Peptide with safer secondary structure, peptide library, and production methods for same

10435439 ยท 2019-10-08

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the invention is to provide a peptide having a stabilized secondary structure. The present invention provides a peptide having a secondary structure stabilized by a crosslinked structure and containing at least one combination of a special amino acid of the formula (I): ##STR00001##
(wherein, (A) represents a single bond or a linking group having, in the main chain thereof, from 1 to 10 atoms;
(B) represents a group containing at least one bond;
(C) represents a hydrogen atom or an alkyl group which may be substituted with a substituent; and X represents a group substitutable by a substitution reaction with a sulfanyl group) and an amino acid having, in the side chain thereof, a sulfanyl group; and having the crosslinked structure formed through a thioether bond between the side chain of the special amino acid residue and the sulfanyl group.

Claims

1. A peptide having a secondary structure stabilized by a crosslinked structure, comprising at least one combination of a special amino acid represented by the following formula (I): ##STR00042## wherein (A) represents a single bond or a linking group having, in the main chain thereof, from 1 to 10 atoms, (B) represents a group containing at least one carbon-carbon double bond, a group containing at least an aromatic ring, or a ketone group, (C) represents a hydrogen atom or an alkyl group which may be substituted with a substituent, and X represents a group substitutable by a substitution reaction with a sulfanyl group, and an amino acid having, in the side chain thereof, a sulfanyl group; and having the crosslinked structure formed through a thioether bond between the side chain of the special amino acid residue and the sulfanyl group.

2. The peptide according to claim 1, wherein in the formula (I), (A) is selected from the class consisting of a single bond, alkylene groups having from 1 to 10 carbon atoms, alkenylene groups having from 2 to 10 carbon atoms, and alkynylene groups having from 2 to 10 carbon atoms, which may be substituted with a substituent; and alkylene groups, alkenylene groups, and alkynylene groups having, in the main chain thereof, 10 or less atoms, in which one or two carbon atoms in the main chain have been substituted with an oxygen atom, a nitrogen atom, or a sulfur atom and which may be substituted with a substituent, (B) is selected from the class consisting of CC, Ar, ArAr, ArCC, ArCC, ArNHC(O), and ArC(O), (C) is selected from the class consisting of hydrogen, a methyl group, an ethyl group, a propyl group, a butyl group, and a pentyl group, and X is selected from the class consisting of Cl, Br, I, OSO.sub.2Me, a tosyl group, a nosyl group, and OSO.sub.2ArR, wherein, R represents a group selected from the class consisting of CH.sub.3, NO.sub.2, CF.sub.3, and H.

3. The peptide according to claim 1, wherein the special amino acid of the formula (I) is represented by formula (III) or formula (IV): ##STR00043## wherein m represents an integer selected from 1 to 10 and selected from the group consisting of Cl, Br, I, OSO.sub.2Me, a tosyl group, a nosyl group, and OSO.sub.2ArR wherein, R represents a group selected from the class consisting of CH.sub.3, NO.sub.2, CF.sub.3 and H.

4. The peptide according to claim 1, wherein the amino acid having a sulfanyl group is selected from the group consisting of cysteine and cysteine analogues represented by the following formulas (V) and (VI): ##STR00044##

5. The peptide according to claim 1, wherein the special amino acid residue and the amino acid residue having, in the side chain thereof, a sulfanyl group are, in each combination, placed with 2, 3, 6, or 10 amino acid residues therebetween.

6. A peptide library comprising two or more kinds of the peptide as claimed in claim 1.

7. The peptide library according to claim 6, wherein each of the peptides is linked to an mRNA encoding the peptide.

8. A method of constructing the peptide library as claimed in claim 6, comprising: (i) producing an mRNA library which contains at least one combination of a codon encoding an amino acid having, in the side chain thereof, a sulfanyl group and a codon encoding the special amino acid represented by the formula (I) ##STR00045## wherein (A) represents a single bond or a linking group having, in the main chain thereof, from 1 to 10 atoms, (B) represents a group containing at least one carbon-carbon double bond, a group containing at least an aromatic ring, or a ketone group, (C) represents a hydrogen atom or an alkyl group which may be substituted with a substituent, and X represents a group substitutable by a substitution reaction with a sulfanyl group, in an RNA encoding a random amino acid sequence; in each combination, the codon encoding an amino acid having, in the side chain thereof, a sulfanyl group and the codon encoding the special amino acid of the formula (I) being placed with 2, 3, 6, or 10 amino acid units therebetween; and (ii) translating the mRNA by using a cell-free translation system containing a tRNA to which the special amino acid has been linked and thereby obtaining a group of peptides having the special amino acid placed in the random sequence; and (iii) forming, in each of the peptides, a crosslinked structure by binding the sulfanyl group to the side chain of the special amino acid of the formula (I).

9. A method of constructing the peptide library as claimed in claim 8, comprising: in step (i), binding puromycin to the 3-end of the mRNA to obtain a puromycin-bound mRNA library; in the step (ii), causing the puromycin-bound mRNA library to express in a cell-free translation system to obtain a peptide-mRNA complex having the special amino acid placed in the random sequence; and conducting the step (iii).

10. The method according to claim 8, wherein an altered codon encoding the special amino acid of the formula (I) is AUG codon and the mRNA random sequence is composed of repetition of a triplet of either one of an NNC or NNU sequence, wherein N represents any one base of A, U, G, and C.

11. A method of selecting a peptide that binds to a target protein from the peptide library as claimed in claim 6, comprising: (i) bringing the peptide library into contact with the target protein, followed by incubation; and (ii) selecting a peptide molecule that binds to the target protein.

12. A method of selecting, from the peptide library as claimed in claim 11, a peptide having inhibitory activity against the intermolecular interaction of a target protein, comprising: (i) primary screening, including the steps (i) and (ii), for selecting a peptide that binds to the target protein; and (ii) secondary screening for evaluating inhibitory activity of the peptide, which has been selected in the primary screening (i), against intermolecular interaction of the target protein and thereby determining that the peptide has inhibitory activity against the intermolecular interaction of the target protein.

13. A process of preparing a peptide that binds to a target protein: (i) bringing the peptide library as claimed in claim 7 into contact with the target protein while incubating; (ii) selecting a peptide-mRNA complex that binds to the target protein; (iii) amplifying the mRNA of the selected peptide-mRNA complex to obtain a peptide-mRNA complex; (iv) repeating the steps (i) to (iii) at least once to concentrate the peptide-mRNA complex having high-affinity; and (v) causing the mRNA of the peptide-mRNA complex concentrated in the step (iv) to express the peptide.

14. The method according to claim 11, wherein the target protein is a molecule that suppresses apoptosis.

15. A special amino acid represented by the following formula (I); ##STR00046## wherein (A) represents a single bond or a linking group having, in the main chain thereof, from 1 to 10 atoms, (B) represents a group containing at least one carbon-carbon double bond, or a group containing at least an aromatic ring, or a ketone group; (C) represents a hydrogen atom or an alkyl group having from 1 to 3 carbon atoms which may be substituted with a substituent; and X represents a group substitutable by a substitution reaction with a sulfanyl group.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows one example of a special peptide having a fixed helix secondary structure.

(2) FIG. 2 shows an arrangement example in a crosslinked structure precursor.

(3) FIG. 3 shows the selective formation of a crosslinked structure.

(4) For the graphs on the left side, the y-axis labels are Intens. [a.u.] and (a) for the top and bottom graphs, the y-axis major tick values are 0, 500, 1000, 1500, 2000, and 2500, (b) for the middle two graphs, the y-axis major tick values are 0, 250, 500, 750, 1000, and 1250, and the x-axis tick values from left to right are 500, 1000, 1500, 1500, 2000, 2500, 3000, and 3500 m/z.

(5) For the graphs on the right side, the y-axis labels are Intens. [a.u.] and (a) for the top two graphs the major tick values are 0, 200, 400, 600, and 800, (b) for the third graph from the top the major tick values are 0, 200, 400, 600, 800, 1000, and 1200, and (c) for the bottom graph the major tick values are 0, 500, 1000, 1500, 2000, and 2500, and the x-axis tick values from left to right are 1800, 1820, 1840, 1860, 1880, 1900, 1920, and 1940 m/z.

(6) FIG. 4 shows the concept of screening using a crosslinked peptide library by using mRNA display.

(7) FIG. 5 shows a construction example of an mRNA library. mRNA sequences of Pools 16-1, 16-2, 20-1, 20-2, 20-3, 24-1, 24-2, 24-3, and 24-4 are set forth as SEQ ID NOs:31 to 39 in the Sequence Listing, respectively.

(8) FIG. 6 shows the concept of translation under an altered genetic code table.

MODE FOR CARRYING OUT THE INVENTION

(9) Peptide Having a Crosslinked Structure Introduced Therein

(10) The present invention provides a novel peptide having a crosslinked structure and thereby having a more stabilized secondary structure. The term secondary structure as used herein is a special structure which is made of a hydrogen bond in the peptide main chain and can be observed in a relatively narrow region and it means a helix structure, structure, or the like. The present invention is suited for stabilization of a helix structure such as helix structure and 3.sub.10 helix structure, but can stabilize another secondary structure.

(11) The term stabilize the secondary structure of a peptide as used herein means that the second structure is stabilized to the extent permitting binding of the peptide to a target molecule with certain reproducibility.

(12) Stabilizing the second structure of a peptide by introducing therein a crosslinked structure is presumed to (i) improve protease resistance, (ii) improve membrane permeability, and (iii) improve affinity with a target protein. As described in the background art, there has been an attempt to stabilize the secondary structure of a peptide by crosslinking between amino acid side chains with an amide bond or disulfide bond. There is also a report on the crosslinking reaction through alkene formation in the presence of a chemical catalyst.

(13) The crosslinked structure formed in the peptide of the present invention is, different from that formed in the conventional method, not easily degraded in vivo. More specifically, it is not enzymatically degraded like an amide bond or is not reduced like a disulfide bond.

(14) The peptide of the present invention contains at least one combination of a special amino acid represented by the following formula (I) and an amino acid having, in the side chain thereof, a sulfanyl group and has a crosslinked structure through a thioether bond between the side chain of the special amino acid and the sulfanyl group.

(15) ##STR00009##

(16) In the formula, (A) is a site functioning as a spacer. (A) is a single bond or a linking group having, in the main chain thereof, from 1 to 10 atoms. Although it is not limited insofar as a crosslinking reaction between (B) CH.sub.2X and a sulfanyl group, which will be described later, occurs smoothly, examples include, not limited thereto, a single bond, alkylene groups having from 1 to 10 carbon atoms, alkenylene groups having from 2 to 10 carbon atoms, and alkynylene groups having from 2 to 10 carbon atoms, which may be substituted with a substituent; and alkylene groups, alkenylene groups, and alkynylene groups having, in the main chain thereof, from not greater than 10 atoms, in which one or two carbon atoms in the main chain have been substituted with an oxygen atom, a nitrogen atom, or a sulfur atom and which may be substituted with a substituent.

(17) It is to be noted that presence of (A) is advantageous because it is preferable for the progress of a translation reaction when the peptide of the present invention is synthesized by using translational synthesis.

(18) Although (B) may represent any group insofar as it induces a substitution reaction of X with a sulfanyl group, examples include groups containing at least one bond. Examples of the groups containing a bond include alkylene groups, alkenylene groups, and alkynylene groups which may be substituted with a substituent; groups containing at least one aromatic ring, which may be substituted with a substituent; and groups containing at least one ketone or amide. The number of carbon atoms of (B) may be, when it is an alkylene group, an alkenylene group, or an alkynylene group, for example, from 1 to 10, from 2 to 8, or from 2 to 5. When it is a group containing at least one aromatic ring or a group containing at least one ketone or amide, the number of atoms in the main chain may be set at, for example, from 1 to 10, from 2 to 8, or from 2 to 5. Although the position of the bond is not particularly limited insofar as the substitution reaction of X with a sulfanyl group proceeds smoothly, it is preferred that at least one atom constituting the bond is bound to a carbon atom at which the substitution reaction with a sulfanyl group is made. It is most preferred that the bond is located directly from a CH.sub.2 group while sandwiching it with X.

(19) Examples of (B) include, but not limited to, CC, CC, Ar, ArAr, ArCC, ArCC, NHC(O), C(O), ArNHC(O), and ArC(O).

(20) The following is an example of a crosslinked structure through a thioether bond between the sulfanyl group and the side chain of the special amino acid represented by the formula (I).

(21) TABLE-US-00002 TABLE 2 Reaction site (B) CH.sub.2X Crosslinked structure CCCH.sub.2X 0embedded image embedded image embedded image embedded image embedded image ArCH.sub.2X ArCH.sub.2S

(22) Although X is not particularly limited insofar as it is an atom or group eliminable by the substitution reaction with a sulfanyl group, it may be, for example, Cl, Br, I, OSO.sub.2Me, or OSO.sub.2ArR (wherein, R represents a group selected from the class consisting of CH.sub.3, NO.sub.2, CF.sub.3 and H).

(23) (C) represents a hydrogen atom or an alkyl group which may be substituted with a substituent. Examples of it may include a methyl group, an ethyl group, a propyl group, a butyl group, and a pentyl group, which may be substituted with a substituent. It may be branched.

(24) The term alkenylene group as used herein means an alkylene group having, in the main chain thereof, from 1 to 3 double bonds and the term alkynylene group means an alkylene group having, in the main chain thereof, from 1 to 3 triple bonds. The position of the double bond or triple bond is not particularly limited insofar as the peptide exhibits an intended effect.

(25) Although the substituent herein is not particularly limited, examples include halogen atoms, alkyl groups with from 1 to 6 carbon atoms which may be substituted, alkoxy groups with from 1 to 6 carbon atoms which may be substituted, a cyano group, a nitro group, a hydroxy group, a carboxyl group, acyl groups, an amino group, aryl groups, heteroaryl groups, a phenoxy group, and non-aromatic heterocyclic groups.

(26) Since in the peptide of the present invention, a crosslinked structure is formed through bond formation between the side chain portion of the special amino acid of the formula (I) and the sulfanyl group, it is necessary that the functional groups are present on different constituent units, where one amino acid residue, which is a constituent of the peptide, is considered as a unit, and are placed so as to stabilize the secondary structure when a crosslinked structure is formed. For the convenience of description, such a constituent unit is called amino acid unit.

(27) An amino acid unit which will be an electrophilic agent (corresponding to a special amino acid) and an amino acid unit having a sulfanyl group are preferably placed at positions indicated by (i, i+3), (i, i+4), (i, i+7), or (i, i+11). Referring to FIG. 2, i represents any integer of 0 or greater and shows the position of an amino acid unit counted from the N-terminal residue of a peptide including a crosslinked structure precursor. For example, when i=3 and the amino acid unit which will be an electrophilic agent and the amino acid unit having a sulfanyl group are placed at the position of (i, i+4), they are placed at positions of three amino acid units and seven amino acid units from the N terminal (0 position), respectively to form a crosslinked structure.

(28) When the crosslinked structure is formed at i+3 or i+4, one crosslink is formed at each turn in the case of helix, while when the crosslinked structure is formed at i+7 or i+11, one crosslink is formed at every two turns or three turns. In other words, presence of 2, 3, 6, or 10 amino acid units between the amino acid units forming a crosslinked structure is preferred.

(29) The amino acid unit located between, before, or after the amino acid units constituting a crosslinked structure is preferably any amino acid, except the initiation amino acid at the N terminal, which is a compound (aminocarboxylic acid) having in the molecule thereof, two functional groups, that is, an amino group (NR.sub.2) and a carboxyl group (COOH). A typical one is -aminocarboxylic acid, with a proteinogenic amino acid being more preferred. The positions of the amino acid unit which will be an electrophilic agent and the amino acid unit having a sulfanyl group are not determined and whichever can be placed on the N-terminal side.

(30) The term special amino acid means any of amino acids different in structure from 20 proteinogenic amino acids to be used in a natural translation system and it may be either an artificially synthesized one or that occurring in nature. It embraces any of non-proteinogenic amino acids obtained by chemically altering or modifying a portion of the side chain structure of a proteinogenic amino acid, artificial amino acids, D-form amino acid, N-methylamino acid, N-acylamino acid, -amino acid, and derivatives having a structure obtained by substituting an amino group or a carboxyl group on the amino acid skeleton. The term special peptide means a peptide in which two or more amino acids containing one or more special amino acids have been bound mainly via a peptide bond (it may sometimes contain a cyclic structure or an ester bond).

(31) In the present invention, a typical example of the amino acid having a sulfanyl group is cysteine or an analogue thereof (cysteine analogue). A typical example of the amino acid reactive with it and serving as an electrophilic agent is the special amino acid of the formula (I). As described later, when the sulfanyl-containing amino acid is cysteine, a universal codon can be used, but when it is a non-proteinogenic amino acid, it is encoded with an altered codon. On the other hand, the special amino acid of the formula (I) is always encoded by an altered codon.

(32) In the present invention, an initiation amino acid that will be a peptide-chain N-terminal is not limited to methionine and any proteinogenic amino acid other than methionine or any special amino acid may be used. For example, in Examples which will be described later, a translation system is constructed from typical 20 amino acids except methionine and translation is started by using an initiator tRNA linked with -N-acetylated amino acid. Such modification of the N terminal may be effective for keeping stability of the peptide. Alternatively, one of the amino acids constituting the crosslinked structure precursor may be an initiation amino acid (meaning when i is 0).

(33) In a more typical mode of the position of the amino acids constituting a crosslinked structure precursor, these amino acids are each introduced by an elongation reaction and placed inside the peptide. This is the case where i is an integer of 1 or greater. Although no particular limitation is imposed on the size of the peptide to which the present invention is applied, the present invention is preferably used for a peptide having not greater than 25 amino acid residues and having difficulty in keeping a helix structure.

(34) Specific examples of the compound of the formula (I) include compounds of the formula (VII):

(35) ##STR00015##
In the formula, m stands for an integer from 1 to 10. As a specific example, the compound of the formula (VII) wherein m stands for 1 can be given. This compound can be prepared at a high enantiomer excess by making use of an Schollkopf's chiral auxiliary.

(36) Examples also include compounds of the formula (VIII):

(37) ##STR00016##
In the formula, m has the same meaning as described above.

(38) Examples also include compounds of the formula (IX):

(39) ##STR00017##
In the formula, m stands for the same meaning as described above. As a specific example, the compound of the following formula (X) wherein m stands for 1 can be given.

(40) ##STR00018##

(41) Specific examples of the compound of the formula (I) wherein (C) represents an alkyl chain include compounds represented by the formula (XI) corresponding to the formula (VII) and compounds represented by the formula (XII) corresponding to the formula (X):

(42) ##STR00019##

(43) On the other hand, specific examples of the cysteine analogue include compounds of the formula (V) or (VI).

(44) ##STR00020##

(45) In the formulas (V) and (VI), m has the same meaning as described above.

(46) Additional examples include special amino acids having a sulfanyl group such as homocysteine and mercapto-norvaline.

(47) Preparation Process of Peptide Having Crosslinked Structure Introduced Therein

(48) Next, a preparation process of the peptide of the present invention will be described.

(49) The peptide of the present invention can be prepared by making use of various known processes such as processes through chemical synthesis or translational synthesis or processes equivalent thereto. For example, in the chemical synthesis, a peptide containing the special amino acid of the formula (I) and the sulfanyl-containing amino acid can be synthesized by using liquid phase synthesis, solid phase synthesis using a protecting group such as Fmoc or Boc, or hybrid process using liquid phase synthesis and solid phase synthesis in combination. In the peptide thus synthesized, a thioether bond is formed spontaneously between the special amino acid of the formula (I) and the sulfanyl group without using an enzyme or the like as will be described later and a crosslinked peptide can be obtained.

(50) As one example of the preparation process of the peptide of the present invention, a process using a cell-free translational synthesis system will next be described. In this process, a crosslinked structure is constructed by forming a covalent bond between peptide side chains by making use of a highly selective intramolecular reaction in which the special amino acid contained in the translationally synthesized peptide is involved. This process includes the following steps:

(51) (i) a step of translationally synthesizing a special peptide having, in the molecule thereof, at least one combination of an amino acid having, in the side chain thereof, a sulfanyl group and a special amino acid represented by the formula (I); and

(52) (ii) causing, in each combination, thioether bonding between the sulfanyl group and the side chain of the special amino acid of the formula (I) to form a crosslinked structure.

(53) The steps (i) and (ii) will hereinafter be called a translational synthesis step and a crosslinked structure formation step, respectively.

(54) In the translational synthesis step (i), a peptide in which the following two amino acids are spaced apart with the appropriate number of amino acid residues is obtained by translational synthesis:

(55) (a) an amino acid having, in the side chain thereof, a sulfanyl group, and

(56) (b) a special amino acid represented by the formula (I).

(57) In the special peptide synthesized in the step (i), a chemical structure containing a combination of functional groups, that is, a sulfanyl group and a functional group of the special amino acid reactive therewith will hereinafter be called crosslinked structure precursor. This means that a combination of the amino acids (a) and (b) in which they are spaced apart with the appropriate number of amino acid residues constitutes a crosslinked structure precursor.

(58) For example, refer to a schematic view of FIG. 2. In FIG. 2, the combination of these amino acids is indicated by a solid black circle placed inside the peptide chain. Not only a crosslinked structure precursor combination but also a plurality of crosslinked structure precursors may be placed in one peptide chain. When a peptide chain containing a plurality of crosslinked structure precursors is synthesized by translation, a plurality of crosslinked structures can be formed in the crosslinked structure formation step (ii).

(59) The special amino acid of the formula (I) has, as a side-chain structure permitting formation of a covalent bond for crosslinking, a structure permitting a bond formation reaction with a sulfanyl group (SH) which is a nucleophilic functional group. As a result of this reaction, in the crosslinked structure formation step (ii), the peptide containing the crosslinked structure precursor is changed to a peptide having a crosslinked structure. In the present invention, formation of the crosslinked structure from the crosslinked structure precursor occurs spontaneously under translational synthesis conditions so that no chemical catalyst is necessary.

(60) When the step (i) is conducted in a cell-free translation system, a peptide chain is introduced by artificially allocating the special amino acid to an existing codon by making use of genetic code reprogramming technology. More specifically, a peptide having the special amino acid introduced therein at a position designated by a codon altered (altered codon) can be obtained by preparing mRNA having a codon encoding the special amino acid and translating it under an altered genetic code table.

(61) The term codon as used herein means both an altered codon and a universal codon to be used in natural translation. The altered codon is a codon which has lost its assignment to a proteinogenic amino acid and is assigned to a special amino acid by genetic code reprogramming. The special amino acid is coded only by the altered codon.

(62) A helix peptide compound is obtained by introducing a crosslinked structure in the peptide compound thus synthesized. Although the reaction conditions for forming the crosslinked structure are determined depending on the kind of the combination of the functional groups, the reaction usually proceeds at high selectivity under the cell-free translation system conditions for synthesizing this peptide compound. Accordingly, a crosslinked peptide compound having a spontaneously formed bond can be obtained without especially controlling the reaction conditions.

(63) For example, refer to FIG. 3. When peptide chains in which combinations of various amino acids introduced with an elongation codon after starting translation with formylmethionine have been placed at a positional relationship of (i,i+4), only a combination of the special amino acid X of the formula (I) and cysteine C formed a crosslinked structure through a thioether bond.

(64) Similarly, in Examples which will be described later, described is a peptide containing a crosslinked structure precursor obtained by translational synthesis of a peptide sequence in which a special amino acid having, in the amino acid chain thereof, propargyl chloride and cysteine have been placed. In the exemplified mode, a substitution reaction by the sulfanyl group to the propargyl position spontaneously proceeds after translation to form a thioether bond and a crosslinked structure is completed.

(65) Cell-free (In Vitro) Translation System

(66) The term translation system means a place for peptide translational synthesis and it is generally a concept including both a method and a kit (substance). As the cell-free translation system to be used in the present invention, a system constructed by subdividing a known reconstituted translation system and reducing impurities as much as possible is preferably used. Specific constituents of the translation system as a kit (substance) usable in the present invention will next be described.

(67) Specific examples of the constituents of the translation system include ribosome, IF group, EF group, RF group, RRF, a minimum set of natural amino acid, tRNA, and a specific ARS protein enzyme which will become necessary in the synthesis of an intended peptide, and energy sources for translation reaction. As the ribosome, that isolated from Escherichia coli and then purified is preferably used.

(68) As the proteins, used are translation initiation factors (for example, IF1, IF2, and IF3), translation elongation factors (for example, EF-Tu, EF-Ts, and EF-G), translation termination factors (for example, RF1, RF2, RF3, and RRF), and enzymes for regeneration of an energy source (for example, creatine kinase, myokinase, pyrophosphatase, and nucleotide-diphosphatase kinase). Among them, translation termination factors and enzymes for regeneration of an energy source may be added as desired. Although T7 RNA polymerase may be added for the transcription from a template DNA, RNA polymerase is not necessary if mRNA transcribed in advance is added to the translation system.

(69) In addition, similar to the conventional system, an appropriate buffer solution, an NTP as an energy source of a translation reaction, Creatine phosphate, and factors necessary for ribosome activation, RNA stabilization, and protein stabilization can be used as needed. While, in the typical translation reaction, N-formylmethionine is defined as initiation codon AUG by initiator tRNA so that a formyl donor such as 10-formyl-5,6,7,8-tetrahydroforlic acid (Baggott et al., 1995) is essential, in the present invention, a formyl donor is optional when a translation reaction is started with the special amino acid. For the same reason, methionyl-tRNA formyltransferase (MTF) is also not essential.

(70) In the translation system to be used in the present invention, natural tRNAs and ARSs can be used for natural proteinogenic amino acids as in the conventional system. Natural tRNAs are, for example, a mixture obtained by collecting Escherichia coli, disrupting it, and purifying the tRNA fraction. They can also be commercially available. The specific A, U, C, and G in the natural tRNAs have been chemically modified with an enzyme. Alternatively, tRNAs having a natural sequence transcribed in a test tube can also be used.

(71) On the other hand, for the special amino acid(s), not natural tRNA(s) but artificial tRNA(s), which is (are) a tRNA transcript(s) as orthogonal tRNA(s), is (are) preferably used. The artificial tRNA(s) can be prepared by in vitro transcription reaction using an appropriate RNA polymerase while using the corresponding DNA(s) as a template(s). No chemical modification can be found in such an artificial tRNA(s).

(72) In order to introduce the special amino acid(s) into the peptide which is a translation product, orthogonal tRNA(s) acylated with the special amino acid(s) in advance is (are) added to the translation system. In a preferred mode, the tRNA(s) acylated with the special amino acid(s) is (are) prepared by binding the special amino acid(s) to the 3-end of orthogonal tRNA(s) by using a flexizyme, under conditions free of the other tRNAs or ARSs. It is also possible to use a tRNA(s) chemically or enzymatically bound with the special amino acid(s).

(73) Peptide Library

(74) The term peptide library as used herein means a library containing two or more peptides having the above-mentioned crosslinked structure introduced therein, in other words, two or more peptides different in sequence. In the peptides constituting the peptide library, amino acid other than an amino acid having, in the side chain thereof, a sulfanyl group and a special amino acid represented by the formula (I) are arbitrary amino acids. For example, when a peptide composed of 25 amino acid residues contains only a combination of an amino acid having a sulfanyl group and a special amino acid represented by the formula (I), a peptide library contains 20.sup.23 peptides in theory even if only 20 natural amino acids are used. This means that it has a sufficient library size.

(75) The peptide library of the present invention has a stable secondary structure due to crosslinking so that it is excellent in cell membrane permeability. Screening using this library makes it possible to obtain useful peptides such as peptides having high affinity with a target and peptides having physiological activity such as peptides inhibiting the function of a target protein.

(76) In one mode of the peptide library, each peptide may be linked with mRNA encoding it. When they are linked, a phenotype (amino acid sequences of peptides) is displayed on a genotype (nucleic acid sequences) in the library so that it can be applied to in vitro display. In other words, a peptide is selected from a display library in which genetic information is displayed as peptides, which are translation products of it. This means that random peptide molecules in the library are attached with a tag which can be amplified or read by a molecular biological method.

(77) In the in vitro display, peptides synthesized using a cell-free translation system (also called in vitro translation system) are displayed while being assigned to genetic information. As this method, ribosome display, mRNA display, DNA display, and the like are known. RaPID display (not published) can also be used. Each display method has a mechanism of assigning the genetic information recorded in mRNA or DNA to a peptide encoded by the genetic information as a [genetic information]-[translation product] complex by linking them with each other. In the ribosome display, mRNA-ribosome-peptide forms a triple complex. In the mRNA display and RaPID display, an mRNA-peptide complex is formed. In DNA display, a DNA-peptide complex is formed. In the present invention, any in vitro display library can be used.

(78) Production Process of Peptide Library

(79) Although no particular limitation is imposed on the production process of a library of peptides having a random sequence, the library can be produced, for example, by conducting translational synthesis from a template nucleic acid (mRNA or DNA corresponding thereto) having a random sequence in a region encoding a peptide in a cell-free translation system.

(80) Accordingly, one mode of the production method of the peptide library includes:

(81) (i) a step of producing a library of mRNAs having, in an RNA encoding a random amino acid sequence, a combination of a codon encoding an amino acid having, in the side chain thereof, a sulfanyl group and a codon encoding a special amino acid represented by the formula (I), wherein, in each combination, the codon encoding an amino acid having, in the side chain thereof, a sulfanyl group and the codon encoding a special amino acid of the formula (i) are spaced apart with 2, 3, 6, or 10 amino acid units;

(82) (ii) a step of translating the mRNAs by using a cell-free translation system containing a tRNA linked with the special amino acid to obtain a peptide group having a random sequence with the special amino acid placed therein; and

(83) (iii) a step of binding, in each peptide, the sulfanyl group and the side chain of the special amino acid of the formula (I) to form a crosslinked structure.

(84) To construct a crosslinked peptide library having a random sequence, a random sequence composed of repetition of a plurality of triplets and codons encoding amino acids which will form a crosslinked structure precursor are placed in a region of an mRNA sequence encoding a peptide. For example, as shown in FIG. 5, a special amino acid having, in the side chain thereof, a propargyl chloride structure is allocated to one of elongation codons and cysteine is introduced into a position spaced apart, from the above position, by codon bases of the random sequence corresponding to the appropriate number of amino acid units (for example, 2, 3, 6, or 10 amino acid units as described above).

(85) A template mRNA is constructed by arranging, in addition to the codons to which said two amino acids have been allocated and an initiation codon, codon bases having a random sequence with a desired length. Translation of this mRNA makes it possible to construct a thioether bond through a nucleophilic substitution reaction between propargyl chloride and the sulfanyl group located in the side chain of the cysteine and construct a crosslinked peptide library having a random sequence.

(86) In order to construct a library having a random sequence, it is the common practice to employ NNK (N represents any base selected from G, A, C, and U and K represents U or G) as a codon sequence of mRNA which will be a template of 20 proteinogenic amino acids so that all the proteinogenic amino acids appear at random. However, when the special amino acid of the formula (I) serving as an electrophilic agent for forming a crosslinked structure is assigned to one of elongation codons, for example, AUG (AUG can be used as both of an initiation codon and an elongation codon) and a peptide library is constructed using the NNK library, AUG appears at random as one of the codons represented by NNK so that a plurality of the special amino acids is incorporated in the peptide library.

(87) When AUG is used as the codon encoding the special amino acid of the formula (I), by way of using a repetition of triplets having NNC or NNU (N represents any one base of A, U, G, and C) as a random sequence, it is possible to avoid AUG from appearing in the random sequence. As a result, the special amino acid of the formula (I) can be introduced into only the designated position in the random sequence.

(88) When a library of bases having an NNU or NNC random sequence is used, five amino acids (Met, Trp, Gln, Lys, and Glu) do not appear. NNK may be used in addition to NNU and NNC if the merit of causing them to appear exceeds the demerit of placing the special amino acid at a position other than the desired position.

(89) It is also possible to use a codon corresponding to an amino acid which does not appear when NNU or NNC is used for introducing another special amino acid for forming a crosslinked structure or a special amino acid having another additional function at a designated position. For example, such a special amino acid can be introduced at a designated position by using four codons, UGG, CAG, AAG, and GAG in addition to AUG.

(90) mRNA including NNU, NNC, and NNK can be obtained by synthesizing DNA including NNT, NNC, and NNK by using a various DNA synthesizer, followed by transcription.

(91) In the above-mentioned illustrative mode, the special amino acid of the formula (I) is introduced through a peptide chain elongation reaction with elongator tRNA. Here, the initiator tRNA pairs with an AUG codon at a translation starting position and introduces an amino acid which is linked thereto into the peptide N-terminal. An AUG codon at the other position pairs with the elongator tRNA having a CAU codon. Two amino acids are therefore assigned to the AUG codon with two tRNAs. The AUG codon which pairs with the initiator tRNA will hereinafter be called initiation AUG and the AUG codon which pairs with the elongator tRNA will hereinafter be called AUG simply.

(92) In the present invention, a cell-free translation system comprised of components optimized according to the intended use is used after DNA or RNA molecules corresponding to a base sequence serving as a translation template are added. A nucleic acid sequence may include, similar to a protein expression system making use of living cells, a base sequence advantageous for translation, depending on a translation system to be employed, in addition to a region encoding an intended amino acid sequence. For example, in a system using ribosome derived from Escherichia coli, the efficiency of a translation reaction increases when the sequence contains, upstream of the initiation codon, Shine-Dalgarno (SD) sequence, epsilon sequence, or the like.

(93) A region encoding a peptide has, at the N terminal thereof, an initiation codon. The initiation codon is typically a triplet sequence, AUG. Using a desired sequence as an anticodon sequence in the initiator tRNA synthesized through an in vitro transcription reaction, however, enables reprogramming of the initiation codon so that another base sequence can also be used as an initiation codon in addition to AUG codon.

(94) The region encoding a peptide has, on the C terminal side thereof, a sequence for linking a nucleic acid molecule and a peptide which is a translation product thereof for in vitro display. For example, in an mRNA display method using a puromycin linker, an mRNA library-peptide complex library is formed by adding, to a translation system, an mRNA library linked preliminarily with a puromycin linker. The linker is typically inserted between the 3 end side of the mRNA and puromycin in order to incorporate puromycin in the A site of a ribosome efficiently.

(95) Puromycin functions as a substrate (aminoacyl tRNA analogue) of a peptide transfer reaction on the ribosome and by binding it to the C-terminal of the elongation peptide, it links between mRNA and the peptide. The mRNA display method is a technology of integrating genotype and phenotype with each other by linking an mRNA and a peptide via an appropriate linker in an in vitro translation system. Insofar as such an object is achieved, puromycin may be replaced by a linker containing another substance having a similar function, which is within a range of the recognition of those skilled in the art.

(96) As another method, it is also possible to use a method of forming an mRNA-peptide complex library by hybridization of a linker and an mRNA in an in vitro translation system instead of the method using an mRNA linked preliminary with a linker. For example, an mRNA-peptide complex library is formed by using a phenylalanine linker (3-phenylalanine-ACCA-PEG-[a base sequence complementary to the 3-end region of an mRNA library]-5) prepared by using flexizyme and a strand complementary to an mRNA library in combination (RAPID display method described in PCT/JP2010/685459 which is an unpublished application). In this case, am mRNA contains a base sequence for hybridization with the linker downstream (3 end region) of the region encoding a peptide.

(97) In Example which will be described specifically later, an initiation AUG codon is placed at the N terminal of a peptide, an elongation AUG codon (or codon UGC encoding Cys) encoding the special amino acid of the formula (I) is placed after a random sequence corresponding to some amino acid residues, and a codon UGC (or the above-mentioned codon encoding the special amino acid of the formula (I)) encoding Cys are placed after a random sequence of appropriate amino acid units. Then, a random sequence follows until the C terminal. Please refer to FIGS. 2 and 5. Just after it, a codon encoding GlySerGlySerGlySer serving as a linker follows.

(98) Aminoacylation Reaction using Flexizyme

(99) Flexizyme is an RNA catalyst (ARS ribozyme) having a function of acylating a desired tRNA with an amino acid substrate having a desired structure. Different from natural ARS protein enzymes, flexizyme has no specificity to each amino acid or each tRNA and is capable of conducting aminoacylation of a tRNA by using any amino acid other than the amino acid which is to be linked to such tRNA in nature. More specifically, it does not contain an -substituent at the recognition site of an amino acid so that not only L amino acid but also hydroxy acid (having a hydroxyl group at the position), -N-methylamino acid, -N-acylaminoacid, or D-amino acid can be used as a substrate. In addition, an amino acid modified after translation such as -N-acetyllysine or -N-methyllysine can also be used as a substrate. Details on it are described in, in addition to the above-mentioned document on flexizyme, the following documents: Y. Goto, H. Suga (2009) Translation initiation with initiator tRNA charged with exotic peptides Journal of the American Chemical Society, Vol. 131, No. 14, 5040-5041, WO2008/059823 Translation and synthesis of polypeptide having nonnative structure at n-terminus and application thereof, Goto et al., ACS Chem. Biol., 2008, 3, 120-129, T. J. Kang, et al., Chem. Biol., 2008, 15, 1166-1174 Expression of histone H3 tails with combinatorial lysine modifications under the reprogrammed genetic code for the investigation on epigenetic markers, and WO2008/117833 Process for synthesizing cyclic peptide compound.

(100) In the present invention, the special amino acid is introduced into a peptide sequence by adding, to a cell-free translation system, orthogonal tRNA obtained by acylation with the special amino acid by using flexizyme.

(101) The orthogonal tRNA is a tRNA capable of efficiently expressing a designated amino acid, being paired with the codon of mRNA in a peptide synthesis reaction on a ribosome, though it is not aminoacylated in a translation system because it is not recognized by naturally occurring ARS (for example, ARS protein enzyme derived from Escherichia coli) inherent in the translation system. As the orthogonal tRNA, for example, a natural suppressor tRNA derived from a different species or an artificially constructed tRNA is used. As described above, an orthogonal tRNA which is an artificial transcript is preferably used for the introduction of the special amino acid in the present invention.

(102) Flexizyme has catalytic ability with an activated amino acid ester as a substrate. It recognizes a carbonyl group which is a reaction point of an amino acid, an aromatic ring in an amino acid side chain or a leaving group, or the 5-RCC-3 sequence portion (R represents A or G) present at the 3 end of tRNA and acylates adenosine at the 3-end with such amino acids. Flexizyme has no specificity to the anticodon portion of tRNA. This means that even if the anticodon portion of tRNA is changed to any sequence, it has no influence on the efficiency of aminoacylation. Since any special amino acid can be linked to a tRNA having any anticodon sequence by using flexizyme, any special amino acid can be assigned to any codon. This therefore makes it possible to produce a library having any special amino acid introduced therein.

(103) The following is a known structure of flexizyme (RNA sequence).

(104) TABLE-US-00003 OriginalflexizymeFx (SEQIDNO:1) [GGAUCGAAAGAUUUCCGCAGGCCCGAAAGGGUAUUGGCGUUAGGU-3, 45nt] DinitrobenzylflexizymedFx (SEQIDNO:2) [5-GGAUCGAAAGAUUUCCGCAUCCCCGAAAGGGUACAUGGCGUUAGG U-3,46nt] EnhancedflexizymeeFx (SEQIDNO:3) [5-GGAUCGAAAGAUUUCCGCGGCCCCGAAAGGGGAUUAGCGUUAGGU- 3,45nt] AminoflexizymeaFx (SEQIDNO:4) [5-GGAUCGAAAGAUUUCCGCACCCCCGAAAGGGGUAAGUGGCGUUAGG U-3,47nt]

(105) Since different from natural ARS protein enzyme, flexizyme serves as a catalyst only in a procedure of binding an amino acid substrate to tRNA while skipping a procedure of forming a high energy intermediate (aminoacyl AMP), which is the first stage of an aminoacylation reaction, it is necessary to use, as an amino acid substrate, an amino acid weakly activated in advance. This means that instead of skipping adenylation of an amino acid, an amino acid derivative having a weakly activated ester bond at a carbonyl group at which acylation proceeds is used. Activation of an acyl group is usually achieved by binding an ester having an electrophilic group to it, but an ester having a too strong electrophilic group causes not only hydrolysis in water but also acylation into a random RNA. It is therefore necessary to use a weakly activated amino acid substrate which hardly causes such a side reaction in a catalyst free state. Such weak activation can be achieved by using AMP, a cyanomethyl ester, a thioester, or a benzyl ester having an electrophilic functional group such as nitro group, fluorine, or the like.

(106) The amino acid substrate should have, in the amino acid side chain or leaving group, an aromatic ring so as to be recognized by flexizyme. The term activated amino acid ester means an amino acid substrate which has, as aminoacyl AMP in a natural aminoacylation reaction, a weakly activated ester bond and at the same time, has an aromatic ring in the amino acid side chain or leaving group. Preferred examples of the activated amino acid ester include, but not limited to, aminoacyl-cyanomoethyl ester (CME: cyanomethyl ester), aminoacyl-dinitrobenzyl ester (DNB: 3,5-dinitrobenzyl ester), and aminoacyl-4-chlorobenzyl thioester (CBT: p-chloro-benzyl thioester).

(107) For example, in Example which will be described later, -N-acetyl-L-phenylalanine (Ac-F) is linked to an artificially constructed initiator tRNA to introduce it to the peptide N-terminal and at the same time, three amino acids (refer to the structural formula shown on the lower side of Table 1 of Example), that is, (s)-2-amino-6-chlorohexy-4-ynoic acid, (s)-2-amino-7-chlorohepto-5-ynoic acid, (s)-2-amino-8-chloroocto-6-ynoic acid, each having propargyl chloride in the side chain thereof, are linked to artificially constructed elongator tRNAs, respectively. In the case of these three compounds, (s)-2-amino-6-chlorohexy-4-ynoic acid DNB, (s)-2-amino-7-chlorohepto-5-ynoic acid DNB, and (s)-2-amino-8-chloroocto-6-ynoic acid DNB are used as substrates to mix dFx and tRNA and respective tRNAs bound to these compounds can be prepared. In the case of -N-acetyl-L-phenylalanine, -N-acetyl-L-phenylalanine CME is used as a substrate to mix eFx and tRNA and a tRNA bound to N-acetyl-L-phenylalanine can be prepared.

(108) ##STR00021##

(109) Acylation reaction by using flexizyme may be conducted either in a solution or in a column in which an ARS ribozyme is immobilized on a carrier. For example, when the scale of the translation reaction is as small as 100 l or less, it is recommended to conduct acylation of tRNA in a solution by using flexizyme; dissolve pellets obtained by precipitating the reaction solution in ethanol in a proper buffer (for example, 1 mM potassium acetate, pH 5 or the like); and add the resulting solution to a translation system. As the reaction conditions, preferable conditions may be selected as needed. The following is one example of the conditions of a small-scale reaction. It is recommended to react a 0.1M reaction buffer of pH 7.5 containing from 0.5 to 20 M tRNA, from 0.5 to 20 M flexizyme, from 2 to 10 mM an amino acid substrate, and 0.6M MgCl.sub.2, each in terms of a final concentration, at 0 C. for from 1 to 24 hours.

(110) When the scale of the translation reaction exceeds 100 l, it is convenient to use flexizyme immobilized on a carrier in consideration of reuse of the flexizyme. Examples of the carrier include, but not particularly limited to, resins, agarose, sepharose, and magnetic beads. With the flexizyme immobilized on the carrier, the reaction may be conducted, for example, according to the following method: Murakami, H., Bonzagni, N. J. and Suga, H. (2002), Aminoacyl-tRNA synthesis by a resin-immobilized ribozyme, J. Am. Chem. Soc. 124(24): 6834-6835. Isolation of the aminoacylated tRNA as a reaction product can be conducted using various methods. One example is to elute it from a column with a buffer containing about 10 mM EDTA. The resin on which ARS ribozyme has been immobilized can be used in repetition a dozen times, for example, by equilibrating it with a reaction buffer.

(111) Initiator tRNA and Elongator tRNA

(112) It is important that in a natural translation reaction, an initiator tRNA is used only in the initiation of translation but not in an elongation reaction and on the contrary, an elongator tRNA is not used in the initiation reaction. This difference between the initiator tRNA and the elongator tRNA is also applied to the present invention.

(113) In the present application, an artificial tRNA is preferably used for acylation of the special amino acid. A non-restrictive example of the artificial tRNA which is an elongator tRNA is tRNA.sup.Asn-E2. The base sequence of this tRNA is based on natural tRNA.sup.Asn (5-UCCUCUG.sup.s4UAGUUCAGDCGGDAGAACGGCGGACUQUU.sup.t6AAYCCGUAU.sup.m7GUCAC UGGTYCGAGUCCAGUCAGAGGAGCCA-3) (SEQ ID NO:7) which is a tRNA for elongation reaction derived from Escherichia coli (.sup.s4U: 4-thiouridine, D: dihydrouridine, Q: queuosine, .sup.t6A: 6-threonylcarbamoyladenine, Y: wyosine, .sup.m7G: 7-methylguanosine, T: ribothymidine). The present inventors removed modified bases from this natural tRNA and introduced mutation thereinto and thereby prepared tRNA.sup.Asn-E2, that is, a tRNA for elongation reaction not aminoacylated with 20 aminoacylation enzymes of Escherichia coli through in vitro transcription. The NNN site corresponds to an anticodon, which is changed so as to correspond to a codon. (tRNA.sup.Asn-E2: 5-GGCUCUGUAGUUCAGUCGGUAGAACGGCGGACUNNNAAUCCGUAUGUCACUGGUUCG AGUCCAGUCAGAGCCGCCA-3 (SEQ ID NO:5) [eight positions where modifications are removed: .sup.s4U8U, D16U, D20U, .sup.t6A37A, Y39U, .sup.m7G46G, T54U, and Y55U. The thirty-fourth Q is an anticodon so that it is changed so as to correspond to a codon] [mutated at four sites in total: U1G, C2G, G71C, and G72C].

(114) A non-restrictive example of the artificial tRNA which is an initiator tRNA is tRNA.sup.fMet. The base sequence of this tRNA is based on natural tRNA.sup.fMet (5-CGCGGGG.sup.s4UGGAGCAGCCUGGDAGCUCGUCGGGCmUCAUAACCCGAAGAUCGU CGGTYCAAAUCCGGCCCCCGCAACCA-3) (SEQ ID NO:8) of Escherichia coli (Cm: 2-O-methylcytidine). The present inventors removed modified bases from this natural tRNA and changed the first C of the 5 end to G and thereby prepared tRNA.sup.fMet, that is, a tRNA for initiation reaction through in vitro transcription. The CAU site is an anticodon and corresponds to an initiation AUG codon. (tRNA.sup.fMet used in the present application: 5-GGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGAUCGUCG GUUCAAAUCCGGCCCCCGCAACCA-3 (SEQ ID NO:6) [six positions where modifications were removed: .sup.s4U8U, D20U, Cm32C, T54U, Y55U] [mutated at one site: C1G]). It is important for the initiator tRNA that the first base at the 5 end (C in the natural tRNA.sup.fMet and G in the tRNA.sup.fMet of the present application) does not form a complementary strand with the seventy second base (A in the natural tRNA.sup.fMet and the tRNA.sup.fMet of the present application). This non-complementary strand transfers a formyl group to Met-tRNA.sup.fMet, recognized by methionylformyl transferase (MTF) (with the proviso that when a special amino acid for initiation is used, it does not have any meaning) or it suppresses EF-Tu binding.

(115) In Example which will be describe later, N-acetyl-L-phenylalanine is linked to tRNA.sup.fMet.sub.CAU to introduce it into the peptide N terminal and three special amino acids having, in the side chain thereof, propargyl chloride are linked to tRNA.sup.AsnE2.sub.CAU, respectively. Although tRNA.sup.AsnE2.sub.NNN can be used while changing the codon sequence (NNN in which N represents any base), when an altered codon encoding a special amino acid having, in the side chain thereof, a propargyl chloride structure is AUG, the anticodon sequence is CAU.

(116) Since these initiator and elongator artificial tRNAs have orthogonality to natural ARS, a natural amino acid is not linked thereto in the translation system, but such tRNAs are accepted without a problem in the translation initiation reaction or peptide-chain elongation reaction on a ribosome. It has been confirmed in the cell-free translation system used in Example that these artificial tRNAs are usable in practice. The artificial tRNA usable in the present invention is however not limited to them. It will be apparent for those skilled in the art that tRNAs usable for introducing the special amino acid of the present invention can be selected as needed, depending on the components of the cell-free translation system to be used.

(117) In Vitro Selection

(118) In the present invention, the special peptide library constructed in the cell-free translation system can be completely adapted to the in vitro display technology including mRNA display so that it is possible to create peptide molecules binding to a target from the high-diversity special peptide library having 10.sup.13 or more peptides.

(119) The in vitro display technology is utilized as a tool of directed evolution. In this directed evolution, with a view to creating proteins or peptides having a desired function or property, genes having such possibility are prepared on a large scale and a clone having a desired phenotype is selected from them. Basically, first, a DNA group (DNA library) is produced. Then, an RNA library is produced as an in vitro transcript, followed by production of a peptide group (peptide library) as an in vitro translation product. From this peptide library, peptides having a desired function or property are selected by using some screening system.

(120) For example, when a peptide molecule binding to a certain protein is desired, a peptide group is applied in a column in which a target protein is immobilized and a mixture of the peptide molecule bound to the column can be collected. At this time, each peptide molecule is attached with a nucleic acid molecule, a template of the peptide molecule, as if a tag. In mRNA display library, each peptide molecule is attached with mRNA. Then the group of peptide-mRNA complexes thus collected is returned to DNA by using a reverse transcriptase and then amplified by using PCR to obtain a biased library containing many clones having a desired phenotype. Then, a similar selection test is conducted again.

(121) It is also possible to conduct a reverse transcription reaction before selection in order to change the nucleic acid portion to a duplex (DNA/RNA hybrid) and thereby avoid possible collection of an RNA aptamer. By repeating this operation, a clone having a desired phenotype is concentrated in the group with the passage of the generation.

(122) In order to identify a peptide aptamer, a gene of the peptide aptamer that binds to a target substance can be cloned by repeating a step of mixing an in vitro display library and the target substance; selecting a molecule (active species) presenting the peptide that has bound to the target substance; and producing a nucleic acid library by using PCR from the nucleic acid portion of the molecule thus selected.

(123) As the target substance, usually any compound such as protein, peptide, nucleic acid, carbohydrate, or lipid or complex of any of them may be usable.

(124) In order to select the active species, it is necessary to bring a [genetic information]-[peptide] complex into contact with the target substance and isolate and collect a complex that presents the peptide bound to the target substance from many other complexes that have not been bound to the target substance. Many technologies are known as such a collection method.

(125) For example, it is convenient to give the target substance some modifications which can be collected by binding to a solid phase. For example, a polyhistidine tag linked to the target substance can be collected by using specific binding of the polyhistidine tag to a carrier having Ni-NTA supported thereon. Examples of such a specific binding usable include a combination of polyhistidine peptide/metal ion (nickel, cobalt, etc.), biotin-binding protein (avidin, streptavidin, etc.)/biotin, maltose-binding protein/maltose, glutathione-S-transferase/glutathione, and antibody/antigen (epitope) combinations, but specific binding is not limited to them.

(126) The present invention includes creating a special peptide that binds to a target substance by repeating in vitro selection having the following steps: bringing a peptide library to a target substance, selecting an active species presenting the peptide that has bound to the target substance, amplifying the nucleic acid sequence of the thus-selected active species, and selecting an active species from the peptide library synthesized again in a cell-free translation system with the amplified nucleic acid sequence as a template. In particular, by using a library containing secondary structure-directing peptides, that is, a library intended to have many predetermined secondary structures, that is, helix structures by incorporating a crosslinked structure in a linear peptide, a three-dimensional structure suited for intermolecular interaction is provided so that it is possible not only to obtain molecules that easily bind to the target protein but also to acquire peptides that bind to a site involved in the intermolecular interaction of the protein and show inhibitory activity.

(127) Creation of a special peptide compound that binds to a target substance includes collecting active species presenting peptides that have bound to the target substance to analyze their nucleic acid sequence, determining a peptide sequence from the nucleic acid sequence, selecting appropriate special peptides based on the resulting peptide sequence, and obtaining an amino acid sequence and a nucleic acid sequence of the special peptides that bind to the target substance. Moreover, based on the sequence information thus obtained, a special peptide can be synthesized, purified, and isolated by using a desired method. From the special peptide thus obtained, a special peptide having higher activity can be obtained by evaluating the binding ability to a target protein or confirming the inhibitory activity against the target protein.

(128) Accordingly, the present invention includes a method of obtaining a peptide having inhibitory activity against intermolecular interaction of a target protein from a peptide library, including:

(129) (i) a primary screening stage of selecting a peptide that binds to a target protein, and

(130) (ii) a secondary screening stage of evaluating the binding ability of the peptide selected in the primary screening stage and determining that the peptide shows a definite binding force;

(131) the primary screening stage includes:

(132) (a) producing a secondary-structure-directing peptide library,

(133) (b) bringing the peptide library into contact with a target protein; and

(134) (c) selecting a peptide molecule that binds to the target protein.

(135) Construction Method of Helix-containing Library when Bcl-2 is a Target and Method of Acquiring Therefrom Peptides Inhibiting Intermolecular Interaction

(136) A description will hereinafter be made on the construction method of a peptide library when Bcl-2 is used as a target protein and a method of acquiring therefrom inhibitory peptides (FIG. 4). This target protein will be addressed later in the section of Example. The mode described here is exemplary only and the present invention is not limited to it.

(137) Target Protein Bcl-2

(138) Apoptosis which is programmed cell death occurs through various pathways and one of them is a control mechanism in which Bcl-2 protein is involved. Bcl-2 protein binds to a protein that induces apoptosis and thereby suppresses its activity. It is known that in cancer cells, much Bcl-2 protein is expressed and prevents apoptosis from being induced.

(139) If molecules that bind strongly to Bcl-2 at high sensitivity can be obtained, they will inhibit Bcl-2 from binding to an apoptosis-inducing protein and thereby introduce apoptosis to cancer cells. Such inhibitory molecules have recently been studied energetically, but it has been difficult to develop such a molecule inhibiting interaction between proteins. A helix structure called BH3 domain contained in the Bcl-2 protein is used for this intermolecular interaction so that it is presumed to be possible to obtain a highly-selective and strong inhibitor if a library of molecules having a helix structure is formed. Based on this presumption, molecules have been searched from a chemical library of the above-described peptides having a crosslinked structure formed through alkene formation, but molecules having strong inhibitory activity have not yet been obtained.

(140) Construction of mRNA Library

(141) First, in order to construct a peptide library through translation, an mRNA library serving as a template is produced. The length of the sequence of a portion of the mRNA to be translated is not limited. For example, it can be a length including from 16 to 24 codons (for example, pools from 16-1 to 24-4 in FIG. 5). In these codons, that at the N-terminal is an initiation AUG codon. A codon encoding GlySerGlySerGlySer which will be a linker may be added to the C-terminal side. The initiation AUG codon may have, downstream thereof, a random codon sequence of NNU or NNC (N represents any one base of A, U, G, and C). In this random sequence, as a specific one codon, an AUG codon is placed for introducing the special amino acid of the formula (I) and at a position separated by 2, 3, 6, or 10 amino acid units from it, a codon UGC encoding Cys is placed (for example, FIGS. 2 and 5).

(142) Construction of Peptide Library

(143) The mRNA library is translated under an altered genetic code table. For example, a translation system is constructed by removing methionine from typical 20 amino acids and a template mRNA is translated by using, instead of methionine, (i) tRNA.sup.fMet.sub.CAU to which -N-acetylated amino acid has been linked and (ii) tRNA.sup.AsnE2.sub.CAU to which a special amino acid having, in the side chain thereof, a propargyl chloride structure has been linked. These two aminoacyl tRNAs can be prepared by using flexizyme.

(144) Here, the aminoacyl tRNA (i) is recognized by an initiation factor and matches with an initiation AUG codon, while the aminoacyl tRNA (ii) is recognized by an elongation factor and matches with an AUG codon. It is therefore possible to introduce two amino acids into an AUG codon only by removing methionine. In the translated peptide, a crosslinked structure is formed through a thioether bond obtained by the action of the sulfanyl group of cysteine on the propargyl chloride structure.

(145) Moreover, by binding puromycin to the 3-end of each mRNA of the mRNA library in advance, the C terminal of the peptide is linked to mRNA via Pu (puromycin) after translation. For initiation, any special amino acids other than N.sup.-acetyl-L-phenylalanine, methionine, or other 19 proteinogenic amino acids may be used.

(146) Acquisition of Inhibitory Peptide

(147) The peptide library thus obtained is screened by various in vitro display methods such as mRNA display method and ribosome display method and peptides that bind to Bcl-2 are selected.

(148) Since a secondary structure-directing peptide library designed so that a helix structure such as BH3 domain that interacts with a target protein is formed stably in a translated peptide is used, even if screening is conducted with only binding as an indicator, there is a high possibility of the peptide thus obtained binding to a molecular recognition site of the target protein and inhibiting its intermolecular interaction.

(149) Construction of Peptide Library Against Different Target

(150) The present invention is used for screening with various molecules including Bcl-2 as a target. As the target molecule, those exerting intermolecular interaction by recognizing a helix structure are preferably selected. Examples of the molecule that exerts intermolecular interaction by recognizing a helix structure include, but not limited to, p53 and hDM2 (F. Bernal, A. F. Tyler, S. J. Korsmeyer, L. D. Walensky, G. L. Verdine J. Am. Chem. Soc. 129 2456-2457 (2007)).

(151) The present invention will hereinafter be described specifically. These examples are exemplary only and are not intended to limit the scope of the invention.

(152) Example

(153) In order to obtain a peptide that binds to the site of intermolecular interaction by the BH3 domain of Bcl-2 and thereby inhibits its intermolecular interaction, a peptide library (NNU mRNA library) having, in the sequence thereof, a crosslinked structure formed by a special amino acid and cysteine was constructed, followed by selection using the mRNA display method.

(154) NNU mRNA Library

(155) First, a double-stranded DNA having the following sequence was prepared (in the following sequence, only a Forward strand is described in the order of 5.fwdarw.3).

(156) TABLE-US-00004 (SEQIDNO:9) TAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACAT(ATG) (NNT)s(ATG)(NNT).sub.3(TGC)(NNT).sub.t(GGT)(AGC)(GGC)(AGC) (GGC)(AGC)(TAG)GACGGGGGGCGGAAA

(157) With regard to the translation region, one codon is shown in parentheses; N represents any one of A, T, G, and C; s and t stand for the repetition number of the triplet and correspond to 2 and 8, 6 and 4, 2 and 12, 6 and 8, 10 and 4, 2 and 16, 6 and 12, 10 and 8, or 14 and 4, respectively.

(158) Then, it was transcribed by using T7 RNA polymerase to obtain a library composed of mRNA pools represented by the following sequence (refer to the table shown on the lower side of FIG. 5).

(159) TABLE-US-00005 (SEQIDNO:10) GGGUUAACUUUAAGAAGGAGAUAUACAU(AUG)(NNU)s(AUG) (NNU).sub.3(UGC)(NNU)t(GGU)(AGC)(GGC)(AGC)(GGC) (AGC)(UAG)GACGGGGGGCGGAAA

(160) The transcripts thus obtained were mixed in equal amount and provided for the following test.

(161) mRNA Display

(162) Peptides that bound to Bcl-2 were selected from a random peptide library by repeating the cycle from linking with a puromycin linker to amplification of sequence information of collected peptides (FIG. 4).

(163) Linking with Puromycin Linker

(164) The puromycin linker having the below-described sequence was annealed with the above-mentioned mRNA library and linked via T4 RNA Ligase. SPC18 represents PEG having C and O in total of 18.

(165) TABLE-US-00006 (SEQIDNO:11) pdCTCCCGCCCCCCGTCC(SPC18).sub.5CC(Pu)
Translation

(166) The mRNA linked with the linker was translated using the mRNA-altered genetic code table (FIG. 6). In this Example, a translation system was constructed by removing methionine from typical 20 amino acids and then, the following two aminoacyl tRNAs (i) and (ii):

(167) (i) tRNA.sup.fMet.sub.CAU to which -N-acetyl-L-phenylalanine had been linked, and

(168) (ii) tRNA.sup.AsnE2.sub.CAU to which (s)-2-amino-6-chlorohexy-4-ynoic acid (X.sub.0), (s)-2-amino-7-chlorohepto-5-ynoic acid (X.sub.1), and (s)-2-amino-8-chloroocto-6-ynoic acid (X.sub.2) had been added respectively, each prepared using flexizyme were added. Translation was conducted using the resulting translation system.

(169) Subsequent to the translation, a thioether bond was formed between the propargyl chloride structure contained in these special amino acids and the sulfanyl group of cysteine. Thus, a crosslinked peptide library was synthesized and a complex in which mRNA had bound to the C terminal of the peptide via Pu was constructed.

(170) Acquisition of Peptide that Binds to Bcl-2

(171) The crosslinked peptide library thus produced was mixed with Bcl-2 immobilized on TALON beads, followed by stirring at 4 C. for 30 minutes. The supernatant was removed by using a magnet and the remaining magnetic particles were washed with a buffer. A PCR solution was added to the beads and the resulting mixture was heated at 95 C. for 5 minutes. The peptide was extracted from the beads and the supernatant was collected.

(172) Amplification of Sequence Information of Peptide thus Collected

(173) The peptide-mRNA bound to Bcl-2 thus collected was amplified as DNA by reverse transcriptionPCR. The DNA thus obtained was transcribed into mRNA.

(174) Identification of Peptide Sequence thus Selected

(175) When the recovery of the peptide-mRNA became saturated after repeating the above-mentioned series of operations, TA cloning was conducted with amplified DNA and the peptide sequence thus obtained was identified.

(176) Results

(177) When the NNU mRNA library is translated, an AUG codon in the random sequence is translated into a special amino acid molecule having in the side chain thereof propargyl chloride and a covalent bond is formed with the sulfanyl group of cysteine coded at a position four amino acid units away from it. Thus, a crosslinked peptide library is formed. When mRNA display was conducted using this peptide library, the recovery of the mRNA became saturated on the seventh round in the peptide library using any of the following three special amino acids different in linker length between propargyl chloride and the amino acid main chain structure: (s)-2-amino-6-chlorohexy-4-ynoic acid (X.sub.0), (s)-2-amino-7-chlorohepto-5-ynoic acid (X.sub.1), (s)-2-amino-8-chloroocto-6-ynoic acid(X.sub.2).

(178) As a result of identification of the peptide sequence after the sixth round, it has been found that most of the sequences had a crosslinked structure and peptides having two aspartic acids near the center of sequence were obtained (Table 1). The concentrated peptide sequences have two aspartic acids in common, which suggests that a molecule inhibiting the interaction with Bcl-2 can be obtained as expected by using the mRNA display method.

(179) TABLE-US-00007 TABLE 1 A-1 embedded image B-1 embedded image A-2 embedded image B-4 embedded image A-3 embedded image B-5 embedded image A-4 embedded image B-6 embedded image A-5 0embedded image B-7 embedded image C-1 embedded image B-8 embedded image C-2 embedded image B-9 embedded image

(180) ##STR00036##

(181) The amino acid sequences of A-1 to A-5, B-1 to B-9, and C-1 to C-2 are set forth as SEQ ID Nos:12 to 25 in the Sequence Listing, respectively.

(182) From the above results, it has been confirmed that the in vitro display functions effectively by using a peptide having a crosslinked peptide structure.

(183) Evaluation of Binding Ability of Selected Peptide to Bcl-2

(184) Next, a crosslinked peptide having the amino acid sequence as shown in the above table was synthesized by using a Fmoc solid-phase method and its binding ability was evaluated by calculating a dissociation constant (KD) in accordance with an evaluation method using SPR (Surface Plasmon Resonance).

(185) Described specifically, first, a solution containing NiCl.sub.2 was applied on a substrate to which Ni could be bound and then Bcl-2 protein having His tag on the C terminal side thereof was applied to immobilize the protein on the substrate. Then, a solution containing a solid-phase synthesized peptide was added successively while appropriately changing the concentration. During addition, a change in refractive index depending on the weight on the substrate was read and bond strength was evaluated based on the binding rate and dissociation rate of the peptide calculated. The results are shown in the following table.

(186) TABLE-US-00008 TABLE 5 KD (nM) A-1 embedded image 0.37 A-1A AcFPHA TIAARADSYDSYVRLAATFLNH.sub.2 15 A-2 embedded image 0.14 A-2A AcFPHA TIAARADSYDSYVRLVATFRNH.sub.2 3.6 A-3 embedded image >0.1 A-3A AcFLNRHNNAYYTA GYAALGRLYRLLNH.sub.2 Unmeas- ured A-4 0embedded image >0.1 A-4A AcFFNRHNNAYYTA GYAALGRLYRLLNH.sub.2 ~14 A-5 embedded image 0.17 A-5A AcFIIA RFSALADSYDASRHIFNH.sub.2 0.58

(187) The amino acid sequences of A-1A to A-4A are set forth as SEQ ID Nos:26 to 30 in the Sequence Listing, respectively.

(188) It has been found that all the peptides thus synthesized had a dissociation constant (KD) less than 1 nM and thus showed strong binding ability.

(189) [Sequence Listing Free Text]

(190) SEQ ID NO:1: flexizyme Fx SEQ ID NO:2: dinitrobenzylflexizyme dFx SEQ ID NO:3: enhanced flexizyme eFx SEQ ID NO:4: aminoflexizyme aFx SEQ ID NO:5: tRNA.sup.AsnE2 SEQ ID NO:6: tRNA.sup.fMet SEQ ID NO:7: tRNA.sup.Asn of Escherichia coli SEQ ID NO:8: tRNA.sup.fMet of Escherichia coli