A DFL-PRODUCING STRAIN

20240043891 ยท 2024-02-08

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a genetically modified cell expressing an -1,2-fucosyltransferase and an -1,3-fucosyltransferase, and a transporter protein of the major facilitator superfamily (MFS) and to a method for recombinant production of human milk oligosaccharides (HMOs) using said genetically modified cell. More particularly, the invention provides a method for recombinant production of and a genetically modified cell capable of producing difucosyllactose (DFL) as the most abundant HMO, with a relatively low content of 3-fucosyllactose (3FL) and/or 2-fucosyllactose (2FL).

    Claims

    1. A genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said cell comprises a heterologous, recombinant and/or synthetic nucleic acid encoding a. an -1,2-fucosyltransferase, and b. an -1,3-fucosyltransferase, and c. a recombinant transporter protein selected from the major facilitator superfamily (MFS).

    2. The genetically modified cell according to claim 1, wherein the genetically modified cell with the MFS transporter protein produces at least 5% w/w more DFL compared to the same cell without the MFS transporter protein.

    3. The genetically modified cell according to claim 1, wherein the most abundant HMO produced by the genetically modified cell is difucosyllactose (DFL).

    4. The genetically modified cell according to claim 1, wherein more than 60% w/w of the HMOs produced by the cell is difucosyllactose (DFL).

    5. The genetically modified cell according to claim 1, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,2-fucosyltransferase is a futC gene or a wbgL A gene, or a functional homologue thereof.

    6. The genetically modified cell according to claim 1, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,3-fucosyltransferase is a futA gene or a fucT gene or moumou gene, or a functional homologue thereof.

    7. The genetically modified cell according to claim 1, wherein at the most 35% w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL), or 2-fucosyllactose (2FL).

    8. The genetically modified cell according to claim 1, wherein the MFS transporter protein originates from a bacterium selected from the group consisting of Serratia marcescens, Rosenbergiella nectarea, Pantoea vagans, Yersinia frederiksenii and Rouxiella badensis.

    9. The genetically modified cell according to claim 1, wherein the transporter protein is selected from the group consisting of SEQ ID NO: 1 (Marc), SEQ ID NO: 2 (Nec), SEQ ID NO: 3 (Vag), SEQ ID NO: 37 (fred) and SEQ ID NO: 38 (bad) or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 85% or at least 90% identical to SEQ ID NO: 1 (Marc), SEQ ID NO: 2 (Nec), SEQ ID NO: 3 (Vag), SEQ ID NO: 42 (fred) or SEQ ID NO: 43 (bad).

    10. The genetically modified cell according to claim 1, wherein the genetically modified cell is a microbial cell, such as Escherichia coli.

    11. The genetically modified cell according to claim 1, wherein the cell further comprises a heterologous, recombinant and/or synthetic regulatory element selected from the group of a promoter nucleic sequences consisting of a Plac promoter, a PmglB promoter, a and a Pglp promoter, such as PglpF, or any variants thereof.

    12. The genetically modified cell according to claim 11, wherein the regulatory element for the regulation of the expression of the -1,2-fucosyltransferase comprises a promoter nucleic sequence which is PglpF or a variant thereof.

    13. The genetically modified cell according to claim 11, wherein the regulatory element for the regulation of the expression of the -1,3-fucosyltransferase comprises a promoter nucleic sequence which is PmglB or a variant thereof.

    14. A method for the production of one or more HMOs, wherein the HMO produced is primarily difucosyllactose (DFL), the method comprising the steps of: (i) providing a genetically modified cell according to claim 1 (ii) culturing the cell according to (i) in a suitable cell culture medium to produce said HMO; and (iii) harvesting one or more HMOs produced in step (ii).

    15. The method according to claim 14, wherein the method produces at least 5% w/w more DFL compared to the same method wherein the genetically modified cell differs from the cell in step (i) by not expressing the recombinant MFS transporter protein.

    16. The method according to claim 14, wherein at the most 45%, such as at the most 30% w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL) and/or 2-fucosyllactose (2FL).

    17. The method according to claim 14, wherein the culturing of the cell in step (ii) is conducted at low lactose conditions, such as conditions having less than 5 g lactose/1 culture medium.

    18. Use of a genetically modified cell according to claim 1 for the production of one or more HMO, wherein the HMO produced is primarily difucosyllactose (DFL).

    19. A 1,3-fuscosyl transferase with an amino acid sequence that is at least 90%, such as at least 95%, such as at least 98% identical to SEQ ID NO: 38 and which comprises or consists of the following substitutions S46F, A128N, H129E, Y1321, D148G and Y221C.

    20. The 1,3-fuscosyl transferase according to claim 19, wherein the amino acid sequence comprises or consist of SEQ ID NO: 39.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0206] FIG. 1

    [0207] Relative production of 2FL, 3FL, and DFL, in modified E. coli strains producing 2FL, 3FL, or DFL, respectively. The modified E. coli DFL strain overexpresses the -1,2-fucosyltransferase gene, futC and the -1,3-fucosyltransferase gene, futA. The HMO levels are given relatively to the 2FL produced by strain 1. Data is obtained from deep-well fed-batch assay.

    [0208] FIG. 2

    [0209] Relative production of total HMO in a modified E. coli DFL production strain overexpressing the homologous sugar efflux transporter A gene (setA) in strain 4, or the heterologous MFS transporter genes marc, nec, or vag, in strain 5-7, respectively. The HMO levels are shown relatively to the total HMO produced in strain 3. Data is obtained from deep-well fed-batch assay.

    [0210] FIG. 3

    [0211] Relative distribution of 2FL and DFL in a modified E. coli DFL production strain overexpressing the homologous sugar efflux transporter A gene (setA) in strain 4, or the heterologous MFS transporter genes marc, nec, or vag, in strain 5-7, respectively. The relative ratio of DFL and 2FL are shown relatively to the total amount HMO produced by each strain. Data is obtained from deep-well fed-batch assay.

    [0212] FIG. 4

    [0213] Time profiles for the lactose monohydrate concentration in the fermentation broth throughout the two runs at either high lactose (process 1, solid line) or low lactose (process, dotted line) condition using the DFL producing strain 8.

    [0214] FIG. 5

    [0215] Time profiles of the ratio DFL/(2FL+DFL) in % by mass in the fermentation broth throughout the two runs at either high lactose condition (process 1, solid line) or low lactose condition (process 2, dotted line) using strain 8. 3FL is in all cases below1% of the total sum of HMO and therefore negligible.

    [0216] FIG. 6

    [0217] Time profiles of the relative formation of DFL titer in the fermentation broth throughout the two runs at either high lactose condition (process 1, solid line) or low lactose condition (process 2, dotted line) using strain 8. The DFL titer is shown relative to the end point measurement of strain 8 process 2 (low lactose level).

    [0218] FIG. 7

    [0219] Purification steps of the fermentation broth to obtain crystalline DFL. Ultrafiltration (UF) is used to separate biomass from the broth, nanofiltration (NF) to concentrate the broth, ion exchange resin (IEX) to remove salts and activated charcoal (AC) to remove color. Selective DFL crystallization as the final step provides DFL in very high purity.

    ITEMS

    [0220] 1. A genetically modified cell capable of producing one or more Human Milk Oligosaccharides (HMOs), wherein said cell comprises a heterologous, recombinant and/or synthetic nucleic acid encoding [0221] a. an -1,2-fucosyltransferase, and [0222] b. an -1,3-fucosyltransferase,
    wherein 50% w/w or more, such as more than 60% of the HMOs produced by the cell are difucosyllactose (DFL).

    [0223] 2. The genetically modified cell according to item 1, wherein the cell further comprises [0224] c. a heterologous, recombinant and/or synthetic nucleic acid encoding a transporter protein selected from the major facilitator superfamily (MFS).

    [0225] 3. The genetically modified cell according to items 1 or 2, wherein the MFS transporter protein originates from a bacterium selected from the group consisting of Serratia marcescens, Rosenbergiella nectarea, Pantoea vagans, Yersinia frederiksenii and Rouxiella badensis.

    [0226] 4. The genetically modified cell according to any one of the preceding items, wherein the transporter protein is selected from the group consisting of SEQ ID NO: 1 (Marc), SEQ ID NO: 2 (Nec), SEQ ID NO: 3 (Vag), SEQ ID NO: 42 (fred) and SEQ ID NO: 43 (bad) or a functional homologue thereof which amino acid sequence is at least 80%, such as at least 85% or at least 90% identical to SEQ ID NO: 1 (Marc), SEQ ID NO: 2 (Nec), SEQ ID NO: 3 (Vag), SEQ ID NO: 42 (fred) or SEQ ID NO: 43 (bad).

    [0227] 5. The genetically modified cell according to any one of the preceding items, wherein the genetically modified cell with the MFS transporter protein produces at least 5% w/w more DFL compared to the same cell without the MFS transporter protein.

    [0228] 6. The genetically modified cell according to any one of the preceding items, wherein 65%, such as 70% w/w or more of the HMOs produced by the cell are difucosyllactose (DFL).

    [0229] 7. The genetically modified cell according to any one of any one of the preceding items, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,2-fucosyltransferase is a futC gene or a wbgL A gene, or a functional homologue thereof.

    [0230] 8. The genetically modified cell according to item 7, wherein the futC gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 37 or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 37 and the wbgL gene comprises or consists of the amino acid sequence of NCBI accession nr ADN43847, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of NCBI accession nr ADN43847.

    [0231] 9. The genetically modified cell according to any one of the preceding items, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,3-fucosyltransferase is a futA gene or a fucT gene or moumou gene, or a functional homologue thereof.

    [0232] 10. The genetically modified cell according to item 9, wherein the futA gene encodes an amino acid sequence comprising or consisting the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39 or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39 and the fucT gene encodes an amino acid sequence comprising or consisting the amino acid sequence of SEQ ID NO: 40, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 40 and the moumou gene encodes an amino acid sequence comprising or consisting the amino acid sequence of SEQ ID NO: 54, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 54.

    [0233] 11. The genetically modified cell according to any one of the preceding items, wherein the heterologous, recombinant and/or synthetic nucleic acid encoding an -1,3-fucosyltransferase is the fucT gene encoding an amino acid sequence of SEQ ID NO: 40, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 40.

    [0234] 12. The genetically modified cell according to any one of the preceding items, wherein the heterologous, recombinant and/or synthetic nucleic acid encoding an -1,3-fucosyltransferase is the futA gene encoding an amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39 or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39.

    [0235] 13. The genetically modified cell according to any one of the preceding items the ratio of the active fucosyltransfeases, -1,2-fucosyltransferase to -1,3-fucosyltransferase is in the range from 1:1 to 2:5, such as 1:1, 1:2, 1:3; 1:4, 1:5, 2:3 or 2:5.

    [0236] 14. The genetically modified cell according to item 13, where in the FutC:FutA ratio is 1:3 or 2:3.

    [0237] 15. The genetically modified cell according to item 12, wherein the cell further comprises a heterologous, recombinant and/or synthetic nucleic acid encoding the -1,2-fucosyltransferase FutC and a heterologous, recombinant and/or synthetic nucleic acid encoding a MFS transporter or a functional homologue thereof selected from Item 4.

    [0238] 16. The genetically modified cell according to item 11, wherein the cell further comprises a heterologous, recombinant and/or synthetic nucleic acid encoding the -1,2-fucosyltransferase FutC and a heterologous, recombinant and/or synthetic nucleic acid encoding a nec or marc MFS transporter or a functional homologue thereof from Item 4.

    [0239] 17. The genetically modified cell according to any one of the preceding items, wherein at the most 45%, such as at most 35%, w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL), or 2-fucosyllactose (2FL).

    [0240] 18. The genetically modified cell according to any one of the preceding items, wherein at the most 30% w/w, such as at the most 20% w/w, at the most 15% w/w, at the most 10% w/w, at the most 5% w/w, at the most 2.5% w/w, or at the most 1% w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL).

    [0241] 19. The genetically modified cell according to any one of the preceding items, wherein at the most 30% w/w, such as at the most 20% w/w, at the most 15% w/w, at the most 10% w/w, at the most 5% w/w, at the most 2.5% w/w, or at the most 1% w/w of the total amount of the HMOs produced in the cell is 2-fucosyllactose (2FL).

    [0242] 20. The genetically modified cell according to any one of the preceding items, wherein the genetically modified cell is a microbial cell.

    [0243] 21. The genetically modified cell according to any one of the preceding items, wherein the genetically modified cell is Escherichia coli.

    [0244] 22. The genetically modified cell according to any one of the preceding items, wherein the cell further comprises a heterologous, recombinant and/or synthetic regulatory element comprising a nucleic sequence for the regulation of the expression of the heterologous, recombinant and/or synthetic nucleic acid.

    [0245] 23. The genetically modified cell according to item 22, wherein the regulatory element for the regulation of the expression of the heterologous, recombinant and/or synthetic nucleic acid comprises a promoter nucleic sequence such as a lac promoter, Plac, or a mglB promoter, PmglB, or a glp promoter, PglpF, or any variation thereof.

    [0246] 24. The genetically modified cell according to item 23, wherein the regulatory element for the regulation of the expression of the -1,2-fucosyltransferase in the heterologous, recombinant and/or synthetic nucleic acid comprises a promoter nucleic sequence which is PglpF or a variant thereof.

    [0247] 25. The genetically modified cell according to item 24, wherein the PglpF promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 29 or a nucleic acid sequence which is at least 90%, such as 95% identical to SEQ ID NO: 29.

    [0248] 26. The genetically modified cell according to item 22 or 23, wherein the regulatory element for the regulation of the expression of the -1,3-fucosyltransferase in the heterologous, recombinant and/or synthetic nucleic acid comprises a promoter nucleic sequence which is PmglB or a variant thereof.

    [0249] 27. The genetically modified cell according to item 26, wherein the PmglB promoter is a variant which comprises or consists of the nucleic acid sequence of SEQ ID NO: 4 or a nucleic acid sequence which is at least 90%, such as 95% identical to SEQ ID NO: 4.

    [0250] 28. A method for the production of one or more oligosaccharides, wherein 50% w/w, such as 70% w/w or more of the HMOs produced in the cell is difucosyllactose (DFL), the method comprising the steps of: [0251] (i) providing a genetically modified cell capable of producing an HMO, wherein said cell comprises a heterologous, recombinant and/or synthetic nucleic acid encoding [0252] a. an -1,2-fucosyltransferase, and [0253] b. an -1,3-fucosyltransferase, and [0254] (ii) culturing the cell according to (i) in a suitable cell culture medium to produce said HMO; and [0255] (iii) harvesting one or more HMOs produced in step (ii).

    [0256] 29. The method according to item 28, wherein said cell further comprises a heterologous, recombinant and/or synthetic nucleic acid encoding a transporter protein selected from the major facilitator superfamily (MFS).

    [0257] 30. The method according to Item 29, wherein the genetically modified cell with a heterologous, recombinant and/or synthetic nucleic acid encoding a MFS transporter protein produces at least 5% w/w more DFL compared to the same cell without the MFS transporter protein.

    [0258] 31. The method according to item 28 to 30, wherein 65%, such as 70% w/w or more of the HMOs produced by the cell is difucosyllactose (DFL).

    [0259] 32. The method according to item 28 to 31, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,2-fucosyltransferase is a futC gene or a wbgL gene, or a functional homologue thereof.

    [0260] 33. The method according to item 32, wherein the futC gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 37 or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 37 and the wbgL gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of NCBI accession nr ADN43847, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of NCBI accession nr ADN43847.

    [0261] 34. The method according to item 28 to 33, wherein said heterologous, recombinant and/or synthetic nucleic acid encoding an -1,3-fucosyltransferase is a futA gene or a fucT gene or moumou gene, or a functional homologue thereof.

    [0262] 35. The method according to item 34, wherein the futA gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39 or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 38 or SEQ ID NO: 39 and the fucT gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 40, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 40 and the moumou gene encodes an amino acid sequence comprising or consisting of the amino acid sequence of SEQ ID NO: 54, or a functional homologue thereof which is at least 90% identical to the amino acid sequence of SEQ ID NO: 54.

    [0263] 36. The method according to any one of items 28 to 35, wherein at the most 30% w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL) or 2-fucosyllactose (2FL).

    [0264] 37. The method according to any one of items 28 to 36, wherein at the most 30%, such as at the most 20% w/w, at the most 15% w/w, at the most 10% w/w, at the most 5% w/w, at the most 2.5% w/w, or at the most 1% w/w of the total amount of the HMOs produced in the cell is 3-fucosyllactose (3FL).

    [0265] 38. The method according to any one of items 28 to 37, wherein at the most 30%, such as at the most 20% w/w, at the most 15% w/w, at the most 10% w/w, at the most 5% w/w, at the most 2.5% w/w, or at the most 1% w/w of the total amount of the HMOs produced in the cell is 2-fucosyllactose (2FL).

    [0266] 39. The method according to anyone of items 28 to 38, wherein the culturing of the cell in step (ii) is conducted at low lactose conditions.

    [0267] 40. The method according to item 39, wherein the culturing of the cell in step (ii) is conducted at conditions having <5 g lactose/l culture medium.

    [0268] 41. Use of a genetically modified cell according to any one of items 1 to 27 for the production of one or more HMO, wherein at least 65% w/w, such as 70% w/w or more of the HMOs produced in the cell is difucosyllactose (DFL).

    [0269] 42. A 1,3-fuscosyl transferase with an amino acid sequence that is at least 90%, such as at least 95%, such as at least 98% identical to SEQ ID NO: 38 and which comprises or consists of the following substitutions S46F, A128N, H129E, Y1321, D148G and Y221C.

    [0270] 43. The 1,3-fuscosyl transferase according to item 42, wherein the amino acid sequence comprises or consist of SEQ ID NO: 39.

    [0271] 44. The 1,3-fuscosyl transferase according to item 42 or 43, wherein the 1,3-fuscosyl transferase is encoded by the nucleotide sequence of SEQ ID NO: 32.

    EXAMPLES

    [0272] Materials and Methods

    [0273] Unless otherwise noted, standard techniques, vectors, control sequence elements, and other expression system elements known in the field of molecular biology are used for nucleic acid manipulation, transformation, and expression. Such standard techniques, vectors, and elements can be found, for example, in: Ausubel et al. (eds.), Current Protocols in Molecular Biology (1995) (John Wiley & Sons); Sambrook, Fritsch, & Maniatis (eds.), Molecular Cloning (1989) (Cold Spring Harbor Laboratory Press, NY); Berger & Kimmel, Methods in Enzymology 152: Guide to Molecular Cloning Techniques (1987) (Academic Press); Bukhari et al. (eds.), DNA Insertion Elements, Plasmids and Episomes (1977) (Cold Spring Harbor Laboratory Press, NY); Miller, J. H. Experiments in molecular genetics (1972) (Cold spring Harbor Laboratory Press, NY)

    [0274] The embodiments described below are selected to illustrate the invention and are not limiting the invention in any way.

    [0275] Media

    [0276] The Luria Broth (LB) medium was made using LB Broth Powder, Millers (Fisher Scientific) and LB agar plates were made using LB Agar Powder, Millers (Fisher Scientific). When appropriated ampicillin ((100 g/mL) or any appropriated antibiotic), and/or chloramphenicol (20 g/mL) was added.

    [0277] Basal Minimal medium had the following composition: NaOH (1 g/L), KOH (2.5 g/L), KH.sub.2PO.sub.4 (7 g/L), NH.sub.4H.sub.2PO.sub.4 (7 g/L), Citric acid (0.5 g/l), Trace mineral solution (5 mL/L). The trace mineral stock solution contained: ZnSO.sub.4*7H.sub.2O 0.82 g/L, Citric acid 20 g/L, MnSO.sub.4*H.sub.2O 0.98 g/L, FeSO.sub.4*7H.sub.2O 3.925 g/L, CuSO.sub.4*5H.sub.2O 0.2 g/L. The pH of the Basal Minimal Medium was adjusted to 7.0 with 5 N NaOH and autoclaved. Before inoculation, the Basal Minimal medium was supplied with 1 mM MgSO.sub.4, 4 g/mL thiamine, 0.5% of a given carbon source (glucose or glycerol (Carbosynth)). Thiamine, and antibiotics, were sterilized by filtration. All percentage concentrations for glycerol are expressed as v/v and for glucose as w/v.

    [0278] M9 plates containing 2-deoxy-galactose had the following composition: 15 g/L agar (Fisher Scientific), 2.26 g/L 5 M9 Minimal Salt (Sigma-Aldrich), 2 mM MgSO.sub.4, 4 g/mL thiamine, 0.2% glycerol, and 0.2% 2-deoxy-D-galactose (Carbosynth).

    [0279] MacConkey indicator plates had the following composition: 40 g/L MacConkey agar Base (BD Difco) and a carbon source at a final concentration of 1%.

    [0280] Cultivation

    [0281] Unless otherwise noted, E. coli strains were propagated in Luria-Bertani (LB) medium containing 0.2% glucose at 37 C. with agitation. Agar plates were incubated at 37 C. overnight.

    [0282] Chemical Competent Cells and Transformations

    [0283] E. coli was inoculated from LB plates in 5 mL LB containing 0.2% glucose at 37 C. with shaking until OD6000.4. 2 mL culture was harvested by centrifugation for 25 seconds at 13.000 g. The supernatant was removed and the cell pellet resuspended in 600 L cold TB solutions (10 mM PIPES, 15 mM CaCl.sub.2, 250 mM KCl). The cells were incubated on ice for 20 minutes followed by pelleting for 15 seconds at 13.000 g. The supernatant was removed and the cell pellet resuspended in 100 L cold TB solution. Transformation of plasmids were done using 100 L competent cells and 1 to 10 ng plasmid DNA. Cells and DNA were incubated on ice for 20 minutes before heat shocking at 42 C. for 45 seconds. After 2 min incubation on ice 400 L SOC (20 g/L tryptone, 5 g/L Yeast extract, 0.5 g/L NaCl, 0.186 g/L KCl, 10 mM MgCl.sub.2, 10 mM MgSO.sub.4 and 20 mM glucose) was added and the cell culture was incubated at 37 C. with shaking for 1 hour before plating on selective plates.

    [0284] Plasmids were transformed into TOP10 chemical competent cells at conditions recommended by the supplier (ThermoFisher Scientific).

    [0285] DNA Techniques

    [0286] Plasmid DNA from E. coli was isolated using the QIAprep Spin Miniprep kit (Qiagen). Chromosomal DNA from E. coli was isolated using the QIAmp DNA Mini Kit (Qiagen). PCR products were purified using the QIAquick PCR Purification Kit (Qiagen). DreamTaq PCR Master Mix (Thermofisher), Phusion U hot start PCR master mix (Thermofisher), USER Enzym (New England Biolab) were used as recommended by the supplier. Primers were supplied by Eurofins Genomics, Germany. PCR fragments and plasmids were sequenced by Eurofins Genomics. Colony PCR was done using DreamTaq PCR Master Mix in a T100 Thermal Cycler (Bio-Rad).

    TABLE-US-00002 TABLE2 Oligosusedforamplificationofplasmidbackbones,promoterelements,andgenesof interest(colonicacidgenes,futA_mut4,futC,setA,marc,necandvag) SEQ Name IDNO OligonucleotideSequence5-3 Description O48 5 CCCAGCGAGACCTGACCGCAGAAC galK.for O49 6 CCCCAGTCCATCAGCGTGACTACC galK.rev O40 7 ATTAACCCUCCAGGCATCAAATAAAACGAAAGGC Backbone.for O79 8 ATTTGCGCAUCACCAATCAAATTCACGCGGCC Backbone.rev OL-0550 9 TCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG wcaJ::PglpF.for CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGA GCGCAATGCGCAAATGCGGCACGCCTTGCAGATTA CG OL-0511 10 TTTTTCCAGCAGAAACTCTGCCAGGTAAGAACCGTC wcaJ::PglpF.rev TTGTCCGGTTACACCGGTGATGAGAGCGACTTTTGA CATAGCTGTTTCCTCCTTGGTTAATGTTTGTTGTATG CG O261 11 ATGCGCAAAUGCGGCACGCCTTGCAGATTACG PglpF.for O262 12 AGCTGTTUCCTCCTTGGTTAATGTTTGTTGTATGCG PglpF.rev O364 13 ATGCGCAAAUTGCGTCGCCATTCTGTCGCAACACG PmglB_70UTR_SD4. CC for O459 14 AGCTGTTUCCTAGTTGGTTAATGTTTGTTGTATGCG PmglB_70UTR_SD4. rev O342 15 AAACAGCUATGTCAAAAGTCGCTCTCATCACCGG CA.for O126 16 AGGGTTAAUTGCGCGTTACTCGTTCAGCAACGTCAG CA.rev C O123 17 AAACAGCUATGGCGTTCAAAGTGGTCCAAATC futC.for O124 18 AGGGTTAAUTGCGCGTTAGCCCAGCGCGTTATATTT futC.rev CTG KABY528 19 AAACAGCUATGTTCCAACCGCTGCTGGACG futA_mut4.for KABY568 20 AGGGTTAAUTTACAGACCCAGTTTTTTGACCAGTTTA futA_mut4.rev CG O449 21 AAACAGCUATGATCTGGATAATGACGAT setA.for O450 22 AGGGTTAAUTCAAACGTCTTTAACCTTTGCGG setA.rev O737 23 AAACAGCUATGCAGCGTCTGAGCCGTCTGAG marc.for O738 24 AGGGTTAAUTTAAACTTCACGCACTTTCGCGC marc.rev O741 25 AAACAGCUATGCAGAGCTTCACCCCGCC nec.for O742 26 AGGGTTAAUTTACGCCTGCTCTTTAACACGCAGC nec.rev KABY745 27 AAACAGCUATGAAGAGCCTGCTGACCCGTAAAC vag.for KABY746 28 AGGGTTAAUTTAAACGTTTTTCACACGCGCG vag.rev KABY733 48 AAACAGCUATGAAGAGCGCGCTGACCTTCAG fred.for KABY734 49 AGGGTTAAUTTACGCTTCACGCACACGCG fred.rev KABY729 50 AAACAGCUATGAGCAGCCGTCGTCTGAGC bad.for KABY730 51 AGGGTTAAUTTACACGTTTTTAACACGGGTCATCAG bad.rev KABY721 52 AAACAGCUATGAAGAGCGCGCTGACCTTTAGC yberC.for KABY722 53 AGGGTTAAUTTACGCCTCACGCACACGCG yberC.rev

    TABLE-US-00003 TABLE3 TheheterologousproteinsexpressedintheHMO-producingcells ProteinGenBank SEQ Gene OriginofGenes AccessionNumber IDNO ProteinFunction futC* Helicobacterpylori26695 WP_080473865.1 37 alpha-1,2-fucosyl- transferase futA** Helicobacterpylori26695 WP_000487428.1 38 alpha-1,3-fucosyl- transferase fucT HelicobacterpyloriNCTC11639 AAB81031.1 40 alpha-1,3-fucosyl- transferase moumou Acanthamoebapolyphaga YP_007354660 54 alpha-1,3-fucosyl- moumouvirus transferase setA Escherichiacoli YP_025293 41 Sugarefflux transporter marc Serratiamarcescens WP_060448169.1 1 MFStransporter nec Rosenbergiellanectarea WP_092672081.1 2 MFStransporter vag Pantoeavagans WP_048785139.1 3 MFStransporter Fred Yersiniafrederiksenii WP_087817556.1 42 MFStransporter Bad Rouxiellabadensis WP_017489914.1 43 MFStransporter yberC Yersiniabercovieri EEQ08298.1 44 MFStransporter *FutC used herein has two additional amino acids (LG) at C-terminus **futA mut4 has 6 amino acid modification: S46F A128N H129E Y132I D148G Y221C (SEQ ID NO: 39).

    [0287] Alternative alpha 1,2-fucosyl transferases are wbgL from E. coli 0126 (NCBI accession nr ADN43847, disclosed in WO 2016/120448, hereby incorporated by reference) or fucT2 from Helicobacter pylori (NCBI ref AAC99764 hereby incorporated by reference).

    TABLE-US-00004 TABLE4 ThesyntheticDNAutilizedinthistheHMO-producingcells Sequence SEQ name IDNO Description Reference PmglB_70 4 Promoter:203-nucleotideDNAexpressionelement WO2020255054 UTR_SD4 PglpF 29 Promoter:300-nucleotideDNAexpressionelement WO2019123324 CA 30 CAoperon:6.706-nucleotidefragmentcontaininggenes WO2019123324 gmd-wcaG-wcaH-wcal-manC-manB futC 31 alpha-1,2-fucosyl-transferaseencodingsequence: WO2019123324 909-nucleotidefragmentcontaininggenefutC futA_mut4 32 alpha-1,3-fucosyl-transferaseencodingsequence: 1.278-nucleotidefragmentcontaininggenefutA_mut4 setA 33 Sugareffluxtransporterencodingsequence NCBI:CP032679 1.179-nucleotidefragmentcontaininggenesetA position77620- 78798 marc 34 MFStransporterencodingsequence: WO2021148614 1.197nucleotidefragmentcontaininggenemarc, nec 35 MFStransporterencodingsequence: WO2021148615 1.185nucleotidefragmentcontaininggenenec, vag 36 MFStransporterencodingsequence: WO2021148611 1.179nucleotidefragmentcontaininggenevag, Fred 45 MFStransporterencodingsequence: WO2021148620 1.182nucleotidefragmentcontaininggenefred Bad 46 MFStransporterencodingsequence: WO2021148618 1.164nucleotidefragmentcontaininggenebad yberC 47 MFStransporterencodingsequence: WO2021148610 1.185nucleotidefragmentcontaininggeneyberc

    [0288] Construction of Plasmids

    [0289] Plasmid backbones containing two I-Scel endonuclease sites, separated by two DNA fragments appropriated for homologous recombination into the E. coli genome and a T1 transcriptional terminator sequence were synthesized. For example, in one plasmid backbone the gal operon (required for homologous recombination in galK), and a T1 transcriptional terminator sequence (pUC57::gal) was synthesized (GeneScript). The DNA sequences used for homologous recombination in the gal operon covered base pairs 3.628.621-3.628.720 and 3.627.572-3.627.671 in sequence Escherichia coli K-12 MG155 complete genome GenBank: ID: CP014225.1. Insertion by homologous recombination would result in a deletion of 949 base pairs of galK and a galK-phenotype. In similar ways, backbones based on pUC57 (GeneScript) or an any other appropriated vector containing two I-Scel endonuclease sites, separated by two DNA fragments appropriated for homologous recombination into the E. coli genome and a T1 transcriptional terminator sequence could be synthesized. Standard techniques well-known in the field of molecular biology were used for designing of primers and amplification of specific DNA sequences of the Escherichia coli K-12 DH1 chromosomal DNA.

    [0290] Chromosomal DNA obtained from E. coli K-12 DH1 was used to amplify a 300 bp DNA fragment containing the promoter PglpF using oligos 0261 and 0262 (Table 2) (described in WO2019123324).

    [0291] A synthetic promoter element was constructed by fusion of the mglB promoter to the 70UTR_SD4 sequence of PglpF_SD4 resulted in a 203 bp promoter element, PmglB_70UTR_SD4 (Table 3, described in PCT/IB2020/055773). This promoter element was amplified using oligos 0364 and 0459 (Table 2).

    [0292] Chromosomal DNA obtained from E. coli K-12 DH1 was used to amplify a 6.706 bp DNA fragment containing the colonic acid genes gmd-wcaG-wcaH-wcaI-manC-manB (Table 3) using oligos 0342 and 0126 (Table 2).

    [0293] A 909 bp DNA fragment containing a codon optimized version of the futC gene originating from Helicobacter pylori 26695 was synthesised by GeneScript (Table 4). The futC gene was amplified by PCR using oligos 0123 and 0124 (Table 2).

    [0294] A 1.278 bp DNA fragment containing a codon optimised version of the futA gene including eight modified base pairs was synthesised by GeneScript (Table 4). The futA_mut4 was amplified by PCR using oligos KABY528 and KABY568 (Table 2). The futA gene originates from Helicobacter pylori 26695.

    [0295] A 1.179 bp DNA fragment containing setA originating from Escherichia coli K-12 DH1 (Table 4) was amplified by PCR using chromosomal DNA from Escherichia coli K-12 DH1 and oligos 0499 and 0450 (Table 2).

    [0296] A 1.197 bp DNA fragment containing a codon optimized version of the marc gene originating from Serratia marcescens was synthesized by GeneScript (Table 4). The marc gene was amplified by PCR using oligos 0737 and 0738 (Table 2).

    [0297] A 1.185 bp DNA fragment containing a codon optimized version of the nec gene originating from Rosenbergiella nectarea was synthesized by GeneScript (Table 4). The nec gene was amplified by PCR using oligos 0741 and 0742 (Table 2).

    [0298] A 1.179 bp DNA fragment containing a codon optimized version of the vag gene originating from Pantoea vagans was synthesized by GeneScript (Table 4). The vag gene was amplified by PCR using oligos KABY745 and KABY746 (Table 2).

    [0299] A 1.182 bp DNA fragment containing a codon optimized version of the fred gene, originating from Yersinia frederiksenii was synthesized by Genescript (Table 4). The fred gene was amplified using oligos KABY733 and KABY734 (Table 2).

    [0300] A 1.182 bp DNA fragment containing a codon optimized version of the bad gene, originating from Rouxiella badensis was synthesized by Genescript (Table 4). The bad gene was amplified using oligos KABY729 and KABY730 (Table 2).

    [0301] A 1.185 bp DNA fragment containing a codon optimized version of the yberC gene originating from Yersinia bercovieri was synthesized by GeneScript (Table 4). The yberC gene was amplified by PCR using oligos KABY721 and KABY722 (Table 2).

    [0302] All PCR fragments (plasmid backbones, promoter elements and genes of interest were purified, and plasmid backbones, promoter elements, and genes of interest were assembled. The plasmids were cloned by standard USER cloning. Cloning in any appropriated plasmid could be done using any standard DNA cloning techniques. The plasmids were transformed into TOP10 cells and selected on LB plates containing 100 g/mL ampicillin (or any appropriated antibiotic) and 0.2% glucose. The constructed plasmids were purified and the promoter sequence and the 5end of the gene of interest was verified by DNA sequencing (MWG Eurofins Genomics). In this way, a genetic cassette containing any promoter of interest fused to any gene of interest was constructed and used for chromosomal integration by homologous recombineering.

    [0303] Construction of Strains

    [0304] The bacterial strain used, MDO, was constructed from Escherichia coli K-12 DH1. The E. coli K-12 DH1 genotype is: F.sup., .sup., gyrA96, recA1, relA1, endA1, thi-1, hsdR17, supE44. In addition to the E. coli K-12 DH1 genotype MDO has the following modifications: lacZ: deletion of 1.5 kbp, lacA: deletion of 0.5 kbp, nanKETA: deletion of 3.3 kbp, melA: deletion of 0.9 kbp, wcaJ: deletion of 0.5 kbp, mdoH: deletion of 0.5 kbp, and insertion of Plac promoter upstream of the gmd gene. Below is a description of the strain construction used in the present Examples. A summary of the strains can be found in table 5.

    [0305] The plasmids containing the expression cassettes, PglpF-gmd-wcaG-wcaH-wcaI-manC-manB, PglpF-futC, PglpF-futA_mut4, Pmg18_70UTR_SD4-futC, PglpF-setA, PglpF-marc, PglpF-nec, or PglpF-vag were integrated into the chromosomal DNA by homologues recombineering as described in WO2019123324. Briefly, for integration in the chromosomal DNA the helper plasmid, pACBSR, and the donor plasmid containing the expression cassettes (as described above) were co-transformed into MDO and selected on LB plates containing 0.2% glucose, ampicillin (100 g/ml) or kanamycin (50 mg/mL) and chloramphenicol (20 pg/ml). A single colony was inoculated in 1 ml LB containing chloramphenicol (20 pg/ml) and 10 l of 20% L-arabinose and incubated at 37 C. with shaking for 7-8 hours. Selection for insertion in the galK loci was done by plating on M9-DOG plates and incubated at 37 C. for 48 hours. Single colonies formed on MM-DOG plates were re-streaked on LB plates containing 0.2% glucose and incubated for 24 hours at 37 C. Colonies that appeared white on MacConkey-galactose agar plates and were sensitive for both ampicillin and chloramphenicol were expected to have lost the donor and the helper plasmid, and contain an insertion in the galK loci. Insertions in the galK site was identified by colony PCR using primers 048 and 049 located outside the galK loci. Chromosomal DNA was purified, the galK locus was amplified using primers 048 and 049 and the inserted DNA was verified by sequencing (Eurofins Genomics, Germany). A number of genetic cassettes were integrated into several specific loci in the chromosomal DNA using homologous DNA located upstream and downstream of the integration site of interest.

    [0306] Strain 1 was constructed by inserting one genetic expression cassette containing PglpF fused to the colonic acid operon gmd-wcaG-wcaH-wcaI-manC-manB and inserting two genetic expression cassettes containing PglpF fused to futC into the chromosomal DNA of strain MDO. The lacI gene was replacement with a marker gene by homologous recombineering. The marker gene in lacI was removed again by homologous recombination resulting in scar-less removal of the lacI gene.

    [0307] Strain 2 was constructed by replacing Plac located upstream of gmd with PglpF. First a marker gene replaced the Plac element by homologous recombineering and secondly the marker gene was replaced by PglpF by homologous recombineering using a dsDNA fragment constructed by PCR using oligos OL-0550 and OL-0511 on a DNA fragment containing PglpF. Furthermore, three genetic expression cassettes containing PglpF fused to futA_mut4, and one genetic expression cassette containing PglpF fused to marc were inserted at specific loci in the chromosomal DNA of strain MDO. The lacI gene was replacement with a marker gene by homologous recombineering. The marker gene in lacI was removed again by homologous recombination resulting in scar-less removal of the lacI gene.

    [0308] Strain 3 was constructed as strain 2 except that Pmg18_70UTR_SD4 fused to futC was inserted into the chromosomal DNA of strain MDO instead of PglpF-marc.

    [0309] Strain 4 was constructed by inserting one genetic expression cassette containing PglpF fused to setA into the chromosome of strain 3.

    [0310] Strain 5 was constructed by inserting one genetic expression cassette containing PglpF fused to marc into the chromosome of strain 3.

    [0311] Strain 6 was constructed by inserting one genetic expression cassette containing PglpF fused to nec into the chromosome of strain 3.

    [0312] Strain 7 was constructed by inserting one genetic expression cassette containing PglpF fused to vag into the chromosome of strain 3.

    [0313] Strain 8 was constructed by inserting one genetic expression cassette containing PglpF fused to futC into the chromosome of strain 2.

    [0314] Strain 9 was constructed by inserting one genetic expression cassette containing PglpF fused to fred into the chromosome of strain 3.

    [0315] Strain 10 was constructed by inserting one genetic expression cassette containing PglpF fused to bad into the chromosome of strain 3.

    [0316] Strain 11 was constructed by inserting one genetic expression cassette containing PglpF fused to YberC into the chromosome of strain 3.

    [0317] Strain 12 was constructed by transformation of a kanamycin resistant pTOPO plasmid construct comprising the 1,3-fucosyltransferase, futA, under control of the PglpF promoter and a transcriptional terminator (pl-futA-mut4), into strain 1A (2-FL strain with the nec transporter).

    [0318] Strain 13 was constructed by transformation of a kanamycin resistant pTOPO plasmid construct comprising the 1,3-fucosyltransferase, fucT, under control of the PglpF promoter and a transcriptional terminator (pl-fucT) into strain 1A (2-FL strain with the nec transporter).

    [0319] Strain 14 was constructed by transformation of a kanamycin resistant pTOPO plasmid construct comprising the 1,3-fucosyltransferase, moumou (table 1), under control of the PglpF promoter and a transcriptional terminator (pl-moumou), into strain 1A (2-FL strain with the nec transporter).

    [0320] Strain 15 was constructed by transformation of a kanamycin resistant pTOPO plasmid construct comprising the 1,3-fucosyltransferase, fucT, under control of the PglpF promoter and a transcriptional terminator (pl-fucT), into strain 1B (2-FL strain with the marc transporter).

    TABLE-US-00005 TABLE5 Strainconstructions StrainIDs Product RelevantGenotype DH1 F.sup..sup.endA1recA1relA1gyrA96thi-1glnV44hsdR17(r.sub.K.sup.m.sub.K.sup.) MDO EcoliDH1lacZlacAnanKETAmelAwcaJmdoH Strain1 2FL MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futC Strain1A MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- nec Strain1B MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- marc Strain2 3FL MDOwcaF::PglpFlacI3xPglpF-futA_mut4PglpF-marc Strain3 DFL MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR_SD4-futC Strain4 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-setA Strain5 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-marc Strain6 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-nec Strain7 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-vag Strain8 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PglpF-marcPglpF-futC Strain9 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-fred Strain10 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-bad Strain11 MDOwcaF::PglpFlacI3xPglpF-futA_mut4PmglB_70UTR-futC_SD4 PglpF-yberC Strain12 MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- neccontainingplasmidpl-futA_mut4 Strain13 MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- neccontainingplasmidpl-fucT Strain14 MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- neccontainingplasmidpl-moumou Strain15 MDOPglpF-gmd-wcaG-wcaH-wcal-manC-manBlacI2xPglpF-futCPglpF- marccontainingplasmidpl-fucT

    [0321] Deep Well Assay (DWA)

    [0322] DWA was performed as originally described to Lv et al (Bioprocess Biosyst Eng (2016) 39:1737-1747) and optimized for the purposes of the current invention.

    [0323] More specifically, the strains disclosed in the examples were screened in 24 deep well plates using a 4-day protocol. During the first 24 hours, cells were grown to high densities while in the next 48 hours cells were transferred to a medium that allowed induction of gene expression and product formation. Specifically, during day 1 fresh inoculums were prepared using a basal minimal medium supplemented with magnesium sulphate, thiamine and glucose. After 24 hours of incubation of the prepared cultures at 34 C. with a 700 rpm shaking, cells were transferred to a new basal minimal medium (2 ml) supplemented with magnesium sulphate and thiamine to which an initial bolus of 20% glucose solution (1 l) and 10% lactose solution (0.1 ml) were added, then 50% sucrose solution as carbon source was provided to the cells accompanied by the addition of sucrose hydrolase (invertase, 4 l of a 0.1 g/L solution) so that glucose was provided at a slow rate for growth by cleavage of sucrose by the invertase. After inoculation of the new medium, cells were shaken at 700 rpm at 28 C. for 48 hours. After denaturation and subsequent centrifugation, the supernatants were analysed by HPLC.

    [0324] Fermentation

    [0325] Fermentations were carried out in 200 mL DasBox bioreactors (Eppendorf, Germany) or 2 L Biostat B bioreactors (Sartorius, Germany). Starting volumes, respectively, were 100 mL or 1 L. The medium was a defined minimal culture medium, consisting of 25 g/kg carbon source (glucose), MgSO.sub.47H.sub.2O, KOH, NaOH, NH.sub.4H.sub.2PO.sub.4, KH.sub.2PO.sub.4, trace element solution, citric acid, antifoam and thiamine. The trace metal solution (TMS) contained Mn, Cu, Fe, Zn as sulfate salts and citric acid. Fermentations were started by inoculation with 2% (v/v) of pre-cultures grown in a defined minimal medium. After depletion of the carbon source contained in the batch medium, a sterile feed solution containing glucose, MgSO.sub.47H.sub.2O, TMS, H.sub.3PO.sub.4, antifoam and lactose was fed continuously in a glucose-limited manner, using a predetermined, linear profile. Lactose concentration in the feed solution was either 120 g/kg (process DFL1) or 60 g/kg (process DFL2), to obtain either high or low lactose concentrations during fermentation. Hence, low lactose condition was defined as having <5 g/I throughout most of the fermentation, while high lactose condition was defined as having 10-25 g/L throughout most of the fermentation. FIG. 4 depicts the resulting lactose concentrations measured in the fermentation broth using HPLC.

    [0326] The pH throughout fermentation was controlled at 6.8 by titration with NH.sub.4OH solution. Aeration was controlled at 1 vvm using air, and dissolved oxygen was kept above 20% of air saturation, controlled by the stirrer rate. At 3 h after glucose feed start, the fermentation temperature setpoint was lowered from 33 C. to 30 C. This temperature drop was conducted instantly or with a 1 hour linear ramp.

    [0327] Throughout the fermentations, samples were taken in order to determine the concentration of 2FL, 3FL, DFL, lactose and other minor by-products using HPLC. Total broth samples were diluted three-fold in deionized water and boiled for 20 minutes. This was followed by centrifugation at 17000 g for 3 minutes, where after the resulting supernatant was analysed by H PLC.

    Example 1. Engineering of Escherichia coli for HMO Production by Overexpressing -1,2-fucosyltransferase and -1,3-fucosyltransferase

    [0328] Three strains producing either 2FL, 3FL, or DFL, as the main product were constructed. Strain 1, a 2FL producing strain, overexpress the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB) and the -1,2-fucosyltransferase gene, futC. Strain 2, a 3FL producing strain overexpress the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB), the -1,3-fucosyltransferase gene, futA_mut4, and the MFS gene, marc. Strain 3, a DFL producing strain, overexpress the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB), the -1,3-fucosyltransferase gene futA_mut4, and the -1,2-fucosyltransferase gene, futC.

    [0329] The strains were cultured using the deep well assay as described in the materials and method section and the contents of 2FL, 3FL and DFL were measured using HPLC. The results are shown in FIG. 1.

    [0330] Surprisingly, overexpressing the -1,2-fucosyltransferase gene, futC, in a 3FL producing strain converts 3FL into DFL. More than 70% of the total HMO produced by strain 3 is DFL and the production of 3FL is almost eliminated.

    [0331] As can be seen in FIG. 1, more than 70% of the total HMO produced by strain 3 is DFL and the production of 3FL is almost eliminated.

    Example 2. Engineering of Escherichia coli for DFL Production by Overexpression of a Heterologous MFS Protein

    [0332] The main HMO produced by Strain 3 is DFL. Strain 3 overexpresses the colonic acid genes (gmd-wcaG-wcaH-wcaI-manC-manB), the -1,2-fucosyltransferase gene, futC, and the -1,3-fucosyltransferase, futA_mut4.

    [0333] In the present example it was investigated whether overexpression of the homologous sugar efflux transporter protein, SetA (strain 4), or one of the three heterologous MFS transporter proteins, Marc (strain 5), Nec (strain 6), or Vag (strain 7), exporter proteins had an effect on total HMO expression and on the DFL/2FL ratio compared to strain 3.

    [0334] The strains were cultured using the deep well assay as described in the materials and method section and the contents of 2FL, 3FL and DFL were measured using HPLC. The results are shown in FIGS. 2 and 3.

    [0335] Overexpression of setA gene (Strain 4) did not increase the total amount of HMO produced (FIG. 2). Overexpression of the marc gene (Strain 5) increased the total amount of HMO produced by 25% (FIG. 2). Overexpression of the nec or vag gene, Strain 6 or 7, respectively, increased the total amount of HMO produced by 80% (FIG. 2). Furthermore, overexpression of marc, nec, or vag increased the ratio of DFL to the total amount of HMO by 25% (FIG. 3) and decreased the ratio of 2FL compared to the total amount of HMO by more than 30% (FIG. 3). More than 70% of the produced HMOs in strains overexpressing the -1,2-fucosyltransferase gene, futC, the -1,3-fucosyltransferase, futA_mut4 combined with overexpression of either marc, nec, or vag, is DFL.

    Example 3. High Ratio of DFL:2FL Obtained by Fermentation

    [0336] Lactose is the substrate for the fucosylation performed by the alpha-1,2-fucosyl transferase and alpha-1,3-fucosyl transferase involved in DFL formation. In the present example it was investigated if the concentration of lactose in the feed during fermentation affected the DFL formation.

    [0337] A DFL producing strain, strain 8, was capable of producing a mixture of 2FL and DFL, where DFL is the predominant HMO, and 2FL generally constitutes 30% or less of the total HMO, depending on the fermentation conditions, as described below. Surprisingly, almost no 3FL is detected in fermentations with these strains even though the alpha-1,3 fucosyltransferase gene futA_mut4 was expressed. Two fermentations with different supplies of lactose were run in parallel as described in the material and method section. The two fermentation processes were identical with regards to medium composition, glucose feed profile and fermentation process parameters such as temperature, pH and dissolved oxygen. The resulting lactose concentrations, as measured in the fermentation broth by HPLC, were above 15 g/L with process DFL1 and below 5 g/L with process DFL2 for most of the time during fermentation (FIG. 4). The low lactose process leads to the highest DFL/(2FL+DFL) ratios of >80%, where this ratio stabilises towards the end of fermentation (FIG. 5). For the high lactose process (DFL1), the DFL/(2FL+DFL) ratio is somewhat lower, but still >70%, which means that in all cases DFL is by far the most abundant HMO produced (FIG. 6). Surprisingly, 3FL is in all cases determined to be <1% of the total sum of HMO and therefore negligible for final product quality (table 6).

    TABLE-US-00006 TABLE 6 HMO composition in total broth sample at end-of-fermentation timepoint. HMO = sum of 2'FL and DFL, while 3FL is negligible at <1% in all samples. DFL/ 3FL/ 2'FL/ Fermentation Process ID HMO HMO HMO Batch IDGDF Strain (lactose high/low) (%) (%) (%) 19558 Strain 8 DFL1 (high) 73.0 <1 27.0 20090 Strain 8 DFL2 (low) 83.8 <1 16.2

    Example 4. Purification and Crystallization of DFL from Fermentation Broth

    [0338] Following fermentation cells and proteins were removed by ultrafiltration and the obtained solution was concentrated by nanofiltration. The solution was eluted through a strong cation exchange resin (H.sup.+ form) and a weak anion exchange resin (free base form) to demineralize it. The solution was then treated with charcoal to decolorize it. Subsequently, the solution was concentrated at reduced pressure to the required concentration for the crystallization step. For crystallization of DFL ethanol (1.3 volumes) was added to the concentrated solution. The solution was seeded and stirred at room temperature for 18 hours. Subsequently, ethanol (1.3 volumes) was added continuously over 3 hours at room temperature. The crystals were filtered off and washed with ethanol (0.4 volumes). The crystals were dried on air until constant weight. DFL content (water free)>90% w/w %.

    [0339] FIG. 7 shows the purification steps of the fermentation broth to obtain crystalline DFL.

    [0340] Ultrafiltration (UF) is used to separate biomass from the broth, nanofiltration (NF) to concentrate the broth, ion absorbance step to remove salts and activated charcoal (AC) to remove color. Selective DFL crystallization as the final step provides DFL in very high purity.

    Example 5Comparative Study of Different a Heterologous Transporter Proteins

    [0341] In Example 2 the three MFS transporter proteins Marc, Nec, or Vag and the sugar efflux transporter protein, SetA were tested for their ability to increase DFL expression when inserted into strain 3. In the present example three additional MFS transporters Fred, Bad and YberC were overexpressed in the DFL producing strain (Strain 3) resulting in strain 9-11, respectively.

    [0342] The strains were cultured using the deep well assay as described in the materials and method section and the contents of 2FL, 3FL and DFL were measured using HPLC.

    [0343] The percentage of DFL, 2FL and 3FL of the total amount of HMO produced is shown in table 7.

    TABLE-US-00007 TABLE 7 Level of DFL, 2'FL or 3FL in % of total HMO produced with different MFS transporters DFL 2FL 3FL % of total % of total % of total Strain Transporter used: HMO HMO HMO 1 none 59.6% 39.3% 1.1% 4 setA 60.3% 38.7% 0.9% 5 marc 67.3% 27.3% 5.4% 6 nec 72.9% 20.4% 6.7% 7 vag 69.9% 19.7% 10.5% 9 fred 66.8% 25.1% 8.0% 10 bad 71.3% 24.6% 4.1% 11 yberC 60.5% 34.9% 4.5%

    [0344] As observed in example 2 overexpression of setA gene (Strain 4) did not increase the amount of DFL produced, which is also the case for the new exporter YberC (strain 11). As in Example 2, overexpression of marc, nec, or vag (strains 5-7) increased the ratio of DFL to the total amount of HMO by 7-12%. The same was observed for the new transporters fred and bad (strains 9 and 10). More than 65% of the produced HMOs in the strains with the marc, nec, vag fred or bad transporter proteins strains overexpressing the -1,2-fucosyltransferase gene, futC, the -1,3-fucosyltransferase, futA_mut4 is DFL.

    Example 6Alternative -1,3-Fucosyltransferase for the DFL Formation

    [0345] The -1,3-fucosyltransferase is responsible for the addition of fucosyl to the glucose moiety of the lactose substrate. In the following example the addition alternative -1,3-fucosyltransferases in combination with the MFS transporter nec was tested.

    [0346] Briefly the 2-FL producing strain, strain 1 containing the FutC -1,2-fucosyltransferase on the chromosome, was modified by overexpressing the nec MFS transporter protein generating strain 1A. To convert this 2FL expressing strain to different a DFL expressing strains the cells were transfected with plasmids containing different -1,3-fucosyltransferases.

    [0347] The strains were cultured using the deep well assay as described in the materials and method section and the contents of 2FL, 3FL and DFL were measured using HPLC. The results are shown in table 8.

    TABLE-US-00008 TABLE 8 Level of DFL, 2'FL or 3FL in % of total HMO produced with nec MFS transporter and different -1,3-fucosyltransferase. DFL 2FL 3FL Transporter -1,3- % of total % of total % of total Strain used: fucosyltransferase HMO HMO HMO 1A nec none 2.1 97.9 0.0 12 nec FutA_mut4 61.1 2.2 36.8 13 nec FucT 64.2 3.4 32.4 14 nec moumou 47.2 6.0 46.8

    [0348] From this it can be seen that three different -1,3-fucosyltransferase are capable of producing DFL as the most abundant HMO in the HMO mixture produced by the cell when combined with the nec MFS transporter. The moumou -1,3-fucosyltransferase (strain 14) produces almost an equal amount of DFL and 3FL, the ratio may likely be changed towards DFL by adjusting the ratio between moumou -1,3-fucosyltransferase and the -1,2-fucosyltransferase FutC, since the moumou transferase is expressed from a high-expression plasmid and the FutC is expressed from 2 copies on the genome, so it would be expected that reducing the copy number of the moumou transferase would shift the HMO production towards more DFL and less 3FL. For the FutA_mut4 -1,3-fucosyltransferase (strain 12) the high overexpression of FutA_mut4 from a high copy number plasmid in a strain comprising two copies of FutC results 61% DFL of total HMO. However, when compared to strain 6 in example 5 where only 3 copies of FutA_mut4 and one copy of futC was present in the strain, an increased production of 3FL and less DFLis produced by strain 12. This indicates that optimization of the fucosyltransferase ratios may be beneficial to increase the amount of DFL in the culture.

    Example 7FucT -1,3-fucosyltransferase in Combination with Marc MFS Transporter for the DFL Formation

    [0349] In the following example the best performing -1,3-fucosyltransferase from example 6, FucT, was tested in combination with the marc MFS transporter.

    [0350] Briefly the 2-FL producing strain, strain 1 containing the FutC -1,2-fucosyltransferase on the chromosome, was modified by overexpressing the marc MFS transporter protein generating strain 1B. To convert this 2FL expressing strain to a DFL expressing strain the strain was transfected with a plasmid containing the FucT -1,3-fucosyltransferase.

    [0351] The strains were cultured using the deep well assay as described in the materials and method section and the contents of 2FL, 3FL and DFL were measured using HPLC. The results are shown in table 9.

    TABLE-US-00009 TABLE 9 Level of DFL, 2'FL or 3FL in % of total HMO produced using FucT -1,3-fucosyltransferase DFL 2FL 3FL Transporter -1,3- % of total % of total % of total Strain used: fucosyltransferase HMO HMO HMO 1B marc none 5.7 94.3 0.0 15 marc FucT 75.9 12.1 12.0 13* nec FucT 64.2 3.4 32.4 *Result from example 6

    [0352] From these data it can be seen that the FucT -1,3-fucosyltransferase is very efficient in producing DFL when combined with the -1,2-fucosyltransferase FutC and the marc MFS transporter. DFL constitutes 76% of the HMO mix produced by the cell whereas 64% DFL was produced using FucT and the nec MFS transporter (data from table 8 included in table 9).