Application of glutamate dehydrogenase GDHA of <i>Peptostreptococcus asaccharolyticus </i>in increasing yield of poly-r-glutamic acid from <i>Bacillus licheniformis</i>

11952596 ยท 2024-04-09

Assignee

Inventors

Cpc classification

International classification

Abstract

Application of glutamate dehydrogenase GdhA of Peptostreptococcus asaccharolyticus in increasing the yield of poly-?-glutamic acid from Bacillus licheniformis. The glutamate dehydrogenase GdhA of the Bacillus licheniformis WX-02 per se is replaced with the glutamate dehydrogenase derived from the Peptostreptococcus asaccharolyticus by means of homologous recombination, which significantly increases the level of synthesizing the poly-?-glutamic acid for the Bacillus licheniformis, and the yield of the obtained poly-?-glutamic acid from strains is increased at least by more than 20% compared with control strains.

Claims

1. A method for increasing yield of poly-?-glutamic acid produced by Bacillus licheniformis through fermentation, comprising: replacing a glutamate dehydrogenase gene in Bacillus licheniformis with a glutamate dehydrogenase gene (gdhA) of Peptostreptococcus asaccharolyticus to obtain a recombinant strain, producing the poly-?-glutamic acid through fermentation of the recombinant strain.

2. The method according to claim 1, wherein the Bacillus licheniformis is Bacillus licheniformis WX-02 with CCTCC Accession No. M208065.

3. The method according to claim 1, wherein the glutamate dehydrogenase gene of the Peptostreptococcus asaccharolyticus is as shown in SEQ ID NO:2.

4. The method according to claim 1, wherein fermentation media used during the fermentation comprise: 30-90 g/L of glucose, 0-30 g/L of sodium glutamate, 0-10 g/L of sodium citrate, 5-10 g/L of NaNO.sub.3, 0-10 g/L of NH.sub.4Cl, 0.5-1 g/L of K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.8-1.2 g/L of MgSO.sub.4.Math.7H.sub.2O, 0.8-1.2 g/L of ZnSO.sub.4.Math.7H.sub.2O, 0.1-0.2 g/L of MnSO.sub.4.Math.H.sub.2O, and 0.8-1.2 g/L of CaCl.sub.2), wherein at most one of the sodium glutamate, the sodium citrate, and the ammonium chloride is optionally 0 in the content; or 18-22 g/L of glycerol, 25-35 g/L of sodium glutamate, 8-13 g/L of sodium citrate, 7-12 g/L of NaNO.sub.3, 8-12 g/L of NH.sub.4Cl, 0.8-1.2 g/L of K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.9-1.2 g/L of MgSO.sub.4.Math.7H.sub.2O, 0.8-1.2 g/L of ZnSO.sub.4.Math.7H.sub.2O, 0.1-0.25 g/L of MnSO.sub.4.Math.H.sub.2O, and 0.5-1.5 g/L of CaCl.sub.2.

5. The method according to claim 4, wherein the fermentation media used during fermentation comprise: 30-90 g/L of glucose, 0-30 g/L of sodium glutamate, 9-10 g/L of sodium citrate, 9-10 g/L of NaNO.sub.3, 9-10 g/L of NH.sub.4Cl, 0.8-1 g/L of K.sub.2HPO.sub.4.Math.3H.sub.2O, 0.8-1 g/L of MgSO.sub.4.Math.7H.sub.2O, 0.8-1 g/L of ZnSO.sub.4.Math.7H.sub.2O, 0.1-0.2 g/L of MnSO.sub.4.Math.H.sub.2O, and 0.8-1.2 g/L of CaCl.sub.2, and the sodium glutamate and the sodium citrate are not 0 in content at same time.

6. The method according to claim 3, wherein a protein encoded by the glutamate dehydrogenase gene of the Peptostreptococcus asaccharolyticus is as shown in SEQ ID NO:1.

7. The method according to claim 1, wherein the recombinant strain is obtained by the following steps of (1) synthesizing the glutamate dehydrogenase gene (gdhA) according to a genomic DNA sequence of Peptostreptococcus asaccharolyticus DSM 20463 to obtain a synthesized gdhA gene, wherein the synthesized gdhA gene has a sequence shown in SEQ ID NO:2, and primers for amplifying the gdhA gene comprise T2-F2 of SEQ ID NO:3 and T2-R2 of SEQ ID NO:4, amplifying an upstream homologous arm and a downstream homologous arm of a glutamate dehydrogenase gene (rocG) of the Bacillus licheniformis per se through PCR with a genomic DNA of Bacillus licheniformis WX-02 as a template, wherein primers for amplifying the upstream homologous arm comprise T2-F1 of SEQ ID NO: 5 and T2-R1 of SEQ ID NO: 6; and primers for amplifying the downstream homologous arm comprise T2-F3 of SEQ ID NO: 7 and T2-R3 of SEQ ID NO: 8; (2) linking the upstream homologous arm of the rocG gene, the amplified gdhA gene, and the downstream homologous arm of the rocG gene through overlap-extension PCR to form a target gene fragment in an order of the upstream homologous arm of the gene rocGthe amplified gdhA genethe downstream homologous arm of the gene rocG; (3) performing double digestion on the target gene fragment using restriction endonucleases SacI and XbaI to obtain digested target gene fragments, and meanwhile, performing double digestion on a plasmid T2(2)-Ori using the restriction endonucleases SacI and XbaI to obtain linear plasmid fragments; (4) linking the digested target fragments obtained in step (3) with the linear plasmid fragments obtained in step (3) via T4-DNA ligases, and verifying correctness to obtain plasmids T2(2)-gdhA; (5) transferring the plasmids T2(2)-gdhA into the Bacillus licheniformis WX-02 to obtain transformants and picking plasmids from the transformants for colony PCR verification to obtain verified strains; (6) transferring and culturing the transformants obtained in step (5) and performing colony PCR to detect single-exchange strains using T2-KYF of SEQ ID NO: 9 and gdhA-R of SEQ ID NO: 10 as primers; and (7) inoculating, mixing, and culturing the verified strains obtained in step (5) and the single-exchange strains obtained in step (6) to obtain mixed strains, transferring and culturing the mixed strains and picking transformants in the mixed strains for colony PCR verification to obtain positive transformants, and performing DNA sequencing on the positive transform ants for further verification, thereby obtaining successfully double-exchanged recombinant strains, wherein primers for the colony PCR verification are T2-KYF of SEQ ID NO: 11 and T2-KYR of SEQ ID NO: 12.

8. The method according to claim 4, wherein conditions for the fermentation comprise inoculating a bacterial liquid of the recombinant strains into the fermentation media at an inoculation amount of 3% by volume, and culturing at the speed of 230 r/min and at the temperature of 37? C. for a fermentation period of 36 hours.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) Embodiments below are intended to further explain rather than limiting the invention. The technical solutions of the invention are conventional solutions in the art unless otherwise specified. The reagents or materials described are commercially available unless otherwise specified.

(2) Experiment Materials and Reagents

(3) 1. Strains: Bacillus licheniformis WX-02, with the Accession No. of CCTCC NO. M208065. The deposit of the biological material was made at China Center for Type Culture Collection (CCTCC), having an address at Wuhan University, Luojiashan, Wuchang, Wuhan, 430072, China, on Apr. 28, 2008; the deposit has the CCTCC Accession No. M208065; the deposited biological material is described as Bacillus licheniformis WX-02; and the deposit has been made under the Budapest Treaty.

(4) The strains E. coli DH5a are commercially available and purchased from Beijing TransGen Biotech Co., Ltd.

(5) 2. Enzymes and other biochemical reagents: High-fidelity Taq enzyme was purchased from Wuhan Qingke Biotechnology Co., Ltd. Bacterial genomic DNA extraction kit was purchased from Tiangen; T4 DNA ligases, restriction endonucleases, and other molecular biological reagents were purchased from Nanjing Vazyme Biotech Co., Ltd; and others were domestic reagents (all available from ordinary biochemical reagent companies).

(6) 3. Media:

(7) Composition of LB media includes: 10 g/L of tryptone, 5 g/L of yeast powder, 10 g/L of sodium chloride; and the LB media had a pH of 7.0-7.2 and were sterilized at 121? C. for 20 min before use.

Example 1. Construction of Replacement of Strain Bacillus licheniformis WX-gdhA with Glutamate Dehydrogenase of Peptostreptococcus asaccharolyticus

(8) (1) a gdhA gene (as shown in SEQ ID NO: 2) is synthesized according to genomic DNA sequence of Peptostreptococcus asaccharolyticus DSM 20463 (GenBank Access No. NZ_FWWR00000000.1), wherein primers for amplifying the gene included T2-F2 of SEQ ID NO: 3 and T2-R2 SEQ ID NO: 4; and an upstream homologous arm (T2-F1 SEQ ID NO: 5 and T2-R1 SEQ ID NO: 6 as primers) and a downstream homologous arm (T2-F3 SEQ ID NO: 7 and T2-R3 SEQ ID NO: 8 as primers) of a glutamate dehydrogenase gene rocG (GenBank Access NO. AKQ74236.1) of the Bacillus licheniformis per se are amplified through PCR with the genomic DNA of the Bacillus licheniformis WX-02 (GenBank Access No. NZ_CP012110.1) as a template;

(9) TABLE-US-00001 (SEQIDNO:5) T2-F1:GGGAGCTCTGCTGTAGTATTGCTGGCC; (SEQIDNO:6) T2-R1:ATTAAGTGTATCTGTCATCTTTTTTCAGCTCCCTTTCT; (SEQIDNO:3) T2-F2:AGAAAGGGAGCTGAAAAAAGATGACAGATACACTTAAT; (SEQIDNO:4) T2-R2:ATGCTCTCTCTTTTTACCGTTAATACCATCCTCTTAATT; (SEQIDNO:7) T2-F3:AATTAAGAGGATGGTATTAACGGTAAAAAGAGAGAGCAT; (SEQIDNO:8) T2-R3:GCTCTAGAATTTTGATTAATCAATCTAC; (2) the upstream homologous arm of the gene rocG (SEQ ID NO: 13), the amplified gdhA gene and the downstream homologous arm of the gene rocG (SEQ ID NO: 14) are linked through overlap-extension PCR to form a target gene fragment, which has an order as follows: the upstream homologous arm of the gene rocGthe amplified gdhA genethe downstream homologous arm of the gene rocG; (3) double digestion is performed on the target gene fragment using restriction endonucleases SacI and XbaI to obtain digested gene fragments, and meanwhile, double digestion is performed on a plasmid T2(2)-Ori using the restriction endonucleases SacI and XbaI to obtain linear plasmid fragments; (4) the digested target fragments obtained in step (3) is linked with the linear plasmid fragments obtained in step (3) via T4-DNA ligases, and the correctness is verified to obtain plasmids T2(2)-gdhA; (5) the plasmids T2(2)-gdhA are transferred into the Bacillus licheniformis WX-02, and screened by media resistant to kanacillin to obtain transformants, and the plasmids are picked from the transformants for colony PCR verification; (6) positive transformants obtained in step (4) are transferred to cultured on the media resistant to kanacillin at 45? C. 3 times, each for 12 hours, and colony PCR is performed to detect single-exchange strains with T2-KYF and gdhA-R as primers;

(10) TABLE-US-00002 (SEQIDNO:9) T2-KYF:TCAACAGCCTCTACAATAAA; and (SEQIDNO:10) gdhA-R:TTAATACCATCCTCTTAATT; (7) strains obtained in step (5) and the single-exchange strains obtained in step (6) are mixed and inoculated, and then transferred to and cultured in media containing no kanacillin at 37? C. several times; the transformants are picked for colony PCR verification to obtain positive transformants; and DNA sequencing is performed on the positive transformants for further verification, thereby obtaining successfully double-exchanged recombinant strains. Then, the positive transformants are obtained. Subsequently, DNA sequencing is performed on the positive transformants for further verification, and successfully double-exchanged gdhA strains (i.e., Bacillus licheniformis WX-gdhA) is obtained.

(11) TABLE-US-00003 (SEQIDNO:11) T2-KYF:TCAACAGCCTCTACAATAAA; and (SEQIDNO:12) T2-KYR:ATGAACGCTTTAAACGAT.

Example 2. Application of Bacillus licheniformis WX-gdhA in Increasing the Fermentation Yield of Poly-?-Glutamic Acid

(12) Analysis of Yield of Fermentation Product

(13) The recombinant strains obtained in Example 1 is inoculated into the LB media and cultured at 37? C. for 14 h; 50 mL of poly-?-glutamic acid fermentation medium (Table 1) is put into a 500 mL Erlenmeyer flask, and then a seed-culturing bacteria liquid is inoculated into the fermentation media at an inoculum amount of 3% (volume percentage). The culture is performed at the speed of 230 r/min and at the temperature of 37? C. for a fermentation period of 36 hours.

(14) In this example, the effect of the Bacillus licheniformis WX-gdhA on the synthesis level of the poly-?-glutamic acid is investigated with respect to different compositions of the fermentation media (at the same time, these 24 media were inoculated with the same inoculation amount of Bacillus licheniformis WX-02 as controls). The specific compositions of the 24 media are shown in Table 1:

(15) TABLE-US-00004 TABLE 1 Compositions of fermentation media Media Com- Na Na position Glu- Glyc- gluta- Cit- K.sub.2HPO.sub.4 MgSO.sub.4 ZnSO.sub.4 MnSO.sub.4 No. cose erol mate rate NaNO.sub.3 NH.sub.4Cl 3H.sub.2O 7H.sub.2O 7H.sub.2O H.sub.2O CaCl.sub.2 1 90 0 30 10 10 10 1 1 1 0.15 1 2 60 0 30 10 10 10 1 1 1 0.15 1 3 30 0 30 10 10 10 1 1 1 0.15 1 4 90 0 15 10 10 10 1 1 1 0.15 1 5 90 0 0 10 10 10 1 1 1 0.15 1 6 90 0 30 5 10 10 1 1 1 0.15 1 7 90 0 30 0 10 10 1 1 1 0.15 1 8 90 0 30 10 5 10 1 1 1 0.15 1 9 90 0 30 10 0 10 1 1 1 0.15 1 10 90 0 30 10 10 5 1 1 1 0.15 1 11 90 0 30 10 10 0 1 1 1 0.15 1 12 90 0 30 10 10 10 0.5 1 1 0.15 1 13 90 0 30 10 10 10 0 1 1 0.15 1 14 90 0 30 10 10 10 1 0.5 1 0.15 1 15 90 0 30 10 10 10 1 0 1 0.15 1 16 90 0 30 10 10 10 1 1 0.5 0.15 1 17 90 0 30 10 10 10 1 1 0 0.15 1 18 90 0 30 10 10 10 1 1 1 0.075 1 19 90 0 30 10 10 10 1 1 1 0 1 20 90 0 30 10 10 10 1 1 1 0.15 0.5 21 90 0 30 10 10 10 1 1 1 0.15 0 22 0 20 30 10 10 10 1 1 1 0.15 1 23 0 40 30 10 10 10 1 1 1 0.15 1 24 0 60 30 10 10 10 1 1 1 0.15 1

(16) The media compositions above are all in g/L, and the fermentation media have the pH of 6.5-7.2 and are sterilized at 115? C. for 20 min before use.

(17) The yield of the poly-?-glutamic acid is measured by a dry weight method, with the specific operation steps as follows. A certain volume of fermentation broth sample is taken, adjusted to 3.0 in pH with 6 mol/L HCl and centrifuged at 12000 r/min for 10 min; bacterial precipitates are dried in an oven at 80? C.; the dry weight of the bacteria is measured. A supernatant is taken, adjusted to neutrality in pH with 6 mol/L NaOH, added with ethanol to precipitate the poly-?-glutamic acid, wherein the volume of the ethanol is 3 times that of the supernatant; a resultant product is centrifuged to collect flocculent precipitates of the poly-?-glutamic acid, and the precipitates are dried in the oven at 80? C. and measured in dry weight. The yield of the poly-?-glutamic acid in the fermentation broth is calculated according to the dry weight method (see Table 2).

(18) TABLE-US-00005 TABLE 2 Yields of poly-?-glutamic acid in fermentation test The yield of poly-?- The yield of poly-?- Increase percentage Media glutamic acid from glutamic acid from in yield of poly-?- Composition strains WX-rocGS.sup.277W control strains WX-02 glutamic acid No. (g/L) (g/L) (%) 1 44.67 35.35 26.36 2 38.36 30.25 26.81 3 30.14 22.45 34.25 4 33.73 25.25 33.58 5 22.77 16.75 35.94 6 34.77 28.48 22.09 7 28.45 20.55 38.44 8 32.53 24.26 34.09 9 25.34 19.12 32.53 10 35.25 27.87 26.48 11 34.86 27.64 26.12 12 38.77 30.45 27.32 13 36.81 30.65 20.10 14 34.03 27.98 21.62 15 32.68 25.47 28.31 16 36.17 29.44 22.86 17 34.75 27.68 25.54 18 31.13 24.82 25.42 19 24.52 20.36 20.43 20 33.77 27.45 23.02 21 30.87 25.08 23.09 22 26.14 19.99 30.77 23 31.85 25.54 24.71 24 36.88 30.17 22.24

(19) The invention provides a new strategy for the efficient production of poly-?-glutamic acid.