FLUORESCENT CYTOSINE ANALOGUES AND THEIR APPLICATION IN TRANSCRIPTION AND TRANSLATION
20230219995 · 2023-07-13
Inventors
Cpc classification
C12Q2525/101
CHEMISTRY; METALLURGY
C07H1/00
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q2525/101
CHEMISTRY; METALLURGY
C07H19/24
CHEMISTRY; METALLURGY
International classification
C07H19/24
CHEMISTRY; METALLURGY
C07H1/00
CHEMISTRY; METALLURGY
Abstract
This specification discloses a novel methodology for labelling RNA via enzymatic incorporation of a minimally perturbing fluorescent tricyclic cytosine analogue. This analogue is shown to be 100% incorporated in example transcripts and is fully compatible with both in vitro and in cell transcription. Spectroscopic characterization shows that the incorporation rate of the cytosine analogue is on par with its natural counterpart. Using live cell imaging and flow cytometry, labelled mRNAs are efficiently and correctly translated upon transfection into living cells and cell-free systems. The spectral properties of the modified transcripts and their correct translation product allow for their straightforward and simultaneous visualization. This technology therefore offers a general route to understanding the biological behaviour of RNA of interest, including RNA based drugs. The fluorescent tricyclic cytosine analogue has formula (I):
##STR00001##
Claims
1. A compound of formula (I) or a salt thereof: ##STR00011##
2. A compound of formula (I) as claimed in claim 1.
3. The compound of formula (I) as claimed in claim 1 which is a sodium, potassium, or ammonium salt.
4. The compound of formula (I) as claimed in claim 3 which is a monosodium, disodium, trisodium, monoammonium, diammonium or triammonium salt.
5. A process for preparing a compound of formula (I) or a salt thereof as claimed in claim 1 comprising: i. providing a compound of formula (II) or a salt thereof: ##STR00012## where PG.sup.1 is a suitable protecting group; ii. immobilising the compound of formula (II) or a salt thereof by linking one of its secondary alcohol groups to a suitable support; iii. capping any free secondary alcohol groups with a suitable protecting group PG.sup.2; iv. removing the protecting group PG.sup.1; v. reacting the exposed primary alcohol group with a compound of formula (III): ##STR00013## where R.sup.1 is selected from a hydro group and a C.sub.1-3alkyl group; vi. oxidising the resultant phosphorus (III) compound to a phosphorus (V) compound; vii. reacting the phosphorus (V) compound with a tetraalkylammonium pyrophosphate to generate a triphosphate; viii. removing the protecting group PG.sup.2; and ix. cleaving the resultant triphosphate from the support to generate a compound of formula (I) or salt thereof.
6. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where R.sup.1 is a methyl group.
7. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where the support is a solid polymer.
8. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 7, where the support is selected from controlled-porosity glass and polystyrene.
9. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 8, where the support is controlled-porosity glass.
10. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where PG.sup.1 is selected from trityl, dimethoxytrityl and trimethoxytrityl.
11. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where PG.sup.2 is selected from acetyl, benzoyl, 2,2,2-trichloroethylcarbonyl, paramethoxybenzyl, methyl, tetrahydropyranyl, triethylsilyl, triisopropylsilyl, trimethylsilyl, tert-butyldimethylsilyl and methoxyethyl.
12. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where PG.sup.1 is dimethoxytrityl and PG.sup.2 is acetyl.
13. (canceled)
14. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where the tetraalkylammonium pyrophosphate is tetrabutylammonium pyrophosphate.
15. The process for preparing a compound of formula (I) or a salt thereof as claimed in claim 5, where the phosphorus (III) compound in step vi) is oxidised to a phosphorus (V) compound using aqueous pyridine and iodine.
16. A composition for preparing a tC.sup.O labelled RNA molecule comprising a compound of formula (I) as claimed in claim 1 and a natural ribonucleotide triphosphate.
17. The use of a compound of formula (I) or a salt thereof as claimed in claim 1 to enzymatically prepare a tC.sup.O labelled RNA molecule.
18. The use of a compound of formula (I) or a salt thereof as claimed in claim 17 where the RNA molecule is mRNA.
19. A process for preparing a tC.sup.O labelled RNA molecule comprising providing a DNA template to composition comprising a compound of formula (I) and a natural ribonucleotide triphosphate, then treating the resultant mixture with an RNA polymerase.
20. The use of a tC.sup.O labelled mRNA molecule to prepare a protein encoded by the mRNA by translation.
21. The use of a tC.sup.O labelled mRNA molecule as claimed in claim 20, where the encoded protein is fused to a fluorescent protein.
22. The use of a tC.sup.O labelled mRNA molecule as claimed in claim 21, where the tC.sup.O labelled mRNA and the encoded protein are simultaneously analysed spatiotemporally using confocal microscopy.
Description
FIGURES
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
DETAILED DESCRIPTION
Example 1: Synthesis of Modified Nucleobase Triphosphates
[0161] Compound (I) may be prepared according to the scheme shown in
3-((2R,3R,4S,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-3,4-dihydroxytetrahydrofuran-2-yl)-3H-benzo[b]pyrimido[4,5-e][1,4]oxazin-2(10H)-one 1
[0162] Compound 1 was prepared according to the literature (Füchtbauer, A. F. et al., Sci. Rep. 7, 2393 [2017])
[0163] MS (ESI−) [M−H]−=634.5. .sup.1H NMR (500 MHz, DMSO-d6) δ 10.61 (bs, 1H), 7.42 (d, J=7.7 Hz, 2H), 7.27-7.35 (m, 7H), 7.22 (t, J=7.1 Hz, 1H), 6.90 (dd, J=8.6, 4.2 Hz, 4H), 6.75-6.87 (m, 3H), 6.46 (d, J=7.8 Hz, 1H), 5.71 (d, J=3.6 Hz, 1H), 5.49 (bs, 1H), 5.18 (bs, 1H), 4.08 (d, J=5.3 Hz, 1H), 4.04 (s, 1H), 3.94 (s, 1H), 3.71 (s, 3H), 3.70 (s, 3H), 3.29 (d, J=4.8 Hz, 1H), 3.16 (d, J=9.1 Hz, 1H).
CPG Solid Support 3
[0164] Amino-SynBase™ CPG 500/110 (LCAA) from LinkTech (Nu. 1397-C025, 1 g, 0.08 mmol) was activated by shaking in trichloroacetic acid 3% in DCE (8 mL, 0.08 mmol) for 18 h. The activated support was then filtered off and washed with 9:1 triethylamine:diisopropylethylamine (20 mL), dichloromethane (20 mL) and diethyl ether (20 mL). The activated support was dried under vacuum for 2 days before use. Subsequently, the support (1 g, 0.08 mmol), succinic anhydride (0.345 g, 3.44 mmol) and N,N-dimethylpyridin-4-amine (0.070 g, 0.57 mmol) were suspended in dry Pyridine (3 mL) under N.sup.2. The reaction mixture was then gently shaken at RT for 4 h. After 4 h, solvent was filtered off and the support washed successively with pyridine (20 mL), dichloromethane (20 mL), diethyl ether (20 mL) and air-dried. Negative ninhydrin test on a small portion of support proved full succinylation. Succinylated CPG could thereafter be kept at room temperature for several months.
CPG-supported (2R,3R,4R,5R)-5-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)-4-hydroxy-2-(2-oxo-2,10-dihydro-3H-benzo[b]pyrimido[4,5-e][1,4]oxazin-3-yl)tetrahydrofuran-3-yl acetate 4
[0165] In a 10 mL syringe with PTFE filter, succinylated support 3 (1.420 g, 82 μmol/g, 0.12 mmol), DMAP (0.028 g, 0.23 mmol), DIC (719 μl, 4.64 mmol), 1 (0.076 g, 0.12 mmol) and triethylamine (49 μl, 0.35 mmol) were suspended pyridine (5 mL). The mixture was gently shaken for 18 h at RT. After 18 h, the syringe was purged and the support washed with pyridine (5 mL), dichloromethane (5 mL) and diethyl ether. Subsequently, in the same syringe, DMAP (0.028 g, 0.23 mmol), diisopopylcarbodiimide (719 μl, 4.64 mmol), triethylamine (49 μl, 0.35 mmol) and 2,3,4,5,6-pentachlorophenol (0.309 g, 1.16 mmol) were added to the support and suspended in pyridine (4 mL). The mixture was gently shaken for 4 h at RT before a solution of piperidine (2 mL, 20% in DMF—for capping of the unreacted carboxylic acids on the support) was added for 1 min (longer exposure time will reduce loading as piperidine cleaves the ester bonds with the nucleoside), then quickly washed away with DMF (3×5 mL), dichloromethane (5 mL) and diethyl ether (5 mL). Finally, the resin was shaken in a CAP A+CAP B mix (50/50 v/v) for 2 hours under argon atmosphere, then washed with DMF (5 mL), dichloromethane (5 mL), diethyl ether (5 mL) and argon-dried (final loading: 13 μmol/g—determined by reading optical density of a DMT solution cleaved from a weighed amount of support—ε=70000 M-1.Math.cm-1 at 498 nm). Final loading can be increased by performing a second coupling with 1 in the same conditions before capping (typical loading after second coupling 20-25 μmol/g). Concentrating the reaction mixture and washing the residue multiple times with water and diethyl ether allows recovery of nearly 85% of unreacted nucleoside 1.
6-chloro-N,N-diisopropyl-4H-benzo[d][1,3,2]dioxaphosphinin-2-amine 5
[0166] Compound 5 was prepared according to the literature (Ducho, C. et al., J. Med. Chem. 50, 1335-1346 [2007]). Briefly, 5-chlorosalicylic acid was reduced with LAH (0.5 equiv.) at −20° C. and the resulting 5-chlorosalicylic alcohol was cyclized into 2,6-dichloro-4H-benzo[d][1,3,2]dioxaphosphinine using PCI.sub.3 (1.2 equiv.) and triethylamine (2.3 equiv.) at −20° C. under argon. Low temperature and use of triethylamine as the base were decisive in avoiding rapid and quantitative Arbuzov rearrangement of the desired product into the more stable 2,5-dichloro-3H-benzo[d][1,2]oxaphosphole 2-oxide. The crude 2,6-dichloro-4H-benzo[d][1,3,2]dioxaphosphinine was subsequently treated with diisopropylamine (3 equiv.) for 2 h at room temperature. The mixture was then filtered under argon, concentrated to dryness and taken in 20% diisopropylamine in heptane. Quick filtration on a small silica gel plug allowed desired compound 5 as a colourless oil, crystallizing over time at −20° C. Any attempt of more thorough column chromatography on compound 5 would lead to quantitative Arbuzov rearrangement.
[0167] .sup.1H NMR (500 MHz, DMSO-d6) δ=7.23 (dd, J=8.6, 2.6 Hz, 1H), 7.20 (d, J=2.4 Hz, 1H), 6.92 (d, J=8.6 Hz, 1H), 5.06 (dd, J=14.7, 5.2 Hz, 1H), 4.89 (dd, J=19.6, 14.8 Hz, 1H), 3.53-3.63 (m, 2H), 1.15-1.19 (dd, J=8.0, 7.0 Hz, 12H). .sup.31P NMR (202 MHz, DMSO-d6) δ=136.00 (s, 1P).
Bis(tetrabutylammonium) dihydrogen diphosphate 6
[0168] Compound 6 was prepared according to the literature (Warnecke, S. & Meier, C., J. Org. Chem. 74, 3024-3030 [2009]).
[0169] .sup.1H NMR (500 MHz, D.sub.2O) δ 3.04-3.13 (m, 16H), 1.53 (bs, 16H), 1.24 (h, J=7.3, 16H), 0.83 (t, J=7.4, 24H). .sup.31P NMR (202 MHz, D.sub.2O) 6=−10.78 (s, 2P).
((2R,3S,4R,5R)-3,4-dihydroxy-5-(2-oxo-2,10-dihydro-3H-benzo[b]pyrimido[4,5-e][1,4]oxazin-3-yl)tetrahydrofuran-2-yl)methyl triphosphate 7
[0170] Reactions were performed in a 5 mL syringe with PTFE filter loaded with 4 (800 mg, 0.016 mmol) under an argon atmosphere and with shaking.
[0171] Steps were performed as following: [0172] a. 5′-DMT removal: the support was washed with a flow of DCA deblock until the filtrate was colourless, then washed with ACN (5×5 mL). [0173] b. Coupling: N,N-diisopropyl-4H-benzo[d][1,3,2]dioxaphosphinin-2-amine 5 (345 mg, 1.36 mmol) was dissolved in 4.8 mL ACN and reacted portion wise with the support (3 equal couplings with reaction times 60 s-60 s-90 s respectively). To each coupling, an activator (e.g. BTT activator (2.4 mL) or Activator 42) was also added. The support was subsequently washed with ACN (3×5 mL). [0174] c. Oxidation: Pyridine/Water/Iodine (9/1/12.7 v/v/w, 5 mL) for 45 s, followed by ACN wash (3×5 mL) and drying of the support in an argon flow. [0175] d. Triphosphorylation: Two injections of bis(tetrabutylammonium) dihydrogen diphosphate 6 (0.5 M, 5 ml) for 15 min and 18 hours, respectively. The support was subsequently rinsed with DMF (5 mL), water (3×5 mL), ACN (5 mL) and then dried in an argon flow. [0176] e. Cleavage and Purification: Cleavage of the triphosphate was done in 2 h at room temperature with AMA (50/50 v/v mix of 23% aq. NH.sub.4OH and 40% aq. methylamine, 5 mL). After 2 hours, the AMA filtrate was purged in a round-bottom flask and the support was rinsed 3 times with 23% aq. NH.sub.4OH solution. After freeze-drying of the mixture, purification by HPLC (Waters Acquity HSS T3 column, 2.1×50 mm, 0.4 mL/min, 2 to 99% 50 mM NH.sub.4OAc in water 80:20 EtOH) was performed to allow compound 7 (5.6 mg, 62.0% determined from UV absorbance) as a light-yellow solid (ammonium salt). The same level of purity could be achieved with ion-exchange HPLC using a semi-preparative Dionex DNAPac PA100 column (9×250 mm) on an ÄKTA pure 25 HPLC system using a gradient from water to 20% 1M NH.sub.4HCO.sub.4 (pH 7.8) in 30 min at a flow rate of 4 mL/min.
[0177] HRMS (ESI-TOF) m/z calc. for C.sub.15H.sub.18N.sub.3O.sub.15P.sub.3[M+H]+: 574.0029, found: 574.0013; m/z calc. for C15H18N3O15P3 [M−H]−: 571.9878, found: 571.9872. .sup.1H NMR (500 MHz, D2O) δ 7.44 (s, 1H), 6.84-6.94 (m, 3H), 6.79 (dd, J=7.5, 1.7 Hz, 1H), 5.91 (d, J=4.9 Hz, 1H), 4.36 (t, J=4.8 Hz, 1H), 4.29 (t, J=5.1 Hz, 1H), 4.25 (d, J=4.1 Hz, 3H). .sup.13C NMR (126 MHz, D2O) δ 155.8, 154.8, 142.4, 129.4, 124.9, 124.3, 122.3, 116.6, 88.8, 82.8, 73.4, 69.7, 64.5. .sup.31P NMR (202 MHz, D.sub.2O) 5-10.89 (d, J=18.5 Hz, 1P), −11.46 (d, J=19.7 Hz, 1P), −23.21 (t, J=19 Hz, 1P).
[0178] Compound (I) can also be made by a slightly modified route wherein the coupling step (b above) is carried out with a modified phosphoramidite such as 6-chloro-N,N-diisopropyl-4-methyl-4H-benzo[d][1,3,2]dioxaphosphinin-2-amine 8 (compound (IIIa) above). This reagent has been found to be more easily prepared, and compound 8 is obtainable in a yield of 60% compared to around 3-10% for the preparation of compound 5 under the conditions in this specification.
6-chloro-N,N-diisopropyl-4-methyl-4H-benzo[d][1,3,2]dioxaphosphinin-2-amine 8
[0179] 5-chloro-2-hydroxybenzaldehyde was reacted with methylmagnesium bromide (2.5 equiv.) at −20° C. and the resulting 4-chloro-2-(1-hydroxyethyl)phenol was cyclized into 2,6-dichloro-4-methyl-4H-benzo[d][1,3,2]dioxaphosphinine using PCI.sub.3 (1.2 equiv.) and triethylamine (2.3 equiv.) at −20° C. under argon. The crude 2,6-dichloro-4-methyl-4H-benzo[d][1,3,2]dioxaphosphinine was subsequently treated with diisopropylamine (3 equiv.) for 2 h at room temperature. The mixture was then filtered under argon, concentrated to dryness and taken in 20% diisopropylamine in heptane. Quick filtration on a small silica gel plug furnished desired compound 8 as a colourless oil.
[0180] .sup.1H NMR (500 MHz, DMSO-d6) 5=6.96 (d, J=8.5 Hz, 1H), 6.87 (d, J=8.5 Hz, 1H), 6.74 (d, J=8.4 Hz, 1H), 5.19-5.26 (m, 1H), 5.16 (dq, J=10.4, 6.6 Hz, 1H), 3.57 (tdt, J=13.6, 10.6, 6.8 Hz, 2H), 1.63 (d, J=6.6 Hz, 3H), 1.55 (d, J=6.4 Hz, 2H), 1.16-1.19 (m, 24H). .sup.31P NMR (202 MHz, DMSO-d6) 5=137.63 (s, 1P), 127.90 (s, 1P).
Example 2: Cell-Free In Vitro Transcription
[0181] The utility of compound (1) in RNA labelling was demonstrated by its cell-free in vitro transcription to produce fluorescent full-length messenger RNA (mRNA), from a DNA template encoding for H2B histone protein fused to GFP (H2B:GFP).
[0182] The template was codon optimized to limit the number of C repeats, preventing self-quenching and improving brightness. Efficient transcription and tC.sup.O incorporation was observed using two different bacteriophage RNA polymerases, T7 and SP6 at tC.sup.O TP/canonical CTP ratios ranging from 0 to 100% (full replacement), as demonstrated by agarose bleach gel electrophoresis (
[0183] All RNA transcripts run as one single band on the gels, with a size corresponding to the expected 1247 nt mRNA product (H2B:GFP), demonstrating that the full-length mRNA is formed. The tC.sup.O-containing mRNA bands could be directly visualized upon 302 nm excitation (
[0184] Furthermore, no shorter transcripts were observed, suggesting that T7 processes tC.sup.O TP correctly and without premature abortion. Higher order bands are apparent in all lanes of the gel (
[0185] Therefore, these results demonstrate that tC.sup.O can be successfully incorporated into full-length RNA transcripts even under conditions where all canonical CTP is replaced with tC.sup.O TP (0% CTP; i.e. 100% C-labelling efficiency).
Example 3: Spectroscopic Characterization of In Vitro Synthesized tC.SUP.O.-Modified RNA Transcripts
[0186] A spectroscopic approach was used to quantify the incorporation efficiency of tC.sup.O TP, compared to the canonical CTP. To enable this, all RNA transcripts were purified using a Monarch RNA Cleanup kit, ensuring complete removal of unreacted tC.sup.O TP. Absorption spectra (
[0187] By relating the absorption of the purified RNA transcripts at 260 nm, which reflects their total concentration, to the absorption at 370 nm (emanating exclusively from tC.sup.O), the relative rate constants for the incorporation of CTP and tC.sup.O TP (kC and ktC.sup.O, respectively, see later for details). The calculated quotients kC/ktC.sup.O (
[0188] The emissive behaviour of tC.sup.O was also investigated in the mRNA transcripts exploring the relation to the tC.sup.O TP fraction added to the initial reaction mixture. A substantial decrease in fluorescence quantum yield (from 0.18 to 0.09,
[0189] This may be ascribed to electronic interaction (coupling) of molecular states of the tC.sup.O fluorophore and self-quenching effect caused by the expected increasing concentration of vicinal tC.sup.O s. Importantly, this quenching effect at high tC.sup.O fractions is balanced by the large overall number of incorporations and does not prevent visualization of the mRNA, even for transcripts where all Cs are replaced by tC.sup.O s.
Example 4: Translation of tC.SUP.O.-Labelled mRNA in Bacterial Lysates
[0190] In order to verify the functionality of the tC.sup.O-labelled mRNA transcripts the translation of a tC.sup.O-labelled Calmodulin-3 mRNA in cell-free conditions using bacterial lysates was investigated. The labelled mRNAs encoding for the 17 kDa protein were transcribed from a commercial Calmodulin-3 DNA template plasmid using the same tC.sup.O TP/CTP ratios as for the H2B:GFP encoding mRNA (0 to 100% of tC.sup.O TP). After RNA purification and cell-free translation, the presence of Calmodulin-3 was confirmed by Coomassie staining (
Example 5: Translation Efficiency of tC.SUP.0.-Labelled mRNA in Human Cells
[0191] Electroporation was used to introduce in vitro-transcribed tC.sup.O-labelled mRNA transcripts into human neuroblastoma SH-SY5Y cells. Taking advantage of them encoding for a fluorescent fusion protein with nuclear localization (H2B:GFP), the translation was detected by fluorescence (
[0192] Live-cell confocal microscopy and flow cytometry showed that GFP fluorescence in the cell nuclei could be detected in 32, 25, 18, and 12% of the cells 24 hours post-electroporation for mRNA's containing 25, 50, 75 and 100% of tC.sup.O, respectively (
[0193] Using flow cytometry, the levels of H2B:GFP fluorescence in the cells was quantified (
[0194] Importantly, no evidence was found of mRNA-induced cell toxicity at 24 hours post-electroporation (
[0195] It is evident from the images in
[0196] H2B:GFP fluorescence was found to increase gradually with time between 24 h and 72 h (
[0197] When delivered using lipofectamine, the tC.sup.O-labelled mRNAs were found to promote very similar H2B:GFP translation compared to the corresponding non-labelled mRNA, as indicated by the fluorescence levels in
[0198] Importantly, the complexation of the tC.sup.O-labelled mRNA with lipofectamine enabled its direct visualization inside cells using live cell confocal microscopy (
Example 6: Biochemical Methods
Generation of H2B:GFP DNA Template
[0199] The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3), in silico-assembled with an additional T7 promoter and other desired features (Shine-Dalgarno/Kozak consensus sequences for enhancement of translation and a 3×Stop, respectively at the 5′ and 3′ of the coding sequence itself, plus the needed HindIII/SnaBI restriction sites, to generate the ligation-prone sticky ends) and ordered from Twist Bioscience as a synthetic gene block. The obtained sequence was then PCR-amplified, using a Phusion Hot Start High-Fidelity Taq (Thermo Scientific), and subcloned into a HindIII/SnaBI-digested (Fast Digest enzymes, Thermo Scientific) empty pCS2 backbone. After ligation with T4 ligase for 1 h at room temperature (Roche), DH5a E. coli competent cells (Invitrogen) were transformed following the recommended protocol, and obtained colonies were screened by colony-PCR. The selected colony was then inoculated into a midiprep-scale volume of liquid Luria-Bertani growth medium (VWR) and plasmid DNA isolated using a PureLink Fast Low-Endotoxin Midi Plasmid Purification Kit (Thermo Scientific). The purified plasmid was finally digested again with HindIII/SnaBI and gel-purified, to generate the transcription template with the desired size.
[0200] Primers (Eurofins Genomics):
TABLE-US-00001 Twist-H2B.F: GAAGTGCCATTCCGCCTGAC Twist-H2B.R: CACTGAGCCTCCACCTAGCC
H2B:GFP RNA Transcription and Purification
[0201] In-vitro transcription reactions, for T7 and SP6 polymerases (Thermo Scientific), were assembled as recommended by the corresponding protocols, with a few modifications that resulted in a consistently increased yield in all conditions: [0202] 1. 5×Transcription buffer—10 μl [0203] 2. NTP Mix, 10 mM each (2 mM final concentration)−volume depending on batch for tC.sup.O TP [0204] 3. Linearized template DNA 1 μg−volume depending on concentration [0205] 4. RiboLock RNase Inhibitor—1.25 μl (50 U) [0206] 5. T7/T3/SP6 RNA Polymerase—3 μl (60 U, double compared to recommendations) [0207] 6. MgCl.sub.2 4 mM final concentration (increased as recommended by Thomen, P. et al. Biophys. J. 95, 2423-2433 [2008]) [0208] 7. DEPC-treated Water qsp 50 μl
[0209] In-vitro transcriptions were always performed at 20° C. for 14 h, then RNAs were purified using a Monarch RNA Cleanup kit (NEB), or homemade equivalent buffers and regenerated columns following the same rationale. It was possible to partially recover unreacted tC.sup.O TP from the transcription mixtures by HPLC to re-use for further assays. For cellular studies, each batch of RNA was then enzymatically added with a polyA tail (with a Poly(A) Polymerase, NEB protocol #M0276 with incubation extended to 1 hour) and a Cap 0 analogue (using a Vaccinia capping system, NEB protocol #M2080), following the recommended procedures.
Denaturing Bleach-Agarose Gels
[0210] For a qualitative check of all in vitro synthesized RNAs, a denaturing agarose gel was run, in presence of 1.5% bleach (Sigma Aldrich), as recommended in Aranda, P. S., LaJoie, D. M. & Jorcyk, C. L., Electrophoresis 33, 366-369 [2012]. RNAs were first mixed with a 6×DNA loading dye (Invitrogen) and then heat-denatured at 70° C. for 10 min in a heating block, then immediately transferred and kept on ice. The RiboRuler High Range RNA Ladder (Thermo Scientific) underwent the same treatment; 2 μl of RNA ladder were loaded along the samples and the gel was run at constant voltage (70 V) for 1 h and then imaged, under UV transillumination (302 nm) using a ChemiDoc Touch (BioRad). To counterstain the whole gel, and especially the lanes without tC.sup.O TP-containing samples, a standard ethidium bromide staining was finally performed at room temperature for 10 min and gentle rocking, followed by two washes in TAE and then a final wash in distilled water (10 min each).
Cell Culture
[0211] Human neuroblastoma SH-SY5Y cells (Sigma-Aldrich) were grown in a 1:1 mixture of minimal essential medium (HyClone) and nutrient mixture F-12 Ham (Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS), 1% non-essential amino acids (Lonza) and 2 mM L-glutamine. For the tracking experiments, an in-house generated model of human hepatic Huh-7 cells stably overexpressing mRFP-Rab5 were cultured in DMEM/GlutaMax/High glucose (Gibco) supplemented with 10% FBS. The cells are detached with trypsin-EDTA 0.05% (Gibco) and passaged twice a week.
Electroporation or Chemical Transfection
[0212] Cells were electroporated either with 9.7 μg of tC.sup.O TP (for in vitro incorporation experiments) or 100 ng of tC.sup.O-labelled mRNA per 105 cells (for in vitro translation, cytotoxicity assessment, flow cytometry analysis and confocal microscopy), using a Neon Transfection System (Invitrogen, Carlsbad, Calif., US) and following the protocol for 10 μL Neon Tip provided by the manufacturer, with a triple pulse of 1200 V and a pulse width of 20 ms. For chemical transfection, SH-SY5Y cells were seeded one day prior transfection at a density of 0.8 106 cells/mL, in 48-well plate or glass-bottomed culture dishes for flow cytometry or confocal microscopy analysis, respectively. Lipofectamine MessengerMAX was used as chemical reagent for transfection according to the manufacturer's instructions. Briefly, the reagent was diluted and incubated for 10 min at room temperature in Opti-MEM medium. The tC.sup.O-mRNA constructs were added to the reagent to reach a 1:1 final ratio reagent-mRNA (v/w), followed by a 5 min incubation at room temperature allowing the complex mRNA-lipid to form. Cells were incubated with this complex up to 72 h. To address the impact of the dye incorporation on RNA translation, SH-SY5Y cells were electroporated or chemical transfected with commercially available non-labelled (NL) or Cyanine5-labelled (Cy5) eGFP encoding mRNAs (Trilink®) has described here.
Cytotoxicity Assessment
[0213] Cell membrane integrity was determined using the Pierce™ LDH Cytotoxicity Assay Kit (Invitrogen) according to the manufacturer's instructions. Briefly, LDH released in the supernatants of cells 24 h post-electroporated or post-transfected with tC.sup.O-labelled mRNA, or Cy5-mRNA, was measured with a coupled enzymatic assay which results in the conversion of a tetrazolium salt into a red formazan product. The absorbance was recorded at 490 nm and 680 nm. The toxicity was expressed as the percentage of LDH release in supernatant compared to maximum LDH release (supernatant+cell lysate). Data are means±SD from three experiments performed in triplicate.
Flow Cytometry
[0214] Following electroporation of tC.sup.O-labelled mRNA, cells were seeded in 48-well plate (2.105 cells/well) and the expression of H2B:GFP in cells was quantified by flow cytometry. Briefly, 24 h, 48 h or 72 h post-electroporation or post-transfection with tC.sup.O-mRNA, non-labelled mRNA or Cy5-mRNA, cells were harvested and analysed on a Guava EasyCyte 8HTflow cytometer (Millipore). Data are mean fluorescence intensities±SD of gated single living cells from three experiments performed in triplicate. The average fluorescence intensities were baseline corrected by subtracting the signal for RNase-free water electroporated or transfected cells. All flow cytometry data were analysed in Flowing software (version 2.5.1) and displayed using R (http://www.R-project.org/). H2B:GFP: Excitation 488 nm; Emission 525-530 nm.
Confocal Microscopy
[0215] After electroporation, cells were seeded in glass-bottomed culture dishes (MatTek glass-bottomed or in 4-sectors subdivided CELLview dishes; 2.105 cells/chamber). For tracking experiment, the Huh-7 cells stably overexpressing mRFP-Rab5 were incubated with lipofectamine/tC.sup.O-mRNA complex and time-lapse was recorded up to 20 h post-chemical transfection. Confocal images were acquired on a Nikon C2+ confocal microscope equipped with a C2-DUVB GaAsP Detector Unit and using an oil-immersion 60×1.4 Nikon APO objective (Nikon Instruments, Amsterdam, Netherlands). Data were processed with the Fiji software. H2B:GFP: Excitation 488 nm; Emission 495-558 nm. tCO-labelled mRNA: Exc. 405 nm; Em. 447-486 nm. Cy5-labelled mRNA: Exc. 640 nm; Em. 652-700 nm. mRFP-Rab5: Exc. 561 nm; Em. 565-720 nm.
Cell-Free Translation
[0216] Cell-free translation reactions were performed using E. coli bacterial lysates and an Expressway™ Mini Cell-Free Expression System (Thermo Scientific). Calmodulin-like 3 protein is provided as a positive control plasmid (pEXP5-NT/CALML3) in the kit itself; this DNA vector contains a T7 polymerase promoter and a 6×His tag, hence it was first in-vitro-transcribed in presence of the desired concentrations of tC.sup.O TP (vide supra). The obtained RNAs, once purified, were used as templates for the cell-free translation reaction according to the manufacturer's recommendations: E. coli slyD—Extract—20 μl; 2.5×IVPS E. coli Reaction Buffer (-A.A.)—20 μl; 50 mM Amino Acids (-Met)—1.25 μl; 75 mM Methionine*—1 μl; T7 Enzyme Mix—1 μl (omitted when using tC.sup.O-labelled RNAs); DNA Template—1 μg (when testing the tC.sup.O-labelled RNAs, added the same amount of RNA instead); DNase/RNase-free distilled water qsp 50 μl.
Coomassie Staining and Western Blots
[0217] Protein samples from in vitro translation experiments were quantified with a Qubit Protein Assay kit (Thermo Scientific), mixed with 6×SDS Laemmli reducing buffer (Alfa Aesar), then heat-denatured at 85° C. for 10 min and kept at room temperature until needed. Samples were generally run in 1 mm polyacrylamide 4-20% Novex MES/SDS gels (Thermo Scientific) and using a Mini Gel Tank, with the PSU set at constant voltage (200 V). For Coomassie staining, the gel was then washed three times in boiling water, to remove excess of SDS, on a benchtop shaker; a 1×Coomassie non-toxic staining solution was added to the gel and microwaved until initial boiling.
[0218] Gel was finally washed after the appropriate incubation time, to remove excess of background noise, in distilled water and imaged using a ChemiDoc Touch. For Western Blot, the gels were blotted onto PVDF LF ethanol-activated membranes (BioRad) with a TransBlot semi-dry system (BioRad), according to manufacturer's recommendations (settings for 1 mm-thick gels and mixed weight proteins). PVDF membranes were then washed 5 min in TBS-T (TBS and 0.1% Tween-20, Sigma Aldrich), blocked in 5% milk in TBS for 1 h at room temperature and incubated with the appropriate primary antibody dilutions.
[0219] After 3×5 min washes in TBST and an incubation of 1 h with the corresponding HRP-conjugated secondary antibodies, the membrane was washed again three times in TBS-T, once in TBS and once more in distilled water. Finally, membranes were incubated with a minimal volume of SuperSignal West Pico PLUS (Thermo Scientific) and imaged with a ChemiDoc Touch. Primary antibodies: mouse monoclonal anti-6×Histidine tag (Invitrogen) and mouse monoclonal anti-GAPDH (ref. 437000, Invitrogen), both diluted 1:1000 in 3% BSA/TBS-T. Secondary antibodies: HRP-conjugated polyclonal goat anti-Ms and anti-Rb Cross-Adsorbed IgG (H+L) (ref. A16072 and A16104, Invitrogen), used at 1:10000 dilution in TBS-T.
Example 8: Spectroscopic Methods
[0220] The tC.sup.O-RNA products from the cell-free transcription reactions (prior to polyadenylation and capping, see Methods: Bio for details) were measured as received, i.e. in RNAse free Milli Q water. All measurements were carried out at room temperature (ca. 22° C.) in a 3.0 mm path length quartz cuvette, with a sample volume of ca. 60 μL.
Steady State Absorption
[0221] Absorption spectra were recorded on a Cary 5000 (Varian Technologies) spectrophotometer with a wavelength interval of 1.0 nm, integration time of 0.1 s, and a spectral band width (SBW) of 1 nm. All spectra were baseline corrected by subtracting the corresponding absorption from the solvent only. A second-order polynomial Savitzky-Golay (five points) smoothing filter was applied to all spectra. For samples exhibiting significant scattering, as evidenced by characteristic absorption in the long wavelength region (here for λ>475 nm), an additional correction was applied. The scattering contribution (A.sub.scatter) to the absorption was in such cases fitted (using absorption at 550-475 nm as input) to the Rayleigh scattering function (equation S1), where c is a proportionality constant and A.sub.0 a constant, and then subtracted for all wavelengths.
Steady State Emission
[0222] Emission spectra were recorded on a SPEX Fluorolog (Jobin Yvon Horiba) fluorimeter with excitation at 356 nm. Emission was collected at a right angle with an integration time of 0.1 s and wavelength interval of 1 nm. Monochromator slits were adjusted to achieve optimal signal output, leading to SBWs in the interval 1.5-2.5 nm on both the excitation and emission side. Emission spectra were corrected for Raman scattering by subtracting the corresponding emission from a sample containing only solvent. A second-order polynomial Savitzky-Golay (five points) smoothing filter was applied to all spectra.
Fluorescence Quantum Yield Determination
[0223] Sample fluorescence quantum yields (Φ.sub.F) were determined relative to a solution of quinine sulphate (Sigma) in 0.5 M H.sub.2SO.sub.4 (Φ.sub.F,REF=0.546) and calculated according to equation S2.
[0224] Emission spectra for the sample, I.sub.S(λ) and reference, I.sub.REF(λ), were integrated between λ.sub.i=365 nm and λ.sub.f=700 nm. Absorption at the excitation wavelength (356 nm) for the sample (A.sub.s) and reference (A.sub.REF) were in the interval 0.05-0.11 for all samples. Adopted solvent refractive indices for the samples (water) and reference (0.5 M H.sub.2SO.sub.4) were η.sub.S=1.333 and η.sub.REF=1.339, respectively. All quantum yields are presented as mean±standard deviation of two independent cell-free transcription reactions.
Time-Resolved Emission
[0225] Fluorescence lifetimes were determined using time-correlated single photon counting (TCSPC). Samples were excited using an LDH-P-C-375 (PicoQuant) pulsed laser diode with emission centred at 377 nm (FWHM pulse width was 1 nm and 70 ps with respect to wavelength and time, respectively), operated with a PDL 800-B (PicoQuant) laser driver at a repetition frequency of 10 MHz. Sample emission (458 nm, SBW=10 nm) was collected at a right angle, through an emission polarizer set at 54.9° (magic angle detection). Photon counts were recorded on a R3809U 50 microchannel plate PMT (Hamamatsu) and fed into a LifeSpec multichannel analyser (Edinburgh Analytical Instruments) with 2048 active channels (24.4 ps/channel), until the stop condition of 104 counts in the top channel was met. The instrument response function (IRF) was determined using a frosted glass (scattering) modular insert while observing the emission at 377 nm (SBW=10 nm).
Fitting of Fluorescence Lifetimes
[0226] The intensity decays were fitted with IRF re-convolution to the multiexponential model shown in equation S3.
[0227] The least-square re-convolution fitting procedure was carried out using the DecayFit software (http://www.fluortools.com/software/decayfit). All decays were fitted to a tri-exponential (n=3) model. The presented lifetimes are amplitude-weighted average lifetimes (
TABLE-US-00002 TABLE 2 Fitted lifetime parameters for the TCSPC experiments. The X.sup.2- value (Chi-Square) was evaluated to indicate goodness of fit. transcript α.sub.1 τ.sub.1 (ns) α.sub.2 τ.sub.2 (ns) α.sub.3 τ.sub.3 (ns)
Cell-Free Transcription Reaction Kinetics
[0228] The ratio of the rate constants for cytosine vs. tC.sup.O incorporation (k.sub.C/k.sub.tC.sub.
[0229] Solving S5 and S6 for the respective rate constants renders equation S7, in which [C] and [tC.sup.O] denote the concentration of incorporated C and tC.sup.O, respectively.
[0230] Using the Lambert-Beer law, absorption is related to nucleobase concentration according to equations S8 and S9. The following molar absorptivities (unit: M.sup.−1 cm.sup.−1) were adopted:
[0231] Assuming that the product RNA is uniform in size (1247 nucleotides), its base composition (A: 408, U: 272, G: 307, C: 260) allows for equations S10-S13.
[tC.sup.0]+[C]=[RNA]×260 (S10)
[A]=[RNA]×408 (S11)
[U]=[RNA]×272 (S12)
[G]=[RNA]×307 (S13)
[0232] Solving the equation system composed of S7 through S13 allows for quantification of kc/k.sub.tC.sup.O, [tC.sup.0], [RNA], [C], [A], [U], and [G]. The average-strand tC.sup.O incorporation degree (θ.sub.tC.sub.
[0233] Using the volume of the cell-free reaction (50 μL) and resulting product solution (100 μL), equation S15 was applied to calculate the tC.sup.0 incorporation yield (η.sub.tC.sub.
[0234] Consequently, the RNA yield (η.sub.RNA) was calculated according to equation S16.
CONCLUSIONS
[0235] This specification demonstrates that an artificial, size-expanded analogue of cytosine takes the role of natural cytosine and is correctly recognized by several enzymatic machineries, including the ribosome. This fluorescent base analogue, tC.sup.O, is demonstrated to be a suitable intrinsic imaging label of different size RNAs which minimally perturbs native properties and is compatible with enzymatic labelling processes.
[0236] Modified transcripts are non-toxic and translationally active both in bacterial lysate and in eukaryotic systems, regardless of their degree of tC.sup.O incorporation. This conveniently allows for simultaneous monitoring of mRNA uptake and translation into H2B:GFP in live-cell confocal microscopy using selective excitation, an approach that should be applicable to the translation of any protein similarly tagged with a GFP family protein.
[0237] The intrinsic fluorescence RNA-labelling methodologies disclosed herein are therefore excellent non-invasive ways to, in real time, elucidate cellular trafficking mechanisms such as endosomal escape or exosomes formation, both of which are of fundamental importance for pharmaceutical applications. As such the technology for live cell imaging should enable new and improved delivery strategies for next-generation nucleic acid-based drugs.