USE OF MICRO-RIBONUCLEIC ACID (MIRNA) TO DIAGNOSE TRANSPLANT REJECTION AND TOLERANCE OF IMMUNOSUPPRESSION THERAPY
20190313957 ยท 2019-10-17
Inventors
- Abraham Shaked (Wynnewood, PA)
- Bao-Li Chang (Paoli, PA, US)
- Brendan Keating (Philadelphia, PA, US)
- Toumy Guettouche (Miami, FL, US)
Cpc classification
G16B25/10
PHYSICS
A61B10/0038
HUMAN NECESSITIES
G16B25/00
PHYSICS
A61B2010/0061
HUMAN NECESSITIES
G16B25/20
PHYSICS
C12N15/113
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
A61B10/00
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the discovery that the expression levels of some microRNAs (miRNAs) can use a diagnostic signature to predict transplant outcomes in a transplant recipient. Thus, in various embodiments described herein, the methods of the invention relate to methods of diagnosing a transplant subject for acute rejection such as acute cellular rejection (ACR), methods of predicting a subject's risk of having or developing ACR and methods of assessing in a subject the likelihood of a successful or failure minimization of immunosuppression therapy (IST) dosage from standard ranges.
Claims
1. A method for detecting or predicting transplant rejection of a transplanted organ in a subject, the method comprising: i. determining a level of at least three miRNAs expression in a sample from the subject, wherein the at least three miRNAs comprise SEQ ID NOs: 1-3; ii. comparing the level of at least one miRNA in the sample from the subject relative to a baseline level in a control wherein a difference in the level of the least one miRNA in the sample from the level of the at least one miRNA in the control is indicative of an acute transplant rejection; and, iii. wherein when acute transplant rejection is indicated, treatment for the rejection is recommended.
2. The method of claim 1, wherein the acute transplant rejection comprises acute cellular rejection (ACR).
3. (canceled)
4. The method of claim 1, wherein the at least three miRNAs further comprise at least one selected from the group consisting of SEQ ID NOs: 4-15.
5. The method of claim 1, wherein the at least three miRNAs further comprise at least one selected from the group consisting SEQ ID NOs: 16-23.
6. The method of claim 1, wherein the at least three miRNAs further comprise at least one selected from the group consisting of SEQ ID NOs: 4-23.
7. The method of claim 1, wherein the at least three miRNAs further comprise at least one selected from the group consisting of SEQ ID NOs: 4-23 and 97-134.
8. The method of claim 1, wherein the subject is a mammal.
9. The method of claim 8, wherein the mammal is a human.
10. The method of claim 1, wherein the level of the at least one miRNA is higher than the level of the at least one miRNA in the control by at least 1 fold.
11. (canceled)
12. The method of claim 1, wherein the sample is at least one selected from the group consisting of urine, peripheral blood, serum, bile, bronchoalveolar lavage (BAL) fluid, pericardial fluid, gastrointestinal fluids, stool samples, biological fluid gathered from an anatomic area in proximity to an allograft, and biological fluid from an allograft.
13. The method of claim 1, wherein the transplanted organ is at least one selected from the group consisting of heart, liver, lung, kidney, an intestine, pancreas, pancreatic islet cells, eye, skin, and stem cells.
14. The method of claim 1, wherein the comparison of level of miRNA expression is computed in a regression model to indicate a trajectory of acute rejection of the transplanted organ.
15-27. (canceled)
28. A composition for detecting or predicting transplant rejection of a transplanted organ in a subject comprising a plurality of miRNAs consisting of SEQ ID NOs: 1-3.
29. A composition for detecting or predicting transplant rejection of a transplanted organ in a subject comprising a plurality of miRNAs consisting of SEQ ID NOs: 1-23 and 97-134.
30. A kit comprising: a plurality of oligonucleotides that are configured to detect at least one miRNA from selected from the group consisting of SEQ ID NOs: 1-3.
31. The kit of claim 30, wherein the oligonucleotides are configured to detect at least SEQ ID NOs: 1-3.
32-36. (canceled)
37. The method of claim 1, wherein the at least three miRNAs further comprise SEQ ID NO: 15.
38. The method of claim 1, wherein the at least three miRNAs further comprise SEQ ID NO: 4.
39. The method of claim 1, wherein the at least three miRNAs further comprise SEQ ID NOs: 4 and 15.
40. The method of claim 1, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 97-134.
41. The method of claim 1, wherein the transplanted organ is a liver.
42. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4-23.
43. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4-15.
44. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4 and 15.
45. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4.
46. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 15.
47. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 16-23.
48. The composition of claim 29, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 97-134.
49. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4-23.
50. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4-15.
51. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4 and 15.
52. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 4.
53. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 15.
54. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 16-23.
55. The kit of claim 31, wherein the one or more further miRNA is selected from the group consisting of SEQ ID NOs: 97-134.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0022] For the purpose of illustrating the invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.
[0023]
[0024]
[0025]
[0026]
[0027]
DETAILED DESCRIPTION OF THE INVENTION
[0028] The present invention relates to the discovery that the expression levels of some microRNAs (miRNAs) can be used as diagnostic signature to predict transplant outcomes in a transplant recipient. Thus, in various embodiments described herein, the methods of the invention relate to methods of diagnosing a transplant subject for acute rejection such as acute cellular rejection (ACR), methods of predicting a subject's risk of having or developing ACR and methods of assessing if a subject is prone to a successful or failure reduction the immunosuppression therapy (IST) dosage from standard ranges.
Definitions
[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
[0030] As used herein, each of the following terms has the meaning associated with it in this section.
[0031] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0032] About as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of 20% or 10%, more preferably 5%, even more preferably 1%, and still more preferably 0, 1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0033] The term abnormal when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the normal (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
[0034] A disease is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
[0035] In contrast, a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
[0036] The terms dysregulated and dysregulation as used herein describes a decreased (down-regulated) or increased (up-regulated) level of expression of a miRNA present and detected in a sample obtained from subject as compared to the level of expression of that miRNA present in a control sample, such as a control sample obtained from one or more normal, not-at-risk subjects, or from the same subject at a different time point. In some instances, the level of miRNA expression is compared with an average value obtained from more than one not-at-risk individuals. In other instances, the level of miRNA expression is compared with a miRNA level assessed in a sample obtained from one normal, not-at-risk subject.
[0037] Differentially increased expression or up regulation refers to expression levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% higher or more, and/or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8 fold, 2.0 fold higher or more, and any and all whole or partial increments therebetween, than a control.
[0038] Differentially decreased expression or down regulation refers to expression levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower or less, and/or 2.0 fold, 1.8 fold, 1.6 fold, 1.4 fold, 1.2 fold, 1.1 fold or less lower, and any and all whole or partial increments therebetween, than a control.
[0039] The term expression as used herein is defined as the transcription and/or translation of a particular nucleotide sequence.
[0040] As used herein, isolated means altered or removed from the natural state through the actions, directly or indirectly, of a human being. For example, a nucleic acid or a peptide naturally present in a living animal is not isolated, but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is isolated. An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0041] As used herein, microRNA or miRNA describes miRNA molecules, generally about 15 to about 50 nucleotides in length, preferably 17-23 nucleotides, which can play a role in regulating gene expression through, for example, a process termed RNA interference (RNAi). RNAi describes a phenomenon whereby the presence of an RNA sequence that is complementary or antisense to a sequence in a target gene messenger RNA (mRNA) results in inhibition of expression of the target gene. miRNAs are processed from hairpin precursors of about 70 or more nucleotides (pre-miRNA) which are derived from primary transcripts (pri-miRNA) through sequential cleavage by RNAse III enzymes.
[0042] By nucleic acid is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylene phosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
[0043] The term, polynucleotide includes cDNA, RNA, DNA/RNA hybrid, anti-sense RNA, siRNA, miRNA, snoRNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified to contain non-natural or derivatized, synthetic, or semisynthetic nucleotide bases. Also, included within the scope of the invention are alterations of a wild type or synthetic gene, including but not limited to deletion, insertion, substitution of one or more nucleotides, or fusion to other polynucleotide sequences.
[0044] Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5-direction.
[0045] The term oligonucleotide typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which U replaces T.
[0046] The term spiked-in refers to a defined sequence nucleic acid species (such as a RNA species, sequence or transcript) that is added to a sample during processing and used to assess the performance of a microarray. Spiked-in refers to artificial sequences that can include standard or modified nucleotides such as locked nucleic acids (LNAs), peptide nucleic acids (PNA), or nucleic acid analogues (e.g., isoG, isoC, etc.). In some embodiments, the defined sequence nucleic acid comprises a sequence that is not likely to be found in the biological sample to be analyzed and is selected to have minimal self-hybridization and cross hybridization with other similar sequences in the set. Such spiked-in controls can be used to monitor microarray quality, in terms of dynamic range, reproducibility, etc. Different spiked-in controls can be used to monitor different processes in a microarray analysis. In some embodiments, the measured degree of hybridization between the spiked-in and the control probes is used to calibrate and normalize the hybridization measurements of the sample RNA or miRNA.
[0047] As used herein, hybridization, hybridize (s) or capable of hybridizing is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. Complementary sequences in the nucleic acids pair with each other to form a double helix. The resulting double-stranded nucleic acid is a hybrid. Hybridization may be between, for example two complementary or partially complementary sequences. The hybrid may have double-stranded regions and single stranded regions. The hybrid may be, for example, DNA:DNA, RNA:DNA or DNA:RNA. Hybrids may also be formed between modified nucleic acids (e.g., LNA compounds). One or both of the nucleic acids may be immobilized on a solid support. Hybridization techniques may be used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. The stability of a hybrid depends on a variety of factors including the length of complementarity, the presence of mismatches within the complementary region, the temperature and the concentration of salt in the reaction or nucleotide modifications in one of the two strands of the hybrid.
[0048] A nucleic acid probe, or a probe, as used herein, is a DNA probe or an RNA probe.
[0049] The term Next-generation sequencing (NGS), also known as high-throughput sequencing, is used herein to describe a number of different modern sequencing technologies that allow to sequence DNA and RNA much more quickly and cheaply than the previously used Sanger sequencing (Metzker, 2010, Nature Reviews Genetics 11.1: 31-46). It is based on micro- and nanotechnologies to reduce the size of sample, the reagent costs, and to enable massively parallel sequencing reactions. It can be highly multiplexed which allows simultaneous sequencing and analysis of millions of samples. NGS includes first, second, third as well as subsequent Next Generations Sequencing technologies.
[0050] Sample or biological sample as used herein means a biological material from a subject, including but is not limited to organ, tissue, exosome, blood, plasma, saliva, urine and other body fluid, A sample can be any source of material obtained from a subject.
[0051] The terms subject, patient, individual, and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human. The term subject does not denote a particular age or sex. Preferably the subject is a human patient. In some embodiments, the subject is a human having received an organ transplant.
[0052] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2,7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0053] A mutation as used therein is a change in a DNA sequence resulting in an alteration from its natural state. The mutation can comprise deletion and/or insertion and/or duplication and/or substitution of at least one deoxyribonucleic acid base such as a purine (adenine and/or thymine) and/or a pyrimidine (guanine and/or cytosine) Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism (subject).
[0054] The term biopsy refers to a specimen obtained by removing tissue from living patients for diagnostic examination. The term includes aspiration biopsies, brush biopsies, chorionic villus biopsies, endoscopic biopsies, excision biopsies, needle biopsies (specimens obtained by removal by aspiration through an appropriate needle or trocar that pierces the skin, or the external surface of an organ, and into the underlying tissue to be examined), open biopsies, punch biopsies (trephine), shave biopsies, sponge biopsies, and wedge biopsies. Biopsies also include a fine needle aspiration biopsy, a minicore needle biopsy, and/or a conventional percutaneous core needle biopsy.
[0055] Baseline expression or Baseline level of gene expression level includes the particular gene expression level of a healthy subject or a subject with a well-functioning transplant. The baseline level of gene expression includes the gene expression level of a subject without acute rejection. The baseline level of gene expression can be a number on paper or the baseline level of gene expression from a control sample of a healthy subject or a subject with a well-functioning transplant.
[0056] Acute rejection or acute cellular rejection refers to an immune reaction evoked by allografted organs. In general, the acute rejection has its onset 2-60 days after transplantation. and possibly other cell-specific antigens expressed by the tubular epithelium and vascular endothelium. It is caused by mismatched HLA antigens, and possibly other cell-specific antigens expressed by the tubular epithelium and vascular endothelium. It is believed that both delayed hypersensitivity and cytotoxicity mechanisms are involved. Acute rejection is characterized by infiltration of the transplanted tissue by immune cells of the recipient, which carry out their effector function and destroy the transplanted tissue. It can be characterized by interstitial vascular endothelial cell swelling, interstitial accumulation of lymphocytes, plasma cells, immunoblasts, macrophages, neutrophils; tubular separation with edema/necrosis of tubular epithelium; swelling and vacuolization of the endothelial cells, vascular edema, bleeding and inflammation, renal tubular necrosis, sclerosed glomeruli, tubular thyroidization.
[0057] Chronic rejection generally occurs within several months to years after engraftment, even in the presence of successful immunosuppression of acute rejection. Fibrosis is a common factor in chronic rejection of all types of organ transplants. Chronic rejection can typically be described by a range of specific disorders that are characteristic of the particular organ. For example, in lung transplants, such disorders include fibroproliferative destruction of the airway (bronchiolitis obliterans); in heart transplants or transplants of cardiac tissue, such as valve replacements, such disorders include fibrotic atherosclerosis; in kidney transplants, such disorders include, obstructive nephropathy, nephrosclerorsis, tubulointerstitial nephropathy; and in liver transplants, such disorders include disappearing bile duct syndrome. Chronic rejection can also be characterized by ischemic insult, denervation of the transplanted tissue, hyperlipidemia and hypertension associated with immunosuppressive drugs.
[0058] The term transplant rejection encompasses both acute and chronic transplant rejection.
[0059] The term diagnosis is used herein to refer to the identification or classification of a molecular or pathological state, disease or condition. For example, diagnosis may refer to identification of a particular type of acute rejection, e.g., acute cellular rejection.
[0060] The term prediction is used herein to refer to the likelihood that a patient will develop acute rejection. Thus, prediction also includes the time period without acute rejection.
[0061] As used herein, the term transplantation refers to the process of taking a cell, tissue, or organ, called a transplant or graft from one individual and placing it or them into a (usually) different individual. The individual who provides the transplant is called the donor and the individual who received the transplant is called the host (or recipient). An organ, or graft, transplanted between two genetically different individuals of the same species is called an allograft. A graft transplanted between individuals of different species is called a xenograft.
[0062] As used herein, transplant rejection refers to a functional and structural deterioration of the organ due to an active immune response expressed by the recipient, and independent of non-immunologic causes of organ dysfunction. Acute transplant rejection can result from the activation of recipient's T cells and/or B cells; the rejection primarily due to T cells is classified as T cell mediated acute rejection or acute cellular rejection (ACR) and the rejection in which B cells are primarily responsible is classified as antibody mediated acute rejection (AMR). In some embodiments, the methods and compositions provided can detect and/or predict acute cellular rejection.
[0063] As used herein, the terms immunosuppression or immunosuppressive therapy (IST) involve an act that reduces the activation or efficacy of the immune system. Deliberately induced immunosuppression is performed to prevent the body from rejecting an organ transplant, treating graft-versus-host disease after a bone marrow transplant, or for the treatment of auto-immune diseases such as rheumatoid arthritis or Crohn's disease.
[0064] As used herein, the term tolerance is a state of immune unresponsiveness specific to a particular antigen or set of antigens induced by previous exposure to that antigen or set. Tolerance is generally accepted to be an active process and, in essence, a learning experience for T cells. Tolerance, as used herein, refers to the inhibition of a graft recipient's ability to mount an immune response which would otherwise occur, e.g., in response to the introduction of a nonself MHC antigen into the recipient. Tolerance can involve humoral, cellular, or both humoral and cellular responses.
[0065] As used herein, the term biomarker includes a polynucleotide or polypeptide molecule which is present or increased in quantity or activity in subjects having acute rejection or where the acute rejection is anticipated.
[0066] As used herein, the term biomarkers for diagnosis or diagnosis signature includes a group of markers such as miRNA, the quantity or activity of each member of which is correlated with subjects having acute rejection or where the acute rejection is anticipated. In certain embodiments, the diagnosis signature may include only those markers. In some embodiments, the signature includes one, two, three, four, five, six, seven, eight, or nine or more miRNAs.
[0067] As used herein, the term biomarkers for tolerance or tolerance signature includes a group of markers such as miRNA, the quantity or activity of each member of which is correlated with subjects having tolerance for a certain level of immunosuppression minimization or where the immunosuppression minimization is anticipated. In certain embodiments, the tolerance signature may include only those markers. In some embodiments, the signature includes one, two, three, four, five, six, seven, eight, or nine or more miRNAs.
Methods of the Invention
[0068] The invention relates to the unexpected discovery that it is possible to anticipate the future development of acute cellular rejection with a high degree of accuracy; and diagnose acute cellular rejection with a high degree of sensitivity and specificity without performing a transplant biopsy, by measuring the levels certain microRNAs, referred as ACR diagnosis signature, in serum samples from liver transplant recipients. Furthermore, by measuring the level of other microRNAs candidates, referred as IST tolerance signature, the invention enables the prediction in a transplant subject of the success or failure of minimizing immunosuppression therapy (IST) dosage from standard ranges.
[0069] In some embodiments, miRNAs associated with ACR are differentially expressed. In yet other embodiments, miRNAs associated with failure in minimizing IST are differentially expressed. Thus, the invention relates to compositions and methods useful for the detection and quantification of miRNAs and the use of these miRNAs signature for the diagnosis, assessment, and characterization of trajectory of, and transplant-outcomes, as well as the adjustment of IST dosage in a subject in need thereof.
Reference Amount of Expression of the miRNA Marker(s)
[0070] The method of the invention includes comparing a measured amount of expression of a miRNA marker(s) in a biological sample from a subject to a reference amount (i.e. the control) of expression of a miRNA marker(s).
[0071] Reference for Detecting or Predicting Acute Cellular Rejection
[0072] In one embodiment, the reference (i.e. the control) level of expression of the miRNA(s) may be obtained by measuring the expression level of a miRNA in a subject having a non-rejected organ. For example, the subject having a non-rejected organ may include a healthy subject. Preferably, the healthy subject is a subject of similar age, gender, race, graft-donor source, Banff histologic grade, and/or that underwent the same initial anti-rejection treatment as the patient having a transplanted organ for which risk of organ failure is to assessed.
[0073] Another example of a subject having a non-rejected organ is a subject having a well-functioning transplanted organ. A well-functioning (e.g., stable) transplanted organ is defined as a transplanted organ that does not exhibit organ failure (e.g., rejection). Preferably, a well-functioning transplanted organ is a transplanted organ that has not developed transplant dysfunction or morphologic evidence of transplant injury in areas of the transplant. Preferably, the subject having a well-functioning (e.g., stable) transplanted organ is a subject of similar age, gender, race, graft-donor source, Banff histologic grade, and/or that underwent the same initial anti-rejection treatment as the subject having a transplanted organ for which risk of organ failure is to be assessed.
[0074] In another embodiment, the reference amount is obtained by measuring an amount of expression of the miRNA in a second biological sample from the subject. For example, the second biological sample may be obtained from the subject before the organ transplantation and/or from another non-rejected organ of the subject.
[0075] In yet another embodiment, the reference amount of expression of the miRNA is a value for expression of the miRNA that is accepted in the art (e.g., spiked-in).
[0076] Reference for Predicting Success or Failure of Minimizing Immunosuppression Therapy (IST).
[0077] In one embodiment, the reference amount of expression of the miRNA is obtained by measuring an amount of expression of the miRNA in a transplant subject having a successful tolerance for a decrease in the IST dosage. For example, the subject under a lower IST dosage includes a healthy subject. Preferably, the healthy subject is a subject of similar age, gender, race, graft-donor source, Banff histologic grade, and/or that underwent the same initial anti-rejection treatment as the subject having a transplanted organ for which the minimization of IST is to assessed.
[0078] Another example of a subject having a non-rejected organ is a subject having a well-functioning transplanted organ. A well-functioning (e.g., stable) transplanted organ may be defined as a transplanted organ that does not exhibit organ failure (e.g., rejection). Preferably, a well-functioning transplanted organ is a transplanted organ that has not developed transplant dysfunction or morphologic evidence of transplant injury in areas of the transplant. Preferably, the subject having a well-functioning (e.g., stable) transplanted organ is a subject of similar age, gender, race, graft-donor source, Banff histologic grade, and/or that underwent the same initial anti-rejection treatment as the subject having a transplanted organ for which risk of organ failure is to assessed.
[0079] In another embodiment, the reference amount is obtained by measuring an amount of expression of the miRNA in a second biological sample from the subject. For example, the second biological sample may be obtained from the subject before the organ transplantation and/or from another non-rejected organ of the subject.
[0080] In another embodiment, the reference amount is obtained by measuring an amount of expression of said miRNA in a second biological sample from the subject prior the organ transplantation and/or prior beginning IST treatment and/or prior beginning minimizing IST.
[0081] In yet another embodiment, the reference amount of expression of the miRNA is a value for expression of the miRNA that is accepted in the art (e.g., spiked-in). Comparison of the Measured Amount of Expression of the miRNA marker
[0082] The method includes comparing the measured amount of expression of the miRNA to the reference amount of expression of the miRNA.
[0083] For Detecting or Predicting Acute Cellular Rejection
[0084] The miRNA marker may be, for example, a miRNA selected from hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p, hsa-miR-483-5p, hsa-miR-505-3p, hsa-miR-378a-3p, hsa-miR-193b-3p, hsa-miR-874, hsa-miR-365a-3p, hsa-miR-152, hsa-miR-148a-3p and hsa-miR-29a-5p, or any combination thereof.
[0085] In one embodiment, the miRNA marker is selected from hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p and hsa-miR-483-5p, or any combination thereof.
[0086] In another embodiment, the miRNA marker is hsa-miR-125b-5p, hsa-miR-100-5p and hsa-miR-483-5p, wherein an increase of expression of the miRNA marker that is equivalent to at least about 1-fold as compared to the reference amount of expression of the miRNA marker indicates an increased risk of rejection of the transplanted organ.
[0087] An increase of expression that is equivalent to at least about 1-fold may be an increase in an amount equivalent to at least about 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold, or more and any and all partial integers therebetween, as compared with the increase in the reference amount of expression of the miRNA marker. Examples of methods to quantify an increase of expression are known in the art, as are described in the Examples disclosed elsewhere herein.
[0088] For Predicting Success or Failure of Minimizing Immunosuppression Therapy (IST).
[0089] The miRNA marker may be, for example, a miRNA selected from hsa-miR-146b-5p, hsa-miR-424-3p, hsa-miR-125a-5p, hsa-miR-342-3p, hsa-miR-150-5p, hsa-miR-421, hsa-miR-148a-3p, hsa-miR-223-5p, hsa-miR-495-3p, hsa-miR-497-5p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-374b-5p, hsa-let-7g-5p, hsa-miR-99a-5p, hsa-miR-18b-5p, hsa-miR-7-1-3p, hsa-miR-181c-5p, hsa-miR-454-3p, hsa-miR-485-3p, hsa-miR-374a-5p, hsa-miR-99b-5p, hsa-miR-192-5p, hsa-miR-191-5p, hsa-miR-21-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-222-3p, hsa-miR-20a-3p and hsa-miR-106b-5p, or any combination thereof.
[0090] In one embodiment, the miRNA marker is hsa-miR-146b-5p, hsa-miR-424-3p and hsa-miR-125a-5p, wherein an increase of expression of the miRNA marker that is equivalent to at least about 1-fold as compared to the reference amount of expression of the miRNA marker indicates an increased risk of failing minimization of IST.
[0091] An increase of expression that is equivalent to at least about 1-fold may be an increase in an amount equivalent to at least about 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold, or more, and any and all partial integers therebetween, as compared with the increase in the reference amount of expression of the miRNA marker. Preferably, the increase is a fold value. Examples of methods to quantify an increase of expression are known in the art, as are described in the Examples disclosed elsewhere herein.
Normalization
[0092] In one embodiment, the invention includes normalizing the amount of expression of the miRNA marker. The method includes measuring an amount of expression of commercially available spiked-in markers as references against the expression level of miRNA from the subject.
[0093] For Detecting or Predicting Acute Cellular Rejection
[0094] The method further includes measuring an amount of expression of a miRNA marker in a biological sample from a first subject having a rejected organ or at risk for rejecting an organ. The method further includes measuring an amount of expression of miRNA marker in a biological sample from a second subject having a non-rejected organ. In addition, the method includes comparing the measured amount of the miRNA markers between these two types of subjects. Furthermore, when acute transplant rejection is indicated, treatment for the rejection is recommended.
[0095] When the level of miRNAs in the first subject is greater than the level of miRNAs in second subject by an amount equivalent to at least 1-fold, the calculation indicates an increased risk of rejection of the transplanted organ in the subject having a transplanted organ. The calculated increase that is at least 1-fold may be an increase that is equivalent to at least about 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold, or more and any and all partial integers therebetween.
[0096] When the level of miRNAs in the first subject is greater than the level of miRNAs in second subject by an amount equivalent to less than 1-fold, the calculation indicates an increased risk of rejection of the transplanted organ in the subject having a transplanted organ. The calculated increase that is less than 1-fold may be an increase that is equivalent to at most about 0.9-, 0.8-, 0.7-, 0.6-, 0.5-, 0.4-, 0.3-, 0.2-, or 0.1-fold, or less.
[0097] For Predicting Success or Failure of Minimizing Immunosuppression Therapy (IST).
[0098] The method further includes measuring an amount of expression of an endogenously expressed small non-coding reference RNA in a biological sample from a first tested subject under consideration for minimization of IST dosage. The method further includes measuring an amount of expression of miRNA marker in a biological sample from a second subject having a successful minimization of IST dosage. In addition, the method includes comparing the measured amount of the miRNA marker between these two types of subjects. Furthermore, when failure of IST minimization is indicated, treatment of the subject is recommended.
[0099] When the level of miRNAs in the first subject is greater than the level of miRNAs in second subject by an amount equivalent to at least 1-fold, the calculation indicates an increased risk of failing minimization of IST dosage in a subject under IST treatment. The calculated increase that is at least 1-fold may be an increase that is equivalent to at least about 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold, or more and any and all partial integers therebetween.
[0100] When the level of miRNAs in the first subject is greater than the level of miRNAs in second subject by an amount equivalent to less than 1-fold, the calculation indicates an increased risk of failing minimization of IST dosage in a subject under IST treatment. The calculated increase that is less than 1-fold may be an increase that is equivalent to at most about 0.9-, 0.8-, 0.7-, 0.6-, 0.5-, 0.4-, 0.3-, 0.2-, or 0.1-fold, or less.
[0101] Accordingly, in the present embodiment, fold changes or equivalents thereof for the miRNA marker are normalized to the spiked-in reference miRNAs.
Detecting Acute Transplant Rejection
[0102] In one embodiment, the invention includes a method of detecting acute rejection in a subject having received an organ transplant. The method comprises the steps of detecting a level of expression of miRNA indicative of acute rejection in a test sample from the subject, wherein the miRNA is at least one selected from hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p, hsa-miR-483-5p, hsa-miR-505-3p, hsa-miR-378a-3p, hsa-miR-193b-3p, hsa-miR-874, hsa-miR-365a-3p, hsa-miR-152, hsa-miR-148a-3p and hsa-miR-29a-5p or any combination thereof. Then comparing the level of expression of the miRNA in the test sample to the level of miRNA in a control sample, wherein an increase between the amount of the miRNA in the test sample relative to the control sample indicates that the subject has acute cellular rejection (ACR). Furthermore, when acute transplant rejection is indicated, treatment for the rejection is recommended.
[0103] The invention is based, in part, on the observation that increased expression of certain miRNAs comprising hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p, hsa-miR-483-5p, hsa-miR-505-3p, hsa-miR-378a-3p, hsa-miR-193b-3p, hsa-miR-874, hsa-miR-365a-3p, hsa-miR-152, hsa-miR-148a-3p and hsa-miR-29a-5p, the miRNAs provided in Table 1, hsa-miR-4790-5p, hsa-miR-3692-3p, hsa-miR-4433b-3p, hsa-miR-6500-3p, hsa-miR-4445-5p, hsa-miR-5194, hsa-miR-4505, hsa-miR-4430, hsa-miR-374c-3p, hsa-miR-4506, hsa-miR-4286, hsa-miR-6816-5p, hsa-miR-758-3p, hsa-miR-4535, hsa-miR-490-3p, hsa-miR-6765-5p, hsa-miR-3197, hsa-miR-1271-3p, hsa-miR-92a-1-5p, hsa-miR-8054, hsa-miR-455-5p, hsa-miR-7151-3p, hsa-miR-628-3p, hsa-miR-556-5p, hsa-miR-6726-5p, hsa-miR-1179, hsa-miR-3196, hsa-miR-6858-5p, hsa-miR-6778-5p, hsa-miR-4459, hsa-miR-380-5p, hsa-miR-1273e, hsa-let-7b-3p, hsa-miR-4481, hsa-miR-1908-5p, hsa-miR-149-3p, hsa-miR-651-3p and hsa-miR-124-5p (provided in Table 5), is associated with acute rejection and/or can be used to predict acute rejection in a transplant subject. In a particular embodiment, the miRNAs comprise the three biomarkers hsa-miR-125b-5p, hsa-miR-100-5p and hsa-miR-483-5p.
Predicting Minimization of Immunosuppressive Therapy (IST) Dosage.
[0104] In one embodiment, the invention includes a method of detecting a subject that has received an organ transplant and is under IST. The method comprises the steps of detecting a level of expression of miRNA indicative of IST in a test sample from the subject, wherein the miRNA is at least one selected from hsa-miR-146b-5p, hsa-miR-424-3p, hsa-miR-125a-5p, hsa-miR-342-3p, hsa-miR-150-5p, hsa-miR-421, hsa-miR-148a-3p, hsa-miR-223-5p, hsa-miR-495-3p, hsa-miR-497-5p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-374b-5p, hsa-let-7g-5p, hsa-miR-99a-5p, hsa-miR-18b-5p, hsa-miR-7-1-3p, hsa-miR-181c-5p, hsa-miR-454-3p, hsa-miR-485-3p, hsa-miR-374a-5p, hsa-miR-99b-5p, hsa-miR-192-5p, hsa-miR-191-5p, hsa-miR-21-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-222-3p, hsa-miR-20a-3p and hsa-miR-106b-5p, or any combination thereof. Then comparing the level of expression of the miRNA in the test sample to the level of miRNA in a control sample, wherein an increase between the amount of the miRNA in the test sample relative to the control sample indicates that the subject is likely to fail a reduction in IST dosage. Further when failure of IST minimization is indicated, treatment of the subject is recommended.
[0105] The invention is based, in part, on the observation that increased expression of certain miRNAs comprising hsa-miR-146b-5p, hsa-miR-424-3p, hsa-miR-125a-5p, hsa-miR-342-3p, hsa-miR-150-5p, hsa-miR-421, hsa-miR-148a-3p, hsa-miR-223-5p, hsa-miR-495-3p, hsa-miR-497-5p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-374b-5p, hsa-let-7g-5p, hsa-miR-99a-5p, hsa-miR-18b-5p, hsa-miR-7-1-3p, hsa-miR-181c-5p, hsa-miR-454-3p, hsa-miR-485-3p, hsa-miR-374a-5p, hsa-miR-99b-5p, hsa-miR-192-5p, hsa-miR-191-5p, hsa-miR-21-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-222-3p, hsa-miR-20a-3p and hsa-miR-106b-5p (listed in Table 2) is associated with a likelihood of failing minimization of IST dosage in a subject. In a particular embodiments, the miRNAs comprise the three biomarker hsa-miR-146b-5p, hsa-miR-424-3p and hsa-miR-125a-5p.
[0106] Based on the data described herein, compositions and methods are now available for the rapid and reliable detection of or prediction of acute rejection even without allograft biopsy, as well as the prediction of success or failure of minimizing IST dosage.
[0107] The amounts of any combinations of the miRNAs listed herein may be detected according to the methods disclosed herein and compared with a control (baseline level). In one embodiment, a difference in the level of expression of one miRNA indicates that the subject has or is developing acute rejection. However, in alternate embodiments, changes in the amounts of any combination of two, three, four, six, eight, nine or more miRNAs can indicate that the subject has or is developing acute rejection. In this way, the dose of immunosuppression agents can be modified, e.g., increased or decreased or discontinued and/or new agents can be added to the administered treatment regimen. In some embodiments, other treatment modalities can be initiated, such as for example, plasmapheresis.
[0108] In certain aspects of the present invention, the level of miRNA expression is determined for one or more miRNA in a sample obtained from a subject. The sample can be a fluid sample such as a blood sample, preferably containing peripheral blood mononuclear cells (PBMCs), a urine sample, preferably containing urinary cells such as epithelial cells, or infiltrating immune cells, a sample of bronchoalveolar lavage fluid, a sample of bile, pleural fluid or peritoneal fluid, or any other fluid secreted or excreted by a normally or abnormally functioning allograft, or any other fluid resulting from exudation or transudation through an allograft or in anatomic proximity to an allograft, or any fluid that is in physiological contact or proximity with the allograft, or any other body fluid in addition to those recited herein should also be considered to be included in the invention.
[0109] Any method known to those in the art can be employed for determining the level of miRNA expression. For example, a microarray can be used. Microarrays are known in the art and consist of a surface to which probes that correspond in sequence to gene products (e.g. mRNAs, polypeptides, fragments thereof etc.) can be specifically hybridized or bound to a known position. To detect at least one miRNA of interest, a hybridization sample is formed by contacting the test sample with at least one nucleic acid probe. A preferred probe for detecting miRNA is a labeled nucleic acid probe capable of hybridizing to miRNA. The nucleic acid probe can be, for example, a full-length nucleic acid molecule, or a portion thereof, such as an oligonucleotide of at least 10, 15, or 20 nucleotides in length and sufficient to specifically hybridize under stringent conditions to appropriate miRNA. The hybridization sample is maintained under conditions which are sufficient to allow specific hybridization of the nucleic acid probe to a miRNA target of interest. Specific hybridization can be performed under high stringency conditions or moderate stringency conditions, as appropriate. In a preferred embodiment, the hybridization conditions for specific hybridization are high stringency. Specific hybridization, if present, is then detected using standard methods. If specific hybridization occurs between the nucleic acid probe and a miRNA in the test sample, the sequence that is present in the nucleic acid probe is also present in the miRNA of the subject. More than one nucleic acid probe can also be used. Hybridization intensity data detected by the scanner are automatically acquired and processed by the Affymetrix Microarray Suite (MASS) software. Raw data is normalized to expression levels using a target intensity of 150. An alternate and preferred method to measure miRNA expression profiles of a small number of different genes is by e.g. either classical TaqMan Gene Expression Assays or TaqMan Low Density Arraymicro fluidic cards (Applied Biosystems). Particularly, this invention preferably utilizes a microRNA qPCR system. Non-limiting examples include commercial kits such as the PrimePCRPathways commercially available from Bio-rad (Berkley, Calif.), the miRCURY LNA Universal RT microRNA PCR commercially available from Exiqon (Denmark), or the Custom RT2 Profiler PCR Arrays commercially available from Qiagen (Netherlands). Another example of method that can be employed for determining the level of miRNA expression is the use of molecular color-coded barcodes and single molecule imaging to detect and count hundreds of unique transcripts in a single reaction such as in the nCounter system from Nanostring Technology (Seattle, Wash.). Using this technology, each color-coded barcode is attached to a single target-specific probe corresponding to a gene of interest so that each color-coded barcode represents a single target molecule. Barcodes hybridize directly to the target molecules and can be individually counted without the need for amplification providing very sensitive digital data. After hybridization, the excess probes are removed and the probe/target complexes are aligned and immobilized in the nCounter Cartridge. The sample Cartridges are placed in the nCounter Digital Analyzer for data collection and the color codes on the surface of the cartridge are counted and tabulated for each target molecule.
[0110] Other technologies contemplated by this invention for profiling microRNAs rely on the use of hydrogel particles such as the Firefly microRNA Assay (Firefly BioWorks Inc, Cambridge, Mass. 02139). This assay, based on porous particle, allows target molecules to diffuse and bind in a unique nanoscale three-dimensional scaffold which favors accurate multiplexed miRNAs detection in a variety of biological samples. The present invention particularly contemplates the use of Firefly Circulating microRNA Assay for profiling circulating microRNAs biomarkers directly from a sample such as blood, serum or plasma without any prior RNA purification.
[0111] The transcriptional state of a sample, particularly miRNAs, may also be measured by other nucleic acid expression technologies known in the art.
[0112] In one embodiment, the miRNAs are detected in a sample from the recipient of an organ transplant. Any method known to those in the art can be employed for determining the level of microRNAs (particularly, the miRNAs provided elsewhere herein in Tables 1-5). miRNA can be isolated from the sample using any method known to those in the art. Non-limiting examples include commercial kits, such as the miRNeasy commercially available from Qiagen (Netherlands) or the Mini Kit the TRI Reagent commercially available from Molecular Research Center, Inc. (Cincinnati, Ohio), can be used to isolate RNA.
[0113] Generally, the isolated miRNAs may be amplified using methods known in the art. Amplification systems utilizing, for example, PCR or RT-PCR methodologies are known to those skilled in the art. For a general overview of amplification technology, see, for example, Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1995).
[0114] An alternative method for determining the level of microRNAs (particularly, the miRNAs provided elsewhere herein in Tables 1-5) includes the use of molecular beacons and other labeled probes useful in, for example multiplex PCR. In a multiplex PCR assay, the PCR mixture contains primers and probes directed to the selected miRNAs PCR product. Typically, a single fluorochrome is used in the assay. The molecular beacon or probe is detected to determine the level of miRNA. Molecular beacons are described, for example, by Tyagi and Kramer (Nature Biotechnology 14, 303-308, 1996) and by Andrus and Nichols in U.S. Patent Application Publication No. 20040053284.
[0115] Another accurate method for profiling miRNA expression can the use of Next Generation Sequencing (NGS) including first, second, third as well as subsequent Next Generations Sequencing technologies. Non limiting examples could be the nanopore or semiconductor technologies (e.g. Oxford Nanopore Technologies, United Kingdom) or the Illumina microRNA-Seq Platform (Luo S., 2012, Methods Mol Biol. 822:183-8).
[0116] In some embodiments, upregulation of miRNA level includes increases above a baseline level of 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, 20-fold, or more and any and all partial integers therebetween; as well as above a baseline level of 0.9-, 0.8-, 0.7-, 0.6-, 0.5-, 0.4-, 0.3-, 0.2-, or 0.1-fold, or less.
[0117] In some embodiments, the level of expression is determined using log-transformed miRNA levels. The log transformation or miRNA levels substantially reduce the positive skew in the data. In some embodiments, the level of expression is determined using log-transformed miRNA levels determined by normalizing miRNA levels using a logistic regression model. Logistic regression models are used for prediction of the probability of occurrence of acute rejection by fitting data to a logistic curve. It is a generalized linear model used for binomial regression.
[0118] In some embodiments, for interpretation of quantitative nucleic acid expression measurements, a normalizer may be needed to correct expression data for differences in sample input, RNA quality, and RT efficiency between samples. In some embodiments, to accurately assess whether increased miRNA is significant, the miRNA expression can be normalized to accurately compare levels of expression between samples, e.g., it is a baseline level against which expression is compared. In quantitative assays, such as for example, quantitative real-time Reverse Transcriptase-PCR (qRT-PCR) normalization can be performed using spiked-in markers as references against the expression level of a miRNA under investigation. Normalization includes rendering the measurements of different arrays or PCR or in particular RT-PCR experiments comparable by reducing or removing the technical variability. Within these experiments there exists a multiplicity of sources capable of falsifying the measurements. Possible technical sources of interference are: different efficiency in reverse transcription, labeling or hybridization reactions, as well as problems with the arrays, batch effects in reagents, or lab-specific conditions. By normalization a more robust detection of miRNA expression can occur.
[0119] Typically, miRNA normalization involves use of spiked-in markers that have known fractional cycle number or crossing point. These are utilized as a reference, internal control or reference values in the quantification of miRNA expression. A spiked-in marker exhibits minimum change of expression and transcription across different miRNA samples and thus serves as a control, or reference, for the measurement of variable miRNA activities across different samples. Spiked-in markers can be, but are not limited to, UniSp2 and UniSp4 (Exiqon, Denmark).
[0120] Receiver Operating Characteristic (ROC) curves can be generated for individual miRNA levels and a linear combination of miRNA levels to determine the cutoff points that yielded the highest combined sensitivity and specificity for detecting ACR or anticipating ACR as well as detecting the likelihood of successful minimization of IST.
[0121] This involves measuring the miRNA levels alone, all together, or in any combination for the following hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p, hsa-miR-483-5p, hsa-miR-505-3p, hsa-miR-378a-3p, hsa-miR-193b-3p, hsa-miR-874, hsa-miR-365a-3p, hsa-miR-152, hsa-miR-148a-3p and hsa-miR-29a-5p; and/or hsa-miR-146b-5p, hsa-miR-424-3p, hsa-miR-125a-5p, hsa-miR-342-3p, hsa-miR-150-5p, hsa-miR-421, hsa-miR-148a-3p, hsa-miR-223-5p, hsa-miR-495-3p, hsa-miR-497-5p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-374b-5p, hsa-let-7g-5p, hsa-miR-99a-5p, hsa-miR-18b-5p, hsa-miR-7-1-3p, hsa-miR-181c-5p, hsa-miR-454-3p, hsa-miR-485-3p, hsa-miR-374a-5p, hsa-miR-99b-5p, hsa-miR-192-5p, hsa-miR-191-5p, hsa-miR-21-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-222-3p, hsa-miR-20a-3p and hsa-miR-106b-5p. These combinations are then weighted based on increased expression. These statistical analyses with different biomarkers are described in Zhang et al., 2005, Biostatistics Working Paper Series. Other statistical analysis methods for quantifying biomarkers known in the art can be used as well.
Compositions
[0122] The invention includes a set of preferred probes or primers, either labeled (e.g., fluorescer, quencher, etc.) or unlabeled, that are useful for the detection of at least three miRNAs selected from the group consisting of hsa-miR-125b-5p, hsa-miR-100-5p, hsa-miR-483-5p, hsa-miR-885-5p, hsa-miR-122-5p, hsa-miR-99a-5p, hsa-miR-30a-5p, hsa-miR-497-5p, hsa-miR-194-5p, hsa-miR-34a-5p, hsa-miR-192-5p, hsa-miR-215, hsa-miR-375, hsa-miR-193a-5p, hsa-miR-483-5p, hsa-miR-505-3p, hsa-miR-378a-3p, hsa-miR-193b-3p, hsa-miR-874, hsa-miR-365a-3p, hsa-miR-152, hsa-miR-148a-3p, hsa-miR-29a-5p (Table1), hsa-miR-4790-5p, hsa-miR-3692-3p, hsa-miR-4433b-3p, hsa-miR-6500-3p, hsa-miR-4445-5p, hsa-miR-5194, hsa-miR-4505, hsa-miR-4430, hsa-miR-374c-3p, hsa-miR-4506, hsa-miR-4286, hsa-miR-6816-5p, hsa-miR-758-3p, hsa-miR-4535, hsa-miR-490-3p, hsa-miR-6765-5p, hsa-miR-3197, hsa-miR-1271-3p, hsa-miR-92a-1-5p, hsa-miR-8054, hsa-miR-455-5p, hsa-miR-7151-3p, hsa-miR-628-3p, hsa-miR-556-5p, hsa-miR-6726-5p, hsa-miR-1179, hsa-miR-3196, hsa-miR-6858-5p, hsa-miR-6778-5p, hsa-miR-4459, hsa-miR-380-5p, hsa-miR-1273e, hsa-let-7b-3p, hsa-miR-4481, hsa-miR-1908-5p, hsa-miR-149-3p, hsa-miR-651-3p and hsa-miR-124-5p (Table 5); and/or hsa-miR-146b-5p, hsa-miR-424-3p, hsa-miR-125a-5p, hsa-miR-342-3p, hsa-miR-150-5p, hsa-miR-421, hsa-miR-148a-3p, hsa-miR-223-5p, hsa-miR-495-3p, hsa-miR-497-5p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-374b-5p, hsa-let-7g-5p, hsa-miR-99a-5p, hsa-miR-18b-5p, hsa-miR-7-1-3p, hsa-miR-181c-5p, hsa-miR-454-3p, hsa-miR-485-3p, hsa-miR-374a-5p, hsa-miR-99b-5p, hsa-miR-192-5p, hsa-miR-191-5p, hsa-miR-21-5p, hsa-miR-24-3p, hsa-miR-27b-3p, hsa-miR-222-3p, hsa-miR-20a-3p and hsa-miR-106b-5p (Table 2). Particularly preferred probe sets comprise probes that are capable of detecting the three biomarkers hsa-miR-483-5p, hsa-miR-125b-5p and hsa-miR-100-5p for the diagnosis or prediction of ACR; and the three biomarkers hsa-miR-146b-5p, hsa-miR-424-3p and hsa-miR-125a-5p for the diagnosis of tolerance for minimization of IST.
[0123] Kits
[0124] In certain embodiments, kits are provided. Commercially available kits for use in these methods are, in view of this specification, known to those of skill in the art. In general, kits will comprise a detection reagent that is suitable for detecting the presence of a polypeptide or nucleic acid, or mRNA of interest.
[0125] In another embodiment, there is a panel of probe sets. Preferred probe sets are designed to detect expression of one or more miRNAs and provide information about the rejection of a graft and/or the minimization of IST. Probe sets are particularly useful because they are smaller and cheaper than probe sets that are intended to detect as many miRNAs as possible in a particular genome. The probe sets are targeted at the detection of miRNAs that are informative about acute rejection or tolerance for IST minimization. Probe sets may also comprise a large or small number of probes that detect miRNAs that are not informative about transplant rejection or minimization of IST. Such probes are useful as controls and for normalization (e.g., spiked-in markers). Probe sets may be a dry mixture or a mixture in solution. In some embodiments, probe sets can be affixed to a solid substrate to form an array of probes. It is anticipated that probe sets may also be useful for multiplex PCR. The probes may be nucleic acids (e.g., DNA, RNA, chemically modified forms of DNA and RNA), LNAs (Locked nucleic acids), or PNAs (Peptide nucleic acids), or any other polymeric compound capable of specifically interacting with the desired nucleic acid sequences.
[0126] It is contemplated that kits may be designed for isolating and/or detecting miRNA in essentially any sample (e.g., urine, blood, etc.), and a wide variety of reagents and methods are, in view of this specification, known in the art.
[0127] The following examples further illustrate aspects of the present invention. However, they are in no way a limitation of the teachings or disclosure of the present invention as set forth herein.
EXAMPLES
[0128] The invention is now described with reference to the following Examples. These Examples are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these Examples, but rather should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0129] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
[0130] The materials and methods employed in the experiments disclosed herein are now described.
Materials and Methods
Clinical Trial Studies.
[0131] Data from three clinical trial studies from The National Institutes of Health (NIH) were used herein. The Immune Tolerance Network A-WISH study (ITN study: ITN030, available at www.clinicaltrials.gov/ct2/show/record/NCT00135694), Clinical Trials in Organ Transplantation (CTOT-03, available at www.clinicaltrials.gov/ct2/show/NCT00531921?term=CTOT-03&rank=1), and Adult to Adult Liver Living Donors Liver Transplantation (A2ALL, available at www.clinicaltrials.gov/ct2/show/NCT02073435?term=A2ALL&rank=2).
Inclusion and Exclusion Criteria.
[0132] Study subjects were required to be adult recipients transplanted for non-immune liver disease, including subjects treated for HCV infection prior to transplantation who remain SVR at the time of clinically indicated liver biopsy. Subjects should receive tacrolimus-based immunosuppression. Overall, the CTOT-03 and -04 protocols demonstrated a >95% consent rate among subjects approached for entry into observational study involving blood collections.
Mirna Profiles.
[0133] RNA was extracted from the subject's serum followed by miRNA profiling and analysis. miRNA profiling was done via miRCURY LNA Universal RT microRNA PCR panels (Exiqon, Denmark). Serum input is held constant to assure the same eluted volume of nucleic acids is used in each reverse transcription reaction. Spike-in assays controlled the efficiencies of extraction, reverse transcription and real-time PCR. Standard miRNA PCR array was used with spiked-in markers that have known Cq (fractional cycle number or crossing point) value to allow quantitative measurements of signature miRNAs.
Expression Data Normalization
[0134] After Inter-Plate-Calibration (IPC), individual measurements that were beyond cycle threshold were replaced with the highest Cq value output from the run to allow their inclusion in subsequent processing, as the measurements were below detection limits rather than true missing value. These values were subtracted from 36 to provide a relative expression value (on log 2-scale) with zero set at approximately the reliable quantification limit for qPCR-based assays. To normalize for technical processing variations, for each sample, the average of the deviation from the study population mean for the UniSp2 and UniSp4 (Exiqon, Denmark) exogenous spiked miRNA was subtracted from the relative expression values for each miRNA within the respective sample. From analysis of population variance vs. mean plot for the normalized miRNA expression values, the limit of detection (LOD) was estimated to be above 0, but could be extended to be above 2, with the limitation of population standard deviation being below 2.5. Based on this LOD, miRNA that had a relative expression value below 2 were adjusted to 3. miRNA that had a population mean below 2 or population standard deviation above 2.5 were flagged as inappropriate for continuous variable analysis. If the miRNA had signal above 2 for at least two samples for ACR=Yes and ACR=No subgroups, then the miRNA was considered for categorical analysis after dichotomization of values to 1 if relative expression was above 2 or 0 otherwise. miRNA that were not considered for continuous variable or categorical analyses were not included in subsequent statistical analyses.
Statistical Analysis
[0135] Normalized miRNA expression values were imported into Array Studio software (www.omicsoft.com) for additional data QC and single variable analysis. Outliers implicated by both Principal Components Analysis (PCA) clustering and MAD scores were excluded. Serum samples collected during biopsy-proven ACR and no-rejection episodes were randomly assigned to discovery (14 ACR and 37 non-ACR samples), and replication (13 ACR and 40 non-ACR samples) sets. The associations between ACR status and individual miRNA expression levels were tested using general linear model, adjusting for the potential cofounder time since transplantation. False discovery rate (FDR) was applied for multiple testing correction.
[0136] Logistic regression analysis was used to identify parsimonious subsets of ACR-associated serum miRNAs that discriminated ACR from non-ACR episodes. Models with up to 6-terms were built with hierarchical forward with switching as the variable selection method. From those models in which each predictor was significant at P<0.1, provisionally selection was based on the miRNA with the greatest log-likelihood and greatest area under the receiver-operating-characteristic (ROC) curve as the best-fitting model. The regression estimates from this model defined a diagnostic signature, and area under the curve (AUC), sensitivity, and specificity were used to evaluate the ability of this signature to discriminate ACR from non-ACR episodes.
[0137] To validate the miRNA diagnostic signature obtained above, the regression coefficients for the miRNAs included in the diagnostic signature obtained from ITN samples were used to calculate a composite score to summarize the expression values of these miRNAs for each sample in the replication datasets (samples obtained from CTOT-03 study and samples collected from non-randomized subjects participating in ITN trial). The composite scores were then used in a logistic regression model. % correct classification, AUC, sensitivity and specificity were calculated for these two replication datasets.
[0138] To investigate the predictive value of the diagnostic signature obtained, LOESS (locally estimated scatterplot smoothing) curves with corresponding 95% confidence intervals (CI) were obtained for the retrospective trajectories of the diagnostic signature, looking backwards from the time of biopsy for ACR and non-ACR episodes.
[0139] To identify the tolerance biomarkers, 10 serum samples from those subjects who were tolerant at the 25% immunosuppression dose were compared with 11 serum samples from subjects who failed at the 25% IST dose. The associations between fail-tolerance status and individual miRNA expression levels at the 25% IST dose were tested using general linear model, adjusting for the potential cofounder time since transplantation. False discovery rate (FDR) was applied for multiple testing correction. Logistic regression analysis was used to build model consisting of three IST-tolerance-associated serum miRNAs that passed multiple-testing correction. The regression estimates from this model defined an IST minimization signature, and area under the curve (AUC), sensitivity, and specificity were used to evaluate the ability of this signature to discriminate subjects who tolerated from subjects who failed 25% immunosuppression dose at various immunosuppression minimization dosages.
[0140] All statistical analyses were performed in Array Studio software (www.omicsoft.com), NCSS version 8.0.14 (www.ncss.com), and R (cran.r-project.org).
Power and Sample Size.
[0141] Power and sample size calculations were performed assuming the use of general linear model. Estimates from the ITN study were used for power calculation because of its larger sample size and more stable variance estimates. Based on the observed within-group variances of the 3-miRNA ACR-Dx biomarker model prediction score and the proportion of subjects expected to have biopsy proven rejection, 75 subjects (25 rejection cases and 50 control non-rejection subjects) were estimated in power analyses to be needed to have 90% power at alpha=0.00001 to observe a significant difference in mean at the same magnitude as was observed in the ITN study, or alpha=0.001 to observe significant difference in mean at 75% level as what observed in the ITN study.
Tables
[0142] Table 1: List of miRNAs associated with ACR diagnosis with a 2-stage study.
Table 2: List of significant miRNAs (P<0.01) between failed and tolerant samples at 25% immunosuppression minimization.
Table 3: List of miRNAs associated with ACR diagnosis detected in the follow up study including 19 ACR and 16 non-ACR samples.
Table 4: List of top ACR-associated miRNAs identified using Exiqon human miRNA panel and confirmed with Qiagen Human miRNome miRNA PCR Array
Table 5: List of top ACR-associated miRNAs (nominal p<0.15) identified using Qiagen Human miRNome miRNA PCR Array.
Table 6: List of the miRNAs biomarkers and their related target sequence selected for ACR prediction and/or IST minimization tolerance.
Table 7: Sequence identifiers for the miRNAs biomarkers and their related target sequence selected for ACR prediction and/or IST minimization tolerance.
[0143] The results of the experiments are now described in the following examples.
Example 1: Identification of Serum miRNA Signatures for the Detection and Prediction of Acute Cellular Rejection (ACR)
[0144] The results presented herein demonstrate that the miRNA profiles obtained at the time of clinically indicated biopsy are diagnostic of biopsy-confirmed acute rejection at any time after transplantation.
[0145] miRNA profiling was performed on 233 serum samples from 42 clinical trial participants from the National Institutes of Health Immune Tolerance in Transplantation-30 (ITN-30) study. This included 33 subjects randomized to immunosuppression withdrawal and 9 subjects randomized to maintenance, using the miRCURY LNA Universal RT microRNA PCR v3 panel (Exiqon, Denmark). The primary aims of this study were: 1) to identify serum miRNA signatures for diagnosis of acute cellular rejection (ACR) events; 2) to identify serum miRNA signatures for prediction of ACR events; 3) to identify serum miRNA signatures to differentiate subjects who fail immunosuppression withdrawal from subjects who develop tolerance; and 4) to identify miRNA markers that are associated with immunosuppression doses and trough levels. The Exiqon miRNA panel included unique 752 miRNA assays of which 240 were above the lower limit of reliable quantification in a sufficient proportion of samples to allow for meaningful statistical analysis. A comparison of serum samples from biopsy proven rejection and serum samples without biopsy proven rejection in a two-stage study design (a discovery phase consisting of 14 ACR samples and 37 non-ACR samples; with a replication phase consisting of 13 ACR samples and 40 non-ACR samples) was conducted. From the miRNAs that were nominally significant (P<0.05) in the discovery phase 11 of 26 were confirmed at P<0.05 in the replication phase. In the combined dataset, 15 miRNAs were significantly associated with ACR diagnosis after multiple testing correction (FDR adjusted P<0.05) (Table 1). These 15 miRNA include all of the 11 miRNA replicated between discovery and replication phases. To build a multiple marker panel/signature that may better differentiate ACR from non-ACR, the aforementioned 15 significant miRNAs and time since randomization were used as inputs in logistic regression modeling for forward variable selection. Three miRNAs, hsa-miR-125b, hsa-miR-100 and hsa-miR-483, remained in the final parsimonious model. The logistic regression model composed of these three miRNAs (herein referred to as the 3-miRNA serum ACR diagnosis signature) provides ability to differentiate ACR from non-ACR with an area under the curve (AUC) of 0.898, 92.6% sensitivity and 84.2% specificity (P=0.0001) (
[0146] Using the aforementioned 3-miRNA serum ACR diagnosis signature as a prediction signature for ACR in liver transplantation, the invention herein assessed the trajectory towards rejection as well as the diagnosis and prognosis for minimization of the immunosuppressive therapy (IST) dose. Specifically, the possibility of using the 3-miRNA serum ACR diagnosis signature to predict ACR events was explored before the onset of rejection. As shown in the LOESS plot (
TABLE-US-00001 TABLE 1 Table 1 lists the identified miRNAs associated with ACR diagnosis with a 2- stage study. The discovery phase with 14 ACR samples and 37 non-ACR samples identified 26 miRNAs with P < 0.05. In replication phase with independent 13 ACR samples and 40 non-ACR samples, 11 of the 26 significant miRNAs were replicated at P < 0.05. 25/26 miRNA trended in the same direction of association, with only one miRNA showing the opposite direction of association, indicating consistency in both study phases. In the combined dataset, 15 miRNAs were found to be associated with ACR diagnosis after multiple test correction (FDR P < 0.05). The 3 miRNAs utilized to generate the multi-marker signature are marked by the symbol **. The Benjamini-Hochberg procedure (BH step-up procedure) controls the false discovery rate (at level alpha) termed FDR-BH. Combined Discovery Phase Replication Phase (Discovery + Replication) Fold- RawP FDR- Fold- RawP FDR- Fold- RawP FDR- ID change Value BH change Value BH change Value BH hsa-miR-483-5-p ** 2.943 0.0009 0.0325 3.1558 0.0007 0.0174 3.0297 1.5698E06 0.0002 hsa-miR-885-5p 5.0249 9.06E05 0.0178 3.6042 5.40E03 0.0341 4.2977 1.76E06 0.0002 hsa-miR125b-5p ** 2.6807 0.0005 0.0308 2.5825 0.004 0.0341 2.6241 6.5752E06 0.0005 hsa-miR-122-5p 4.3631 0.0001 0.0178 2.8355 0.0185 0.0678 3.5258 0.000013505 0.0008 hsa-miR-99a-5p 3.0213 0.0007 0.0308 2.1309 0.0173 0.0678 2.5397 0.000032828 0.0014 hsa-miR-30a-5p 2.2002 0.0048 0.1181 2.0876 0.0025 0.033 2.1308 0.00003452 0.0014 hsa-miR-100-5p ** 3.3132 0.0006 0.0308 2.3914 0.0231 0.0678 2.7997 0.000060205 0.0021 hsa-miR-497-5p 1.8997 0.0117 0.2198 1.7814 0.0066 0.0341 1.8416 0.0002 0.0053 hsa-miR-194-5p 2.5048 0.0026 0.0702 1.9288 0.0432 0.102 2.2043 0.0003 0.0083 hsa-miR-34a-5p 2.2139 0.0075 0.1517 2.224 0.0235 0.0678 2.2307 0.0004 0.0102 hsa-miR-192-5p 2.6448 0.0008 0.0308 1.7659 0.1278 0.2215 2.1752 0.0008 0.0178 hsa-miR-215 2.8864 0.0055 0.1218 2.1567 0.0603 0.1206 2.497 0.0009 0.0178 hsa-miR-375 2.9171 0.0228 0.2648 2.5796 0.0324 0.0842 2.7311 0.0015 0.0282 hsa-miR-193a-5p 2.3295 0.0141 0.2299 1.8149 0.0503 0.1089 2.06 0.0016 0.0282 hsa-miR-483-3p 3.5557 0.0024 0.0702 1.7078 0.2362 0.2791 2.4712 0.0029 0.0474 hsa-miR-505-3p 2.0367 0.0161 0.2452 1.4995 0.1608 0.2288 1.7504 0.0058 0.084 hsa-miR-378a-3p 1.6826 0.0471 0.4419 1.5235 0.1007 0.1869 1.6069 0.0085 0.0992 hsa-miR-193b-3p 3.0741 0.0192 0.2537 2.0751 0.176 0.2288 2.5326 0.0088 0.0992 hsa-miR-874 2.4234 0.0243 0.2648 1.5514 0.1644 0.2288 1.9256 0.0089 0.0992 hsa-miR-365a-3p 2.1253 0.0396 0.3866 1.6169 0.1482 0.2288 18571 0.0108 0.1114 hsa-miR-152 1.8159 0.025 0.2648 1.3642 0.2 0.2477 1.5698 0.011 0.1114 hsa-miR-148a-3p 1.9598 0.0385 0.3866 1.5212 0.1707 0.2288 1.7321 0.0124 0.1206 hsa-miR-29a-5p 2.4134 0.0138 0.2299 1.257 0.5467 0.5685 1.7262 0.0431 0.3758 hsa-miR-210 1.8276 0.0217 0.2648 1.2748 0.5034 0.5453 1.529 0.0542 0.4412 hsa-miR-33b-5p 2.2862 0.0175 0.2517 1.114 0.7815 0.7815 1.6104 0.0652 0.4968 hsa-miR-432-5p 2.288 0.0198 0.2537 1.4459 0.3348 0.3785 1.2684 0.3639 0.9992 ** miRNA utilized to generate multi-marker signature (3-miRNA ACR-Dx)
Example 2: Identification of Serum miRNA Signatures for the Prediction of Immunosuppression Minimization Tolerance
[0147] These experiments were designed to identify additional clinically relevant biomarkers for immunosuppression minimization that are predictive of which subjects will be able to tolerate lower doses of medication without inducing rejection. To identify each tolerance biomarkers, 10 serum samples from those subjects who were tolerant at the 25% immunosuppression dose (also meant by that a decrease of the initial IST dose by 75%) were compared with 11 serum samples from subjects who failed at the 25% IST dose (these serum samples were taken 58 days on average before rejection occurred). The 25% IST dose was used as the basis for this comparison because a large proportion of subjects (40% of all participants) failed at this stage, and this may represent where major changes occur in serum miRNAs that best differentiate patients who may tolerate or fail at lower IST doses As shown in Table 2, the level of 30 miRNAs were found to be significantly different at P<0.01 between samples taken from those who eventually failed at the 25% IST dose and those who were tolerant at the 25% IST dose. Three miRNAs were still significant after multiple testing correction (FDR P<0.05). It is noted that the serum miRNA biomarkers for ACR diagnosis are not on the higher significant list for biomarkers for tolerance, indicating potential biological differences in the physiological states of rejection vs. tolerance.
[0148] To test whether the identified tolerance related miRNA biomarkers have predictive value, a composite score model was constructed including the three miRNAs that passed the FDR<0.05 significance threshold (hsa-miR-146b, hsa-miR-424 and hsa-miR-125a) for tolerance association at the 25% IST dose. Composite scores computed based on the expression levels of the 3 miRNAs at the 75% IST dose or at randomization (100% IST dose) were used to test whether those subjects who were tolerant at the 25% IST dose could be differentiated from those who failed at the 25% IST dose. As shown in
TABLE-US-00002 TABLE 2 Table 2 Lists 30 serum miRNAs that were significant at P < 0.01 for the comparison of failed and tolerant samples at 25% immunosuppression minimization. Failed.vs.Tolerant Failed.vs.Tolerant Failed.vs.Tolerant ID FoldChange Raw P-Value FDR P-Value hsa-miR- 3.3138 0.0004 0.044 146b-5p hsa-miR- 5.9117 0.0004 0.044 424-3p hsa-miR- 3.6992 0.0006 0.044 125a-5p hsa-miR- 2.2354 0.0019 0.0719 342-3p hsa-miR- 2.3795 0.002 0.0719 150-5p hsa-miR-421 6.7364 0.0021 0.0719 hsa-miR- 3.133 0.0025 0.0719 148a-3p hsa-miR- 4.4363 0.0025 0.0719 223-5p hsa-miR- 2.8986 0.0036 0.0719 495-3p hsa-miR- 2.6304 0.0039 0.0719 497-5p hsa-miR- 2.5658 0.0039 0.0719 29a-3p hsa-miR- 2.5706 0.0043 0.0719 30a-5p hsa-miR- 4.4668 0.0047 0.0719 374b-5p hsa-let-7g-5p 3.0967 0.0048 0.0719 hsa-miR- 2.4666 0.0057 0.0719 99a-5p hsa-miR- 2.9925 0.0063 0.0719 18b-5p hsa-miR-7-1-3p 4.4785 0.0063 0.0719 hsa-miR- 3.3391 0.0065 0.0719 181c-5p hsa-miR- 3.0594 0.0072 0.0719 454-3p hsa-miR- 1.8711 0.0073 0.0719 485-3p hsa-miR- 3.8964 0.0075 0.0719 374a-5p hsa-miR- 2.397 0.0079 0.0719 99b-5p hsa-miR- 2.606 0.0081 0.0719 192-5p hsa-miR- 3.2862 0.0081 0.0719 191-5p hsa-miR-21-5p 2.1481 0.0083 0.0719 hsa-miR-24-3p 2.7691 0.0083 0.0719 hsa-miR- 2.7774 0.0084 0.0719 27b-3p hsa-miR- 2.2814 0.0086 0.0719 222-3p hsa-miR- 4.298 0.0087 0.0719 20a-3p hsa-miR- 2.8124 0.0094 0.0719 106b-5p
Example 3: Replication of miRNA Sera Signatures for Detection and Prediction of Acute Cellular Rejection (ACR)
[0149] To initially replicate the list of 23 ACR-associated miRNAs as well as the 3-miRNA signature identified previously for ACR diagnosis signature (Phase I study, presented previously in Example 1), miRNA profiling of serum samples from two independent studies were subsequently analyzed via the 752 miRCURY LNA Universal RT microRNA PCR v3 panels from Exiqon (Denmark). The first study comprised 15 ACR and 5 non-ACR serum samples from the ITN participants who were not randomized to IST withdrawal or maintenance. The second study comprised 4 ACR and 11 non-ACR samples from the NIH-CTOT03 prospective study. After excluding miRNAs that failed standard quality control (QC) measures, 20 of the 23 ACR-associated miRNAs were included in logistic regression modelling to test their association with ACR. As shown in Table 3, all 20 miRNAs were replicated in this follow-up study.
[0150] The performance of the previously identified 3-miRNA (hsa-miR-125b, hsa-miR-100 and hsa-miR-483) serum multiple marker signature that differentiates ACR from non-ACR was also evaluated in this follow-up study. When using the same coefficients obtained from phase I of the study (presented previously in Example 1) in the logistic regression model to derive a composite score composed of the 3-miRNA serum ACR diagnosis signature, the model also provided excellent ability to differentiate ACR from non-ACR with AUC of 0.885 (95% CI: 0.94-0.83), with 84% sensitivity and 75% specificity (P=0.01) (
TABLE-US-00003 TABLE 3 Table 3 lists 20 replicated miRNAs associated with ACR diagnosis detected in the follow up study including 19 ACR and 16 non-ACR samples. ID Fold-Change Nominal PValue FDR-BH Pvalue hsa-miR-483-3p 6.4822 0.0002 0.0034 hsa-miR-122-5p 6.9065 0.001 0.0069 hsa-miR-885-5p 6.1095 0.0015 0.0069 hsa-miR-215 4.9237 0.0019 0.0069 hsa-miR-100-5p 5.4082 0.002 0.0069 hsa-miR-34a-5p 3.7757 0.0026 0.0069 hsa-miR-152 3.9237 0.0027 0.0069 hsa-miR-192-5p 3.645 0.0029 0.0069 hsa-miR-483-5p 3.7951 0.0032 0.0069 hsa-miR-148a-3p 3.4924 0.0038 0.0069 hsa-miR-194-5p 3.5736 0.0038 0.0069 hsa-miR-365a-3p 3.3761 0.0063 0.0101 hsa-miR-193a-5p 2.5899 0.007 0.0101 hsa-miR-125b-5p 3.358 0.0071 0.0101 hsa-miR-30a-5p 2.8838 0.0108 0.014 hsa-miR-505-3p 2.2178 0.0112 0.014 hsa-miR-378a-3p 2.0742 0.0244 0.0288 hsa-miR-99a-5p 2.8353 0.0322 0.0357 hsa-miR-874 2.3653 0.0504 0.0531 hsa-miR-497-5p 2.0478 0.1131 0.1131
Example 4: Additional miRNAs Candidates for Detection and Prediction of Acute Cellular Rejection (ACR)
[0151] To identify additional novel miRNAs that are not included in Exiqon Human miRNA Ready-to-Use PCR Panels I and II (v.3) (number of miRNAs included: 752), Qiagen Human miRNome miRNA PCR Array, which contains a much broader panel of 2408 human miRNAs, were employed to screen for additional ACR-associated miRNAs. Fifteen serum samples from the CTOT03 study, including four collected at biopsy proven rejection episodes and eleven collected at non-rejection episodes, were used in this screening. As shown in Table 4, a majority of the top ACR-associated miRNAs identified by the Exiqon platform showed the same direction of association using Qiagen miRNome miRNA PCR array.
TABLE-US-00004 TABLE 4 Table 4 lists the top ACR-associated miRNA identified using Exiqon human miRNA panel that were confirmed with Qiagen Human miRNome miRNA PCR Array Exiqon (ITN + CTOT03 Qiagen (CTOT03 130 samples) 15 samples) Fold Nominal Fold ID Change P-Value Change Nominal P-Value hsa-miR-885-5p 8.8013 6.0689E15 6.44 0.0318 hsa-miR-122-5p 6.2466 3.0231E12 5.67 0.1533 hsa-miR-194-5p 3.8097 9.9819E12 2.18 0.2486 hsa-miR-483-3p 5.4763 1.027E11 3.63 0.1122 hsa-miR-483-5p 4.0709 2.6528E11 4.89 0.0037 hsa-miR-192-5p 3.9011 2.7644E11 2.1 0.1623 hsa-miR-30a-5p 3.1198 1.2351E10 3.88 0.2258 hsa-miR-193a-5p 3.1971 1.7252E09 1.63 0.5229 hsa-miR-378a-3p 2.4777 1.4478E08 1.55 0.5225 hsa-miR-21-5p 2.3019 7.9969E08 2.77 0.2463 hsa-miR-574-3p 2.574 4.011E07 5.81 0.0776 hsa-miR-148a-3p 2.6657 6.1793E07 3.1 0.2199 hsa-let-7b-3p 2.6712 2.9049E06 4.89 0.0123 hsa-miR-365a-3p 2.5382 0.000010321 1.41 0.5012 hsa-miR-320c 2.292 0.000014479 1.75 0.5081 hsa-miR-320b 2.1672 0.000022355 1.37 0.7152 hsa-miR-378a-5p 2.2401 0.000072482 1.44 0.6297 hsa-miR-1260a 2.0542 0.000073078 3.67 0.1225
[0152] Particularly, by using Qiagen Human miRNome miRNA PCR Array, additional ACR-associated miRNAs, that are not included in the Exiqon panels, were identified (Table 5). Some of the newly-identified miRNAs showed greater fold changes between ACR and non-ACR samples than those originally identified using Exiqon panels and would potentially provide greater discrimination ability if replicated. Examples of box-and-whisker plots for the top five newly-identified miRNAs are shown in
TABLE-US-00005 TABLE 5 Table 5 lists the top ACR-associated miRNA (nominal p < 0.15) identified using Qiagen Human miRNome miRNA PCR Array. 15 CTOT03 samples, 4 ACR, 11 non-ACR FDR-BH adjusted ID Fold Change Nominal P-Value P-Value hsa-miR-4790-5p 1840.47 7.21E05 0.0755 hsa-miR-3692-3p 4.27 0.0006 0.2323 hsa-miR-4433b-3p 5.06 0.0009 0.2323 hsa-miR-6500-3p 4.51 0.0009 0.2323 hsa-miR-4445-5p 6.78 0.0015 0.2937 hsa-miR-5194 6.61 0.002 0.2937 hsa-miR-4505 12.24 0.0024 0.2937 hsa-miR-4430 4.26 0.0027 0.2937 hsa-miR-374c-3p 18708.97 0.0028 0.2937 hsa-miR-4506 4.4 0.0033 0.2937 hsa-miR-4286 9.75 0.0037 0.2937 hsa-miR-483-5p* 4.89 0.0037 0.2937 hsa-miR-6816-5p 39.27 0.0039 0.2937 hsa-miR-758-3p* 17.22 0.0039 0.2937 hsa-miR-4535 5.08 0.0047 0.3168 hsa-miR-490-3p* 4.22 0.0048 0.3168 hsa-miR-6765-5p 3.12 0.0061 0.3312 hsa-miR-3197 6.5 0.0065 0.3312 hsa-miR-1271-3p 4.28 0.0067 0.3312 hsa-miR-92a-1-5p* 4.11 0.0068 0.3312 hsa-miR-8054 8.79 0.007 0.3312 hsa-miR-455-5p* 15.06 0.0077 0.3312 hsa-miR-7151-3p 3.67 0.0084 0.3312 hsa-miR-628-3p* 5.16 0.0086 0.3312 hsa-miR-556-5p* 8.01 0.0088 0.3312 hsa-miR-6726-5p 4.18 0.0088 0.3312 hsa-miR-1179* 8.58 0.0089 0.3312 hsa-miR-3196 3.26 0.0094 0.3312 hsa-miR-6858-5p 5.43 0.0099 0.3312 hsa-miR-3673 13.01 0.01 0.3312 hsa-miR-6778-5p 4.81 0.0101 0.3312 hsa-miR-4459 3.73 0.0102 0.3312 hsa-miR-380-5p* 25.15 0.0104 0.3312 hsa-miR-1273e 2.95 0.0109 0.3354 hsa-let-7b-3p* 4.89 0.0123 0.3683 hsa-miR-4481 3.84 0.0132 0.3826 hsa-miR-1908-5p 5.3 0.014 0.3849 hsa-miR-149-3p* 4.45 0.0142 0.3849 hsa-miR-651-3p 4.85 0.0147 0.3849 hsa-miR-124-5p* 6.76 0.0148 0.3849 *miRNA also included in Exiqon Human miRNA Ready-to-Use PCR Panels I and II (v.3)
Example 5: Detailed List of the miRNAs Biomarkers and their Related Target Sequence Selected for ACR Prediction and/or IST Minimization Tolerance
[0153]
TABLE-US-00006 TABLE6 ThemicroRNAs' nucleotidessequencesinbold correspondtotheonesthatdonothavea matchingtargetsequence(i.e.probe)listedinthetable6. Symbol Accession MicroRNASequence(5-3)) microRNATargetSequence(5-3) hsa-miR-125b-5p MIMAT0000423 ucccugagacccuaacuuguga tccctgagaccctaacttgtga hsa-miR-100-5p MIMAT0000098 aacccguagauccgaacuugug aacccgtagatccgaacttgtg hsa-miR-483-5p MIMAT0004761 aagacgggaggaaagaagggag aagacgggaggaaagaagggag hsa-miR-885-5p MIMAT0004947 uccauuacacuacccugccucu tccattacactaccctgcctct hsa-miR-122-5p MIMAT0000421 uggagugugacaaugguguuug tggagtgtgacaatggtgtttg hsa-miR-99a-5p MIMAT0000097 aacccguagauccgaucuugug aacccgtagatccgatcttgtg hsa-miR-30a-5p MIMAT0000087 uguaaacauccucgacuggaag tgtaaacatcctcgactggaag hsa-miR-497-5p MIMAT0002820 cagcagcacacugugguuugu cagcagcacactgtggtttgt hsa-miR-194-5p MIMAT0000460 uguaacagcaacuccaugugga tgtaacagcaactccatgtgga hsa-miR-34a-5p MIMAT0000255 uggcagugucuuagcugguugu tggcagtgtcttagctggttgt hsa-miR-192-5p MIMAT0000222 cugaccuaugaauugacagcc ctgacctatgaattgacagcc hsa-miR-215 MI0000291 aucauucagaaaugguauacaggaaaaugaccuau atgacctatgaattgacagac gaauugacagacaauauagcugaguuugucuguc auuucuuuaggccaauauucuguaugacugugcu acuucaa hsa-miR-375 MIMAT0000728 uuuguucguucggcucgcguga tttgttcgttcggctcgcgtga hsa-miR-193a-5p MIMAT0004614 ugggucuuugcgggcgagauga tgggtctttgcgggcgagatga hsa-miR-483-3p MIMAT0002173 ucacuccucuccucccgucuu tcactcctctcctcccgtctt hsa-miR-505-3p MIMAT0002876 cgucaacacuugcugguuuccu cgtcaacacttgctggtttcct hsa-miR-378a-3p MIMAT0000732 acuggacuuggagucagaaggc actggacttggagtcagaagg hsa-miR-193b-3p MIMAT0002819 aacuggcccucaaagucccgcu aactggccctcaaagtcccgct hsa-miR-874 MI0005532 uuagcccugcggccccacgcaccaggguaagaga ctgccctggcccgagggaccga gacucucgcuuccugcccuggcccgagggaccgacu ggcugggc hsa-miR-365a-3p MIMAT0000710 uaaugccccuaaaaauccuuau taatgcccctaaaaatccttat hsa-miR-152 MI0000462 ugucccccccggcccagguucugugauacacucc tcagtgcatgacagaacttgg gacucgggcucuggagcagucagugcaugacagaa cuugggcccggaaggacc hsa-miR-148a-3p MIMAT0000243 ucagugcacuacagaacuuugu tcagtgcactacagaactttgt hsa-miR-29a-5p MIMAT0004503 acugauuucuuuugguguucag actgatttcttttggtgttcag hsa-miR-146b-5p MIMAT0002809 ugagaacugaauuccauaggcu tgagaactgaattccataggct hsa-miR-424-3p MIMAT0004749 caaaacgugaggcgcugcuau caaaacgtgaggcgctgctat hsa-miR-125a-5p MIMAT0000443 ucccugagacccuuuaaccuguga tccctgagaccctttaacctgtga hsa-miR-342-3p MIMAT0000753 ucucacacagaaaucgcacccgu tctcacacagaaatcgcacccgt hsa-miR-150-5p MIMAT0000451 ucucccaacccuuguaccagug tctcccaacccttgtaccagtg hsa-miR-421 MIMAT0003339 aucaacagacauuaauugggcgc atcaacagacattaattgggcgc hsa-miR-223-5p MIMAT0004570 cguguauuugacaagcugaguu cgtgtatttgacaagctgagtt hsa-miR-495-3p MIMAT0002817 aaacaaacauggugcacuucuu aaacaaacatggtgcacttctt hsa-miR-29a-3p MIMAT0000086 uagcaccaucugaaaucgguua tagcaccatctgaaatcggtta hsa-miR-374b-5p MIMAT0004955 auauaauacaaccugcuaagug atataatacaacctgctaagtg hsa-let-7g-5p MIMAT0000414 ugagguaguaguuuguacaguu tgaggtagtagtttgtacagtt hsa-miR-18b-5p MIMAT0001412 uaaggugcaucuagugcaguuag taaggtgcatctagtgcagttag hsa-miR-7-1-3p MIMAT0004553 caacaaaucacagucugccaua caacaaatcacagtctgccata hsa-miR-181c-5p MIMAT0000258 aacauucaaccugucggugagu aacattcaacctgtcggtgagt hsa-miR-454-3p MIMAT0003885 uagugcaauauugcuuauagggu tagtgcaatattgcttatagggt hsa-miR-485-3p MIMAT0002176 gucauacacggcucuccucucu gtcatacacggctctcctctct hsa-miR-374a-5p MIMAT0004688 uuauaauacaaccugauaagug ttataatacaacctgataagtg hsa-miR-99b-5p MIMAT0000689 cacccguagaaccgaccuugcg cacccgtagaaccgaccttgcg hsa-miR-191-5p MIMAT0000440 caacggaaucccaaaagcagcug caacggaatcccaaaagcagctg hsa-miR-21-5p MIMAT0000076 uagcuuaucagacugauguuga tagcttatcagactgatgttga hsa-miR-24-3p MIMAT0000080 uggcucaguucagcaggaacag tggctcagttcagcaggaacag hsa-miR-27b-3p MIMAT0000419 uucacaguggcuaaguucugc ttcacagtggctaagttctgc hsa-miR-222-3p MIMAT0000279 agcuacaucuggcuacugggu agctacatctggctactgggt hsa-miR-20a-3p MIMAT0004493 acugcauuaugagcacuuaaag actgcattatgagcacttaaag hsa-miR-106b-5p MIMAT0000680 uaaagugcugacagugcagau taaagtgctgacagtgcagat hsa-miR-4790-5p MIMAT0019961 aucgcuuuaccauucauguu atcgctttaccattcatgtt hsa-miR-3692-3p MIMAT0018122 guuccacacugacacugcagaagu gttccacactgacactgcagaagt hsa-miR-4433b-3p MIMAT0030414 caggaguggggggugggacgu caggagtggggggtgggacgt hsa-miR-6500-3p MIMAT0025455 acacuuguugggaugaccugc acacttgttgggatgacctgc hsa-miR-4445-5p MIMAT0018963 agauuguuucuuuugccgugca agattgtttcttttgccgtgca hsa-miR-5194 MIMAT0021125 ugagggguuuggaaugggaugg tgaggggtttggaatgggatgg hsa-miR-4505 MIMAT0019041 aggcugggcugggacgga aggctgggctgggacgga hsa-miR-4430 MIMAT0018945 aggcuggagugagcggag aggctggagtgagcggag hsa-miR-374c-3p MIMAT0022735 cacuuagcagguuguauuauau cacttagcaggttgtattatat hsa-miR-4506 MIMAT0019042 aaauggguggucugaggcaa aaatgggtggtctgaggcaa hsa-miR-4286 MIMAT0016916 accccacuccugguacc accccactcctggtacc hsa-miR-6816-5p MIMAT0027532 uggggcggggcaggucccugc tggggcggggcaggtccctgc hsa-miR-758-3p* MIMAT0003879 uuugugaccugguccacuaacc tttgtgacctggtccactaacc hsa-miR-4535 MIMAT0019075 guggaccuggcugggac gtggacctggctgggac hsa-miR-490-3p* MIMAT0002806 caaccuggaggacuccaugcug caacctggaggactccatgctg hsa-miR-6765-5p MIMAT0027430 gugaggcggggccaggagggugugu gtgaggcggggccaggagggtgtgt hsa-miR-3197 MIMAT0015082 ggaggcgcaggcucggaaaggcg ggaggcgcaggctcggaaaggcg hsa-miR-1271-3p MIMAT0022712 agugccugcuaugugccaggca agtgcctgctatgtgccaggca hsa-miR-92a-1-5p* MIMAT0004507 agguugggaucgguugcaaugcu aggttgggatcggttgcaatgct hsa-miR-8054 MIMAT0030981 gaaaguacagaucggaugggu gaaagtacagatcggatgggt hsa-miR-455-5p* MIMAT0003150 uaugugccuuuggacuacaucg tatgtgcctttggactacatcg hsa-miR-7151-3p MIMAT0028213 cuacaggcuggaaugggcuca ctacaggctggaatgggctca hsa-miR-628-3p* MIMAT0003297 ucuaguaagaguggcagucga tctagtaagagtggcagtcga hsa-miR-556-5p* MIMAT0003220 gaugagcucauuguaauaugag gatgagctcattgtaatatgag hsa-miR-6726-5p MIMAT0027353 cgggagcuggggucugcaggu cgggagctggggtctgcaggt hsa-miR-1179* MIMAT0005824 aagcauucuuucauugguugg aagcattctttcattggttgg hsa-miR-3196 MIMAT0015080 cggggcggcaggggccuc cggggcggcaggggcctc hsa-miR-6858-5p MIMAT0027616 gugaggaggggcuggcagggac gtgaggaggggctggcagggac hsa-miR-6778-5p MIMAT0027456 agugggaggacaggaggcaggu agtgggaggacaggaggcaggt hsa-miR-4459 MIMAT0018981 ccaggaggcggaggagguggag ccaggaggcggaggaggtggag hsa-miR-380-5p* MIMAT0000734 ugguugaccauagaacaugcgc tggttgaccatagaacatgcgc hsa-miR-1273e MIMAT0018079 uugcuugaacccaggaagugga ttgcttgaacccaggaagtgga hsa-let-7b-3p* MIMAT0004482 cuauacaaccuacugccuuccc ctatacaacctactgccttccc hsa-miR-4481 MIMAT0019015 ggagugggcuggugguu ggagtgggctggtggtt hsa-miR-1908-5p MIMAT0007881 cggcggggacggcgauugguc cggcggggacggcgattggtc hsa-miR-149-3p* MIMAT0004609 agggagggacgggggcugugc agggagggacgggggctgtgc hsa-miR-651-3p MIMAT0026624 aaaggaaaguguauccuaaaag aaaggaaagtgtatcctaaaag hsa-miR-124-5p* MIMAT0004591 cguguucacagcggaccuugau cgtgttcacagcggaccttgat *miRNA also included in Exiqon Human miRNA Ready-to-Use PCR Panels I and II (v.3)
TABLE-US-00007 TABLE 7 Table 7 lists the sequence identifiers for the miRNAs biomarkers and their related target sequence (listed in Table 6) selected for ACR prediction and/or IST minimization tolerance. SEQ. ID for miRNA SEQ. ID Symbol sequence for miRNA Target sequence hsa-miR-125b-5p SEQ ID NO: 1 SEQ ID NO: 49 hsa-miR-100-5p SEQ ID NO: 2 SEQ ID NO: 50 hsa-miR-483-5p SEQ ID NO: 3 SEQ ID NO: 51 hsa-miR-885-5p SEQ ID NO: 4 SEQ ID NO: 52 hsa-miR-122-5p SEQ ID NO: 5 SEQ ID NO: 53 hsa-miR-99a-5p SEQ ID NO: 6 SEQ ID NO: 54 hsa-miR-30a-5p SEQ ID NO: 7 SEQ ID NO: 55 hsa-miR-497-5p SEQ ID NO: 8 SEQ ID NO: 56 hsa-miR-194-5p SEQ ID NO: 9 SEQ ID NO: 57 hsa-miR-34a-5p SEQ ID NO: 10 SEQ ID NO: 58 hsa-miR-192-5p SEQ ID NO: 11 SEQ ID NO: 59 hsa-miR-215 SEQ ID NO: 12 SEQ ID NO: 60 hsa-miR-375 SEQ ID NO: 13 SEQ ID NO: 61 hsa-miR-193a-5p SEQ ID NO: 14 SEQ ID NO: 62 hsa-miR-483-3p SEQ ID NO: 15 SEQ ID NO: 63 hsa-miR-505-3p SEQ ID NO: 16 SEQ ID NO: 64 hsa-miR-378a-3p SEQ ID NO: 17 SEQ ID NO: 65 hsa-miR-193b-3p SEQ ID NO: 18 SEQ ID NO: 66 hsa-miR-874 SEQ ID NO: 19 SEQ ID NO: 67 hsa-miR-365a-3p SEQ ID NO: 20 SEQ ID NO: 68 hsa-miR-152 SEQ ID NO: 21 SEQ ID NO: 69 hsa-miR-148a-3p SEQ ID NO: 22 SEQ ID NO: 70 hsa-miR-29a-5p SEQ ID NO: 23 SEQ ID NO: 71 hsa-miR-146b-5p SEQ ID NO: 24 SEQ ID NO: 72 hsa-miR-424-3p SEQ ID NO: 25 SEQ ID NO: 73 hsa-miR-125a-5p SEQ ID NO: 26 SEQ ID NO: 74 hsa-miR-342-3p SEQ ID NO: 27 SEQ ID NO: 75 hsa-miR-150-5p SEQ ID NO: 28 SEQ ID NO: 76 hsa-miR-421 SEQ ID NO: 29 SEQ ID NO: 77 hsa-miR-223-5p SEQ ID NO: 30 SEQ ID NO: 78 hsa-miR-495-3p SEQ ID NO: 31 SEQ ID NO: 79 hsa-miR-29a-3p SEQ ID NO: 32 SEQ ID NO: 80 hsa-miR-374b-5p SEQ ID NO: 33 SEQ ID NO: 81 hsa-let-7g-5p SEQ ID NO: 34 SEQ ID NO: 82 hsa-miR-18b-5p SEQ ID NO: 35 SEQ ID NO: 83 hsa-miR-7-1-3p SEQ ID NO: 36 SEQ ID NO: 84 hsa-miR-181c-5p SEQ ID NO: 37 SEQ ID NO: 85 hsa-miR-454-3p SEQ ID NO: 38 SEQ ID NO: 86 hsa-miR-485-3p SEQ ID NO: 39 SEQ ID NO: 87 hsa-miR-374a-5p SEQ ID NO: 40 SEQ ID NO: 88 hsa-miR-99b-5p SEQ ID NO: 41 SEQ ID NO: 89 hsa-miR-191-5p SEQ ID NO: 42 SEQ ID NO: 90 hsa-miR-21-5p SEQ ID NO: 43 SEQ ID NO: 91 hsa-miR-24-3p SEQ ID NO: 44 SEQ ID NO: 92 hsa-miR-27b-3p SEQ ID NO: 45 SEQ ID NO: 93 hsa-miR-222-3p SEQ ID NO: 46 SEQ ID NO: 94 hsa-miR-20a-3p SEQ ID NO: 47 SEQ ID NO: 95 hsa-miR-106b-5p SEQ ID NO: 48 SEQ ID NO: 96 hsa-miR-4790-5p SEQ ID NO: 97 SEQ ID NO: 135 hsa-miR-3692-3p SEQ ID NO: 98 SEQ ID NO: 136 hsa-miR-4433b-3p SEQ ID NO: 99 SEQ ID NO: 137 hsa-miR-6500-3p SEQ ID NO: 100 SEQ ID NO: 138 hsa-miR-4445-5p SEQ ID NO: 101 SEQ ID NO: 139 hsa-miR-5194 SEQ ID NO: 102 SEQ ID NO: 140 hsa-miR-4505 SEQ ID NO: 103 SEQ ID NO: 141 hsa-miR-4430 SEQ ID NO: 104 SEQ ID NO: 142 hsa-miR-374c-3p SEQ ID NO: 105 SEQ ID NO: 143 hsa-miR-4506 SEQ ID NO: 106 SEQ ID NO: 144 hsa-miR-4286 SEQ ID NO: 107 SEQ ID NO: 145 hsa-miR-6816-5p SEQ ID NO: 108 SEQ ID NO: 146 hsa-miR-758-3p* SEQ ID NO: 109 SEQ ID NO: 147 hsa-miR-4535 SEQ ID NO: 110 SEQ ID NO: 148 hsa-miR-490-3p* SEQ ID NO: 111 SEQ ID NO: 149 hsa-miR-6765-5p SEQ ID NO: 112 SEQ ID NO: 150 hsa-miR-3197 SEQ ID NO: 113 SEQ ID NO: 151 hsa-miR-1271-3p SEQ ID NO: 114 SEQ ID NO: 152 hsa-miR-92a-1-5p* SEQ ID NO: 115 SEQ ID NO: 153 hsa-miR-8054 SEQ ID NO: 116 SEQ ID NO: 154 hsa-miR-455-5p* SEQ ID NO: 117 SEQ ID NO: 155 hsa-miR-7151-3p SEQ ID NO: 118 SEQ ID NO: 156 hsa-miR-628-3p* SEQ ID NO: 119 SEQ ID NO: 157 hsa-miR-556-5p* SEQ ID NO: 120 SEQ ID NO: 158 hsa-miR-6726-5p SEQ ID NO: 121 SEQ ID NO: 159 hsa-miR-1179* SEQ ID NO: 122 SEQ ID NO: 160 hsa-miR-3196 SEQ ID NO: 123 SEQ ID NO: 161 hsa-miR-6858-5p SEQ ID NO: 124 SEQ ID NO: 162 hsa-miR-6778-5p SEQ ID NO: 125 SEQ ID NO: 163 hsa-miR-4459 SEQ ID NO: 126 SEQ ID NO: 164 hsa-miR-380-5p* SEQ ID NO: 127 SEQ ID NO: 165 hsa-miR-1273e SEQ ID NO: 128 SEQ ID NO: 166 hsa-let-7b-3p* SEQ ID NO: 129 SEQ ID NO: 167 hsa-miR-4481 SEQ ID NO: 130 SEQ ID NO: 168 hsa-miR-1908-5p SEQ ID NO: 131 SEQ ID NO: 169 hsa-miR-149-3p* SEQ ID NO: 132 SEQ ID NO: 170 hsa-miR-651-3p SEQ ID NO: 133 SEQ ID NO: 171 hsa-miR-124-5p* SEQ ID NO: 134 SEQ ID NO: 172
[0154] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.
[0155] While the present invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the present invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.