in the middle of the electrophoresis camera. The gel run in the XCell Sure Lock system (Invitrogen) at 200 V until bromophenol reached the end of the gel.
(96) Western Blot
(97) The solutions necessary for this experiment are described in the following Table.
(98) TABLE-US-00006 TABLE Buffer/Solution Composition Transfer buffer 1x NuPAGE Transfer buffer (20x) 0.001% (v/v) NuPAGE Reducing agent 10% (v/v) Methanol Washing solution 0.3% (w/v) Milk pulver 0.3% (v/v) Tween 20 in PBS Blocking solution 3% (w/v) Milk pulver in washing solution Antibody solution 1% (w/v) Milk pulver in washing solution
(99) Following SDS-PAGE, the separated proteins were transferred from the gel to a thin HybondP PVDF-membrane. Prior to this, the membrane was previously in methanol wetted (30 sec.) and equilibrated in transfer buffer. The XCell II Blot Module was set up according to the manufacturers instructions. Transfer buffer was added to the inside of the Blotting Module and MilliQ-H.sub.2O to the outer part. The blotting was carried out at a constant voltage of 35 V for 1 h. Afterwards, the membrane was blocked in 20 ml blocking solution (1 h, shaking, RT), in order to prevent unspecific antibody binding in the following steps. After washing the membrane twice, the carbonic anhydrase II was detected in a three-step procedure. In the first step, the membrane was incubated (4 C.) with a 1:50,000 or 1:20,000 specific primary antibody diluted solution (Rabbit polyclonal IgG to CAII, 10 mg/ml, Abcam) overnight. In a second incubation step (1 h, RT), 1:4,000 peroxidase-conjugated secondary antibody diluted solution (ECL Donkey anti-rabbit IgG, HRP-Linked, 0.20 mg/ml, GE Healthcare) was applied. In a final step, the membrane was exposed to the ECL Plus Western Blotting Reagent (Amersham), and the qualitative analysis was done by means of enhanced chemoluminescence (ECL) and autoradiography ECL-films (Hyperfilm ECL film, Amersham), according to manufacturer's instructions. Between the incubations with the different antibodies and before detection, the membrane was washed shortly with washing solution, followed by two 15 min washing steps. All washing steps were performed at RT while shaking. Film exposure times ranged from 30 sec to 5 min. Afterwards, films were developed until protein band had a good resolution, followed by a short washing step in MilliQ-H.sub.2O and fixation for about 10 min. Later, the films were watered for about 30 min. and finally dried.
(100) Carbonic Anhydrase Activity
(101) The activity of carbonic anhydrase in lysates was determined using the .sup.18O exchange method developed by SILVERMAN (SILVERMAN, D. N., Methods Enzymol. 87 (1982) 732-752). The .sup.18O exchange method is based on the assessment by membrane-inlet mass spectrometry of the exchange of .sup.18O between CO.sub.2 and water at chemical equilibrium (Equations 10.12 and 10.13).
(102) ##STR00001##
(103) Lysates from control cell lines and from clones G9 and E11 were prepared by two different approaches. One of them focused on the cytoplasm protein extraction in RIPA buffer and the other on the protein extraction by mechanical disruption with glass beads in TE buffer. As positive control, the commercial available carbonic anhydrase II (carbonic anhydrase isozyme II from human erythrocytes; Sigma Aldrich) was used. The lysates were divided into two aliquots and the positive control was added to one of the samples in order to exclude influence of buffer composition and other proteins in the determination of CAII activity. The total enzyme concentration of a solution containing the positive control was computed using a linear regression fitting to the inhibition data for the titration curve with highly CAII bound inhibitor ethoxyzolamide (EZA). This value was used as standard for the calculation of the CAII concentration in the samples using Equation 10.14.
(104)