SYSTEMS AND METHODS FOR EVALUATING TISSUE OF A SUBJECT
20240041358 ยท 2024-02-08
Inventors
- John R. Chevillet (Seattle, WA)
- Tatiana D. Khokhlova (Seattle, WA, US)
- George R. Schade (Seattle, WA, US)
- Joo Ha Hwang (Bellevue, WA, US)
- Muneesh Tewari (Seattle, WA, US)
Cpc classification
A61B8/5223
HUMAN NECESSITIES
A61B5/14546
HUMAN NECESSITIES
A61B5/14507
HUMAN NECESSITIES
G16H50/30
PHYSICS
A61B5/145
HUMAN NECESSITIES
A61B10/0038
HUMAN NECESSITIES
A61B5/4836
HUMAN NECESSITIES
International classification
A61B5/145
HUMAN NECESSITIES
A61B5/00
HUMAN NECESSITIES
A61B10/00
HUMAN NECESSITIES
Abstract
The present disclosure is directed to relates to systems and methods for evaluating tissue using high intensity focused ultrasound (HIFU) energy. In one embodiment, for example, a system for treating a patient comprises an ultrasound source configured to deliver HIFU energy to a target tissue mass of the patient and a function generator operably coupled to the ultrasound source for initiating a pulsing protocol for delivering the HIFU energy. The system further comprises a controller configured to perform operations comprising applying HIFU energy to induce cavitation in the target tissue mass and cause a biomarker to be released, comparing a baseline concentration of the biomarker from a first fluid sample to a concentration of the biomarker in a second fluid sample within 2 hours after applying HIFU, and repeating the applying and comparing until the concentration of the biomarker in the fluid sample falls below a threshold value.
Claims
1. A system for treating a human patient, the system comprising: an ultrasound source configured to deliver high intensity focused ultrasound energy to a target tissue mass of the patient; a function generator operably coupled to the ultrasound source, wherein the function generator initiates a pulsing protocol for delivering the high intensity focused ultrasound energy from the ultrasound source to the target tissue mass; and a controller in communication with the ultrasound source and the function generator, wherein controller is configured to perform operations comprising applying high intensity focused ultrasound energy to induce cavitation in the target tissue mass and cause a biomarker to be released from within the cells; comparing (a) a baseline concentration of the biomarker from a first fluid sample of the patient to (b) a concentration of the biomarker in a second fluid sample of the subject within 2 hours after applying high intensity focused ultrasound energy to the target tissue mass; and repeating the applying and comparing until the concentration of the biomarker in the fluid sample falls below a threshold value.
2. The system of claim 1 wherein a period of time between applying high intensity focused ultrasound energy and comparing a baseline concentration of the biomarker in the first fluid sample to the concentration of the biomarker in the second fluid sample is no more than about 1 hour.
3. The system of claim 1 wherein a period of time between applying high intensity focused ultrasound energy and comparing a baseline concentration of the biomarker in the first fluid sample to the concentration of the biomarker in the second fluid sample is no more than about 20 minutes.
4. The system of claim 1 wherein applying high intensity focused ultrasound energy to induce cavitation in the target tissue mass comprises inducing cavitation bubbles that reversibly permeabilize the cells.
5. The system of claim 1 wherein the function generator is configured to initiate the pulsing protocol for inducing shock waves having a pulse-average intensity of 25 kW/cm2 or greater.
6. The system of claim 1 wherein the function generator is configured to initiate the pulsing protocol for inducing shock waves having a pulse-average intensity of 40 kW/cm2 or greater.
7. The system of claim 1 wherein applying high intensity focused ultrasound energy to induce cavitation in the target tissue mass comprises inducing cavitation bubbles that reversibly permeabilize the cells.
8. The system of claim 1 wherein the threshold value of the biomarker is greater than the baseline concentration of the biomarker in the fluid before applying the high intensity focused ultrasound energy, and wherein the threshold value is at least 2 times greater than the baseline concentration.
9. The system of claim 1 wherein the biomarker comprises any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.
10. The system of claim 1 wherein the biomarker is released into a fluid of the patient, and wherein the fluid is selected from the group consisting of blood, a blood fraction, a blood derivative, a fluid fraction of blood, a non-fluid fraction of blood, whole blood, blood cells, microvesicles, cryoprecipitate, plasma, serum, subcellular vesicles, lymph fluid, ascites, urine, cerebrospinal fluid, seminal fluid, breast milk, breast secretions, breast aspirates, and feces.
11. The system of claim 1 wherein the fluid is blood, a blood fraction, or a blood derivative.
12. A system for diagnosing a disease or an increased risk of a disease in a subject, the system comprising: an ultrasound source configured to non-invasively deliver high intensity focused ultrasound energy to a target tissue mass of the patient to cause release of a marker from the mass; and a controller configured to determine a concentration of the marker in a fluid of the subject.
13. The system of claim 12 wherein the ultrasound source is configured to deliver sufficient high intensity focused ultrasound energy to the target tissue mass of the subject to induce cavitation bubble activity in the target tissue mass.
14. The system of claim 12 wherein the ultrasound source is configured to deliver sufficient high intensity focused ultrasound energy to the target tissue mass of the subject to induce boiling histotripsy in the target tissue mass.
15. The system of claim 12 wherein the disease is a cancer, and wherein the marker is a DNA, a RNA, a protein, or a small molecule.
16. A method, comprising: determining a baseline concentration of a biomarker in a first fluid sample of a subject; applying high intensity focused ultrasound nonlinear waveform energy to induce cavitation in a target tissue mass of the subject and cause the biomarker to be released from within cells of the target tissue mass; determining a second concentration of the biomarker in a second fluid sample of the subject within 2 hours after applying high intensity focused ultrasound nonlinear waveform energy to the target tissue mass; and repeating the applying and determining until the second concentration of the biomarker in the fluid sample falls below a threshold value.
17. The method of claim 16 wherein the target tissue mass is a tumor and the biomarker is a miRNA.
18. The method of claim 16 wherein the amount of the biomarker released from within the cells of the target tissue mass is determined by determining a concentration of the biomarker in a fluid of the subject, wherein the fluid is selected from the group consisting of blood, a blood fraction, a blood derivative, a fluid fraction of blood, a non-fluid fraction of blood, whole blood, blood cells, microvesicles, cryoprecipitate, plasma, serum, subcellular vesicles, lymph fluid, ascites, urine, cerebrospinal fluid, seminal fluid, breast milk, breast secretions, breast aspirates, and feces.
19. The method of claim 16 wherein the threshold value of the biomarker is greater than the baseline concentration of the biomarker in the first fluid sample before applying the high intensity focused ultrasound nonlinear waveform energy, and wherein the threshold value is at least 2 times greater than the baseline concentration.
20. The method of claim 16 wherein a period of time between applying high intensity focused ultrasound nonlinear waveform energy to the target tissue mass and determining the second concentration of the biomarker is no more than 20 minutes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] The present technology is directed toward systems and methods for selectively inducing release of a marker from a tissue mass. In several embodiments, for example, an ultrasound source can pulse HIFU energy toward a tissue mass or suspected tissue mass that includes one or more markers (e.g., a biomarker such as an miRNA), generally referred to herein as a liquid molecular biopsy technique. The pulsed HIFU waves can induce release of at least a portion of one or more markers into a fluid of a subject (e.g., the subject's blood stream), which can then be detected by conventional means. In some embodiments, the fluid is blood, such as a fluid and/or non-fluid fraction or derivative of blood like whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate. In some embodiments, the HIFU energy is applied to the tissue mass or suspected tissue mass in a non-invasive or minimally invasive manner. The terms tissue mass and suspected tissue mass are used herein to describe various collections of cells which may be abnormal (including benign abnormal masses), such as nodules, cysts, tumors (e.g., prostate tumors). A single blood test can facilitate detection of the marker(s), and the resulting marker expression profile can be used to diagnose a condition (e.g., PCA) in a subject and provide critical individualized prognostic information for the subject. Systems and methods configured in accordance with embodiments of the present technology are expected to provide effective minimally invasive (e.g., non-invasive) diagnosis and/or treatment of tissue masses, and facilitate better informed, potentially personalized treatment related decisions while reducing risks commonly associated with conventional methods such as needle biopsy.
[0030] In some embodiments, a method of diagnosing a disease or an increased risk of a disease in a subject according to the present technology comprises applying high intensity focused ultrasound (HIFU) energy to a target mass of the subject to cause release of a marker from the mass; and thereafter determining a concentration of the marker in a fluid of the subject.
[0031] In other embodiments, a method of characterizing two or more masses in a human or non-human animal subject (collectively, the subject) according to the present technology comprises optionally determining a baseline concentration of a first marker and/or a second marker in fluid of the subject; applying a first high intensity focused ultrasound (HIFU) energy to a first mass of the subject to cause release of a first marker from the mass; thereafter determining a concentration of the first marker in a first fluid sample of the subject; after a period of time, for example a period of time sufficient for the concentration of the first marker in the blood to return to or near a pre-HIFU baseline level, applying a second HIFU energy to a second mass of the subject to cause release of a second marker from the mass; thereafter determining a concentration of the second marker in a second fluid sample of the subject; and characterizing the first and second masses based, at least in part, on the concentrations of the first and second markers in the first and second fluid samples, respectively. In some embodiments, the first marker comprises a plurality of markers related to the first mass, and/or the second marker comprises a plurality of markers related to the second mass (e.g., multiplex biomarkers).
[0032] In other embodiments, a method of treating a target tissue mass in a human or non-human animal subject (collectively, the subject) according to the present technology comprises optionally determining a baseline concentration of a biomarker in a fluid sample of the subject; performing a procedure on the target tissue mass of the patient; applying high intensity focused ultrasound (HIFU) energy to the target tissue mass; determining a concentration of the biomarker in a fluid sample of the subject after applying HIFU energy to the target tissue mass; and repeating the performing, applying, and determining until a concentration of the biomarker in the fluid sample falls below a threshold value.
[0033] In still other embodiments, a method of treating two or more tissue masses in a human or non-human animal subject (collectively, the subject) according to the present technology comprises (a) optionally determining a baseline concentration of a first marker and/or second marker in fluid of the subject; (b) performing a first procedure on a first tissue mass of the subject; (c) applying high intensity focused ultrasound (HIFU) energy to the first tissue mass to cause a first marker to release from the first tissue mass; (d) thereafter, determining a concentration of the first marker in a first fluid sample of the subject; (e) after a first period of time, performing a second procedure on a second tissue mass of the subject; (f) applying HIFU energy to the second tissue mass to cause a second marker to release from the second tissue mass; (g) thereafter, determining a concentration of the second marker in a second fluid sample of the subject; and (h) after a second period of time, repeating: (1) steps (b) to (d) if the concentration of the first marker exceeds a first threshold value; (2) steps (e) to (g) if the concentration of the second marker exceeds a second threshold value; or (3) steps (b) to (g) if the concentration of the first marker exceeds the first threshold value and the concentration of the second marker exceeds the second threshold value.
[0034] In some embodiments, a method of inducing release of a marker from target tissue of a human or non-human animal subject according to the present technology comprises non-invasively applying high intensity focused ultrasound (HIFU) energy to the target tissue.
[0035] Certain specific details are set forth in the following description and in
[0036] For ease of reference, throughout this disclosure identical reference numbers are used to identify similar or analogous components or features, but the use of the same reference number does not imply that the parts should be construed to be identical. Indeed, in many examples described herein, the identically-numbered parts are distinct in structure and/or function. Further, the headings provided herein are for convenience only.
[0037] For ease of reference, throughout this disclosure systems and methods of treatment may refer to a mass or a tissue mass. Unless the context clearly dictates otherwise, these terms may refer to a collection of cells (e.g., a tissue or a portion of a tissue), a region of one or more organs, a sarcoma, a tumor, a nodule, a cyst, or a combination thereof.
Selected Embodiments of HIFU Systems for Performing Non-Invasive Biopsies and Associated Methods
[0038]
[0039] The system 10 also includes an ultrasound source 400 configured for delivering the high-intensity ultrasound waveform to the target tissue mass or suspected tissue mass of the patient (see
[0040] The system 10 may also comprise an optional controller 300 in operative communication with the function generator 100, the amplifier 200, and the ultrasound source 400. The system 10 may also include an optional display 500 in operative communication with the function generator 100, the amplifier 200, the ultrasound source 400, and the optional controller 300 (when present).
[0041] As noted previously, the system 10 is configured to deliver powerful, controlled ultrasound waves that are focused inside the patient's body to ablate the targeted tissue at the focus, without affecting or significantly affecting surrounding tissue or organ(s). In some embodiments, the HIFU waves are sent in short, infrequent but powerful bursts, causing mechanical disruption of tissue at the focus without any significant thermal effects (e.g., thermal damage). Without wishing to be bound by theory, it is believed that the mechanical disruption is achieved at least in part by the formation of small gas bubbles in the targeted tissue. These bubbles grow and collapse in response to the ultrasound wave, a phenomenon commonly referred to as cavitation. Depending on the pulsing protocol employed, the outcome can range from small holes in cell membranes and capillaries to complete liquefaction of a small region of tumor.
[0042] As shown in
[0043] The controller 300 may be a single processing unit or multiple processing units in a device or distributed across multiple devices. The controller 300 may communicate with the hardware controller for devices, such as for a display that displays graphics and/or text (e.g., LCD display screensnot shown). The controller 300 can also be in communication with a memory that includes one or more hardware devices for volatile and non-volatile storage, and may include both read-only and writable memory. For example, a memory may comprise random access memory (RAM), read-only memory (ROM), writable non-volatile memory, such as flash memory, hard drives, floppy disks, CDs, DVDs, magnetic storage devices, tape drives, device buffers, and so forth. A memory is not a propagating electrical signal divorced from underlying hardware, and is thus non-transitory. In certain embodiments, the controller 108 can also be coupled to a communication device capable of communicating wirelessly or wire-based with a network node. The communication device may communicate with another device or a server through a network using, for example, TCP/IP protocols.
[0044] The controller 300 can execute automated control algorithms to initiate, terminate, and/or adjust operation of one or more features of the system 10 and/or receive control instructions from a user. The controller 300 can further be configured to provide feedback to a user based on the data received from the system 10 via an evaluation/feedback algorithm. This information can be provided to the users via a display (e.g., a monitor on a computer, tablet computer, or smart phone; not shown) communicatively coupled to the controller.
[0045] In various embodiments, the system 10 can further include a positioning device 110 coupled to the ultrasound source 400 to aid in positioning the focus 485 of the ultrasound source 400 at a desired target site in the tissue. For example, the positioning device 110 can include a three-axis computer-controlled positioning system. The positioning device 110 can also manipulate the ultrasound source 400 to move the focus 485 to different regions in the tissue to mechanically damage larger portions of the tissue 112. In other embodiments, the system 10 can include additional devices and/or some of the devices may be omitted from the system 10.
[0046] In operation, the ultrasound source 400 is positioned proximate to a volume of tissue 112 (e.g., an organ), and the focus 485 of the ultrasound source 400 is aligned with a target site within the tissue 112 using the positioning device 110. For example, the ultrasound source 400 can be positioned such that its focus 485 is a depth within an ex vivo or in vivo liver, kidney, heart, and/or other tissue mass and aligned with a tumor, cancerous tissue region, and/or other volume of tissue that a clinician would like to mechanically damage. HIFU energy can be delivered from the ultrasound source 400 to the target site in the tissue 112 in a sequence of pulses (e.g., coordinated by the function generator 100 and/or the controller 300) rather than continuous-wave HIFU exposures, which can reduce undesirable thermal effects on the surrounding tissue. Larger target sites can be treated by scanning the focus 485 of the ultrasound source 400 over the treatment region (e.g., using the positioning device 110) while pulsing HIFU energy toward the tissue 112.
[0047] In various embodiments, the system 10 can deliver a pulsing protocol to provide boiling histotripsy that mechanically fractionates the tissue. During boiling histotripsy, the ultrasound source 400 propagates millisecond-long bursts of non-linear HIFU waves toward the focal region 485 in the tissue 112, and the accumulation of the harmonic frequencies produces shock fronts proximate to the focal region 485. This results in rapid heating of tissue and boiling bubbles at the focal region 485 that liquefy and otherwise mechanically damages the tissue 112.
[0048] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with peak positive amplitudes of about 5 MPa to about 100 MPa at the focus 485, about 15 MPa to about 90 MPa at the focus 485, about 25 MPa to about 80 MPa at the focus 485, about 35 MPa to about 70 MPA at the focus 485, or about 45 MPa to about 60 MPa at the focus 485, for example 5 MPa, about 10 MPa, about 15 MPa, about 20 MPa, about 25 MPa, about 30 MPa, about 35 MPa, about 40 MPa, about 45 MPa, about 50 MPa, about 55 MPa, about 60 MPa, about 65 MPa, about 70 MPa, about 75 MPa, about 80 MPa, about 85 MPa, about 90 MPa, about 95 MPa, or about 100 MPa at the focus 485. In other embodiments, the shock wave amplitudes may differ depending, at least in part, on the power driving the ultrasound source 400.
[0049] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with peak negative pressures of about 3 MPa to about 25 MPa at the focus 485, about 5 MPa to about 20 MPa at the focus 485, or about 10 MPa to about 15 MPa at the focus 485, for example about 3 MPa, about 4 MPa, about 5 MPa, about 6 MPa, about 7 MPa, about 8 MPa, about 9 MPa, about 10 MPa, about 11 MPa, about 12 MPa, about 13 MPa, about 14 MPa, about 15 MPa, about 16 MPa, about 17 MPa, about 18 MPa, about 19 MPa, about 20 MPa, about 21 MPa, about 22 MPa, about 23 MPa, about 24 MPa, or about 25 MPa at the focus 485.
[0050] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves including a single frequency of ultrasound energy or more than one frequency of ultrasound energy. In some embodiments, for example, the ultrasound waveform comprises an ultrasound frequency of about 1 MHz to about 3 MHz at the focus 485, or about 1.5 MHz to about 2.5 MHz at the focus 485, for example about 1 MHz, about 1.1 MHz, about 1.2 MHz, about 1.3 MHz, about 1.4 MHz, about 1.5 MHz, about 1.6 MHz, about 1.7 MHz, about 1.8 MHz, about 1.9 MHz, about 2 MHz, about 2.1 MHz, about 2.2 MHz, about 2.3 MHz, about 2.4 MHz, about 2.5 MHz, about 2.6 MHz, about 2.7 MHz, about 2.8 MHz, about 2.9 MHz, or about 3 MHz at the focus 485. In some embodiments, the frequency is selected to provide a focal area that is smaller than the size of the tissue mass or suspected tissue mass and/or to provide an attenuation (e.g., depth) sufficient to contact the tissue mass or suspected tissue mass with the ultrasound energy.
[0051] The function generator 100 is also configured to provide a specific form (e.g., shape, pulse pattern, etc.) to the ultrasound energy. In some embodiments, for example, the function generator 100 is configured to provide an ultrasound energy waveform comprising periodic pulse sequences, non-periodic pulse sequences, or a combination thereof. For example, in some embodiments the function generator 100 is configured to provide an ultrasound energy waveform comprising a sinusoidal waveform. In other embodiments, the function generator 100 is configured to provide an ultrasound energy waveform comprising a square waveform. In still further embodiments, the function generator 100 is configured to provide an ultrasound energy waveform comprising a peaked waveform. In yet other embodiments, the function generator 100 may be configured to provide an ultrasound energy waveform comprising a combination of any of the foregoing.
[0052] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a pulse-average intensity of about 10 kW/cm.sup.2 to about 60 kW/cm.sup.2 at the focus 485, about 20 kW/cm.sup.2 to about 50 kW/cm.sup.2 at the focus 485, or about 30 kW/cm.sup.2 to about 40 kW/cm.sup.2 at the focus 485, for example about 10 kW/cm.sup.2, about 11 kW/cm.sup.2, about 12 kW/cm.sup.2, about 13 kW/cm.sup.2, about 14 kW/cm.sup.2, about 15 kW/cm.sup.2, about 16 kW/cm.sup.2, about 17 kW/cm.sup.2, about 18 kW/cm.sup.2, about 19 kW/cm.sup.2, about 20 kW/cm.sup.2, about 21 kW/cm.sup.2, about 22 kW/cm.sup.2, about 23 kW/cm.sup.2, about 24 kW/cm.sup.2, about 25 kW/cm.sup.2, about 26 kW/cm.sup.2, about 27 kW/cm.sup.2, about 28 kW/cm.sup.2, about 29 kW/cm.sup.2, about 30 kW/cm.sup.2, about 31 kW/cm.sup.2, about 32 kW/cm.sup.2, about 33 kW/cm.sup.2, about 34 kW/cm.sup.2, about 35 kW/cm.sup.2, about 36 kW/cm.sup.2, about 37 kW/cm.sup.2, about 38 kW/cm.sup.2, about 39 kW/cm.sup.2, about 40 kW/cm.sup.2, about 41 kW/cm.sup.2, about 42 kW/cm.sup.2, about 43 kW/cm.sup.2, about 44 kW/cm.sup.2, about 45 kW/cm.sup.2, about 46 kW/cm.sup.2, about 47 kW/cm.sup.2, about 48 kW/cm.sup.2, about 49 kW/cm.sup.2, about 50 kW/cm.sup.2, about 51 kW/cm.sup.2, about 52 kW/cm.sup.2, about 53 kW/cm.sup.2, about 54 kW/cm.sup.2, about 55 kW/cm.sup.2, about 56 kW/cm.sup.2, about 57 kW/cm.sup.2, about 58 kW/cm.sup.2, about 59 kW/cm.sup.2, or about 60 kW/cm.sup.2 at the focus 485.
[0053] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a pulse duration of about 1 microsecond (s) to about 100 milliseconds (ms), about 10 s to about 10 ms, or about 100 s to about 1 ms, for example about 1 s, about 5 s, about 10 s, about 15 s, about 20 s, about 25 s, about 30 s, about 35 s, about 40 s, about 45 s, about 50 s, about 55 s, about 60 s, about 65 s, about 70 s, about 75 s, about 80 s, about 85 s, about 90 s, about 95 s, about 100 s, about 125 s, about 150 s, about 175 s, about 200 s, about 225 s, about 250 s, about 275 s, about 300 s, about 325 s, about 350 s, about 375 s, about 400 s, about 425 s, about 450 s, about 475 s, about 500 s, about 525 s, about 550 s, about 575 s, about 600 s, about 625 s, about 650 s, about 675 s, about 700 s, about 725 s, about 750 s, about 775 s, about 800 s, about 825 s, about 850 s, about 875 s, about 900 s, about 925 s, about 950 s, about 975 s, about 1 ms, about 5 ms, about 10 ms, about 15 ms, about 20 ms, about 25 ms, about 30 ms, about 35 ms, about 40 ms, about 45 ms, about 50 ms, about 55 ms, about 60 ms, about 65 ms, about 70 ms, about 75 ms, about 80 ms, about 85 ms, about 90 ms, about 95 ms, or about 100 ms.
[0054] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a duty cycle of about 0.1% to about 5%, about 0.5% to about 3%, or about 1% to about 2%, for example about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, about 2%, about 2.1%, about 2.2%, about 2.3%, about 2.4%, about 2.8%, about 2.9, about 3%, about 3.1%, about 3.2%, about 3.3%, about 3.4%, about 3.5%, about 3.6%, about 3.7%, about 3.8%, about 3.9%, about 4%, about 4.1%, about 4.2%, about 4.3%, about 4.4%, about 4.5%, about 4.6%, about 4.7%, about 4.8%, about 4.9%, or about 5%.
[0055] The amplifier 200 may also be configured to output an amplified ultrasound energy waveform that is nonlinearly distorted at the focus 485. Further, the amplifier 200 may be configured to output an amplified ultrasound energy waveform having more than one peak pressure.
[0056] In certain embodiments, the function generator 100 can initiate a pulsing protocol to generate shock waves with a peak negative pressure of about 3 MPa to about 25 MPa, a peak positive pressure of about 5 MPa to about 100 MPa, a frequency of about 1 MHz to about 3 MHz, and a pulse duration of about 1 s to about 100 ms. In some embodiments, the waveform further has a duty cycle of about 0.1% to about 5%. In some embodiments, the waveform further is nonlinearly distorted at the focal point.
[0057] The ultrasound source 400 is operatively coupled with one or more components of the system 10 and is configured to administer (e.g., apply, deliver, etc.) the amplified ultrasound energy waveform to a tissue mass or a suspected tissue mass. In some embodiments, such as that shown in
[0058] The transducer head 420 is arranged to provide the amplified ultrasound energy waveform with an adjustable focus. In some embodiments, for example, the transducer head 420 includes an array of transducer elements 425, each of which may be energized in a pattern sufficient to provide the amplified ultrasound energy waveform having a focus located at a preselected distance from the ultrasound source 400.
[0059] Referring to
[0060] In any of the embodiments disclosed herein, the system 10 may be configured to be portable. In such embodiments, the system 10 may further include a battery (not shown) for providing power to the system 10. In further embodiments, one or more of the components of the system 10 may be wirelessly coupled to the other components of the system 10. Additionally, the system 10 may include one or more additional features or the components may have a different arrangement relative to each other.
[0061] Methods of diagnosing and/or treating a tissue mass or suspected tissue mass T may include the use of the systems and/or components described herein (such as the system 10 described above with reference to
[0062] In some embodiments, for example, the tissue mass or suspected tissue mass may be associated with prostate cancer. In such embodiments, the corresponding marker(s) (e.g., biomarker(s)) is also associated with prostate cancer. In some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In some embodiments, the marker is a DNA, an RNA or a protein. In other embodiments, the biomarker is a known prostate cancer biomarker, such as prostate cancer antigen 3 (PCA3) RNA, a TMPRSS2-ERG fusion (e.g., DNA or RNA), a diagnostic androgen receptor (AR) DNA or RNA or protein, a phosphatase and tensin homolog (PTEN) (e.g., a PTEN RNA or DNA), TP53 (p53) RNA or DNA, a Kirsten rat sarcoma viral oncogene homolog (KRAS), an NKX3.1 DNA or RNA, a CDH1 (aka Ecad, E-cadherin) DNA or RNA or protein, an APC DNA or RNA, a BRAF DNA or RNA, an src DNA or RNA, an abl DNA or RNA, an raf DNA or RNA, an erbA DNA or RNA, or an myc DNA or RNA.
[0063] In other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with ovarian cancer. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known ovarian cancer biomarker, such as a TP53 (aka p53) RNA or DNA, BRCA1 or BRCA2 (DNA or RNA), an src DNA or RNA, a raf DNA or RNA, an erbA DNA or RNA, or a myc DNA or RNA.
[0064] In other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with breast cancer. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known breast cancer biomarker, such as a TP53 (aka p53) RNA or DNA, an APC DNA or RNA, a BRAF DNA or RNA, an src DNA or RNA, a raf DNA or RNA, an erbA DNA or RNA, a myc DNA or RNA, BRCA1 or BRCA2 (DNA or RNA), or an HER2/neu (DNA and RNA).
[0065] In still other embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with renal cell carcinoma. In some embodiments, for example, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known renal cell carcinoma biomarker, such as a phosphatase and tensin homolog (PTEN) RNA or DNA, a von Hippel-Lindau syndrome (VHL) DNA or RNA, a TP53 (aka p53) RNA or DNA, an src DNA or RNA, a raf DNA or RNA, or an erbA DNA or RNA.
[0066] In further embodiments, the tissue mass or suspected tissue mass and corresponding marker (e.g., biomarker) may be associated with a uterine fibroid. For example, in some embodiments, the biomarker is hsa-miR-9-5p (SEQ ID NO:1). In some embodiments, the biomarker is hsa-miR-196a-5p (SEQ ID NO:2). In some embodiments, the biomarker is hsa-miR-34c-5p (SEQ ID NO:3). In some embodiments, the biomarker is hsa-miR-129-5p (SEQ ID NO:4). In some embodiments, the biomarker is hsa-miR-100-5p (SEQ ID NO:5). In some embodiments, the biomarker is hsa-miR-16-5p (SEQ ID NO:6). In other embodiments, the biomarker is a known uterine fibroid biomarker, such as gene mediator subcomplex 12 (MED12) DNA or RNA.
[0067] In some embodiments, methods according to the present technology can further include introducing an ultrasound contrast agent to the tissue mass or suspected tissue mass (e.g., by administering an antibody-microbubble conjugate or a peptide-microbubble conjugate to the subject, or by administering a systemic ultrasound contrast agent to the subject) before applying HIFU energy to the target tissue. Without wishing to be bound by theory, the ultrasound contrast agent is expected to enhance the effect of the applied ultrasound energy (e.g., HIFU), for example, by enabling an enhanced amount of a biomarker to be released from the tissue mass or suspected tissue mass.
[0068] When used in conjunction with a therapeutic protocol (e.g., anti-tumor therapies), the present technology is also expected to significantly enhance a clinician's ability to assess and monitor the effectiveness of treatment. For example, when using therapeutic techniques that often require more than one application of a therapy (e.g., radiation), the present technology enables a clinician to apply a first round of therapy to a tissue mass, assess the effectiveness of the therapy by applying an amplified ultrasound energy wave (e.g., HIFU) to the tissue mass and measuring an amount of a selected biomarker in a fluid sample (e.g., a blood sample, such as a fluid and/or non-fluid fraction or derivative of blood like whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate) obtained from the subject, and determine (based on the amount of the biomarker in the fluid sample) whether additional round(s) of therapy are warranted. Because methods according to the current technology cause rapid release of the biomarker from the tissue mass (e.g., within 10 minutes or within 5 minutes), the tissue mass can be conveniently be treated multiple times within a single procedure (e.g., single visit to a treatment clinic).
EXAMPLES
Example 1
[0069] HIFU was applied to prostate cancer tumors implanted under the skin of laboratory rats. Conventional ultrasound imaging was used or image guidance and targeting. Blood samples were collected immediately before and at periodic intervals after HIFU treatment (boiling histotripsy and cavitation regimes), and were tested for the presence of microRNAs (miRNAs) that are associated with rat prostate cancer, shown in Table 1.
TABLE-US-00001 TABLE1 PutativemiRNAbiomarkersequences. miRNA* RNAsequence(humanandrat) miR-9-5p UCUUUGGUUAUCUAGCUGUAUGA (SEQIDNO:1) miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG (SEQIDNO:2) miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC (SEQIDNO:3) miR-129-5p CUUUUUGCGGUCUGGGCUUGC (SEQIDNO:4) miR-100-5p AACCCGUAGAUCCGAACUUGUG (SEQIDNO:5) miR-16-5p UAGCAGCACGUAAAUAUUGGCG (SEQIDNO:6) *Equivalent miRNA species may be referred to herein with or without the 5psuffix.
[0070] The levels of these miRNAs were elevated up to 30-fold within minutes after the ultrasound procedure, and then declined over the course of several hours. The effects on tissue were evaluated in the resected tumors, and only micron-sized areas of hemorrhage scattered through otherwise intact tissue were found when the HIFU was applied as a cavitation regime, suggesting damage to small capillaries. Liquefaction HIFU caused substantial disruption to the tissue in corollary experiments. These data provided the proof of principle for the technology disclosed herein directed to ultrasound-aided liquid molecular biopsy.
Example 2
[0071] Objectives: The ability of ultrasound to stimulate the release of cancer-specific protein biomarkers into the circulation was recently reported, however, physical and biological mechanisms behind it are unclear. In addition, the protein biomarker in that study (carcinoembryonic antigen, CEA) is expressed on the cell surface, thus providing no proof of principal for releasing biomarker molecules from within the cell. Here, the release of a recently established class of intracellular nucleic acid-based cancer biomarkersmicroRNAs (miRNAs)by high intensity focused ultrasound (HIFU) was investigated in a rat prostate cancer model. The benefits of three different HIFU treatment protocols causing localized tissue lysis (histotripsy), bubble-induced reversible permeabilization (cavitation), or mild hyperthermia in stimulation of miRNA release were compared to untreated controls.
[0072] Methods: Copenhagen rats were implanted subcutaneously on the hind limb with the syngeneic MatLyLu prostate cancer cell line. HIFU exposures at 1.1 MHz, optimized for either partial lysis of the tumor tissue or sublethal heating thereof (I.sub.SPPA=120 W/cm.sup.2, 50% duty cycle, 1-minute exposure) were performed in two groups of animals (n=8) after the tumor reached 12 mm in diameter. The control group received sham exposure. Lysis of the tumor tissue was performed using boiling-histotripsy, in which boiling is induced in several milliseconds at the transducer focus by a high amplitude nonlinear HIFU pulse, and the interaction of the boiling bubble with HIFU field leads to tissue emulsification. Blood withdrawals were performed before and immediately after each exposure, and at several post treatment points: 30 minutes, 1, 3 and 24 hours. Specimens were immediately processed into plasma (the cell-free, liquid portion of blood prevented from coagulating), from which miRNA was extracted. Prospective tumor-specific biomarkers were identified by qRT-PCR array profiling of 375 known miRNAs (microRNA Ready-to-Use PCR Panel I, Exiqon) in the cell line, filtering away those known to be broadly expressed in normal tissue or abundant in untreated rat plasma.
[0073] Results: The number of copies of tumor-specific miRNAs (miR-34c, miR-9, miR-129-5p, miR-100, miR-196a) were substantially increased (2-fold to 34-fold) within 15 minutes after HIFU-induced tumor lysis or HIFU-induced cavitation of the tumor tissue, but not after HIFU-induced mild hyperthermia. This increase returned to baseline within 1-3 hours. The concentration of a broadly expressed miR-16 was used as a negative control and did not change significantly.
[0074] This study demonstrates that HIFU-induced localized tissue lysis may be used to enhance the diagnostic yield of the tumor-specific nucleic acid biomarkers, and thus serve as a non-invasive biopsy of undiagnosed tissue masses. Furthermore, these data demonstrate that HIFU-induced cavitation of tumor tissue may be used to enhance the diagnostic yield of the tumor-specific nucleic acid biomarkers, and thus serve as a non-invasive biopsy of undiagnosed tissue masses without common patient risks associated with the histotripsy HIFU regime used to induce localized tissue lysis.
Example 3
[0075] An experiment to determine the effect of HIFU frequency on the lesion shape and size using repetitive millisecond boiling caused by shock wave heating was performed ex vivo using bovine liver tissue. An acrylic water tank at room temperature (20 C.) was filled with purified water that was degassed using a multiple pinhole degasser to 25% of saturation, as measured by a dissolved oxygen meter (WTW Oxi 330i, Weilheim, Germany). The HIFU source used in the majority of the experiments was a single-element, air-backed, custom-built piezoceramic transducer of 2.158 MHz frequency, 44 mm aperture, and focal length (f-number=1). The transducer was driven by a function generator (Agilent 33250A, Agilent, Palo Alto, CA) and a rf amplifier (300 W, ENI A-300, ENI, Rochester, NY). In addition, two other HIFU transducers with frequencies of 1.1 and 3.4 MHz were used in a small set of experiments to investigate the effect of frequency on the resulting tissue damage. The 1.1 MHz source (also 44 mm aperture and focal length) was driven by a separate rf amplifier (1000 W, RFG-1000, JJ&A Instruments, Duvall, WA). The 3.4 MHz transducer (H-102 model, outer aperture 64 mm and focal length 62.6 mm, Sonic Concepts, Bothell, WA) was driven with the same electronics as the 2 MHz source. A timing board (NI 6608, National Instruments, Austin, TX) was used to trigger the function generator for various pulsing protocols and was controlled using a custom Labview program (National Instruments, Austin, TX). The HIFU source was attached to a three-axis positioning system (Velmex Inc., Bloomfield, NY) to align the focus with the desired position within the exposure sample. B-mode ultrasound imaging was performed during experiments using an HDI-1000 scanner with a CL10-5 scanhead (Philips Medical Systems, Bothell, WA). The excitation voltage at the HIFU source was monitored using a 10 Lecroy high-voltage probe in parallel with the HIFU transducer. The voltage was recorded using a digital oscilloscope (LT344, Lecroy, Chestnut Ridge, NY) and fluctuations in the rms voltage were used to indicate the onset of boiling at the focus. The fluctuations in the voltage are caused by transduction of ultrasound energy that is backscattered from boiling bubbles at the focus. A high-speed camera (Fastrax APX-RS, Photron, San Diego, CA) was used simultaneously with the ultrasound imaging system for viewing heating effects and bubbles in transparent gel phantoms. The camera was operated at a pixel resolution of 10241024 and a Nikon 105 mm lens (Nikon, Melville, NY, USA) was used with a bellows extension to obtain a field of view of 10 mm10 mm (10 m/pixel). The frames were recorded at 20,000 frames per second (fps) with a 4 s shutter speed.
[0076] Gel phantoms were prepared using polyacrylamide with 7% bovine serum albumin (BSA). These gels are optically transparent and have similar acoustic properties to tissue except for the attenuation coefficient, which is about three times lower than most tissues (0.15 dB/cm/MHz). Localized heating of the gels causes the BSA to denature and form an opaque region above temperatures of about 60 C. that can be visualized optically. To prepare the samples, the liquid mixture of gel constituents was degassed for 1 h in a desiccant chamber, then poured into a custom mold and polymerized. A 1 mm needle was attached to the mold and placed within the gel for alignment purposes. Tissue samples were prepared from bovine heart or liver tissue. The tissue was obtained from an abattoir on the same day as experiments and stored in phosphate buffered saline and on ice until experiments were performed. The tissue was cut into samples to fit in a custom-designed tissue holder (8 cm wide by 8 cm tall by 2.7 cm deep) and was degassed for 1 h in a desiccant chamber immediately prior to experiments. The heart tissue samples were oriented so that the ultrasound was incident perpendicularly to the muscle fibers. For positioning the HIFU focus at a depth of 12 mm within the sample, a removable pointer was attached to the transducer before each exposure. The pointer was also used to position the ultrasound imaging probe so that the HIFU axis was aligned with the B-mode imaging plane. After exposures, the tissue was sectioned and photographed to observe the lesion morphology.
[0077] For gel phantoms, a fiber-optic probe hydrophone of 100 m diameter and 100 MHz bandwidth (FOPH 2000, RP Acoustics, Leutenbach, Germany) was embedded at the depth of the HIFU focus in the gel before polymerization. Pressure waveforms were measured at increasing source power levels at the spatial maximum of the peak positive pressure. Measured waveforms were deconvolved using the FOPH impulse response provided by the manufacturer and the sensitivity of the FOPH was corrected to account for the slightly different acoustical properties of gel as compared to water.
[0078] Sonications were performed using 1.06, 2.158, and 3.42 MHz transducers. The transducers were operated to produce approximately the same peak positive and negative pressure levels in water as measured with the FOPH. For the 2 MHz transducer, the corresponding power setting was the same as for exposure 3. The equivalent in situ pressure level for each transducer was generated by varying the depth of focus location within the tissue to account for the increase in attenuation with frequency; therefore, the focus was positioned 20, 12, and 6 mm below the tissue surface for the 1, 2, and 3 MHz transducers.
[0079] The exposure parameters at the focus were the same for all three exposures: the in situ focal pressure was p.sup.+=74 MPa, p.sup.=13 MPa, the duty factor was 0.01, and the total HIFU on time was 500 ms. The pulse duration used in all of these experiments was approximately three times longer than the time to initiate boiling for each frequency: 20 ms (1 MHz), 10 ms (2 MHz), and 5 ms (3 MHz).
[0080]
Example 4
[0081] In order to determine if ultrasound stimulation is sufficient for the release of intercellular biomarkers, Copenhagen rats bearing MatLyLu subcutaneous tumors were surgically modified with jugular vein catheters for simplified, repeatable, clean blood draws. HIFU was applied to the modified rats using various regimes shown in Table 2 using a 1.5 MHz transducer, under B-mode guidance, in tank of water.
TABLE-US-00002 TABLE 2 HIFU regimes for rat model studies. Treatment p.sup.+, p.sup., T.sub.p, PRF, Time/ type MPa MPa ms Hz spot, s Liquification 90 17 10 1 30 (histotripsy) Permeabilizaiton 78 16 1 1 30 (cavitation) Mild heating 2.5 2.3 2 250 30 (thermal)
[0082] The modified rats were divided into three separate HIFU treatment groups, according to the ultrasound regimen utilized for treatment: liquification (histotripsy N=11), mild heating (thermal, N=9) and permeabilization (cavitation, N=6), in addition to a mock-treated control group (which did receive anesthesia and other manipulations inherent to the protocol but no ultrasound exposure, N=9). Blood was collected immediately prior to treatment and over a subsequent time course (up to 24 hours).
[0083] Prospective tumor-specific biomarkers were identified by qRT-PCR array profiling (Exiqon) of RNA extracts derived from the grafted cell line and untreated rat plasma. miRNAs that were abundant in untreated rat plasma were filtered from the list of those detected in the cell line (Table 1). To control the pre-analytic variability encountered in plasma due to blood cell contaminants introduced during plasma processing, miRNA biomarker candidates were then filtered against a list of miRNAs known to be abundant in blood cells. This process identified miRNAs miR-9, miR-34c, miR-100, miR-129, and miR-196a as putative, tumor-specific miRNAs in this system.
[0084] As shown in
[0085]
[0086] These data indicate that liquification (histotripsy) HIFU and permeabilization (cavitation) HIFU, but not thermal HIFU, significantly increased prostate cancer biomarker release from prostate tumors in rats.
FURTHER EXAMPLES
[0087] Example 1. A method of diagnosing a disease or an increased risk of a disease in a subject, the method comprising: [0088] applying high intensity focused ultrasound (HIFU) energy to a target mass of the subject to cause release of a marker from the mass; and [0089] thereafter determining a concentration of the marker in a fluid of the subject.
[0090] Example 2. The method of Example 1 wherein the disease is a cancer, and wherein the marker is a DNA, an RNA (e.g., an miRNA), a protein or a small molecule.
[0091] Example 3. The method of Example 1 or Example 2 further comprising determining that the subject has the disease or the increased risk of the disease if the concentration of the marker in the fluid exceeds a threshold value.
[0092] Example 4. The method of Example 3 wherein the threshold value is an amount that is significantly greater than a baseline amount of the marker in fluid determined before applying HIFU energy to the target mass, optionally wherein the threshold value is about 2 times greater than the baseline amount.
[0093] Example 5. The method of any one of Examples 1 to 4, wherein applying HIFU energy to a target mass of the subject is non-invasive.
[0094] Example 6. The method of any one of Examples 1 to 5 wherein applying HIFU energy to a target mass of the subject comprises inducing cavitation bubble activity in tissue of the target mass
[0095] Example 7. The method of any one of Examples 1 to 5 wherein applying HIFU energy to a target mass of the subject comprises inducing boiling histotripsy in tissue of the target mass.
[0096] Example 8. A method of characterizing two or more masses in a subject, the method comprising: [0097] optionally determining a baseline concentration of a first marker and/or a second marker in fluid of the subject; [0098] applying a first high intensity focused ultrasound (HIFU) energy to a first mass of the subject to cause release of a first marker from the mass; [0099] thereafter determining a concentration of the first marker in a first fluid sample of the subject; [0100] after a period of time, applying a second HIFU energy to a second mass of the subject to cause release of a second marker from the mass; [0101] thereafter determining a concentration of the second marker in a second fluid sample of the subject; and [0102] characterizing the first and second masses based, at least in part, on the concentrations of the first and second markers in the first and second fluid samples, respectively.
[0103] Example 9. The method of Example 8 wherein the period of time is sufficient for the concentration of the first marker in fluid of the subject to return to a concentration substantially the same as a baseline concentration of the first marker associated with the fluid before applying the second HIFU energy to the second mass.
[0104] Example 10. The method of Example 9 wherein the period of time is no more than about 2 hours.
[0105] Example 11. The method of Example 9 wherein the period of time is no more than about 1 hour.
[0106] Example 12. The method of Example 9 wherein the period of time is no more than about 20 minutes.
[0107] Example 13. The method of any one of Examples 8 to 12 wherein applying the first HIFU energy to the first mass induces boiling histotripsy (e.g. liquification) in the first mass, and applying the second HIFU energy to the second mass induces boiling histotripsy (e.g. liquification) in the second mass.
[0108] Example 14. The method of any one of Examples 8 to 12, wherein applying the first HIFU energy to the first mass induces cavitation (e.g., permeabilization) in the first mass, and applying the second HIFU energy to the second mass induces cavitation (e.g., permeabilization) in the second mass.
[0109] Example 15. A method of treating a target tissue mass in a subject, the method comprising: [0110] optionally determining a baseline concentration of a biomarker in a fluid sample of the subject; [0111] performing a procedure on the target tissue mass of the subject; [0112] applying high intensity focused ultrasound (HIFU) energy to the target tissue mass; [0113] determining a concentration of the biomarker in a fluid sample of the subject after applying HIFU energy to the target tissue mass; and [0114] repeating the performing, applying, and determining until a concentration of the biomarker in the fluid sample falls below a threshold value.
[0115] Example 16. The method of Example 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 2 hours.
[0116] Example 17. The method of Example 15 wherein a period of time between applying HIFU energy to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 1 hour.
[0117] Example 18. The method of Example 15 wherein a period of time between applying HIFU to the target tissue mass and determining the concentration of the predetermined biomarker is no more than about 20 minutes.
[0118] Example 19. A method of treating two or more tissue masses in a subject, the method comprising: [0119] (a) optionally determining a baseline concentration of a first marker and/or second marker in fluid of the subject; [0120] (b) performing a first procedure on a first tissue mass of the subject; [0121] (c) applying high intensity focused ultrasound (HIFU) energy to the first tissue mass to cause a first marker to release from the first tissue mass; [0122] (d) thereafter, determining a concentration of the first marker in a first fluid sample of the subject; [0123] (e) after a first period of time, performing a second procedure on a second tissue mass of the subject; [0124] (f) applying HIFU energy to the second tissue mass to cause a second marker to release from the second tissue mass; [0125] (g) thereafter, determining a concentration of the second marker in a second fluid sample of the subject; and [0126] (h) after a second period of time, repeating: [0127] (1) steps (b) to (d) if the concentration of the first marker exceeds a first threshold value; [0128] (2) steps (e) to (g) if the concentration of the second marker exceeds a second threshold value; or [0129] (3) steps (b) to (g) if the concentration of the first marker exceeds the first threshold value and the concentration of the second marker exceeds the second threshold value.
[0130] Example 20. The method of Example 19 wherein the first threshold value is significantly greater than the baseline concentration of the first marker in fluid of the subject determined before step (c), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the first marker.
[0131] Example 21. The method of Example 19 or Example 20 wherein the second threshold value is significantly greater than the baseline concentration of the second marker in fluid of the subject determined before step (f), optionally wherein the threshold value is about 2 times greater than the baseline concentration of the second marker.
[0132] Example 22. The method of any one of Examples 19 to 21 wherein applying HIFU energy to the first mass and applying HIFU energy to the second tissue mass induces boiling histotripsy or cavitation.
[0133] Example 23. The method of any one of Examples 19 to 22 wherein the fluid sample is obtained from the subject while applying HIFU energy to the subject.
[0134] Example 24. A method of inducing release of a marker from target tissue of a subject, the method comprising non-invasively applying high intensity focused ultrasound (HIFU) energy to the target tissue.
[0135] Example 25. The method of Example 24 wherein the target tissue is a tumor and the marker is an miRNA.
[0136] Example 26. The method of Example 24 or Example 25 wherein a maximum amount of the marker is released from the target tissue in no more than about 5 minutes after application of the HIFU energy.
[0137] Example 27. The method of Example 24 or Example 25 wherein a maximum amount of the marker is released from the target tissue in no more than about 3 minutes after application of the HIFU energy.
[0138] Example 28. The method of Example 26 or Example 27 wherein the marker is released into a fluid of a subject, and the amount of the marker released from the target tissue is determined by determining a concentration of the marker in a fluid of the subject, wherein the fluid is optionally selected from the group consisting of blood (e.g., fluid and/or non-fluid fractions or derivatives of blood such as whole blood, cells, plasma, serum, microvesicles, and/or cryoprecipitate), plasma, serum, subcellular vesicles, lymph fluid, ascites, urine, cerebrospinal fluid, seminal fluid, breast milk, breast secretions, breast aspirates, and feces.
[0139] Example 29. The method of Example 28 wherein the fluid is blood, a blood fraction, or a blood derivative.
[0140] Example 30. The method of Example 26 or Example 27 wherein the maximum amount of the marker is significantly greater than the baseline amount of the marker in the fluid before application of the HIFU energy, optionally at least about 2 times greater than the baseline amount.
[0141] Example 31. The method of any one of Examples 8 to 13 and 19 to 23 wherein the first marker and the second marker are the same.
[0142] Example 32. The method of any preceding Example wherein the marker comprises SEQ ID NO:1.
[0143] Example 33. The method of any preceding Example wherein the marker comprises SEQ ID NO:2.
[0144] Example 34. The method of any preceding Example wherein the marker comprises SEQ ID NO:3.
[0145] Example 35. The method of any preceding Example wherein the marker comprises SEQ ID NO:4.
[0146] Example 36. The method of any preceding Example wherein the marker comprises SEQ ID NO:5.
[0147] Example 37. The method of any preceding Example wherein the marker comprises SEQ ID NO:6.
[0148] Example 38. The method of any preceding Example wherein the subject is human.
[0149] Example 39. The method of any preceding Example wherein the subject is a non-human animal.
CONCLUSION
[0150] The above detailed descriptions of embodiments of the technology are not intended to be exhaustive or to limit the technology to the precise form disclosed above. Although specific embodiments of, and examples for, the technology are described above for illustrative purposes, various equivalent modifications are possible within the scope of the technology, as those skilled in the relevant art will recognize. For example, while steps are presented in a given order, alternative embodiments may perform steps in a different order. The various embodiments described herein may also be combined to provide further embodiments.
[0151] From the foregoing, it will be appreciated that specific embodiments of the invention have been described herein for purposes of illustration, but well-known structures and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments of the technology. Where the context permits, singular or plural terms may also include the plural or singular term, respectively.
[0152] Moreover, unless the word or is expressly limited to mean only a single item exclusive from the other items in reference to a list of two or more items, then the use of or in such a list is to be interpreted as including (a) any single item in the list, (b) all of the items in the list, or (c) any combination of the items in the list. Additionally, the term comprising is used throughout to mean including at least the recited feature(s) such that any greater number of the same feature and/or additional types of other features are not precluded. It will also be appreciated that specific embodiments have been described herein for purposes of illustration, but that various modifications may be made without deviating from the technology. Further, while advantages associated with certain embodiments of the technology have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the technology. Accordingly, the disclosure and associated technology can encompass other embodiments not expressly shown or described herein.
[0153] Unless the context clearly requires otherwise, throughout the description and the claims, the words comprise, comprising, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of including, but not limited to. Words using the singular or plural number also include the plural and singular number, respectively. Additionally, the words herein, above, and below and words of similar import, when used in this application, shall refer to this application as a whole and not to any particular portions of the application.
[0154] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While the specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize.
[0155] Specific elements of any foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.