INGESTIBLE SYSTEM TO MONITOR GASTROINTESTINAL HEALTH IN SITU
20190313942 ยท 2019-10-17
Assignee
Inventors
- Timothy Kuan-Ta Lu (Cambridge, MA)
- Mark K. Mimee (Cambridge, MA, US)
- Phillip Nadeau (Cambridge, MA, US)
- Anantha P. Chandrakasan (Belmont, MA)
Cpc classification
A61B5/14546
HUMAN NECESSITIES
A61B7/008
HUMAN NECESSITIES
International classification
A61B5/00
HUMAN NECESSITIES
Abstract
Disclosed herein are novel devices comprising small, ultra-low power microelectronic components. In some instances, the microelectronic components is combined with a biosensor component that enables in situ detection of biomolecules. Also disclosed herein are methods of detecting signal analytes and methods of monitoring the health of a patient using these novel devices.
Claims
1. A device comprising an electrical component wherein the electrical component comprises: at least one detector configured to charge a respective capacitance, wherein each of the at least one detector is configured to detect an output from a biosensor component, optionally wherein at least one detector is a photodetector; a comparator configured to compare respective voltage signals from each of the at least one detector to a reference voltage, each voltage signal indicating the charge stored by the respective capacitance; an oscillation counter configured to, when the voltage signal from a first detector of the at least one detector exceeds the reference voltage, store a number of oscillator cycles taken for the first detector to charge the capacitance; and a transmitter configured to, when the voltage signals from each of the at least one detector exceed the reference voltage, wirelessly transmit the respective stored numbers of oscillator cycles taken for the at least one detector to charge the capacitance.
2. (canceled)
3. The device of claim 1, wherein the device contains a calibration scheme for detecting and removing background light and temperature-induced drift.
4. The device of claim 1, wherein the device is shaped as a capsule or spherocylinder; optionally wherein the capsule or spherocylinder comprises a cross-sectional diameter that is shorter than 10 cm, 9 cm, 8 cm, 7 cm, 6 cm, 5 cm, 4 cm, 3 cm, 2 cm, or 1 cm.
5. (canceled)
6. The device of claim 1, wherein the device can be swallowed by a patient.
7. The device of claim 1, further comprising at least one biosensor component, wherein each of the at least one biosensor component: is sensitive to the presence of at least one signal analyte; and communicates the presence of the at least one signal analyte to the electrical component, optionally wherein the communication is proportional to the abundance of the at least one signal analyte; and optionally wherein each of the at least one biosensor component is separated from the outside environment by a semi-permeable membrane that permits diffusion of the at least one signal analyte.
8. (canceled)
9. The device of claim 7, wherein the semi-permeable membrane is a polyethersulfone membrane filter.
10. The device of claim 7, wherein at least one of the at least one biosensor component is an enzymatic biosensor or a non-enzymatic biosensor; optionally wherein: (i) the non-enzymatic biosensor comprises an antibody, a binding protein, or a nucleic acid and/or (ii) the enzymatic or non-enzymatic biosensor is a cellular biosensor comprising at least one microorganism.
11.-12. (canceled)
13. The device of claim 10, wherein the enzymatic or non-enzymatic biosensor is a cellular biosensor comprises at least one microorganism, wherein the at least one microorganism is present in the device in a dormant state; optionally wherein the at least one microorganism: (i) is combined with additional substances to aid in removing the at least one microorganism from its dormant state, to provide nutrients to the at least one microorganism, and/or to prolong the lifetime of the at least one microorganism; and/or (ii) comprises an engineered genetic circuit.
14.-15. (canceled)
16. The device of claim 13, wherein the output of the engineered genetic circuit is luminescence, fluorescence, ion flow, or turbidity; optionally wherein at least one analyte is selected from the group consisting of a microorganism, a biomolecule, or an inorganic molecule.
17.-18. (canceled)
19. The device of claim 16, wherein at least one signal analyte is a biomolecule selected from the group consisting of heme, thiosulfate, and acyl-homoserine lactone.
20. A method of detecting at least one signal analyte in situ comprising contacting the device of claim 1 with a sample and comparing the output of the device to a control; optionally wherein the sample is selected from the group consisting of soil, water, air, or food.
21. (canceled)
22. A method of monitoring the health of a patient comprising contacting the device of claim 1 with a patient and comparing the output of the device to a control; optionally wherein: (i) the control is established through analysis of a population of healthy patients; (ii) the contacting of the device with the patient occurs by oral administration or deposition of the device in the esophagus, stomach, or intestine; and/or (iii) the contacting of the device with the patient occurs by surgical implantation.
23.-25. (canceled)
26. The method of claim 22, wherein the patient is a human patient; optionally wherein the human patient is predisposed and/or diagnosed to a disease, disorder, morbidity, sickness, or illness.
27.-28. (canceled)
29. A device contained within a capsule or spherocylinder suitable for ingestion comprising an electrical component and at least one biosensor component wherein: the electrical component comprises wireless low-power electronics powered by (a) a battery, (b) energy harvesting, or (c) wireless power transfer, wherein the low-power electronics comprise at least one detector, optionally wherein at least one detector is a photodetector; and each biosensor component (a) is separated from the external environment via a semi-permeable membrane, (b) is sensitive to the presence of at least one signal analyte, and (c) communicates the presence of the at least one signal analyte to the electrical component, optionally wherein: (i) the communication is proportional to the abundance of the at least one signal analyte and/or (ii) the semi-permeable membrane is a polyethersulfone membrane filter; and optionally wherein the capsule or spherocylinder comprises a cross-sectional diameter that is shorter than 10 cm, 9 cm, 8 cm, 7 cm, 6 cm, 5 cm, 4 cm, 3 cm, 2 cm, or 1 cm.
30.-32. (canceled)
33. The device of claim 29, wherein at least one of the at least one biosensor component is an enzymatic biosensor or a non-enzymatic biosensor, optionally wherein: (i) the non-enzymatic biosensor comprises an antibody, a binding protein, or a nucleic acid; and/or (ii) the enzymatic biosensor or non-enzymatic biosensor is a cellular biosensor comprising at least one microorganism.
34.-35. (canceled)
36. The device of claim 33, wherein: (i) at least one microorganism is present in the device in a dormant state; (ii) at least one microorganism is combined with additional substances to aid in removing the at least one microorganism from its dormant state, to provide nutrients to the at least one microorganism, and/or to prolong the lifetime of the at least one microorganism; and/or (iii) at least one microorganism comprises an engineered genetic circuit; optionally wherein the device further comprises at least one control component comprising a reference microorganism for calibration to remove background light and temperature induced drift.
37.-39. (canceled)
40. The device of claim 36, wherein the output of the engineered genetic circuit is luminescence, fluorescence, ion flow, or turbidity; optionally wherein at least one signal analyte is selected from the group consisting of a microorganism, a biomolecule, or an inorganic molecule.
41.-42. (canceled)
43. The device of claim 42, wherein at least one signal analyte is a biomolecule selected from the group consisting of heme, thiosulfate, and acyl-homoserine lactone.
44. A method of monitoring the health of a patient comprising orally administering the device of claim 29 to a patient and comparing the output of the device to a control; optionally wherein the control is established through analysis of a population of healthy patients.
45. (canceled)
46. The method of claim 44, wherein the patient is a human patient, optionally wherein the human patient is predisposed and/or diagnosed to a disease, disorder, morbidity, sickness, or illness.
47.-48. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. It is to be understood that the data illustrated in the drawings in no way limit the scope of the disclosure.
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION
[0038] The scaling of semiconductor microelectronics over the past few decades has delivered sophisticated, highly sophisticated platforms for sensing, computating, and wireless communication (Otis B. and Parviz B., Google Off. Blog, 2014; Wang H., IEEE Microw. Mag., Jill 2013; 14(5): 110-30; Norian H., et al., Lab Chip., 2014 Oct. 21; 14(20): 4076-84). These platforms have been incorporated into devices that monitor health and disease. For example, in the gastrointestinal tract, electronic capsules have been deployed for taking visual images (Iddan G., et al., Nature, 2000 May; 405(6785): 417) (15), delivering drugs while measuring temperature and pH (van der Schaar P. J., et al., Gastrointest. Endosc., 2013 September; 78(3): 520-28), and recording patient compliance (Hafezi H., et al., IEEE Trans. Biomed. Eng., 2015 January; 62(1): 99-109). While electronics provide a versatile interface for collecting, processing, and sharing information, their ability to directly sense biomolecules in vivo has been limited due to their dependence on labile biochemical transducers that necessitate large, power-demanding circuits for sensitive detection.
[0039] By combining the environmental resilience and natural sensing properties of bacterial cells with the complex data processing and wireless transmission afforded by microelectronics, a device capable of in vivo biosensing in harsh, difficult-to-access environments was developed. Using gastrointestinal bleeding as a proof-of-concept model system, strategies for genetic circuit design and optimization, fabrication of an ingestible low-power, wireless luminometer, and validation of integrated system functionality were demonstrate both in vitro and in a large animal model.
[0040] As the field of whole-cell biosensors matures, newly developed sensors of clinically-relevant biomarkers can be rapidly integrated into a MicroBioElectronic Device (MBED) to perform minimally-invasive detection in the gastrointestinal tract. By creating a larger array of photodetectors, a panel of biochemical tests can be simultaneously performed by a single device. With a test panel of candidate biomolecules, MBEDs enable studies of biochemical activity in anatomical regions that are traditionally difficult to access and lead to the discovery of novel clinical biomarkers associated with health or disease. Further integration of electronic modules, such as photodetectors, microprocessor and transmitter, in a single integrated circuit allows for further miniaturization of MBEDs as well as lower power consumption. Additional measurement channels also enables more precise biochemical readings, as the response of replicate biosensors within the same device could be averaged to mitigate the inherent variance of biological sensors as well as the heterogeneity of the complex gastrointestinal environment. This integration of biological engineering and semiconductor electronics offers opportunities to transform diagnosis, management, and monitoring of health and disease.
[0041] Disclosed herein are novel devices comprising small, ultra-low power microelectronic components that overcome these limitations. For example, integration of electronic modules, such as photodetectors, microprocessor and transmitter, in a single integrated circuit can allow for further miniaturization of MBEDs as well as lower power consumption.
[0042]
[0043] The detectors are connected to an ultra-low power (ULP) luminescence chip, which may be configured to determine when the detectors are indicating the presence of an analyte. For example, the ULP luminescence chip may measure voltage and/or current signals generated by photodetectors in response to luminescence from an engineered genetic circuit. The ULP luminescence chip may include any suitable circuitry for interfacing with the detectors and receiving signals indicating the presence of an analyte. For example, the detectors may be used to charge a capacitance, and the ULP luminescence chip may measure the voltage across the capacitance. In some embodiments, the output level of an engineered genetic circuit may be determined based on the amount of time that is required for the respective detector to charge the capacitance, the amount of time being related to a current signal generated by the detector in response to the output luminescence) of the engineered genetic circuit.
[0044] The ULP luminescence chip interfaces with a microcontroller and radio chip that may be used to wirelessly transmit indications of the detector outputs to a receiver. The wireless transmission allows for monitoring that may substantially continuous and performed in real time. For example, data may be transmitted at regular intervals or in response to signals from the detectors. In some embodiments, as shown in
[0045]
[0046] The electrical component includes at least one photodetector configured to charge a capacitance. In some embodiments, the capacitance is internal to the photodetector. The photodetectors may be associated with at least one biosensor component of the MBED. One or more photodetectors may be used as controls to detect common mode signals that may be subsequently suppressed. The photodetectors may provide respective voltage signals, indicating the charge stored by the capacitance, to a comparator that may be configured to compare the respective voltage signals to a reference voltage. When the voltage signal from one of the photodetectors exceeds the reference voltage, an oscillation counter may store a number of oscillator cycles that occurred during the time required for the photodetector to charge the capacitance. When the voltage signals from all or a portion of the photodetectors exceed the reference voltage, the wireless transmitter may wirelessly transmit the numbers of oscillator cycles stored for each of the photodetectors with voltages that exceeded the threshold.
[0047] In some embodiments, the device contains a calibration scheme for detecting and removing background light and temperature-induced drift (see e.g., Material and Methods).
[0048] The electrical component of the device can be made small enough to perform detection in space-constrained environments. The low power consumption of the device, which in some embodiments is on the order of 10 uW or less, enables the use of a millimeter-scale battery for extended measurement. For example, in some embodiments, the device comprises a battery, wherein the longest cross-sectional measurement of the battery is shorter than 10 mm, 9 mm, 8 mm, 7 mm, 6 mm, 5 mm, 4 mm, 3 mm, 2 mm, or 1 mm. Other power sources known to those of skill in the art can be utilized in the device, in addition to or in place of the battery, such as energy harvesting component(s) or wireless power transfer component(s).
[0049] Semiconductor integration and packaging allow all components of the device to be placed in a compact arrangement. For example, in some embodiments, the device is encapsulated within a capsule or spherocylinder comprising a cross-sectional diameter that is shorter than 100 cm, 50 cm, 25 cm, 20 cm, 15 cm, 10 cm, 9 cm, 8 cm, 7 cm, 6 cm, 5 cm, 4 cm, 3 cm, 2 cm, 1 cm, 0.9 cm, 0.8 cm, 0.7 cm, 0.6 cm, 0.5 cm, 0.4 cm, 0.3 cm, 0.2 cm, or 0.1 cm. In some embodiments, the device is ingestible (or suitable for ingestion) or implantable.
[0050] The devices described herein are capable of detecting a wide range of analytes or combinations of analytes. In some embodiments, an analyte is selected from the group consisting of a microorganism, a biomolecule, or an inorganic molecule. As used herein, the term biomolecule refers to a molecule generated by an organism. In some embodiments, the biomolecule is a macromolecule. Examples of macromolecules include, but are not limited to, proteins (i.e., polypeptides), carbohydrates, lipids, nucleic acids (i.e., polynucleic acids), and combinations thereof. In some embodiments, the biomolecule is a small molecule such as a metabolite, secondary metabolite, or a natural product. Examples of small molecule biomolecules are known to those having ordinary skill in the art In some embodiments, the biomolecule is selected from the group consisting of heme, thiosulfate, and acyl-homoserine lactone. As used herein, the term inorganic molecule refers to any molecule (including an element) that is not a biomolecule. In some embodiments, the inorganic molecule is a gas, a heavy metal (e.g., Hg, Cd, Ni, Co, Zn, Cu, Pb, Au), a PCB, or a pesticide.
[0051] In some embodiments, the device facilitates the detection of numerous analytes. For example, by creating a large array of photodetectors, a panel of biochemical tests can be simultaneously performed by a single device.
[0052] Also described herein are MBEDs that combine biosensors with the ultra-low power electronics described above to enable in situ detection of analytes (
[0053] In some embodiments, the biosensor component is sensitive to the presence of at least one signal analyte and communicates the presence of the at least one signal analyte to the electronic component. As used herein the term sensitive to the presence of refers to the ability of a biosensor to detect the presence of an analyte above a threshold amount. As such, the sensitivity of a biosensor will vary. Methods of determining the sensitivity of a particular biosensor are known to those having skill in the art (see e.g., Example 1).
[0054] As used herein the term communicates the presence of refers to the generation of an output that can be sensed by the electronic component of the device. In some embodiments, the output of the engineered genetic circuit is luminescence chemiluminescence, triboluminescence, photoluminescence, fluorescence, phosphorescence), ion flow (e.g., resulting from the opening of a channel or a redox reaction), or turbidity (e.g., cell growth that precludes the passage of light). For example, the sensing of a target analyte by a biosensor may generate light, which can be detected by photodetectors embedded in the electronic component. These electrical signals can then be processed by integrated bioluminescence detection incorporated into the circuit (Nadeau P., et al., IEEE, 2017 Mar. 6; doi10.1109/ISSCC.2017.7870406) and transmitted wirelessly from the device to an external radio or cellular phone for convenient readout.
[0055] In some embodiments, the communication is proportional to the abundance of the at least one signal analyte (i.e., the strength of a signal increase as the abundance of the analyte increases).
[0056] In some embodiments, the biosensor lies adjacent to readout electronics, separated from the outside environment by a semi-permeable membrane that permits diffusion of analytes. As used herein, the term permits diffusion relates to the pore size of the semi-permeable membrane. If a barrier permits the diffusion of an analyte, the radius of the pore of the membrane is larger than the radius of the analyte (e.g., Stokes radius). In some embodiments, the semi-permeable membrane is a polyethersulfone (PES) membrane filter.
[0057] In some embodiments, at least one of the at least one biosensor is an enzymatic biosensor or a non-enzymatic biosensor. An enzymatic biosensor, as used herein, comprises an enzyme that recognizes the target analyte to produce an output that can be sensed by the electronic component of the device. The output may be a signal generated through: 1) the enzymatic conversion of the analyte into a new product; 2) analyte-mediated inhibition or activation of the enzyme; or 3) analyte-mediate modification of enzyme properties. As used herein, the term enzyme refers to a biomolecule that acts as a catalyst to bring about a specific biochemical reaction.
[0058] In contrast, a non-enzymatic biosensor does not require interaction between an enzyme and a target analyte. For example, in some embodiments, a non-enzymatic biosensor comprises a protein channel that facilitates the signal flow (or output) when in the presence of an analyte. In some embodiments, a non-enzymatic biosensor comprises an antibody or a binding protein that recognizes the presence of an analyte. In some embodiments, the non-enzymatic biosensor comprises a nucleic acid that hybridizes to an analyte or otherwise hinds to it (e.g., as an aptamer). In some embodiments, the non-enzymatic biosensor comprises of a transcription factor that alters gene expression upon binding to an analyte.
[0059] In some embodiments, the enzymatic biosensor or non-enzymatic biosensor is a cellular biosensor comprising at least one microorganism. As used herein, the term microorganism refers to microscopic living organisms including archaea, bacteria, fungi, protista, microbial mergers or symbionts, planarians (e.g., C. elegans), and suspensions of mammalian cells, plant cells, or insect cells. In some embodiments, the cellular biosensor is an E. coli bacterium. In some embodiments, the at least one microorganism is present in the device in a dormant state. For example, in some embodiments the at least one microorganism is freeze-dried or lyophilized prior to or during device manufacture. Microorganisms present in the device in a dormant state may be removed from the dormant state prior to device use (e.g., through hydration) or as a result of device use. In some embodiments, the at least one microorganism is combined with additional substances to aid in removing the at least one microorganism from its dormant state (e.g., a wetting agent), to provide nutrients to the at least one microorganism, and/or to prolong the lifetime of the at least one microorganism in environments sub-optimal for the at least one microorganism (e.g., low pH or high pH).
[0060] Microorganisms living on and in the human body constantly interrogate their biochemical surroundings and alter gene expression to adapt to changing environments. Whole-cell biosensors harness this sensing ability to detect analytes of interest. In some embodiments, the cellular biosensor lies adjacent to readout electronics in individual wells separated from the outside environment by a semi-permeable membrane that confines cells in the device and allows for diffusion of analytes.
[0061] Synthetic biology enables the robust engineering of living cells with increasingly complex genetic circuits to sense multiple biological inputs and control gene expression (Brophy J. A. and Voigt C. A., Nat. Methods., 2014 May; 11(5): 508-20.). In some embodiments, the cellular biosensor comprises an engineered genetic circuit. Examples of engineered genetic circuits are provided in Example 1, Example 2, and Example 5. Other non-limiting examples of engineered genetic circuits for detection of analytes of interest include: US 2017/0058282 (describing genetically engineered sensors for in vivo detection of bleeding), US 2017/0360850 (describing genetically engineered sensors for in vivo detection of hydrogen peroxide, nitric oxide, inflammatory cytokines such as IL-6, IL-18, or TNF-alpha), US 2017/0335411 (describing genetically engineered sensors for in vivo detection of signals including chemical signals), and US 2017/0255857 (describing genetically engineered analog-to-digital biological converter switches and their use in biological systems including as sensors).
[0062] In some aspects, the disclosure relates to methods of detecting at least one signal analyte. In some embodiments, the method comprises contacting a device as described above with a sample and comparing the output of the device to a control, wherein the control contains a known quantity of the at least one signal analyte. As described herein, the term lacks a detectable quantity relates to a threshold amount of analyte that is detectable by a device above background level. As such, the term lack a detectable quantity is tied to the sensitivity of the particular device. Methods of determining the sensitivity of a particular device are known to those having skill in the art (see e.g., Materials and Methods and Example 5).
[0063] Whole-cell biosensors have been used previously to detect analytes associated with environmental contamination (Roggo C., and van der Meer J. R., Curr. Opin. Biotechnol. 2017 June; 45: 24-33). In some embodiments, the sample is selected from the group consisting of soil, water, air, or food.
[0064] The integration of biological engineering and semiconductor electronics offers opportunities to transform diagnosis, management, and monitoring of health and disease. Previously described biosensors have been developed to sense clinically relevant biomarkers in serum or urine ex vivo (Courbet A., et al., Sci. Transl. Med., 2015 May 27; 7(289): 289-83) as well as gut biomolecules supplemented in diet (Kotula J. W., et al., Proc. Natl. Acad. Sci. U.S.A, 2014 Apr. 1; 111(13): 4838-43; Mimee M., et al., Cell Syst., 2016 March 23; 2(3): 214; Lim B., et al., Cell, 2017 Apr. 20; 169(3): 547-58.e15) or generated during disease (Daeffler K. N., et al., Mol. Syst. Biol., 2017 Apr. 3; 13(4): 923; Riglar D. T., et al., Nat. Biotechnol., 2017 July; 35(7): 653-58; Pickard J. M., et al., Nature, 2014 Oct. 30; 514(7524): 638-41). However, despite their promise as non-invasive diagnostics, previously described biosensors have yet to be employed for clinically compatible testing in an unobtrusive, real-time, and user-friendly way. Current research applications of ingestible biosensors in animal models rely on cumbersome analysis of bacterial gene expression or DNA in stool samples (Kotula J. W., et al., Proc. Natl. Acad. Sci. U.S.A, 2014 Apr. 1; 111(13): 4838-43; Mimee M., et al., Cell Syst., 2016 Mar. 23; 2(3): 214; Lim B., et al., Cell, 2017 Apr. 20; 169(3): 547-58.e15; Daeffler et al., Mol. Syst. Biol., 2017 Apr. 3; 13(4): 923; Riglar D. T., et al., Nat. Biotechnol., 2017 July; 35(7): 653-58; Pickard J. M., et al., Nature, 2014 Oct. 30; 514(7524): 638-41), rather than real-time reporting from within the body. Moreover, biomolecular monitoring is often impeded by access to the remote and complex environments. The MicroBioElectronic Devices (MBEDs) described herein overcome the limitation of the prior art and are capable of in vivo biosensing in harsh, difficult-to-access environments.
[0065] In some aspects, the disclosure relates to methods of monitoring the health of a patient. In some embodiments, the method comprises contacting a device as described above with a patient and comparing the output of the device to a control, wherein the control is a reference value that optionally is established through analysis of a population of healthy patients.
[0066] In some embodiments the patient is a domestic or wild animal. In some embodiments, the patient is a human patient.
[0067] In some embodiments, the contacting occurs by oral administration of the device to the patient or other delivery methods that result in deposition of the device into the esophagus, stomach, or intestine. In some embodiments, deposition arises through the consuming or the swallowing of the device by the patient. In other embodiments, the contacting of the device with the patient occurs by implantation, such as by surgical implantation. In some embodiments, the contacting occurs by attachment to the surface of the patient, e.g., the skin.
[0068] In some embodiments, the patient is being monitored in a pre-clinical or clinical trial.
[0069] In some embodiments, the patient is a human patient. In some embodiments, the human patient is predisposed to a disease, disorder, morbidity, sickness, or illness. In some embodiments, the human patient has been diagnosed with a disease, disorder, morbidity, sickness, or illness.
Examples
Materials and Methods
[0070] Bacterial Strains and Culture Conditions:
[0071] Routine cloning and plasmid propagation was performed in E. coli DH5a, Gene circuits were initially prototyped in E. coli MG1.655 and were transferred into probiotic E. coli Nissle 1917 for capsule and in vivo experiments. Cells were routinely cultured at 37 C. in Luria-Bertani (LB) media (Difco). Where appropriate, growth media was supplemented with antibiotics at the following concentrations: 30 g/mL kanamycin, 100 g/mL carbenicillin, 25 g/mL chloramphenicol and 100 g/mL spectinomycin.
[0072] Genetic Part and Plasmid Construction:
[0073] Genetics parts and plasmids used in this study are listed in TABLE 1 and TABLE 2 and will be available from Addgene upon publication. All plasmids were constructed by combining PCR fragments generated by Kapa Hifi Polymerase using Gibson Assembly (Gibson D. G., et al., Nat Meth., 2009 May; 6(5): 343-45). Assembly products were transformed into chemically competent E. coli DH5a (Chung C. J., et al., Proc. Natl. Acad. Sci. U.S.A, 1989 April; 86(7): 2172-75) and sequences were confirmed using Sanger sequencing. Ribosome binding sites (RBSs) of variable strengths were computationally designed using the Salis lab RBS calculator (Espah Borujeni A., et al., Nucleic Acids Res., 2014 February; 42(4): 2646-59; Salis H. M., et al., Nat. Biotechnol., 2009 October; 27(10): 946-50),
TABLE-US-00001 TABLE1 GeneticParts SEQ Part ID Name NO: Type DNAsequence HrtRO 1 HrtRoperator ATGACACAGTGTCAT sequence PL(HrtO) 2 Heme-inducible ATAAATGACACAGTGTCATTTGACAAAATGACACAGTG Promoter TCATGATACTGAGCACA Plux 3 AHL-inducible ACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTT promoter TGTTATAGTCGAATAAA PphsA 4 Thiosulfate- TTCAAGCATTATTATGCTGTTTTTTGAAGTGAATGTGCG induciblepromoter GCCATCTAGCCGCACATTTTGCATCTAAAACATGCAGT CATCAGCAAAATAATAAACTTTTCCCCAATATGTGGTTT ACCACAATTTACAGGAATTCACTCCTGTGGTGGTGCAA ATTTGAACTGTGAATTGCTTCACAAACGCCGCTATCGC AATGTCAGTATGTGGTTTACCACAATATCTAATATCACT CTGCTCAATAACAATGATGAAAACCTTAGGAAGAAGTT AATTGTGTTAAACAGTTAACTAGGGGCTTTATCTAACG CTCTCCTAAGGACAACTGTCATTGGGAGATTTAAC J23107 5 Constitutive TTTACGGCTAGCTCAGCCCTAGGTATTATGCTAGCACAT Promoter+ RBSfor TTCCAACACTAACCCAAGGGAGCTTTAAATC ChuA ProD 6 Consitutive CACAGCTAACACCACGTCGTCCCTATCTGCTGCCCTAG PromoterforHrtR GTCTATGAGTGGTTGCTGGATAACTTTACGGGCATGCA TAAGGCTCGTATAATATATTCAGGGAGACCACAACGGT TTCCCTCTACAAATAATTTTGTTTAACTTT K176009 7 Consitutive TTTACGGCTAGCTCAGTCCTAGGTATTATGCTAGCACTA Promoter+ RBSfor GAAAAGAGGAGAAAACTAGA LuxR J23104 8 Constitutive TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGCCTAG Promoter+ RBSfor TATCGATCTCCATAACTATCCTATAGATC ThsS J23105 9 Constitutive TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGCAGA Promoter+ RBSfor AATATAAAGAACGATCTATTTATCCGCGTAC ThsR RBS1 10 HrtRRBSvariant GCTATAAGAAAACACCCTTTATAATCTAGGTTAAT RBS2 11 HrtRRBSvariant ATTAAAGAGGAGAAAG RBS3 12 HrtRRBSvariant TATACTCTAATTAATCACATAATAAGGACGAATTT RBS4 13 HrtRRBSvariant AGCCGCAAACATATAAGGAGGAACCCC HrtR 14 Heme-responsive ATGCCAAAATCAACCTATTTTAGTCTTTCTGACGAAAA transcriptional ACGAAAACGTGTCTATGATGCCTGTTTACTAGAATTTCA repressor AACGCACTCTTTCCATGAAGCTAAAATCATGCACATCG TAAAAGCACTTGATATCCCAAGAGGAAGTTTTTATCAA TACTTTGAAGATTTGAAGGATTCATACTATTATATCTTG TCACAGGAAACTGTCGAGATTCATGATTTATTTTTTAAT TTACTAAAAGAATATCCTCTAGAAGTTGCTCTTAATAA ATACAAGTATCTTCTTCTTGAAAATTTAGTAAATTCGCC CCAATATAATCTTTATAAATATCGATTTTTAGATTGGAC TTATGAATTAGAAAGAGATTGGAAGCCTAAAGGCGAG GTAACTGTTCCCGCTCGTGAACTTGATAATCCTATTTCC CAAGTATTAAAATCAGTCATTCACAATCTAGTTTATCGC ATGTTTAGTGAAAATTGGGATGAACAAAAGTTTATTGA AACTTACGATAAAGAAATCAAATTGCTCACAGAGGGCT TGCTTAATTATGTTACTGAAAGCAAAAAATAG ChuA 15 Outermembrane ATGTCACGTCCGCAATTTACCTCGTTGCGTTTGAGTTTA hemetransporter TTGGCCTTAGCTGTTTCTGCCACCTTGCCAACGTTTGCT TTTGCTACTGAAACCATGACCGTTACGGCAACGGGGAA TGCCCGTAGTTCCTTCGAAGCGCCTATGATGGTCAGCGT CATCGACACTTCCGCTCCTGAAAATCAAACGGCTACTT CAGCCACCGATCTGCTGCGTCATGTTCCTGGAATTACTC TGGATGGTACCGGACGAACCAACGGTCAGGATGTAAAT ATGCGTGGCTATGATCATCGCGGCGTGCTGGTTCTTGTC GATGGTGTTCGTCAGGGAACGGATACCGGACACCTGAA TGGCACTTTTCTCGATCCGGCGCTGATCAAGCGTGTTGA GATTGTTCGTGGACCTTCAGCATTACTGTATGGCAGTGG CGCGCTGGGTGGAGTGATCTCCTACGATACGGTCGATG CAAAAGATTTATTGCAGGAAGGACAAAGCAGTGGTTTT CGTGTCTTTGGTACTGGCGGCACGGGGGACCATAGCCT GGGATTAGGCGCGAGCGCGTTTGGGCGAACTGAAAATC TGGATGGTATTGTGGCCTGGTCCAGTCGCGATCGGGGT GATTTACGCCAGAGCAATGGTGAAACCGCGCCGAATGA CGAGTCCATTAATAACATGCTGGCGAAAGGGACCTGGC AAATTGATTCAGCCCAGTCTCTGAGCGGTTTAGTGCGTT ACTACAACAACGACGCGCGTGAACCAAAAAATCCGCA GACCGTTGGGGCTTCTGAAAGCAGCAACCCGATGGTTG ATCGTTCAACAATTCAACGCGATGCGCAGCTTTCTTATA AACTCGCCCCGCAGGGCAACGACTGGTTAAATGCAGAT GCAAAAATTTTATTGGTCGGAAGTCCGTATTAATGCGCA AAACACGGGGAGTTCCGGCGAGTATCGTGAACAGATA ACAAAAGGAGCCAGGCTGGAGAACCGTTCCACTCTCTT TGCCGACAGTTTCGCTTCTCACTTACTGACATATGGCGG TGAGTATTATCGTCAGGAACAACATCCGGGCGGCGCGA CGACGGGCTTCCCGCAAGCAAAAATCGATTTTAGCTCC GGCTGGCTACAGGATGAGATCACCTTACGCGATCTGCC GATTACCCTGCTTGGCGGAACCCGCTATGACAGTTATC GCGGTAGCAGTGACGGTTACAAAGATGTTGATGCCGAC AAATGGTCATCTCGTGCGGGGATGACTATCAATCCGAC TAACTGGCTGATGTTATTTGGCTCATATGCCCAGGCATT CCGCGCCCCGACGATGGGCGAAATGTATAACGATTCTA AGCACTTCTCGATTGGTCGCTTCTATACCAACTATTGGG TGCCAAACCCGAACTTACGTCCGGAAACTAACGAAACT CAGGAGTACGGTTTTGGGCTGCGTTTTGATGACCTGAT GTTGTCCAATGATGCTCTGGAATTTAAAGCCAGCTACTT TGATACCAAAGCGAAGGATTACATCTCCACGACCGTCG ATTTCGCGGCGGCGACGACTATGTCGTATAACGTCCCG AACGCCAAAATCTGGGGCTGGGATGTGATGACGAAATA TACCACTGATCTGTTTAGCCTTGATGTGGCCTATAACCG TACCCGCGGCAAAGACACCGATACCGGCGAATACATCT CCAGCATTAACCCGGATACTGTTACCAGCACTCTGAAT ATTCCGATCGCTCACAGTGGCTTCTCTGTTGGGTGGGTT GGTACGTTTGCCGATCGCTCAACACATATCAGCAGCAG TTACAGCAAACAACCAGGCTATGGCGTGAATGATTTCT ACGTCAGTTATCAAGGACAACAGGCGCTCAAAGGTATG ACCACTACTTTGGTGTTGGGTAACGCTTTCGACAAAGA GTACTGGTCGCCGCAAGGCATCCCACAGGATGGTCGTA ACGGAAAAATTTTCGTGAGTTATCAATGGTAA ThsS 16 Thiosulfate- ATGTCCCGCCTGCTGCTGTGTATCTGTGTTCTGCTGTTC responsive TCTTCTGTGGCGTGGTCTAAACCGCAGCAGTTTTATGTG histidinekinase GGCGTACTGGCTAACTGGGGTCATCAGCAAGCCGTTGA ACGTTGGACCCCGATGATGGAGTATCTGAACGAACATG TGCCGGACGCGGAATTTCACGTCTACCCGGGCAACTTC AAAGCACTGAACCTGGCAATGGAACTGGGCCAGATTCA GTTCATTATCACTAACCCGGGCCAATATCTGTACCTGAG CAATCAGTACCCGCTGTCTTGGCTGGCGACCATGCGTTC TAAGCGTCACGATGGTACCACTTCTGCGATCGGTTCCG CCATTATTGTCCGCGCGGACAGCGACTACCGCACCCTG TACGACCTGAAAGGTAAAGTGGTGGCTGCGTCCGACCC GCATGCTCTGGGTGGCTACCAAGCGACCGTCGGTCTGA TGCATTCCCTGGGCATGGATCCGGACACCTTCTTCGGTG AAACCAAGTTTCTGGGCTTTCCACTGGATCCGCTGCTGT ACCAAGTTCGTGATGGCAACGTTGACGCGGCCATTACC CCACTGTGCACTCTGGAGGACATGGTTGCACGCGGCGT ACTGAAATCTTCCGATTTTCGTGTGCTGAACCCTAGCCG CCCGGATGGTGTAGAATGCCAGTGCTCTACCACCCTGT ACCCGAACTGGTCTTTCGCTGCGACTGAGTCTGTATCCA CCGAACTGTCTAAAGAAATCACGCAGGCACTGCTGGAA CTGCCATCCGACAGCCCGGCAGCTATCAAAGCGCAACT GACCGGCTGGACCAGCCCGATCTCCCAACTGGCGGTAA TCAAACTGTTCAAAGAGCTGCACGTAAAAACCCCGGAC TCTAGCCGTTGGGAAGCCGTTAAGAAGTGGCTGGAAGA AAACCGTCACTGGGGTATCCTGTCTGTTCTGGTGTTCAT CATTGCAACGCTGTATCACCTGTGGATTGAATACCGCTT CCACCAAAAAAGCTCTTCTCTGATCGAATCTGAACGTC AGCTGAAACAGCAAGCTGTTGCCCTGGAACGTCTGCAA TCTGCTAGCATCGTTGGTGAAATTGGTGCGGGTCTGGC CCACGAGATTAATCAGCCGATCGCTGCAATTACCTCTT ATTCTGAAGGTGGCATCATGCGCCTGCAAGGTAAAGAA CAGGCGGATACGGATAGCTGCATCGAACTGCTGGAAAA AATCCACAAACAGAGCACTCGCGCAGGCGAAGTGGTG CACCGCATCCGTGGTCTGCTGAAACGTCGTGAAGCGGT GATGGTAGATGTTAACATCCTGACCCTGGTGGAAGAAT CCATCAGCCTGCTGCGTCTGGAGCTGGCACGTCGCGAA ATCCAGATCAACACTCAGATCAAAGGTGAACCGTTCTT CATTACTGCCGACCGCGTTGGCCTGCTGCAAGTTCTGAT TAACCTGATCAAAAACTCCCTGGACGCGATCGCTGAAT CTGATAATGCCCGTTCTGGTAAAATCAACATCGAACTG GACTTTAAAGAGTACCAGGTAAACGTCTCCATCATCGA TAACGGTCCGGGCCTGGCGATGGATTCTGACACTCTGA TGGCTACGTTTTACACTACCAAAATGGATGGCCTGGGC CTGGGTCTGGCAATCTGCCGCGAAGTTATCAGCAACCA CGACGGCCACTTCCTGCTGTCCAACCGTGACGACGGCG TTCTGGGCTGTGTGGCAACCCTGAATCTGAAAAAACGC GGTTCTGAAGTGCCGATCGAAGTCTAA ThsR 17 Thiosulfate- ATGCAGCAGCAAATCAACGGCCCGGTCTACCTGGTGGA responsive TGATGATGAAGCCATTATCGACTCCATCGATTTTTTGAT responseregulator GGAGGGCTACGGTTACAAACTGAACTCGTTTAACTGCG GCGATCGCTTTTTGGCAGAAGTCGATCTCACCCAGGCA GGATGTGTAATTCTGGATGCGCGTATGCCAGGCTTAAC TGGTCCTCAGGTGCAACAGCTGCTGAGCGACGCGAAAA GCCCGCTTGCGGTCATCTTCCTGACCGGCCATGGCGAT GTTCCGATGGCGGTTGATGCGTTCAAAAATGGCGCGTT CGATTTCTTTCAAAAACCTGTGCCGGGTAGCTTGCTCAG TCAGTCAATTGCCAAAGGCTTGACTTATTCAATCGATCA ACATCTGAAACGTACTAACCAAGCGTTAATCGACACGC TCTCGGAACGCGAAGCTCAAATTTTTCAACTGGTGATT GCAGGCAACACCAACAAACAGATGGCTAACGAGCTTTG CGTGGCTATTCGTACCATTGAGGTTCACCGTAGCAAAC TGATGACCAAACTGGGTGTTAACAACCTGGCTGAACTG GTTAAACTGGCGCCGCTGCTGGCACATAAATCCGAATA A LuxR 18 AHL-responsive ATGAAAAACATAAATGCCGACGACACATACAGAATAA transcriptionfactor TTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATT AATCAATGCTTATCTGATATGACTAAAATGGTACATTGT GAATATTATTTACTCGCGATCATTTATCCTCATTCTATG GTTAAATCTGATATTTCAATCCTAGATAATTACCCTAAA AAATGGAGGCAATATTATGATGACGCTAATTTAATAAA ATATGATCCTATAGTAGATTATTCTAACTCCAATCATTC ACCAATTAATTGGAATATATTTGAAAACAATGCTGTAA ATAAAAAATCTCCAAATGTAATTAAAGAAGCGAAAAC ATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTCATAC GGCTAACAATGGCTTCGGAATGCTTAGTTTTGCACATTC AGAAAAAGACAACTATATAGATAGTTTATTTTTACATG CGTGTATGAACATACCATTAATTGTTCCTTCTCTAGTTG ATAATTATCGAAAAATAAATATAGCAAATAATAAATCA AACAACGATTTAACCAAAAGAGAAAAAGAATGTTTAG CGTGGGCATGCGAAGGAAAAAGCTCTTGGGATATTTCA AAAATATTAGGTTGCAGTGAGCGTACTGTCACTTTCCAT TTAACCAATGCGCAAATGAAACTCAATACAACAAACCG CTGCCAAAGTATTTCTAAAGCAATTTTAACAGGAGCAA TTGATTGCCCATACTTTAAAAATTAATAA LuxCDABE 19 Photorhabdus TCAGCAGGACGCACTGACCATTAAAGAGGAGAAAGGT luminescens ACCATGACTAAAAAAATTTCATTCATTATTAACGGCCA luciferaseoperon GGTTGAAATCTTTCCCGAAAGTGATGATTTAGTGCAAT includingRBSs CCATTAATTTTGGTGATAATAGTGTTTACCTGCCAATAT TGAATGACTCTCATGTAAAAAACATTATTGATTGTAAT GGAAATAACGAATTACGGTTGCATAACATTGTCAATTT TCTCTATACGGTAGGGCAAAGATGGAAAAATGAAGAAT ACTCAAGACGCAGGACATACATTCGTGACTTAAAAAAA TATATGGGATATTCAGAAGAAATGGCTAAGCTAGAGGC CAATTGGATATCTATGATTTTATGTTCTAAAGGCGGCCT TTATGATGTTGTAGAAAATGAACTTGGTTCTCGCCATAT CATGGATGAATGGCTACCTCAGGATGAAAGTTATGTTC GGGCTTTTCCGAAAGGTAAATCTGTACATCTGTTGGCA GGTAATGTTCCATTATCTGGGATCATGTCTATATTACGC GCAATTTTAACTAAGAATCAGTGTATTATAAAAACATC GTCAACCGATCCTTTTACCGCTAATGCATTAGCGTTAAG TTTTATTGATGTAGACCCTAATCATCCGATAACGCGCTC TTTATCTGTTATATATTGGCCCCACCAAGGTGATACATC ACTCGCAAAAGAAATTATGCGACATGCGGATGTTATTG TCGCTTGGGGAGGGCCAGATGCGATTAATTGGGCGGTA GAGCATGCGCCATCTTATGCTGATGTGATTAAATTTGGT TCTAAAAAGAGTCTTTGCATTATCGATAATCCTGTTGAT TTGACGTCCGCAGCGACAGGTGCGGCTCATGATGTTTG TTTTTACGATCAGCGAGCTTGTTTTTCTGCCCAAAACAT ATATTACATGGGAAATCATTATGAGGAATTTAAGTTAG CGTTGATAGAAAAACTTAATCTATATGCGCATATATTA CCGAATGCCAAAAAAGATTTTGATGAAAAGGCGGCCTA TTCTTTAGTTCAAAAAGAAAGCTTGTTTGCTGGATTAAA AGTAGAGGTGGATATTCATCAACGTTGGATGATTATTG AGTCAAATGCAGGTGTGGAATTTAATCAACCACTTGGC AGATGTGTGTACCTTCATCACGTCGATAATATTGAGCA AATATTGCCTTATGTTCAAAAAAATAAGACGCAAACCA TATCTATTTTTCCTTGGGAGTCATCATTTAAATATCGAG ATGCGTTAGCATTAAAAGGTGCGGAAAGGATTGTAGAA GCAGGAATGAATAACATATTTCGAGTTGGTGGATCTCA TGACGGAATGCGACCGTTGCAACGATTAGTGACATATA TTTCTCATGAAAGGCCATCTAACTATACGGCTAAGGAT GTTGCGGTTGAAATAGAACAGACTCGATTCCTGGAAGA AGATAAGTTCCTTGTATTTGTCCCATAATAGGTAAAAGT ATGGAAAATGAATCAAAATATAAAACCATCGACCACGT TATTTGTGTTGAAGGAAATAAAAAAATTCATGTTTGGG AAACGCTGCCAGAAGAAAACAGCCCAAAGAGAAAGAA TGCCATTATTATTGCGTCTGGTTTTGCCCGCAGGATGGA TCATTTTGCTGGTCTGGCGGAATATTTATCGCGGAATGG ATTTCATGTGATCCGCTATGATTCGCTTCACCACGTTGG ATTGAGTTCAGGGACAATTGATGAATTTACAATGTCTA TAGGAAAGCAGAGCTTGTTAGCAGTGGTTGATTGGTTA ACTACACGAAAAATAAATAACTTCGGTATGTTGGCTTC AAGCTTATCTGCGCGGATAGCTTATGCAAGCCTATCTG AAATCAATGCTTCGTTTTTAATCACCGCAGTCGGTGTTG TTAACTTAAGATATTCTCTTGAAAGAGCTTTAGGGTTTG ATTATCTCAGTCTACCCATTAATGAATTGCCGGATAATC TAGATTTTGAAGGCCATAAATTGGGTGCTGAAGTCTTT GCGAGAGATTGTCTTGATTTTGGTTGGGAAGATTTAGCT TCTACAATTAATAACATGATGTATCTTGATATACCGTTT ATTGCTTTTACTGCAAATAACGATAATTGGGTCAAGCA AGATGAAGTTATCACATTGTTATCAAATATTCGTAGTA ATCGATGCAAGATATATTCTTTGTTAGGAAGTTCGCATG ACTTGAGTGAAAATTTAGTGGTCCTGCGCAATTTTTATC AATCGGTTACGAAAGCCGCTATCGCGATGGATAATGAT CATCTGGATATTGATGTTGATATTACTGAACCGTCATTT GAACATTTAACTATTGCGACAGTCAATGAACGCCGAAT GAGAATTGAGATTGAAAATCAAGCAATTTCTCTGTCTT AAAATCTATTGAGATATTCTATCACTCAAATAGCAATA TAAGGACTCTCTATGAAATTTGGAAACTTTTTGCTTACA TACCAACCTCCCCAATTTTCTCAAACAGAGGTAATGAA ACGTTTGGTTAAATTAGGTCGCATCTCTGAGGAGTGTG GTTTTGATACCGTATGGTTACTGGAGCATCATTTCACGG AGTTTGGTTTGCTTGGTAACCCTTATGTCGCTGCTGCAT ATTTACTTGGCGCGACTAAAAAATTGAATGTAGGAACT GCCGCTATTGTTCTTCCCACAGCCCATCCAGTACGCCAA CTTGAAGATGTGAATTTATTGGATCAAATGTCAAAAGG ACGATTTCGGTTTGGTATTTGCCGAGGGCTTTACAACAA GGACTTTCGCGTATTCGGCACAGATATGAATAACAGTC GCGCCTTAGCGGAATGCTGGTACGGGCTGATAAAGAAT GGCATGACAGAGGGATATATGGAAGCTGATAATGAAC ATATCAAGTTCCATAAGGTAAAAGTAAACCCCGCGGCG TATAGCAGAGGTGGCGCACCGGTTTATGTGGTGGCTGA ATCAGCTTCGACGACTGAGTGGGCTGCTCAATTTGGCC TACCGATGATATTAAGTTGGATTATAAATACTAACGAA AAGAAAGCACAACTTGAGCTTTATAATGAAGTGGCTCA AGAATATGGGCACGATATTCATAATATCGACCATTGCT TATCATATATAACATCTGTAGATCATGACTCAATTAAA GCGAAAGAGATTTGCCGGAAATTTCTGGGGCATTGGTA TGATTCTTATGTGAATGCTACGACTATTTTTGATGATTC AGACCAAACAAGAGGTTATGATTTCAATAAAGGGCAGT GGCGTGACTTTGTATTAAAAGGACATAAAGATACTAAT CGCCGTATTGATTACAGTTACGAAATCAATCCCGTGGG AACGCCGCAGGAATGTATTGACATAATTCAAAAAGACA TTGATGCTACAGGAATATCAAATATTTGTTGTGGATTTG AAGCTAATGGAACAGTAGACGAAATTATTGCTTCCATG AAGCTCTTCCAGTCTGATGTCATGCCATTTCTTAAAGAA AAACAACGTTCGCTATTATATTAGCTAAGGAGAAAGAA ATGAAATTTGGATTGTTCTTCCTTAACTTCATCAATTCA ACAACTGTTCAAGAACAAAGTATAGTTCGCATGCAGGA AATAACGGAGTATGTTGATAAGTTGAATTTTGAACAGA TTTTAGTGTATGAAAATCATTTTTCAGATAATGGTGTTG TCGGCGCTCCTCTGACTGTTTCTGGTTTTCTGCTCGGTTT AACAGAGAAAATTAAAATTGGTTCATTAAATCACATCA TTACAACTCATCATCCTGTCGCCATAGCGGAGGAAGCT TGCTTATTGGATCAGTTAAGTGAAGGGAGATTTATTTTA GGGTTTAGTGATTGCGAAAAAAAAGATGAAATGCATTT TTTTAATCGCCCGGTTGAATATCAACAGCAACTATTTGA AGAGTGTTATGAAATCATTAACGATGGTTTTAACAACAG GCTATTGTAATCCAGATAACGATTTTTATAGCTTCCCTA AAATATCTGTAAATCCCCATGCTTATACGCCAGGCGGA CCTCGGAAATATGTAACAGCAACCAGTCATCATATTGT TGAGTGGGCGGCCAAAAAAGGTATTCCTCTCATCTTTA AGTGGGATGATTCTAATGATGTTAGATATGAATATGCT GAAAGATATAAAGCCGTTGCGGATAAATATGACGTTGA CCTATCAGAGATAGACCATCAGTTAATGATATTAGTTA ACTATAACGAAGATAGTAATAAAGCTAAACAAGAGAC GCGTGCATTTATTAGTGATTATGTTCTTGAAATGCACCC TAATGAAAATTTCGAAAATAAACTTGAAGAAATAATTG CAGAAAACGCTGTCGGAAATTATACGGAGTGTATAACT GCGGCTAAGTTGGCAATTGAAAAGTGTGGTGCGAAAAG TGTATTGCTGTCCTTTGAACCAATGAATGATTTGATGAG CCAAAAAAATGTAATCAATATTGTTGATGATAATATTA AGAAGTACCACATGGAATATACCTAATAGATTTCGAGT TGCAGCGAGGCGGCAAGTGAACGAATCCCCAGGAGCA TAGATAACTATGTGACTGGGGTGAGTGAAAGCAGCCAA CAAAGCAGCAGCTTGAAAGATGAAGGGTATAAAAGAG TATGACAGCAGTGCTGCCATACTTTCTAATATTATCTTG AGGAGTAAAACAGGTATGACTTCATATGTTGATAAACA AGAAATTACAGCAAGCTCAGAAATTGATGATTTGATTT TTTCGAGCGATCCATTAGTGTGGTCTTACGACGAGCAG GAAAAAATCAGAAAGAAACTTGTGCTTGATGCATTTCG TAATCATTATAAACATTGTCGAGAATATCGTCACTACTG TCAGGCACACAAAGTAGATGACAATATTACGGAAATTG ATGACATACCTGTATTCCCAACATCGGTTTTTAAGTTTA CTCGCTTATTAACTTCTCAGGAAAACGAGATTGAAAGT TGGTTTACCAGTAGCGGCACGAATGGTTTAAAAAGTCA GGTGGCGCGTGACAGATTAAGTATTGAGAGACTCTTAG GCTCTGTGAGTTATGGCATGAAATATGTTGGTAGTTGGT TTGATCATCAAATAGAATTAGTCAATTTGGGACCAGAT AGATTTAATGCTCATAATATTTGGTTTAAATATGTTATG AGTTTGGTGGAATTGTTATATCCTACGACATTTACCGTA ACAGAAGAACGAATAGATTTTGTTAAAACATTGAATAG TCTTGAACGAATAAAAAATCAAGGGAAAGATCTTTGTC TTATTGGTTCGCCATACTTTATTTATTTACTCTGCCATTA TATGAAAGATAAAAAAATCTCATTTTCTGGAGATAAAA GCCTTTATATCATAACCGGAGGCGGCTGGAAAAGTTAC GAAAAAGAATCTCTGAAACGTGATGATTTCAATCATCT TTTATTTGATACTTTCAATCTCAGTGATATTAGTCAGAT CCGAGATATATTTAATCAAGTTGAACTCAACACTTGTTT CTTTGAGGATGAAATGCAGCGTAAACATGTTCCGCCGT GGGTATATGCGCGAGCGCTTGATCCTGAAACGTTGAAA CCTGTACCTGATGGAACGCCGGGGTTGATGAGTTATAT GGATGCGTCAGCAACCAGTTATCCAGCATTTATTGTTAC CGATGATGTCGGGATAATTAGCAGAGAATATGGTAAGT ATCCCGGCGTGCTCGTTGAAATTTTACGTCGCGTCAATA CGAGGACGCAGAAAGGGTGTGCTTTAAGCTTAACCGAA GCGTTTTGATAGTTGA
TABLE-US-00002 TABLE 2 Plasmids Table S3. Plasmids Identifier Plasmid Relevant Features Source pMM532 pZA1D-hrtR HrtR expressed constitutively from promoter ProD with This RBS2, p15a origin, AmpR work pMM534 pZE2-PLhrtO- LuxCDABE expressed constitutively from promoter This luxCDABE PLhrtO, ColE1 origin, KanR work pMM549 pZA1D-hrtR-chuA HrtR expressed consitutively from promoter ProD with This RBS2, ChuA expressed consitiutively from promoter work J23107, p15a origin, AmpR pMM627 pZE2-PLhrtO-lux- Composite plasmid of pMM534 and pMM549, ColE1 This hrtR-RBS2-chuA origin, KanR work pMM637 pZE2-PLhrtO-lux- HrtR RBS variant of plasmid pMM627 (Strength 1783.6 This hrtR-RBS1-chuA AU), ColE1 origin, KanR work pMM638 pZE2-PLhrtO-lux- HrtR RBS variant of plasmid pMM627 (Strength This HrtR-RBS4-chuA 599195.9 AU), ColE1 origin, KanR work pMM643 pZE2-PLhrtO-lux- HrtR RBS variant of plasmid pMM627 (Strength This hrtR-RBS3-chuA 33545.5 AU), ColE1 origin, KanR work pMM1157 pZE2-PLhrtO-lux- ChuA transciptional unit deletion of plasmid pMM643, This hrtR-RBS3 ColE1 origin, KanR work pMM1161 pZE1-LuxR-Plux- AHL-inducible plasmid; LuxR constitutively expressed This luxCDABE from promoter K176009, LuxCDABE under promoter work Plux, ColE1 origin, AmpR pMM1162 pZE2-hrtR-RBS3- LuxCDABE transcriptional unit deletion of plasmid This chuA pMM643, ColE1 origin, KanR work pMM1489 pKD236-4b ThsS constitutively expressed, p15a origin, SpecR Daeffler K. N., et al., Mol. Syst. Biol., 2017 Apr. 3; 13(4): 923 pMM1532 pKD237-3a-3-Lux ThsR constitutively expressed, LuxCDABE under This control of PphsA, ColE1 origin, CamR work
[0074] Growth and Induction:
[0075] For genetic circuit characterization, overnight cultures were diluted 1:100 in fresh LB and incubated with shaking at 37 C. for 2 hours. Cultures were removed from the incubator and 200 L of culture was transferred to a 96-well plate containing various concentrations of inducer. The plate was returned to a shaking incubator at 37 C. Following 2 hours of incubation, luminescence was read using a BioTek Synergy H1 Hybrid Reader using a is integration time and a sensitivity of 135. Luminescence values, measured in relative luminescence units (RLUs), were normalized by the optical density of the culture measured at 600 nm. For in vitro kinetic studies, subcultured cells were mixed with inducer in a 96-well plate and immediately placed in the plate reader set at 37 C. without shaking. Luminescence and absorbance was read at 5 minute intervals.
[0076] A stock solution of hemin (Sigma) was prepared by dissolving hemin powder in 1M NaOH (Sigma) to a concentration of 25 mM, diluting with double distilled water to a final concentration of 500 M and sterilizing with a 0.2 m polyethersulfone (PES) filter. Defibrillated horse blood (Hemostat) was used as the source of blood for most experiments. Blood was lysed by first diluting 1:10 in simulated gastric fluid (SGF) (0.2% NaCl, 0.32% pepsin, 84 mM HCl, pH 1.2) before further dilution in culture media. Stock solutions of sodium thiosulfate (Sigma) and 3-OC.sub.6-HSL (referred to as acyl homoserine lactone (AHL)) (Cayman Chemical) were made in double distilled water.
[0077] Indomethacin Mouse Experiments:
[0078] All mouse experiments were approved by the Committee on Animal Care at the Massachusetts Institute of Technology. Specific-pathogen free (SPF), male C57BL/6J mice (8-10 weeks of age) were purchased from Jackson Labs and were housed and handled under conventional conditions. Mice were acclimated to the animal facility 1 week prior to the commencement of experiments. Animals were randomly allocated to experimental groups. Researchers were not blinded to group assignments. Prior to indomethacin experiments, a pilot experiment was conducted to determine the transit rate of bacteria through the mouse gastrointestinal tract (
[0079] For indomethacin experiments, animals were inoculated with blood sensor bacteria and fecal pellets were collected 6 hours later for luminescence analysis and CFU enumeration. Indomethacin (Sigma) solution was prepared by dissolving the compound in absolute ethanol to a concentration of 20 mg/mL. Immediately prior to mouse gavage, the indomethacin stock solution was diluted to 1.25 mg/mL in PBS and 0.2 mL of dilute indomethacin solution was administered to each animal (10 mg/kg). Preparation of indomethacin solution using this method was essential to ensure reliable and reproducible induction of gastrointestinal bleeding. The following morning, gastrointestinal bleeding was confirmed by performing a guaiac test (Hemoccult, Beckman Coulter) on fecal pellets from each animal. All mice administered indomethacin were guaiac positive, whereas those administered a PBS control were uniformly guaiac negative. Subsequently, mice were again administered blood sensor bacteria and fecal pellets were collected 6 hours later for luminescence analysis and CFU enumeration.
[0080] Preparation of Capsules:
[0081] The electronic component in the capsules consisted of four phototransistor detectors (SFH3710, Osram Opto Semiconductors GmbH), a custom bioluminescence detector chip fabricated in a TSMC 65 nm process (Nadeau P., et al., IEEE, 2017 Mar. 6; doi10.1109/ISSCC.2017.7870406), a microcontroller and radio chip (PIC12LF1840T39A, Microchip Technology Inc.), 22 MHz crystal resonator (7M-22.000MEEQ-T, TXC Corporation), 915 MHz chip antenna (0915AT43A0026, Johanson Technology Inc.), two 220 F ceramic capacitors (CL32A227MQVNNNE, Samsung Electro-Mechanics America, Inc.), and a 5 mAh lithium manganese button-cell battery (MS621FE-FL11E, Seiko Instruments Inc.). The electronics were soldered onto custom four-layer printed circuit boards (Advanced Circuits Inc.) and two screws were epoxied into mounting holes for later attachment of the plastic cell carriers. The assembly was coated with 4-15 m of Parylene C to act as a moisture barrier (additional methods describing Parylene C deposition described below). A clear rectangular polycarbonate window (500 m thickness, Rowland Technologies Inc.) was epoxied above the four phototransistor detectors to provide a flat optical interface. The boards were coated with 1-3 mm of epoxy (20845, Devcon) for mechanical stability and then casted into PDMS capsules 13 mm in diameter (Sylgard 184, Dow Corning).
[0082] Parylene C Deposition:
[0083] Di-chloro-di-p-xylylene (brand name: diX C) dimer was purchased from Daisan Kasei Co. (now a KISCO partner company). Thin film Parylene C coating was preformed using an in-house pyrolysis CVD coating tool. After loading the capsules, 10 grams of dimer was loaded into a thermal evaporation heater and the system was evacuated to 1.3 bar. The pyrolysis furnace and all other vacuum components were pre-heated prior to deposition. During deposition the dimer was evaporated between 105 C. to 120 C. in order to maintain a constant deposition rate of around 3 /s. Upon reaching the desired thickness the deposition chamber was isolated, the system was cooled, the deposition chamber was vented, and the capsules were removed.
[0084] Preparation of Cell Carriers:
[0085] Cell carriers were machined or injection-molded in ABS plastic (Protolabs Inc.). Semipermeable membranes (0.22 m pore size, EIMF22205, Millipore Sigma) were affixed to one side of the cell carriers via heat sealing for 35-45 seconds at 230 C. with a stainless steel die. Rubber gaskets for fluidic sealing were die-cut from 380 m silicone rubber (86435K13, McMaster-Carr) and epoxied to the opposite side of the cell carriers to provide a seal between the carrier and the optical window during experiments.
[0086] System Operation, Packet Transmission and Reception: The NPN phototransistor detectors, which may examples of the detectors in
[0087] The custom integrated circuit contained a low-power voltage reference (V.sub.R=0.625 V) and local oscillator counter (oscillator period, T.sub.OSC=5 ms). In each oscillator cycle, the detector voltages for each channel were compared to the reference voltage and, if the reference was exceeded, a count value was saved corresponding to the number of oscillator cycles required the charge the channel. The on-board microprocessor polled the custom circuit once every 8 seconds to determine whether all four channels had exceeded the reference voltage. Once all were exceeded, the microprocessor read the four counter values through a serial peripheral interface and transmitted a short wireless packet at +1.0 dBm with count data using an on-board transmitter, which may be an example of the radio chip in
[0088] Photocurrent Estimation with Temperature and Offset Calibration:
[0089] The photocurrent detected by the system was estimated using measured quantities and an algorithm for temperature drift and offset calibration, which is described as follows:
[0090] Let there be three potentially luminescing sensor channels with counts denoted by N.sub.i: i={1,2,3}. The time required for the photocurrent stimulated by luminescing cells (I.sub.PH,i) and the dark background current intrinsic to the photodetectors (I.sub.D,i) to charge the channel capacitance (C.sub.o) of a channel (i) to the threshold voltage (V.sub.R) was quantized using the number of cycles (N.sub.i) counted by the internal oscillator (period, T.sub.OSC). The measured cycles were then used to estimate the photocurrent level. The number of cycles required to charge a sensor channel is given by:
[0091] Let there be one reference channel containing no luminescing cells (I.sub.PH=0) with a count denoted by N.sub.r. The number of cycles required to charge the reference is given by:
[0092] The desired photocurrent signal on a channel (I.sub.PH,i) is corrupted by the channel's dark current, which has been modelled as:
I.sub.D,r=I.sub.D,OS,i.Math.f(T),
by separating a temperature-independent, channel-specific dark current offset (I.sub.D,OS,i) from a temperature dependent scaling function [f(T)].
[0093] To calibrate the temperature and offset, the counts from each sensor channel were first compared to the reference channel by calculating a relative signal R.sub.i:
[0094] In the first term of R.sub.i, the temperature dependence is cancelled, leaving only a dependence on the relative offsets between channels. This term can denoted as R.sub.i,OS. Early segments of the count data can be used for each experiment, prior to induction of luminescence from the whole-cell biosensors (I.sub.PH,i=0) to estimate R.sub.i,OS for each channel. For all experiments, the samples between 0.2 and 0.3 hours (12 to 18 minutes) were used to estimate R.sub.i,OS. By substituting the measured offset (R.sub.i,OS), as well as the expression for N.sub.r, the final expression for the estimated photocurrent was obtained in terms of known and measured quantities.
[0095] This calibration procedure was performed using Matlab software (R2017a, The Mathworks, Inc.).
[0096] Optical Calibration:
[0097] A green LED (=525 nm, WP7083ZGD/G, Kingbright) was first calibrated across four decades of input current using an optical power meter located 30 cm away (PM100D and S130C, Thor Labs Inc.). Three capsules were then placed at the same distance as the power meter and measured across the same LED current conditions. The optical power readings were scaled by the ratio of the area of the phototransistor detectors (0.29 mm.sup.2) to the area of the S130C sensor (70.9 mm.sup.2) in order to estimate the optical power incident on the detectors.
[0098] Mobile Phone App for Real-Time Reception and Visualization of Results:
[0099] A 900 MHz USB dongle (CC1111 USB Evaluation Module Kit, Texas instruments, Inc.) was attached to an Android mobile phone (Galaxy SIII, SCH-I535, Samsung Electronics Co. Ltd.) running a custom application created in Android Studio (Google, Inc.). Temperature and offset calibration was performed on the phone after receiving the first 18 minutes of data to enable offset calibration and the photocurrent estimate was displayed to the user. The raw data was simultaneously uploaded to a cloud service for later analysis.
[0100] In Vitro MBED Experiments:
[0101] LB culture media supplemented with or without inducer (500 ppm lysed blood (unless otherwise noted), 1.0 mM thiosulfate, or 100 nM AHL) was pre-warmed for at least 2 hours prior to the start of experiments. For blood sensor experiments, overnight cultures were diluted 1:10 in 2YTPG (20 g tryptone, 5 g NaCl, 10 g yeast extract, 22 mL of 1 M potassium phosphate monobasic, 40 mL of 1 M potassium phosphate dibasic, 0.2% glucose, pH 7.2) and 15 L of diluted culture was added to wells in the cell carrier (approximately 10.sup.6 cells per well). Wild-type E. coli Nissle 1917 was added in the reference channel for all experiments. Blood sensor bacteria were added in triplicates to three wells in a single device and values from these three channels were averaged to obtain a single replicate plotted in
[0102] Pig Experiments:
[0103] All pig experiments were approved by the Committee on Animal Care at the Massachusetts Institute of Technology. Female Yorkshire pigs (50-95 kg) were obtained from Tufts University and housed under conventional conditions. Animals were randomly selected for the experiments. The animals were placed on a clear liquid diet for 24 hours prior to the experiment with the morning feed held on the day of the experiment. At the time of the experiment, the pigs were sedated with Telazol (tiletamine/zolazepam 5 mg/kg), xylazine (2 mg/kg) and atropine (0.04 mg/kg). An endoscopic overtube (US endoscopy) was placed in the esophagus under endoscopic (Pentax) visual guidance during esophageal intubation. Prior to deposition of devices, 250 mL of neutralization solution (1% sodium bicarbonate and 0.2% glucose) with or without 0.25 mL of pig blood was administered directly to the stomach through the endoscope. Overnight bacterial cultures were diluted 1:10 in 2YTPG and 15 L of diluted culture was added to wells in the cell carriers. Devices were assembled and deposited in the pig gastric cavity via endoscopic overtube. Full submersion in gastric fluid was confirmed by endoscopic observation. For 2 hours, data from deposited capsules was acquired via a 900 mHz radio attached to a laptop or the Android cellular phone. Endoscopic videos and radiographs of capsules inside the pig stomach were acquired. Devices were retrieved from the gastric cavity using a hexagonal snare. A total of 6 animals were included in the experiments; 3 were administered neutralization solution containing blood and 3 served as negative controls. Two devices were deposited per pig, such that each group has a sample size of 6.
[0104] Data Analysis, Statistics and Computational Methods:
[0105] All data were analyzed using GraphPad Prism version 7.03 (Graph Software, San Diego, Calif., USA, graphpad.com). Sequence analysis was performed using Geneious version 9.1.8 (geneious.com) (Kearse M., et al., Bioinformatics, 2013 Jun. 15; 28(12): 1647-49). As noted, error bars represent the SEM of at least three independent experiments carried out on different days. Significance between groups was determined using an unpaired, two-tailed Student's t-test assuming unequal variance. Fold change or signal-to-noise ratio was determined by dividing the normalized luminescence values (RLU/CFU) of samples treated with the maximal inducer concentration with uninduced samples. Response curves were fit to a Hill function: Y=(B.sub.maxX.sup.n)/(K.sup.n+X.sup.n)+C, where X is the inducer concentration, Y is the normalized luminescence output, B.sub.max is the maximum luminescence, K is the threshold constant, n is the Hill coefficient and C is the baseline luminescence.
Example 1: Development of Heme Biosensor
[0106] A biosensor was developed for gastrointestinal bleeding as a proof-of-concept MBED for a clinically relevant biomarker. Bleeding in the gastrointestinal tract can be a result of a wide range of causes, including inflammation, cancer, peptic ulcers, non-steroidal anti-inflammatory drug use, portal vein hypertension, among others (Hearnshaw S. A., et al., Gut, 2011 October; 60(10): 1327-35), While cost-effective fecal occult-blood testing exists (Rockey D. C., et al., N. Engl. J. Med., 1998 Jul. 16; 339(3): 153-59), rapid diagnosis of acute bleeding in the upper gastrointestinal tract requires endoscopic observation or aspiration of gastric fluid (Barkun A., et al., Ann. Intern. Med., 2003 Nov. 18; 139(10): 843-57). Importantly, early diagnosis and appropriate treatment of individuals with upper gastrointestinal bleeding has been found to reduce hospital stays and overall medical costs (Lee J. G., et al., Gastrointest. Endosc., 1999 December; 50(6): 755-61). Blood sensing MBEDs could offer an additional means of diagnosing upper gastrointestinal bleeds or monitoring patients at high risk for re-bleeding following endoscopic therapy (Cheng C. L., et al., Dig. Dis. Sci., 2010 September; 5(9): 2577-83) to aid in the triage of individuals who may require further endoscopic or surgical intervention.
[0107] As a bleeding event leads to an accumulation of free heme liberated from lysed red blood cells, the literature was examined for bacterial transcription factors responsive to heme. Lactococcus lactis encodes a heme-regulated TetR-family transcriptional repressor, HrtR, which naturally controls expression of an efflux pump to control intracellular heme-mediated toxicity (Lechardeur D., et al., J. Biol. Chem., 2012 Feb. 10; 287(7): 4752-58). In the absence of heme, HrtR binds to cognate palindromic HrtO operator sequences in the P.sub.hrtRAB promoter, repressing promoter activity (
Example 2: Optimization of Heme Genetic Circuit
[0108] Next, the prototype genetic circuit was iteratively optimized with the goal of improving SNR without compromising maximum luminescence output. Genetic components were combined onto a single high-copy plasmid to minimize plasmid burden as well as the risk of plasmid loss. Increasing the translation initiation strength of HrtR using computationally designed ribosome binding site (RBS) sequences (Salis H. M., et al., Nat. Biotechnol., 2009 October; 27(10): 946-50) decreased baseline luminescence and improved SNR to 132 (MG1655 V2;
Example 3: Demonstration of Optimized Heme Biosensor Functionality
[0109] To examine functionality of the bacterial blood sensor in vivo, a murine model of indomethacin-induced gastrointestinal bleeding was employed. Gastroduodenal ulceration is a common adverse effect of non-steroidal anti-inflammatory drug use, as decreased prostaglandin production leads to a thinning of the gastric mucosa and acidification of gastric contents (Lancs A. and Chan F. K. L., Lancet., 2017 Aug. 5; 390(10094): 613-24). Upper gastrointestinal bleeding elicited by oral indomethacin administration could be detected by bacterial blood sensors passing through the gut and measured by observing luminescence activity in fecal pellets (
Example 4: Integrating Biosensors with Electronic Sensors and Wireless Transmission
[0110] Ways of integrating the bacterial biosensor with an electronic sensor and wireless transmission platform were then investigated. Interrogation of cellular bioluminescence is typically performed by power and area-expensive lab equipment that is ill-suited for in situ measurements in the body. Prior demonstrations of custom sensitive bioluminescence detection electronics have required external wiring and have been limited to bench-top assays (Nadeau P., et al., WEE, 2017 Mar. 6; doi10.1109/ISSCC.2017.7870406; Eltoukhy H., et al., IEEE J. Solid-State Circuits, 2006 April; 41(3): 651-61; 36. Singh R. R., et al., IEEE J. Solid-State Circuits, 2012 November; 47(11): 2822-33). For this reason, the first miniaturized, fully-integrated, wireless readout capsule for targeted in vivo sensing of small molecules in the gastrointestinal tract was developed (
[0111] The electronic system is highly sensitive and captured photon flux down to 510.sup.4 photons/s incident on the 0.29 mm.sup.2 area of the detectors (white-noise limited coefficient of variation 13%.sub.rms,
TABLE-US-00003 TABLE 3 Average current consumption of the capsule system. The System Leakage is the static current consumed with all functions of the capsule disabled. The commercial Microcontroller average consumption arises from polling of the luminescence chip every 8 seconds to determine whether a measurement has been completed. The ULP Luminescence Chip consumption results from the continuous operation of the luminescence quantification circuitry. The Wireless consumption results from the transmission of packets. The commercial wireless transmitter dominates the total system consumption (84.4%), whereas the custom illuminometer consumes only a small fraction of the total (<0.2%). Running from the 5 mAh button cell, the system can be expected to last for over 9 months in sleep mode, and for 1.5 months uring continuous active operation. Current Consumption System (excluding wireless) System Leakage 0.30 A Microcontroller 0.42 A ULP Luminescence Chip 0.01 A Wireless Active Wireless Current 16.5 mA Packet Bits 396 bits Bit Rate 50 kbps Packet Time 5.92 ms Sampling Interval 25 s Duty Cycle 2.4 104 Average Wireless Current 3.96 A Total 4.69 A
Example 5: Demonstration of MBED Adaptability
[0112] The sensing functionality of MBEDs can be readily adapted to alternative biomarkers. To illustrate this, thiosulfate and acyl-homoserine lactone (AHL) sensors were developed in bacteria to act as bioluminescent reporters. Thiosulfate could serve as a biomarker of gut inflammation as it is elevated in murine models of colitis (Daeffler K. N., et al., Mol. Syst, Biol., 2017 Apr. 3; 13(4): 923). AHLs are molecular signatures of particular bacteria used to coordinate gene expression across populations and their detection in the context of the gut microbiota can indicate the presence of commensal or infectious agents in the gut (Hwang I. Y., et al., Nat. Commun., 2017 Apr. 11; 8: 15028; Schuster M., et al., Annu. Rev. Microbiol., 2013; 67: 43-63; Balagadde F. K., et al., Mol. Syst. Biol., 2008; 4: 187). Thiosulfate- and AHL-inducible genetic circuits were introduced into E. coli Nissle and exposure to increasing concentrations of inducer led to increasing levels of bioluminescence (
Example 6: Demonstration of MBED Functionality
[0113] To examine wireless in situ detection of biomolecules with whole-cell biosensors, a blood sensor MBEDs was deployed in a porcine model of gastrointestinal bleeding. Prior to device deposition, pigs were administered a bicarbonate-glucose neutralization solution with or without 0.25 mL of blood (
REFERENCES
[0114] 1. Balagadde F. K., Song H., Ozaki J., Collins C. H., Barnet M., Arnold F. H., Quake S. R., and You L., A synthetic Escherichia coli predator-prey ecosystem. Mol. Syst. Biol., 2008; 4: 187. [0115] 2. Barkun A., Bardou M., and Marshall J. K., Clinical Guidelines Consensus Recommendations for Managing Patients with Nonvariceal Upper Gastrointestinal Bleeding. Ann. Intern. Med., 2003 Nov. 18; 139(10): 843-57. [0116] 3. Borkowski O., Ceroni F., Stan G. B., and Ellis T., Overloaded and stressed: whole-cell considerations for bacterial synthetic biology. Curr. Opin. Microbiol., 2016 October; 33: 123-30. [0117] 4. Brophy J. A. and Voigt C. A., Principles of genetic circuit design. Nat. Methods., 2014 May; 11(5): 508-20. [0118] 5. Cheng C. L., Lin C. H., Kuo C. J., Sung K. F., Lee C. S., Liu N.J., Tang J. H., Cheng H. T., Chu Y. Y., and Tsou Y. K., Predictors of rebleeding and mortality in patients with high-risk bleeding peptic ulcers. Dig. Dis. Sci., 2010 September; 5(9): 2577-83. [0119] 6. Chung C. J., Niemela S. L., and Miller R. H., One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. U.S.A, 1989 April; 86(7): 2172-75. [0120] 7. Close D., Xu T., Smartt A., Rogers A., Crossley R., Price S., Ripp S., and Sayler G., The evolution of the bacterial luciferase gene cassette (lux) as a real-time bioreporter. Sensors., 2012; 12(1): 732-52. [0121] 8. Courbet A., Endy D., Renard E., Molina F., and Bonnet J., Detection of pathological biomarkers in human clinical samples via amplifying genetic switches and logic gates. Sci. Transl. Med., 2015 May 27; 7(289): 289-83. [0122] 9. Daeffler K. N., Galley J. D., Sheth R. U., Ortiz-Velez L. C., Bibb C. O., Shroyer N. F., Britton R. A., and Tabor J. J., Engineering bacterial thiosulfate and tetrathionate sensors for detecting gut inflammation. Mol. Syst. Biol., 2017 Apr. 3; 13(4): 923. [0123] 10. Eltoukhy H., Salama K., and El Gamal A., A 0.18-um CMOS Bioluminescence Detection Lab-on-Chip. IEEE J. Solid-State Circuits, 2006 April; 41(3): 651-61. [0124] 11. Espah Borujeni A., Channarasappa A. S., and Salis H. M., Translation rate is controlled by coupled trade-offs between site accessibility, selective RNA unfolding and sliding at upstream standby sites. Nucleic Acids Res., 2014 February; 42(4): 2646-59. [0125] 12. Gibson D. G., Young L., Chuang R. Y., Venter J. C., Hutchison C. A. 3.sup.rd, and Smith H. O., Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Meth., 2009 May; 6(5): 343-45. [0126] 13. Hafezi H., Robertson T. L., Moon G. D., Au-Yeung K. Y., Zdeblick M. J., and Savage G. M., An ingestible sensor for measuring medication adherence. IEEE Trans. Biomed. Eng., 2015 January; 62(1): 99-109. [0127] 14. Hearnshaw S. A., Logan Lowe D., Travis S. P., Murphy M. F., and Palmer K. R., Acute upper gastrointestinal bleeding in the UK: patient characteristics, diagnoses and outcomes in the 2007 UK audit. Gut., 2011 October; 60(10): 1327-35. [0128] 15. Hwang I. Y., Koh E., Wong A., March J. C., Bentley W. E., Lee Y. S., and Chang M. W., Engineered probiotic Escherichia coli can eliminate and prevent Pseudomonas aeruginosa gut infection in animal models. Nat. Commun., 2017 Apr. 11; 8: 15028. [0129] 16. Iddan G., Meron G., Glukhovsky A., and Swain P., Wireless capsule endoscopy. Nature, 2000 May; 405(6785): 417. [0130] 17. Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., Thierer T., Ashton B., Meintjes P., and Drummond A., Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 2013 Jun. 15; 28(12): 1647-49. [0131] 18. Kotula. J. W., Kerns S. J., Shaket L. A., Siraj L., Collins J. J., Way J. C., and Silver P. A., Programmable bacteria detect and record an environmental signal in the mammalian gut. Proc. Natl. Acad. Sci. U.S.A, 2014 Apr. 1; 111(13): 4838-43. [0132] 19. Lanas A. and Chan F. K. L., Peptic ulcer disease. Lancet., 2017 Aug. 5; 390(10094): 613-24. [0133] 20. Lechardeur D., Cesselin B., Liebl U., Vos M E., Fernandez A., Brun C., Gruss A., and Gaudu P., Discovery of intracellular heme-binding protein HrtR, which controls heme efflux by the conserved HrtB-HrtA transporter in Lactococcus lactis. J. Biol. Chem., 2012 Feb. 10; 287(7): 4752-58. [0134] 21. Lee J. G., Turnipseed S., Romano P. S., Vigil H., Azari R., Melnikoff N., Hsu R., Kirk D., Sokolove P., and Leung J. W., Endoscopy-based triage significantly reduces hospitalization rates and costs of treating upper GI bleeding: a randomized controlled trial. Gastrointest. Enclose., 1999 December; 50(6): 755-61. [0135] 22. Lim B., Zimmermann M., Barry N. A., and Goodman A. L., Engineered Regulatory Systems Modulate Gene Expression of Human Commensals in the Gut. Cell., 2017 Apr. 20; 169(3): 547-58.e15. [0136] 23. Mimee M., Tucker A. C., Voigt C. A., and Lu T. K., Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota. Cell Syst., 2016 Mar. 23; 2(3): 214. [0137] 24. Nadeau P., El-Damak D., Glettig D., Kong Y. L., Mo S., Cleveland C., Booth L., Roxhed N., Langer R., Chandrakasan A. P., and Traverso G., Prolonged energy harvesting for ingestible devices. Nat. Biomed. Eng., 2017; 1: pii: 0022. [0138] 25. Nadeau P., Mimee M., Carim S., Lu T. K., and Chandrakasan A. P., 21.1 Nanowatt Circuit interface to Whole-Cell Bacterial Sensors. IEEE, 2017 Mar. 6; doi10.1109/ISSCC.2017.7870406. [0139] 26. Nobles C. L., Clark J. R., Green S. I., and Maresso A. W., A dual component heme biosensor that integrates heme transport and synthesis in bacteria. J. Microbiol. Methods., 2015 November; 118: 7-17. [0140] 27. Norian H., Field Kymissis I., and Shepard K. L., An integrated CMOS quantitative-polymerase-chain-reaction lab-on-chip for point-of-care diagnostics. Lab Chip., 2014 Oct. 21; 14(20): 4076-84. [0141] 28. Otis B. and Parviz B., Introducing our smart contact lens project. Google Off. Blog (2014), (available at googleblog.blogspot.com/2014/01/introducing-our-smart-contact-lens.html). [0142] 29. Pickard J. M., Maurice C. F., Kinnebrew M. A., Abt M. C., Schenten D., Golovkina T. V., Bogatyrev S. R., Ismagilov R. F., Pamer E. G., Turnbaugh P. J., and Chervonsky A. V., Rapid fucosylation of intestinal epithelium sustains host-commensal symbiosis in sickness. Nature, 2014 Oct. 30; 514(7524): 638-41. [0143] 30. Riglar D. T., Giessen T. W., Baym M., Kerns S. J., Niederhuber M. J., Bronson R. T., Kotula J. W., Gerber G. K., Way J. C., and Silver P. A., Engineered bacteria can function in the mammalian gut long-term as live diagnostics of inflammation. Nat. Biotechnol., 2017 July; 35(7): 653-58. [0144] 31. Rockey D. C., Koch J., Cello J. P., Sanders L. L., and McQuaid K., Relative frequency of upper gastrointestinal and colonic lesions in patients with positive fecal occult-blood tests. N. Engl. J. Med., 1998 Jul. 16; 339(3): 153-59, [0145] 32. Roggo C. and van der Meer J. R., Miniaturized and integrated whole cell living bacterial sensors in field applicable autonomous devices. Curr. Opin. Biotechnol. 2017 June; 45: 24-33. [0146] 33. Salis H. M., Mirsky E. A., and Voigt C. A., Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol., 2009 October; 27(10): 946-50. [0147] 34. Sawai H., Yamanaka M., Sugimoto H., Shiro Y., and Aono S., Structural basis for the transcriptional regulation of heme homeostasis in Lactococcus lactis. J. Biol. Chem., 2012 Aug. 31; 287(36): 30755-68. [0148] 35. Schuster M., Sexton J. D., Diggle S. P., and Greenberg E. P., Acyl-Homoserine Lactone Quorum Sensing: From Evolution to Application. Annu. Rev. Microbiol., 2013; 67: 43-63. [0149] 36. Singh R. R., Leng L., Guenther A., and Genov R., A CMOS-microfluidic chemiluminescence contact imaging microsystem. IEEE J. Solid-State Circuits, 2012 November; 47(11): 2822-33. [0150] 37. Slomovic S., Pardee K., and Collins J. J., Synthetic biology devices for in vitro and in vivo diagnostics. Proc. Natl. Acad. Sci. U.S.A, 2015 Nov. 24; 112(47): 14429-35. [0151] 38. Torres A. G. and Payne S. M., Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol., 1997 February; 23(4): 825-33. [0152] 39. van der Schaar P. J., Dijksman J. F., Broekhuizen-de Gast H., Shimizu J., van Lelyveld N., Lou H., Iordanov V., Wanke C., and Siersema P. D., A novel ingestible electronic drug delivery and monitoring device. Gastrointest. Enclose., 2013 September; 78(3): 520-28. [0153] 40. Wang H., Magnetic sensors for diagnostic medicine: CMOS-based magnetic particle detectors for medical diagnosis applications. IEEE Microw. Mag., July 2013; 14(5): 110-30.
OTHER EMBODIMENTS
[0154] All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0155] From the above description, one skilled in the art can easily ascertain the essential characteristics of the present disclosure, and without departing from the spirit and scope thereof, can make various changes and modifications of the disclosure to adapt it to various usages and conditions. Thus, other embodiments are also within the claims.
EQUIVALENTS
[0156] While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure.
[0157] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.
[0158] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.
[0159] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.
[0160] The phrase and/or, as used herein in the specification and in the claims, should be understood to mean either or both of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with and/or should be construed in the same fashion, i.e., one or more of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the and/or clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to A and/or B, when used in conjunction with open-ended language such as comprising can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
[0161] As used herein in the specification and in the claims, or should be understood to have the same meaning as and/or as defined above. For example, when separating items in a list, or or and/or shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as only one of or exactly one of, or, when used in the claims, consisting of, will refer to the inclusion of exactly one element of a number or list of elements. In general, the term or as used herein shall only be interpreted as indicating exclusive alternatives (i.e. one or the other but not both) when preceded by terms of exclusivity, such as either, one of, only one of, or exactly one of. Consisting essentially of, when used in the claims, shall have its ordinary meaning as used in the field of patent law.
[0162] As used herein in the specification and in the claims, the phrase at least one, in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase at least one refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, at least one of A and B (or, equivalently, at least one of A or B, or, equivalently at least one of A and/or B) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
[0163] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0164] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It should be appreciated that embodiments described in this document using an open-ended transitional phrase (e.g., comprising) are also contemplated, in alternative embodiments, as consisting of and consisting essentially of the feature described by the open-ended transitional phrase. For example, if the disclosure describes a composition comprising A and B, the disclosure also contemplates the alternative embodiments a composition consisting of A and B and a composition consisting essentially of A and B.