Composition for preventing or treating neuroinflammatory disease comprising didanosine

Abstract

The present invention relates to a composition for preventing or treating a neuroinflammatory disease, which can inhibit the expression of neuroinflammatory cytokines, promote the degradation of amyloid beta, and improve a cognitive function in an animal model of Alzheimer's disease. More specifically, the present invention relates to a composition for preventing or treating a neuroinflammatory disease comprising didanosine or a pharmaceutically acceptable salt thereof, and the composition may be used for the development of drugs and quasi-drug materials.

Claims

1. A method for preventing or treating a neuroinflammatory disease, comprising a step of administering didanosine or a pharmaceutically acceptable salt thereof to a subject in need thereof, wherein the subject has an increased level of an inflammatory cytokine in a central nervous system, and wherein the neuroinflammatory disease is a disease caused by neuroinflammation in the central nervous system, and is selected from the group consisting of multiple sclerosis, neuroblastoma, stroke, dementia, Alzheimer's disease, cognitive impairment, memory impairment, disturbance of attention, Parkinson's disease, Lou Gehrig's disease, Huntington's disease, Creutzfeldt Jakob disease, post-traumatic stress disorder, depression, schizophrenia, neuropathic pain, and amyotrophic lateral sclerosis.

2. The method of claim 1, wherein the subject has a decreased activity of microglia in degrading amyloid beta.

3. The method of claim 1, wherein the method inhibits expression of a neuroinflammatory cytokine in microglia.

4. The method of claim 1, wherein the method recovers microglial activity of amyloid beta degradation.

5. The method of claim 1, wherein the didanosine or a pharmaceutically acceptable salt thereof is administered at a daily dose of 0.001 to 4 mg/kg.

6. The method of claim 1, wherein the neuroinflammatory disease is hereditary dementia.

7. The method of claim 1, wherein the neuroinflammatory disease is familial Alzheimer's disease.

8. The method of claim 1, wherein the neuroinflammatory disease is an Alzheimer's disease or dementia related with Alzheimer's disease having at least a genetic mutation in at least one selected from the group consisting of amyloid precursor protein (APP), presenilin 1 (PSEN1), and presenilin 2 (PSEN2).

9. The method of claim 8, wherein the genetic mutation in the Presenilin 2 gene comprises at least one selected from the group consisting of PSEN N141, A85V, N141Y, M1741, G212V, A237V, M239I and M239V.

10. A method of promoting amyloid beta degradation in microglia, comprising a step of administering didanosine or a pharmaceutically acceptable salt thereof to a subject in need thereof, wherein the subject has a neuroinflammatory disease caused by an increased level of an inflammatory cytokine in a central nervous system.

11. The method of claim 10, wherein the microglia have at least a genetic mutation in at least one selected from the group consisting of amyloid precursor protein (APP), presenilin 1 (PSEN1), and presenilin 2 (PSEN2).

12. The method of claim 1, wherein the neuroinflammation is hippocampal tissue inflammation.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A and FIG. 1B illustrate the construction of Psen2 N141I mutation Alzheimer's disease mouse models according to an embodiment of the present disclosure: FIG. 1A is a schematic view of a strategy for targeted insertion of N141I point mutation; and FIG. 1B depicts Sanger sequencing chromatograms of normal (wild-type), KI/+, KI/KI mouse.

(2) FIG. 2A to FIG. 2C show overactive inflammatory responses in the Psen2 N141I mutation Alzheimer's disease mouse models compared to normal (wild-type) mouse according to an embodiment of the present disclosure: FIG. 2A shows blood IL-6 concentration in animals in which neuroinflammation has been induced by intraperitoneal injection of various concentrations of lipopolysaccharide (LPS). The Psen2 mutation Alzheimer's disease mice overexpressed IL-6 at all LPS concentrations injected thereto via an intraperitoneal route, with the expression difference between normal and Alzheimer' disease models being more pronounced at lower concentrations; FIG. 2B shows the production of TNF- in response to intraperitoneal injection of LPS, with similar blood levels between normal and Psen2 N141I mutation Alzheimer's disease mice at all concentrations; and FIG. 2C shows blood concentrations of the inflammatory cytokines IL-6, CXCL1, CCL2, and CCLS. The levels of the inflammatory cytokines were remarkably increased only in the Psen2 N141I mutation mice upon injection of LPS at a low concentration (0.35 g/kg) which does not induce any inflammatory response in wild-type mice.

(3) FIG. 3A shows immunofluorescent images by Iba-1 (microglial marker antibody) staining in the hippocampus of normal and Psen2 N141I mutation Alzheimer's disease mice; FIG. 3B shows 3D filament tracking images of Iba-1 signals made by IMARIS software; and FIG. 3C shows dendrite lengths and number of branch points, as analyzed by FilamentTracker of IMARIS software. Through this, Psen2 N141I mutation Alzheimer's disease mice undergo overactive immune response by producing inflammatory cytokines in response to a low con centration of inflammatory stimulus.

(4) FIG. 4A to FIG. 4D show that intraperitoneal injection of LPS at a low concentration induces memory deficit in the Psen2 N141I mutation Alzheimer's disease mouse models: FIG. 4A shows a memory decline in the neuroinflammation-induced Psen2 N141I mutation mice as measured by Y-maze assay; FIG. 4B shows no difference in locomotor activity between the mice as measured by Y-maze assay; FIG. 4C is a schematic view of T-maze assay methods; and FIG. 4D is a graph of T-maze assay results showing a memory decline in the neuroinflammation-induced Psen2 N141I mutation mice in terms of a remarkable decrease in success rate.

(5) FIG. 5 shows cell death rates of microglia derived from wild-type mice after treatment with didanosine.

(6) FIG. 6 shows secretion levels of the inflammatory cytokine IL-6 in microglia derived from wild-type (WT) and Psen2 N141I KI/+ Alzheimer's disease mice (KI/+) in response to LPS and didanosine.

(7) FIG. 7 is a view illustrating that didanosine recovers the ability to degrade amyloid beta from a decreased level in microglia derived from Psen2 N141I KI/+ mice (KI/+), which are Alzheimer's disease animal models, in comparison with wild-type (WT) mice.

(8) FIG. 8 is a view illustrating that the neuroinflammation-induced overexpression of IL-6 in wild-type (WT) and Psen2 N141I KI/+ mice (KI/+), which are Alzheimer's disease animal models, is remarkably suppressed by didanosine.

(9) FIG. 9A shows that the administration of didanosine does not affect locomotor activity.

(10) FIG. 9B shows that didanosine has an effect of recovering memory performance from a declined state.

(11) FIG. 10 shows that didanosine decreases an increased secretion level of IL-6 in microglia derived from Psen2 N141I KI/+ mice in which neuroinflammation has been induced by LPS.

(12) FIG. 11A shows that the administration of didanosine does not affect locomotor activity in wild-type mice and 5FAD disease animal models.

(13) FIG. 11B shows that didanosine has an effect of recovering memory performance from a declined state in 5FAD disease animal models.

(14) FIG. 12 shows that didanosine has a recovery effect on the brain from inflammation in 5FAD disease animal models.

MODE FOR INVENTION

(15) Below, a better understanding of the present disclosure may be obtained through the following examples, which are set forth to illustrate, but are not to be construed to limit the present disclosure.

Example 1. Construction of Animal Model of Disease

(16) All protocols for the care and use of animals were approved by and in accordance with the guidelines established by the Institutional Animal Care and Use Committee of DGIST. Animals were maintained in a specific pathogen-free environment under a standard 12-h light/12-h dark cycle at the DGIST animal facility.

(17) To more accurately reproduce a human neuroinflammatory disease, e.g., human Alzheimer's disease and maintain the endogenous expression level, heterozygous Psen2.sup.N141I/+ (KI/+) mice were used. Psen2.sup.N141I/+ mice were generated using homologous recombination.

(18) Specifically, construction was made of a Psen2 N141I knock-in (KI) animal model of familial Alzheimer's disease in which arginine (N) at position 141 in the presenilin amino acid sequence was substituted by isoleucine (I). Targeting vector included the 1141 mutation in exon 4 and the Neo-loxp sequence, and the homologous region in the targeting vector was inserted into Psen2 of the wild-type (WT) allele. Psen2.sup.N141I/N141I; loxp-Neo-loxp mice were crossed with Cre mice using the Cre-loxp system to generate knock-in mice carrying the Psen2 N141I mutation.

(19) In the Example, Psen2 N141I refers to a substitution in the normal Psen2 gene of animal models for expressing the same mutation as a dementia mutation reported for humans and more specifically to the substitution of the amino acid I for the amino acid N at position 141 in the murine Presenilin 2 gene. In the present disclosure, the gene carrying Psen2 N141I is represented by the polynucleotide of SEQ ID NO: 1 while the wild-type Psen2 gene is given as SEQ ID NO: 2.

(20) KI mice harboring the Psen2 N141I allele (Psen2.sup.N141I/+ and Psen2.sup.N141I/N141I) were generated as illustrated in FIG. 1A. As shown in FIG. 1B, the substitution of AAC to ATC at Asparagine (N) resulted in KI/+ models with asparagine (N) and isoleucine (I) and KI/KI models in which both the alleles were substituted to ATC (I141) as confirmed by genomic sequencing.

Example 2. LPS-Induced Inflammation in Animal Model of Disease

(21) This example was designed to confirm that the Psen2 N141I mutation Alzheimer's disease mouse models exhibit hyperimmune responses compared to normal (wild-type) mice.

(22) 2-1. Assay for LPS Concentration to Induce Inflammation

(23) To examine whether the Psen2.sup.N141I/+ mice tended to exhibit inflammation and cognitive impairment as the immune response of the microglia derived therefrom was aggravated, comparison was made of immune responses between wild-type and Psen2.sup.N141I/+ mice at various concentration of LPS.

(24) In mice, the immune response peaks in the hours around the beginning of the active phase. Therefore, wild-type and Psen2.sup.N141I/+ mice were intraperitoneally (i.p.) injected with LPS at 18:00 (Zeitgeber time, light-on at 07:00 and light-off at 19:00) and monitored for the inflammatory response after 20 hours, that is, at 14:00 next day. The LPS, which acts as a ligand to toll-like receptor 4 to induce cellular immune responses, was derived Escherichia coli O111:B4. LPS was diluted in phosphate-buffered saline (PBS) according to predetermined concentrations and 100 L each was injected into mice via an intraperitoneal route.

(25) Specifically, LPS intraperitoneal injections at concentrations of 1.4, 3.6, 4.0, 25, and 5,000 g/kg induced neuroinflammation in the Psen2 N141I mutation Alzheimer's disease mouse models obtained in Example 1.

(26) For a comparison experiment, wild-type mouse models, instead of the Alzheimer's disease mouse models, were injected with the same concentrations of LPS for neuroinflammatory tests. In other comparative tests, wild-type mouse and Psen2 N141I mutation Alzheimer's disease mouse models without LPS injections were prepared. That is, wild-type mice without LPS injection (WT(LPS())) were assigned to group 1, wild-type mice with various concentration of LPS injected thereto (WT(LPS(+))) to group 2, Alzheimer's disease mouse models without LPS injection (KI/+(LPS())) to group 3, and Alzheimer's disease mouse models with various concentration of LPS injected thereto (KI/+(LPS(+))) to group 4, each consisting of 5-8 mice.

(27) To investigate neuroinflammatory responses to various concentration of LPS injection, blood was extracted from cheek veins of the wild-type mice of group 2 and the Alzheimer's disease mouse models of group 4 at 20 hours after injection of LPS. Sera obtained by centrifuging the blood samples were measured for levels of IL-6, TNF, CCL2, CXCL1, and CCLS using an ELISA kit (R&D Systems) according to the manufacturer's instruction. In addition, sera were extracted from the wild-type without LPS injection of group 1 and the Psen2 N141I mutation Alzheimer's disease mouse models of group 3 in the same manner and measured for levels of the proteins using the ELISA kit according to the manufacturer's instruction.

(28) IL-6 and TNF- levels analyzed in sera from the mice of groups 1 to 4 are summarized in Table 1, below.

(29) TABLE-US-00001 TABLE 1 LPS Concentration (g/kg) 1.4 3.6 4.0 25 5000 Group 1- IL-6 55.983 5.891 6.167 2.833 26.815 6.121 152.718 7.843 47.066 4.710 WT(LPS()) (pg/mL) TNF- 57.129 15.581 51.606 16.486 13.801 6.203 7.112 2.436 59.262 18.848 (pg/mL) Group 2- IL-6 135.414 12.377 435.609 58.851 589.102 31.891 2186.084 152.786 3362.240 261.326 WT(LPS(+)) (pg/mL) TNF- 95.940 15.385 212.951 57.449 127.232 32.518 844.100 52.867 1549.235 124.825 (pg/mL) Group 3- IL-6 65.998 13.677 6.167 2.833 14.302 5.915 180.661 7.031 54.023 6.36 KI/+(LPS()) (pg/mL) TNF- 35.391 13.406 21.775 9.850 19.633 6.349 9.389 2.097 88.176 18.527 (pg/mL) Group 4- IL-6 260.651 28.433 858.809 45.574 884.273 27.475 3180.879 95.747 4596.187 136.528 KI/+(LPS(+)) (pg/mL) TNF- 93.490 24.912 218.504 666.226 157.121 13.298 874.443 65.026 1736.561 19.360 (pg/mL)

(30) In Table 1, data for blood L-6 and TNF- levels of each group are meanSEM. The wild-type mice of group 2 and the Alzheimer's disease mouse models of group 4, which were both injected with LPS, both overexpressed IL-6, with the expression difference therebetween gradually increasing at lower concentrations. In response to LPS, the wild-type mice and the Alzheimer's disease mouse models exhibited the same blood TNF- levels. The wild-type mice in group 1 and the Psen2 N141I mutation Alzheimer's disease mouse models in group 3, which had not been injected with LPS, both exhibited same excretion of IL-6 and TNF- at very low levels.

(31) As shown in FIG. 2A, compared with wild-type mice, KI/+ mice exhibited a higher circulating level of IL-6 at all LPS concentration tested, and the relative difference between the genotypes was more pronounced at the lower concentrations. The blood levels of TNF- were the same in both genotypes at all concentrations as can be seen in FIG. 2B.

(32) 2-2. Inflammation Induced by Treatment with Low Concentration of LPS in Disease Animal

(33) Animals of groups 1 to 4 were prepared in the same manner as in Example 2-1, but for injecting LPS at a low concentration (0.35 g/kg) insufficient to induce inflammatory responses in the wild-type mice, instead of the various concentrations.

(34) Sera were extracted in the same manner from the mouse models and measured for protein levels using an ELISA kit according to the manufacturer's instructions. Blood levels of the inflammatory cytokines IL-6, CXCL1, CCL2, and CCLS in sera from the mice of groups 1 to 4 are summarized in Table 2, below.

(35) TABLE-US-00002 TABLE2 Inflammatory cytokine IL-6 CXCL1 CCL2 CCL5 TNF- secretion (pg/mL) (pg/mL) (pg/mL) (pg/mL) (pg/mL) Group 1- WT(LPS()) 59.231 290.073 49.908 81.978 65.792 11.121 47.194 14.051 13.271 9.335 Group 2- WT(LPS(+)) 60.385 298.861 63.494 108.104 58.332 8.520 27.363 17.542 24.672 7.341 Group 3- KI/+(LPS()) 47.048 252.408 66.926 99.095 64.929 11.825 38.448 24.473 28.489 3.615 Group 4- KI/+(LPS(+)) 190.945 447.010 263.378 244.741 69.896 28.265 13.464 15.024 36.921 7.249

(36) In Table 2, blood levels of the inflammatory cytokines IL-6, CXCL1, CCL2, and CCLS are listed (meanSEM). The lowest LPS concentration (0.35 g/kg) of LPS which did not elicit immune responses in the wild-type mice of group 2 was observed to remarkably increase levels of the inflammatory cytokines only in the Psen2 Alzheimer's disease mice of group 4, unlike TNF-.

(37) As shown in FIG. 2C, the lowest LPS concentration (0.35 g/body weight kg) did not cause inflammation in wild-type mice, but increased blood levels of the inflammatory cytokines (IL-6, CXCL1, CCL2, and CCLS) in Psen2 Alzheimer's disease mice.

Example 3: Identification of Inflammatory Aggravation of Neuroinflammatory Animal Model by Analysis of Microglial Morphology

(38) Microglia morphology is closely related to their function and microglial activation is characterized by cell shape change. To investigate whether the increased production of inflammatory cytokines is associated with changes in the morphology in KI/+ microglia, examination was made of microglia shapes in the hippocampus of wild-type and Psen2 mutation Alzheimer's disease mice by immunohistochemical analyses with an antibody against the microglia-specific marker IBA-1.

(39) Immunohistochemical and confocal analyses were conducted on the mice of groups 1 to 4 prepared in Example 2-2. The LPS concentration injected into groups 2 and 4 was ineffective to induce an inflammatory response in the wild-type mice (0.35 g/kg).

(40) For immunohistochemistry analysis, mice were anesthetized by injection of a mixture of Zoletil (Virbac, 50 mg/kg) and Rompun (Bayer, 10 mg/kg). Then, the mice were perfused with PBS, followed by 4% paraformaldehyde (PFA) for fixation. Brains were collected, post-fixed in 4% PFA for 16 hours, transferred to 30% sucrose until they sank to the bottom of the tube, and stored by using frozen solution. The brain samples were cut into 50-m-thick coronal sections. The slices were incubated at 95 C. for antigen retrieval and then treated with IBA-1 antibody (1:250) in PBS containing 3% bovine serum albumin for 24 hours at 4 C. and then treated with secondary antibody for 2 hours at room temperature. Images were acquired with LSM 7 and LSM 700 confocal laser scanning microscope.

(41) As shown in FIG. 3A, hippocampal microglia in the wild-type mice of group 1 had a small cell body with highly ramified processes. Consistent with no induction of cytokine release, a low concentration of LPS did not change their morphology. On the other hand, hippocampal microglia in Psen2 mutation Alzheimer's disease mice of group 3, even in the absence of LPS injection, already had a round enlarged soma with shorter processes, and these morphological features were furthered by LPS injection in group 4.

(42) As shown in FIG. 3B, confocal images of hippocampal microglia of the mice in groups 1 to 4 were reconstructed into their 3D morphology and measured for morphological parameters using IMARIS software. In detail, confocal images were obtained along the entire Z-axis of a randomly selected field. Then, 3D images were reconstructed from confocal images using IMARIS software (version 9.2.1, Bitplane AG).

(43) TABLE-US-00003 TABLE 3 IMARIS analysis Dendrite length (m) Dendrite branch point Group 1- WT(LPS()) 679.113 38.931 88.226 16.285 Group 2- WT(LPS(+)) 774.000 38.151 81.161 13.253 Group 3- KI/+(LPS()) 531.981 31.526 44.645 3.416 Group 4- KI/+(LPS(+)) 420.806 21.694 35.871 2.186

(44) In Table 3, data for dendrite lengths and dendrite branch points are summarized (meanSEM).

(45) As shown in FIG. 3C, the total dendrite length and the number of dendrite terminal points of each microglial cell were further reduced in the Alzheimer's disease mice of groups 3 and 4 than in the wild-type mice of groups 1 and 2 by LPS injection. It was confirmed from the data that, on the basis of morphology, microglial activation was evident in Psen2 mutation Alzheimer's disease mice and was further induced by mild LPS injection.

Example 4. Memory Decline of Neuroinflammatory Animal Model

(46) 4-1. Y-Maze Assay

(47) To examine the spatial learning and memory of the mice of groups 1 to 4 prepared in Example 2-2, Y-maze tests were conducted 20 hours after LPS injection. The mice were injected at the low concentration of LPS (0.35 g/kg) that does not induce an inflammatory response in wild-type mice.

(48) Specifically, Y-maze was used to evaluate spatial working memory. The assay was conducted in white plastic arms of a Y-shaped maze. A mouse was placed in the center and was allowed to freely explore the arms for 5 min. The experiment was recorded with EthoVision software 11.5 (Noldus). The number of arm entries and the number of triads were analyzed to calculate the percentage of alternation by dividing the number of three consecutive arm entries by the number of possible triads100 (total arm entries2).

(49) TABLE-US-00004 TABLE 4 Y-maze Alternation percent No. of Arm entry Group 1- WT(LPS()) 65.120 4.161 16.769 1.574 Group 2- WT(LPS(+)) 66.124 4.441 14.923 1.129 Group 3- KI/+(LPS()) 61.475 4.855 15.417 1.209 Group 4- KI/+(LPS(+)) 42.353 4.137 14.200 0.818

(50) In Table 4, data for percentages of alternation and numbers of arm entries of each group in Y-maze are summarized (meanSEM). As shown in FIGS. 4a and 4b, the arm alternation in the Y-maze exhibited no difference in memory ability between the wild-type mice of group 1 (13 mice) and the wild-type mice of group 2 with LPS injection (13 mice) in proportion to the secretion of inflammatory cytokines. The wild-type mice of group 1 without LPS injection did not differ in memory even from the Psen2 mutation Alzheimer's disease mice (12 mice) of group 3, which were not injected with LPS, but the memory was significantly decreased in the LPS-injected Psen2 mutation Alzheimer's disease mice (15 mice) of group 4. The total number of arm entries was similar across all the groups, indicating normal locomotor function.

(51) 4-2. T-Maze Assay

(52) To further examine learning memory, a T-maze test with a food reward was conducted 20 hours after LPS injection. Groups 2 and 4 were injected with LPS at the concentration (0.35 g/kg) that does not induce an inflammatory response in wild-type mice.

(53) Specifically, T-maze was used to evaluate spatial learning and memory with reward alternation. As shown in FIG. 4C, the assay was conducted in white plastic arms of a T-shaped maze. Mice were acclimated to the maze and food reward for 5 min before the test. Then, in the test run, one arm was blocked and rewards were placed in another arm, and. Mice were placed at the base and ran to open arms to eat the reward. At the next trial, the previously closed arm was opened. Mice were placed back again at the base and chose one arm. If mice chose the newly opened arm, they were able to eat the reward. If mice incorrectly chose the previously visited arm, they did not get any rewards. The number of trials in which the correct arm was visited was expressed as a percentage of total arm entries.

(54) TABLE-US-00005 TABLE 5 T-maze Success rate (%) Group 1- WT(LPS()) 68.831 5.030 Group 2- WT(LPS(+)) 63.636 3.907 Group 3- KI/+(LPS()) 64.113 7.608 Group 4- KI/+(LPS(+)) 25.000 3.761

(55) Data in Table 5 are meanSEM of the success rates of T-maze in each group. As shown in FIG. 4D, there is no difference in learning and memory ability between the wild-type mice of group 1 (11 mice) and the LPS-injected wild-type mice of group 2 (11 mice) in proportion to the secretion of inflammatory cytokines. The wild-type mice of group 1 without LPS injection did not differ in learning and memory ability even from the Alzheimer's disease mice (10 mice) of group 3, which were not injected with LPS, but the LPS-injected Alzheimer's disease mice (10 mice) of group 4 significantly decreased in learning and memory.

(56) From the data, it was understood that a low concentration of LPS induced a hyperactive immune response and caused memory deficit through the overproduction of inflammatory cytokines comprising IL-6 in Psen2 N141I KI/+ Alzheimer's disease mice, while the same concentration of LPS was innocuous to wild-type mice.

Example 5. Assay for Cytotoxicity of Didanosine

(57) 5-1. Preparation of Wild-Type Mouse-Derived Microglia

(58) The brains were excised from 1- to 3-day-old neonatal mice and primary microglia were obtained from the brains and cultured in Dulbecco's modified Eagle's medium (DMEM, Corning) supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS, Hyclone) and 1% penicillin-streptomycin (Hyclone). Primary microglia were isolated in vitro at day 12 by tapping. Purity of primary microglia was estimated by immunostaining with an antibody against IBA-1, which is a specific microglial marker.

(59) 5-2. Cytotoxicity Assay

(60) To assay cytotoxicity of didanosine, microglia from wild-type (WT) mice were treated with 1, 5, or 10 M of didanosine and measured for cell death rate. For use in this experiment, didanosine (CCL-D1-000017-G06) was provided from the Korea Chemical Bank.

(61) Specifically, the microglia prepared in Example 5-1 were seeded at a density of 510.sup.4 cells into 96-well plates. Next day, the seeded cells were incubated with 0, 1, 5, or 10 M of didanosine for 12 hours and then co-stained with Hoechst 33342 (Invitrogen, H3570) and propidium iodide (PI; Sigma-Aldrich, P4170) for cell death measurement. Images of stained cells were captured using a fluorescence microscope (Axiovert 40 CFL; Carl Zeiss). Hoechst-positive and PI-positive cells were counted using NIH ImageJ software. Cell death rates were calculated by (number of PI-positive [dead] cells/number of Hoechst-positive [total] cells)100.

(62) As can be seen in FIG. 5 and Table 6, didanosine was observed to have no cytotoxicity to cells.

(63) TABLE-US-00006 TABLE 6 Didanosine dose (M) Cell death rate (%) 0 5.784 0.985 1 2.026 0.769 5 5.567 1.694 10 5.847 1.059

Example 6. Neuroinflammation Inhibitory Effect of Drug Using Microglia of Disease Animal

(64) Brains were excised from 1- to 3-day-old neonatal Psen2 N141I KI/+ mice and wild-type mice prepared in Example 1. Primary microglia derived from the wild-type and the Psen2 N141I KI/+ mice were cultured according to Example 5-1.

(65) The prepared microglia were pretreated with 0, 5, or 10 M of didanosine for 30 minutes and further with 1 LPS derived from Escherichia coli O111:B4(L4391). After 12 hours of incubation, the cytokine IL-6 released into the cell medium was quantitatively analyzed by ELISA. An ELISA kit for murine IL-6 was purchased from R&D system and used to measure a level of the cytokine in a culture medium according to the manufacturer's instructions.

(66) Specifically, the primary microglia treated with didanosine were divided as follows.

(67) TABLE-US-00007 TABLE 7 Test Group IL-6 (pg/mL) Group 5- WT (LPS(didanosine 0 uM)) 3424.373 86.045 Group 6- WT (LPS(didanosine 5 uM)) 3099.967 67.852 Group 7- WT (LPS(didanosine 10 uM)) 3009.218 196.428 Group 8- KI/+(LPS(didanosme 0 uM)) 4730.879 231.776 Group 9- KI/+(LPS(didanosme 5 uM)) 3749.965 35.714 Group 10- KI/+(LPS(didanosme 10 uM)) 3261.407 156.334

(68) As shown in Table 7 and FIG. 6, didanosine significantly decreased the elevated secretion level of IL-6 in LPS-treated microglia derived from Psen2 N141I KI/+ mice.

Example 7. Recovery Effect of Ability to Degrade Amyloid Beta Decreased by Psen2 N141I Mutation in Microglia According to Treatment of Didanosine

(69) Brains were excised from 1- to 3-day-old neonatal Psen2 N141I KI/+ mice and wild-type mice prepared in Example 1. Primary microglia derived from the wild-type and the Psen2 N141I KI/+ mice were cultured according to Example 5-1 and then seeded into 24-well plates covered with a cover glass.

(70) Specifically, FITC signal-conjugated amyloid beta.sub.1-42 was prepared with reference to the document (Cho, M.-H. et al. Autophagy in microglia degrades extracellular -amyloid fibrils and regulates the NLRP3 inflammasome. Autophagy 10, 1761-1775 (2014)).

(71) FITC-conjugated amyloid beta oligomers were fibrilized for 24 hours in a medium.

(72) The microglia were pretreated with 10 M didanosine for 30 minutes, and then the fibrilized amyloid beta.sub.1-42 (fA42) prepared above was directly applied at a concentration of 4 M to the microglial cell culture. After 2 hours of incubation with the fibrilized amyloid beta, amyloid beta which was not engulfed but remained in the medium was removed through washing process.

(73) Subsequently, the cells were continuously treated with didanosine for 24 hours, followed by fixation. The fixed cells were mounted on a slide glass and quantitatively measured for fibrilized amyloid beta remaining within the cells to compare degradation performance. Amyloid beta was quantitated by obtaining images taken by a confocal laser scanning microscope (LSM700) at intervals of 2 m along the entire Z-axis of a randomly selected field and calculating pixel numbers of the HIC-labeled amyloid beta signals through ZEN (black edition; Carl Zeiss) software to measure relative fluorescent intensities.

(74) As can be seen in FIG. 7 and Table 8, didanosine exhibited a therapeutic effect on a neuroinflammatory disease, e.g., Alzheimer's disease through recovery from the decreased amyloid beta degradation performance in Psen2 N141I KI microglia.

(75) TABLE-US-00008 TABLE 8 Test Group Relative residual amyloid beta Group 11- WT (didanosine 0 uM) 1.000 0.075 Group 12- WT (didanosine 10 uM) 0.973 0.100 Group 13- KI/+(didanosine 0 uM) 1.964 0.169 Group 14- KI/+(didanosine 10 uM) 1.353 0.115

Example 8. Assay for Cytokine Expression in Psen2 N141I KI Model Mouse (KI/+)

(76) Didanosine was intraperitoneally injected at a concentration of 5 mg/kg into wild-type mice (WT) and the Alzheimer's disease Psen2 N141I KI model mice (KI/+) constructed in Example 1, and after 4 hours, intraperitoneal injection of LPS at a concentration of 0.35 g/kg was conducted.

(77) As shown in FIG. 8, a concentration of 0.35 g/kg of LPS did neither induce any inflammatory response, nor increased blood IL-6 levels in wild-type mice, but induced neuroinflammation in the Psen2 N141I KI/+ mice, overproducing IL-6. In addition, the concentration of 5 mg/kg of didanosine corresponds to 0.4 mg/kg for humans (24 mg/60 kg), which is about 0.1 times or lower compared to the daily dose of 250 mg prescribed for HIV treatment.

(78) Twenty-four hours after injection of didanosine, blood samples were taken from the mice, and sera were isolated therefrom and quantitatively analyzed for the cytokine IL-6 through ELISA. As shown in FIG. 8 and Table 9, didanosine remarkably reduce the level of IL-6 oversecreted by neuroinflammation

(79) TABLE-US-00009 TABLE 9 Test group IL-6 (pg/mL) Group 15- WT (LPS(didanosine 0 mg/kg)) 339.507 24.022 Group 16- WT (LPS(didanosine 5 mg/kg)) 312.679 68.423 Group 17- KI/+(LPS(didanosine 0 mg/kg)) 675.229 105.941 Group 18- KI/+(LPS(didanosine 5 mg/kg)) 297.484 25.155

Example 9. Assay for Locomotor Activity and Memory in Psen2 N141I KI Model Mouse (KI/+)

(80) Animal tests were performed using animal models of Psen2 N141I KI/+ disease. Didanosine was administered in the same manner as in Example 5 to wild-type mice and Psen2 N141I KI model mice (KI/+) constructed in Example 1, and after 4 hours, intraperitoneal injection of LPS at a concentration of 0.35 g/kg was conducted thereon. As shown in FIG. 9B and Table 11, the concentration of 0.35 g/kg of LPS corresponds to a very low concentration that does not induce memory deficit in wild-type mice, but induced neuroinflammation in Psen2 N141I KI/+ mice which thus underwent memory deficit.

(81) For locomotor activity assay, an open field test was performed to measure locomotion speeds and total locomotor distance 24 hours after injection of didanosine. As shown in FIG. 9A and Table 10, intraperitoneal injection of didanosine did not affect locomotor activity.

(82) TABLE-US-00010 TABLE 10 Locomotion Total locomotor Open field test speed (cm/s) distance (cm) Group 19- WT (LPS(didanosine 0 3.09 0.136 2983.939 172.749 mg/kg)) Group 20- WT (LPS(didanosine 5 3.155 0.138 3354.104 240.995 mg/kg)) Group 21- KI/+(LPS(didanosine 0 3.019 0.178 3050.195 213.565 mg/kg)) Group 22- KI/+(LPS(didanosine 5 3.410 0.138 3549.364 215.031 mg/kg))

(83) For memory recovery assay, spatial memory performance was assessed through Y-maze analysis 24 hours after didanosine injection. Specifically, a mouse was placed in one maze arm in a Y-maze and allowed to freely wander for 5 minutes. The Y-shaped arms were named A, B, and C, and whenever the mouse entered the arms, the names of the arms were recorded. The number of entries into new arms that the mice did not enter just before were calculated and analyzed as follows: Alternation (%)=(three consequent different trials (arm)/(total number of entry2))100. The total numbers of entries into the arms were same across the groups, indicating same locomotor activity thereamong.

(84) As shown in FIG. 9B and Table 11, didanosine recovered the decreased memory performance of the Alzheimer's disease Psen2 N141I KI model mice to the memory level of wild-type mice. In detail, as confirmed in Example 4-1, the low concentration of LPS did neither cause memory decline, nor affect locomotor activity in the normal group. Thus, the LPS-injected normal group did not differ in memory and locomotor activity from the normal group without LPS injection. The low concentration of LPS caused memory deficit only in the Alzheimer's disease-induced groups. That is, didanosine recovered the decreased memory of the LPS-injected, Alzheimer's disease Psen2 N141I KI mice to the memory level of the wild-type mice without LPS injection.

(85) TABLE-US-00011 TABLE 11 Alternation No. of Arm Y- maze percent entry Group 19- WT (LPS(didanosine 0 76.261 2.810 30.239 4.694 mg/kg)) Group 20- WT (LPS(didanosine 5 75.512 5.919 34.707 8.543 mg/kg)) Group 21- KI/+(LPS(didanosine 0 55.485 2.942 27.000 4.481 mg/kg)) Group 22- KI/+(LPS(didanosine 5 75.977 5.160 30.545 7.187 mg/kg))

Example 10. Therapeutic Effect of Drug on Neuroinflammation in Microglial of Disease Animal

(86) Brains were excised from 1- to 3-day-old neonatal Psen2 N141I KI/+ mice and wild-type mice prepared in Example 1. Primary microglia derived from the wild-type and the Psen2 N141I KI/+ mice were cultured according to Example 5-1.

(87) To observe the therapeutic effect of didanosine, the prepared microglia were pretreated with 1 g/mL LPS and then 10 M of didanosine was treated after 1 hour. After 11 hours of incubation, the cytokine IL-6 released into the cell medium was quantitatively analyzed by ELISA. An ELISA kit for murine IL-6 was purchased from R&D system and used to measure a level of the cytokine in a culture medium according to the manufacturer's instructions.

(88) The primary microglia treated with didanosine were divided as follows. As shown in FIG. 10 and Table 12, application of didanosine to the Psen2 N141I KI/+ mouse-derived microglial cells where LPS induced neuroinflammation significantly decreased the elevated secretion level of IL-6, demonstrating a therapeutic effect of didanosine on neuroinflammation.

(89) TABLE-US-00012 TABLE 12 Test group IL-6 (pg/mL) Group 23- WT (LPS(didanosine 0 uM)) 2160 176.635 Group 24- WT (LPS(didanosine 10 uM)) 2040 164.317 Group 25- KI/+(LPS(didanosme 0 uM)) 3607.5 128.087.sup. Group 26- KI/+(LPS(didanosine 10 uM)) 2115 151.959

Example 11. Assay for Locomotor Activity and Memory in 5FAD Mouse Model

(90) As an animal model for use in research into Alzheimer's disease, a 5FAD mouse model that has a total of 5 AD-related mutant APP and PSEN1 genes (APP; Swedish (K670N/M671L), Florida (I716V), and London (V717I) mutations and PSEN1; M146L and L286V mutations) was employed in this assay. The APP and PSEN1 mutant genes are expressed under the control of Thy1 (mature neuron-specific label) promoter and cause severe amyloid pathology and behavior deficiency even in hemizygous mice (Jawhar S. et al. Motor deficits, neuron loss, and reduced anxiety coinciding with axonal degeneration and intraneuronal A aggregation in the 5XFAD mouse model of Alzheimer's disease. Neurobiology of Aging 196. e29-40 (2012)).

(91) Didanosine was intraperitoneally injected at a concentration of 0.5 mg/kg/day into 6-month-old 5FAD mice and wild-type mice five days in series per week for a total of four weeks. The concentration of 0.5 mg/kg of didanosine corresponds to 0.04 mg/kg for humans (2.4 mg/60 kg), which is about 0.01 times or lower compared to the daily dose of 250 mg prescribed for HIV treatment.

(92) For locomotor activity assay after injection of didanosine, an open field test was performed in the same manner as in Example 9 to measure locomotion speeds and total locomotor distance. As shown in FIG. 11A and Table 13, intraperitoneal injection of didanosine did not affect locomotor activity.

(93) TABLE-US-00013 TABLE 13 Locomotion Total locomotor Open field test speed (cm/s) distance (cm) Group 27- WT (didanosine 3.118 0.197 2841.843 445.852 (0 mg/kg/day)) Group 28- WT (didanosine 3.616 0.154 3253.840 138.739 (0.5 mg/kg/day)) Group 29- 5xFAD (didanosine 3.464 0.335 3855.947 187.071 (0 mg/kg/day)) Group 30- 5xFAD (didanosine 3.607 0.525 3212.850 438.732 (0.5 mg/kg/day))

(94) For memory recovery assay, spatial memory performance was assessed in the same manner as in Example 9 after injection of didanosine. As shown in FIG. 11B and Table 14, didanosine was observed to make a recovery from the memory decline induced in the 5FAD (6 month) Alzheimer's disease models.

(95) TABLE-US-00014 TABLE 14 Alternation No. of Arm Y- maze percent entry Group 27- WT (didanosine 72.333 3.180 15.667 1.667 (0 mg/kg/day)) Group 28- WT (didanosine 76.667 6.489 20.333 0.333 (0.5 mg/kg/day)) Group 29- 5xFAD (didanosine 40.667 7.881 16.333 2.333 (0 mg/kg/day)) Group 30- 5xFAD (didanosine 68.667 4.096 21.000 4.359 (0.5 mg/kg/day))

Example 12. Assay for Recovery from Neuroinflammation in 5FAD Mouse Model

(96) After completion of the experiment in Example 11, hippocampal tissues were isolated from the 5FAD mouse and examined for expression of IL-6 gene (Il-6). Specifically, an expression level of Il-6 mRNA was measured using quantitative RT-PCR (qRT-PCR). In this regard, RNA was extracted from the isolated hippocampal tissues and used to synthesize cDNA with ImProm-II Reverse Transcriptase kit (Promega). PCR primers were commercially synthesized (Cosmo Genetech). qRT-PCR was carried out using murine cDNA-specific Taq Polymerase (Invitrogen) and the primers listed in Table 15. In CFX96 Real-Time System (Bio-Rad), 50-cycle amplification was applied to all the primers by using TOPreal qPCR 2PreMIX (SYBR Green with low ROX) (Enzynomics). Actb was used as a reference gene for normalization.

(97) TABLE-US-00015 TABLE15 Genereference Gene number 5-primersequence-3 IL-6 NM_031168.2 F CTGGATATAATCAGGAAATTTGC (SEQIDNO:3) R AAATCTTTTACCTCTTGGTTGA (SEQIDNO:4)

(98) As shown in FIG. 12 and Table 16, the expression level of IL-6 which was elevated in the 5FAD mouse brain tissues was lowered by didanosine, demonstrating that didanosine has a recovery effect from brain inflammation, specifically, hippocampal inflammation and thus a therapeutic effect on neuroinflammatory disease.

(99) TABLE-US-00016 TABLE 16 Il-6 mRNA Test group expression (fold) Group 27- WT (didanosine (0 mg/kg/day)) 1.000 0.141 Group 28- WT (didanosine (0.5 mg/kg/day)) 1.033 0.124 Group 29- 5xFAD (didanosine (0 mg/kg/day)) 2.104 0.169 Group 30- 5xFAD (didanosine (0.5 mg/kg/day)) 1.348 0.255

Example 13. Statistical Analysis

(100) Data in the Examples above were acquired in at least three independent experiments and are presented as meanstandard error of the mean values (SEM). Statistical analysis was performed by using Student's unpaired t-test, one-way ANOVA, or two-way ANOVA. Statistical significance was analyzed using GraphPad Prism.

(101) Although the preferred embodiments of the present disclosure have been disclosed for illustrative purposes, those skilled in the art will understand that other specific variations and modifications are possible, without departing from the technical spirit or essential features of the present disclosure. Therefore, it should be understood that the Examples described above are illustrative in all respects and not limited.