Screening method

11693012 · 2023-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

A screening method is provided. Cells secreting target antibodies are screened by mixing candidate cells labeled with a first fluorescent molecule, a capture antigen and a labeled antibody against a target antibody and incubating, labeling using a high content cell imager and sorting using flow cytometry so as to screen cells secreting target antibodies. The screening method disclosed in the present application can automatically complete the labeling and sorting of target candidate cells in high throughput by labeling with a fluorescent molecule in combination with high-content cell imager and flow cytometer, so as to provide sufficient quantity of cells for subsequent amplification to obtain their antibody sequences and screen affinity antibodies. This method greatly improves the screening efficiency.

Claims

1. A method for screening cells secreting target antibodies, comprising the following steps: step (a): labeling a candidate cell with a first fluorescent molecule; step (b): adding the candidate cell labeled with the first fluorescent molecule and a labeled antibody against the target antibodies into a container fixed with a capture antigen to be mixed and incubated to obtain a cellular fluid; wherein the capture antigen is configured to specifically bind to the target antibodies; the labeled antibody is labeled with a second fluorescent molecule; the first fluorescent molecule has the following properties: a fluorescent light emitted after the first fluorescent molecule is excited by a first exciting light is different from a fluorescent light emitted after the second fluorescent molecule is excited by the first exciting light; the first fluorescent molecule is in a photo-activated state or a photo-converted state, the first fluorescent molecule emits a first fluorescent light after being excited by a third exciting light under the photo-activated state or the photo-converted state; the first fluorescent molecule emits a second fluorescent light after being directly excited by the third exciting light instead of a second exciting light; a wavelength of the first fluorescent light is different from a wavelength of the second fluorescent light, or a wavelength of the first fluorescent light is the same as a wavelength of the second fluorescent light but fluorescence intensities are different; wherein a wavelength of the first exciting light is different from a wavelength of the second exciting light; the wavelength of the second exciting light is different from a wavelength of the third exciting light; a wavelength of the fluorescent light emitted after the second fluorescent molecule is excited by the first exciting light is different from the wavelength of the second exciting light; step (c): observing the cellular fluid using a high content cell imager, exciting the second fluorescent molecule by using the first exciting light to emit the fluorescent light and screening the candidate cell surrounded by the fluorescent light, and labeling the candidate cell as a target candidate cell; then irradiating the target candidate cell with the second exciting light so that the first fluorescent molecule labeling the target candidate cell is in the photo-activated state or the photo-converted state; step (d): sorting the candidate cell in the cellular fluid using a flow cytometry, wherein in a process of sorting, the candidate cell processed in step (c) is irradiated using the third exciting light and the target candidate cell emitting the first fluorescent light is sorted, namely, the cells secreting the target antibodies.

2. The method according to claim 1, wherein the first fluorescent molecule is one selected from the group consisting of a photo-activated fluorescent protein and a photo-converted fluorescent protein.

3. The method according to claim 2, wherein in step (d), when the cellular fluid is used to flow through the flow cytometry for sorting, the second fluorescent molecule is a fluorescent molecule not emitting the fluorescent light under an excitation of the third exciting light, or a fluorescent molecule emitting the fluorescent light under an excitation of the third exciting light having a wavelength different from the wavelength of the first fluorescent light.

4. The method according to claim 3, wherein the photo-activated fluorescent protein is PA-GFP; a range of the wavelength of the first exciting light is not within a range of 390 nm-415 nm, a range of the wavelength of the second exciting light is 390 nm-450 nm, and a range of the wavelength of the third exciting light is 450 nm-550 nm.

5. The method according to claim 4, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

6. The method according to claim 4, wherein in step (a), a method for labeling the candidate cell with the first fluorescent molecule is one selected from the group consisting of the following (I)-(IV): (I): introducing a nucleotide encoding the first fluorescent molecule into the candidate cell and allowing the nucleotide to express the first fluorescent molecule in the candidate cell; (II): introducing the first fluorescent molecule into the candidate cell through an electrotransfection; (III): performing a fusion expression on the first fluorescent molecule and an antibody of a cytomembrane surface specific marker of the candidate cell, so that the first fluorescent molecule is linked to a surface of the candidate cell through a specific binding of the antibody to the cytomembrane surface specific marker; and (IV): labeling the first fluorescent molecule with a lipid, mixing the first fluorescent molecule labeled with the lipid with the candidate cell so that the first fluorescent molecule is linked to a surface of the candidate cell.

7. The method according to claim 3, wherein the photo-converted fluorescent protein is one selected from the group consisting of PS-CFP2, PS-CFP, mEosFP, tdEosFP, dEosFP, WtEosFP, Kaede, Dendra2, and KikGR.

8. The method according to claim 7, wherein the first fluorescent molecule is a PS-CFP2 protein, a range of the wavelength of the first exciting light is not within a range of 390 nm-450 nm, a range of the wavelength of the second exciting light is 390 nm-415 nm, and a range of the wavelength of the third exciting light is 420 nm-520 nm; or, the first fluorescent molecule is a Kaede protein, a range of the wavelength of the first exciting light is not within a range of 350 nm-400 nm, a range of the wavelength of the second exciting light is 350 nm-400 nm, and a range of the wavelength of the third exciting light is 500 nm-600 nm; or, the first fluorescent molecule is a KikGR protein, a range of the wavelength of the first exciting light is not within a range of 390 nm-415 nm, a range of the wavelength of the second exciting light is 390 nm-415 nm, and a range of the wavelength of the third exciting light is 500 nm-600 nm.

9. The method according to claim 8, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

10. The method according to claim 8, wherein in step (a), a method for labeling the candidate cell with the first fluorescent molecule is one selected from the group consisting of the following (I)-(IV): (I): introducing a nucleotide encoding the first fluorescent molecule into the candidate cell and allowing the nucleotide to express the first fluorescent molecule in the candidate cell; (II): introducing the first fluorescent molecule into the candidate cell through an electrotransfection; (III): performing a fusion expression on the first fluorescent molecule and an antibody of a cytomembrane surface specific marker of the candidate cell, so that the first fluorescent molecule is linked to a surface of the candidate cell through a specific binding of the antibody to the cytomembrane surface specific marker; and (IV): labeling the first fluorescent molecule with a lipid, mixing the first fluorescent molecule labeled with the lipid with the candidate cell so that the first fluorescent molecule is linked to a surface of the candidate cell.

11. The method according to claim 7, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

12. The method according to claim 7, wherein in step (a), a method for labeling the candidate cell with the first fluorescent molecule is one selected from the group consisting of the following (I)-(IV): (I): introducing a nucleotide encoding the first fluorescent molecule into the candidate cell and allowing the nucleotide to express the first fluorescent molecule in the candidate cell; (II): introducing the first fluorescent molecule into the candidate cell through an electrotransfection; (III): performing a fusion expression on the first fluorescent molecule and an antibody of a cytomembrane surface specific marker of the candidate cell, so that the first fluorescent molecule is linked to a surface of the candidate cell through a specific binding of the antibody to the cytomembrane surface specific marker; and (IV): labeling the first fluorescent molecule with a lipid, mixing the first fluorescent molecule labeled with the lipid with the candidate cell so that the first fluorescent molecule is linked to a surface of the candidate cell.

13. The method according to claim 3, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

14. The method according to claim 3, wherein in step (a), a method for labeling the candidate cell with the first fluorescent molecule is one selected from the group consisting of the following (I)-(IV): (I): introducing a nucleotide encoding the first fluorescent molecule into the candidate cell and allowing the nucleotide to express the first fluorescent molecule in the candidate cell; (II): introducing the first fluorescent molecule into the candidate cell through an electrotransfection; (III): performing a fusion expression on the first fluorescent molecule and an antibody of a cytomembrane surface specific marker of the candidate cell, so that the first fluorescent molecule is linked to a surface of the candidate cell through a specific binding of the antibody to the cytomembrane surface specific marker; and (IV): labeling the first fluorescent molecule with a lipid, mixing the first fluorescent molecule labeled with the lipid with the candidate cell so that the first fluorescent molecule is linked to a surface of the candidate cell.

15. The method according to claim 2, wherein in step (a), a method for labeling the candidate cell with the first fluorescent molecule is one selected from the group consisting of the following (I)-(V): (I): introducing a nucleotide encoding the first fluorescent molecule into the candidate cell and allowing the nucleotide to express the first fluorescent molecule in the candidate cell; (II): introducing the first fluorescent molecule into the candidate cell through an electrotransfection; (III): performing a fusion expression on the first fluorescent molecule and an antibody of a cytomembrane surface specific marker of the candidate cell, so that the first fluorescent molecule is linked to a surface of the candidate cell through a specific binding of the antibody to the cytomembrane surface specific marker; and (IV): labeling the first fluorescent molecule with a lipid, mixing the first fluorescent molecule labeled with the lipid with the candidate cell so that the first fluorescent molecule is linked to a surface of the candidate cell.

16. The method according to claim 15, wherein the lipid is selected from DSPE-NHS, DSPE-PEG2000-NHS, DSPE-PEG3400-NHS, oleyl-PEG2000-NHS, oleyl-PEG4000-NHS, and DOPE-PEG2000-NHS.

17. The method according to claim 2, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

18. The method according to claim 1, wherein the candidate cell in step (a) is selected from the group consisting of B lymphocytes, T cells, NK cells, HEK cells, CHO cells, bacteria, and yeast.

19. A method for screening target antibodies, comprising the following steps: obtaining the cells secreting the target antibodies using the method according to claim 1; and acquiring a nucleotide sequence encoding the target antibodies from the cells secreting the target antibodies.

20. The method according to claim 19, wherein the first fluorescent molecule is one selected from the group consisting of a photo-activated fluorescent protein and a photo-converted fluorescent protein.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) In order to more clearly explain the technical solution of the embodiments of the present application, accompanying drawings used in the embodiments will be simply described below. It should be understood that the following drawings only show some embodiments of the present application, but should not be regarded as limiting the scope. For persons of ordinary skill in the art, other relevant drawings can also be obtained according to these drawings without creative efforts.

(2) FIG. 1 is a schematic diagram of a heavy chain variable region sequence and a light chain variable region sequence of an antibody obtained by PCR, both of which are about 400 bp in size.

(3) FIG. 2 is a schematic diagram of a 5′ untranslated region with a size of about 400 bp, a heavy chain antibody constant region and a 3′ untranslated region with a size of about 1200 bp, a light chain antibody constant region and a 3′ untranslated region with a size of about 400 bp, which are required for constituting a full-length antibody sequence and obtained by PCR.

(4) FIG. 3 is a schematic diagram showing that light and heavy chain variable regions of antibody reconstitute a complete full-length antibody sequence by overlap PCR, wherein the full-length antibody sequence has a size of about 1900 bp, and the light chain full-length antibody sequence has a size of about 1000 bp.

(5) FIG. 4 is a schematic diagram of a labeled antibody labeled by a second fluorescent molecule around a capture antigen by antibody affinity detection using a high content cell imager.

(6) FIG. 5 is a schematic diagram showing that halo is present around B lymphocytes secreting specific anti-PDL1 antibodies.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(7) In order to make the objectives, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be described clearly and completely below. If no specific conditions are indicated in the embodiments, the embodiments will be conducted according to conventional conditions or conditions recommended by a manufacturer. If the used reagents or instruments have no manufacturers, they are all conventional products that can be purchased in the market.

(8) The features and performances of the present application are further described in detail below in combination with embodiments.

Example 1

(9) This example takes an anti-PDL1 antibody and B lymphocytes as examples to explain a method for screening B lymphocytes secreting the anti-PDL1 antibody provided in this example. The method includes:

(10) 1. PDL1 Proteins were Used as Antigen Immune Mice. Refer to Conventional Methods in the Art.

(11) 2. Enrichment of B Lymphocytes

(12) 1) Spleen was taken from mice, placed in a 40 μm filter membrane and crushed, and single splenocytes were obtained through a filter screen and then placed in 50 ml of pre-cooled serum-free 1640 culture medium.

(13) 2) The splenocytes were centrifuged for 5 min under the conditions of 4° C. and 500 g.

(14) 3) The supernatant was discarded, and the cells were re-suspend to 10 ml 1×red split solution (BD bioscience, cat: 555899) and subjected to standing for 5 min at room temperature under dark conditions.

(15) 4) The re-suspended cells were added into 40 ml of serum-free 1640 culture medium and then centrifuged for 5 min under the conditions of 4° C. and 500 g.

(16) 5) The supernatant was discarded, and cell precipitates were re-suspended in 10 ml MACS Buffer (MACS Buffer: Miltenyi biotec order no. 130-091-221), evenly blown, stained with trypan blue, and finally counted.

(17) 6) 5×10.sup.7 cells were taken and centrifuged for 5 min under the conditions of 4° C. and 500 g, and the supernatant was discarded.

(18) 7) 175 μl of MACS buffer, 25 μl of FcR Blocking Reagent and 50 μl of biotin antibody cocktail (Pan B Cell Isolation Kit II, mouse (Order No: 130-104-443)) were added, evenly mixed, and incubated for 5 min at 4° C.

(19) 8) The cell suspension was added into 150 μl of MACS buffer, 100 μl of Anti-Biotin Microbeads and then evenly mixed, and incubated for 10 min at 4° C.

(20) 9) An Ls column was equilibrated with 3 ml of buffer.

(21) 10) The cell suspension passed through the column (500 μl) to collect filtrate.

(22) 11) 3 ml of buffer was added again into the LS column, and the filtrate was collected to a centrifuge tube.

(23) 12) 3.5 ml of the resulting filtrate was candidate B lymphocyte.

(24) 3. Packaging Lentivirus Before Enrichment of B Lymphocytes

(25) 1) 293T cells densely grown were taken, with a dense of about 80%-90%, and a fresh culture medium (DMEM+10% FBS) was changed, namely, 10 ml/10 cm cell culture dish.

(26) 2) Two 2 ml centrifuge tubes were taken, 625 μl of DMEM culture medium and 18.75 μl of Lipofectamine3000 were added into tube 1. 625 μl of DMEM culture medium, 7.5 mg of psPAX2, 2.5 μg of PMD2G plasmid, 10 μg of PLVX-Kaede-IRES-PURO plasmid and 25 μl of P3000 were added into tube 2.

(27) 3) The solution in tube 1 was transferred into tube 2, and then the solution in the tube was evenly mixed with an oscillator and stood for 5 min.

(28) 4) 293T cells were taken out, the mixture was gently transferred into the cells to put back into an incubator.

(29) 5) After 48 h, the lentivirus supernatant was collected for the first time, and then the cells were added again into a 10 ml/10 cm fresh culture medium.

(30) 6) After 72 h, the lentivirus was collected for the second time, the virus supernatant was centrifuged for 2 h under the conditions of 4° C. and 60000 g, and the supernatant was discarded. The precipitate was re-suspended with an appropriate amount of PBS to obtain concentrated viruses with a titer of 10.sup.7 μ/ml.

(31) 4. B Lymphocytes were Infected by Viruses to Obtain B Lymphocytes Expressing Kaede Protein (First Fluorescent Molecule)

(32) 1) The isolated B lymphocytes were infected according to MOI=50 (10-100, preferably 50), transfected for 6 h (30 min-48 h, preferably 6 h), then 500 g of cell suspension was centrifuged for 5 min, and the supernatant was discarded to obtain B lymphocytes expressing Kaede protein.

(33) 5. Spread of Transfected B Lymphocytes

(34) 1) CHO-K1 cells over-expressing PDL1 (capture antigen) were inoculated into a cell culture dish one day before transfection.

(35) 2) The transfected B lymphocytes were spread into the dish, and the number of spread cells was preferably 2×10.sup.6 (2×10.sup.4-2×10.sup.7). After culturing for 6-48 h, the medium was gently aspirated and discarded, and a Goat pAb to Ms lgG (Aleax Flour 647, abcam, cat: ab150115) staining solution (containing a second fluorescent molecule Aleax Flour 647 labeled secondary antibody) prepared with a fresh culture medium was added to avoid that B cells were disturbed, wherein the working concentration was 0.2 μg/ml. After incubation for 30 min with 5% CO.sub.2 at 37° C., the staining solution was gently sucked and discarded, and a fresh culture medium was changed, wherein the B cells were avoided to be disturbed in the process of changing the culture medium.

(36) 6. Detection by Putting a Cell Culture Dish into a High Content Cell Imager

(37) 1) Imaging was performed by using a high content cell imager under a 5-fold microscope, and excitation was conducted with the first exciting light (550 nm-700 nm). The wavelength of the Aleax Flour 647 emitting light was 620 nm-750 nm, from which it can be observed that red halo is present around CHO-K1 cells over-expressing PDL1 around B lymphocytes secreting specific anti-PDL1 antibodies (see FIG. 5). Then, under the 60-fold microscope, the B lymphocytes were photo-activated, the wavelength of the second exciting light (second exciting light) is 365 nm (350 nm-400 nm), and the exposure time is 500 ms (50 ms-5000 ms), which promotes the cells to be photo-activated without light emission.

(38) 7. Flow Sorting of Single B Lymphocytes Secreting Specific Antibodies

(39) 1) The cells in step 6 were digested into a single-cell suspension, the suspension was sorted by flow cytometry, excited by 500 nm-600 nm exciting light (the maximum exciting wavelength was 572 nm) to obtain the emitting light in an interval of 550 nm-650 nm. (after step 6, the target B cells with halo (secreting target antibodies) were photo-converted to emit red emitting light with a wavelength of 580 nm, B lymphocytes (cannot secrete the target antibody) that were not photo-converted in step 6 do not have fluorescent light), and the photo-converted B lymphocytes (that is, B lymphocytes secreting anti-PDL1 antibody) were sorted to a PCR tube containing cell lysate.

Example 2

(40) This example takes the B lymphocytes secreting the anti-PDL1 antibody screened in example 1 as an example to explain the method for screening the anti-PDL1 antibody. The method includes:

(41) 1. Reverse Transcription of a First Strand of cDNA and Amplification of Full-Length cDNA by 5′RACE.

(42) 1) Synthesis of first-strand cDNA (SMARTer® RACE 5′/3′Kit, Takara, cat; 634858)

(43) A: Preparation of Reaction System

(44) Mixed Reaction System 1

(45) TABLE-US-00001 Component Volume 5x first chain buffer  4 μl DTT 0.5 μl  Mixed nucleotide  1 μl Total 5.5 μl 

(46) The mixed reaction system 1 was gently mixed with a pipette, and then transiently centrifuged and placed at room temperature.

(47) Mixed Reaction System 2:

(48) TABLE-US-00002 Component Volume RNA  6 μl mRNA5′ cap primer  1 μl Deionized water  4 μl Total 11 μl

(49) MRNA5′ cap primer: AGCAGTGGTATCAACGCAGAGTACrGrGG (as shown in SEQ ID NO: 1).

(50) The mixed reaction system 2 was gently mixed with a pipette, and then transiently centrifuged.

(51) The mixed reaction system 2 was reacted under the following conditions:

(52) TABLE-US-00003 Temperature Time 72° C.  3 min 42° C.  2 min Centrifuge at 14000 g 10 s

(53) B: Preparation of Reaction System:

(54) Mixed Reaction System 3:

(55) TABLE-US-00004 Component Volume Mixed reaction system 1 5.5 μl  RNA enzyme inhibitor 0.5 μl  SMARTScribe reverse transcriptase  2 μl Total  8 μl

(56) The mixed reaction system 3 was gently mixed with a pipette, and then transiently centrifuged.

(57) C: Synthesis of First Strand cDNA

(58) Mixed Reaction System 4:

(59) TABLE-US-00005 Component Volume Mixed reaction system 2 11 μl Mixed reaction system 3  8 μl Oligothymine primer  1 μl Total 20 μl

(60) Oligothymine Primer:

(61) AGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTVN (as shown in SEQ ID NO: 2).

(62) The mixed reaction system 4 was gently mixed with a pipette, and then transiently centrifuged.

(63) Reaction Conditions:

(64) TABLE-US-00006 Temperature Time 42° C. 90 min 70° C. 10 min

(65) D: Amplification of Full-Length cDNA

(66) Mixed Reaction System 5

(67) TABLE-US-00007 Component Volume Deionized water 15.5 μl 2× SeqAmp buffer   25 μl SeqAmp DNA polyase   1 μl Total 41.5 μl

(68) The mixed reaction system was gently mixed with a pipette, and then transiently centrifuged.

(69) Mixed Reaction System 6

(70) TABLE-US-00008 Component Volume Mixed reaction system4  2.5 μl ISPCR primer   5 μl Oligothymine primer   1 μl Mixed reaction system5 41.5 μl Total   50 μl

(71) Oligothymine Primer:

(72) AGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTVN (as shown in SEQ ID NO: 3)

(73) ISPCR primer: AAGCAGTGGTATCAACGCAGAGT (as shown in SEQ ID NO: 4)

(74) PCR Conditions:

(75) TABLE-US-00009 Number of Temperature Time cycles 94° C. 30 s 25× 68° C. 30 s 72° C. 6 min

(76) 2. The Sequence of the Heavy Chain Variable Region and the Sequence of the Light Chain Variable Region of the Antibody were Obtained by PCR.

(77) Preparation of PCR Reaction System

(78) TABLE-US-00010 Component System (50 μl) 5× Q5 reaction buffer 10 μl 10 nM mixed nucleotide  1 μl Forward primer (10 μM) 1.5 μl  (final concentration 0.3 μM) Reward primer (10 μM)   1 μl (final concentration 0.2 μM) Amplified full-length cDNA  5 μl GC enhancer 10 μl Q5 hot-starting high-fidelity DNA polyase 0.5 μl  dH.sub.2O 21 μl

(79) PCR Conditions:

(80) TABLE-US-00011 98° C. (pre-denature) 30 s 1× 98° C. (denature) 10 s 35×  57° C. (anneal) 30 s 72° C. (extend) 30 s 72° C. (final extend) 2 min 1×  4° C. (maintain) ∞

(81) The forward primer of the heavy chain variable region of the antibody was FVH_Mix (nine 10 μM primers FVH_I-IX were mixed in equal volumes).

(82) The reverse primer of the heavy chain variable region of the heavy chain was RVH_Mix (four 10 μM primers RVH of M_I to IV were mixed in equal volumes). The forward and reverse primers of the heavy chain variable region of the antibody are seen in the following table.

(83) TABLE-US-00012 FVH_I GGCGAGAACTTaTATTTCCAGGGAGAWGTGCAGCTGGTGGAGTC (as shown in SEQ ID NO: 5) FVH_II GGCGAGAACTTaTATTTCCAGGGACAGGTGCAGCTGAAGSAGTC (as shown in SEQ ID NO: 6) FVH_III GGCGAGAACTTaTATTTCCAGGGAGARGTGAAGCTGGTGGARTC (as shown in SEQ ID NO: 7) FVH_IV GGCGAGAACTTaTATTTCCAGGGACAGGTCCAACTGCAGCAGCC (as shown in SEQ ID NO: 8) FVH_V GGCGAGAACTTaTATTTCCAGGGASAGGTYCAGCTGCARCAGTC (as shown in SEQ ID NO: 9) FVH_VI GGCGAGAACTTaTATTTCCAGGGACAAGTGCAGATGAAGGAGTC (as shown in SEQ ID NO: 10) FVH_VII GGCGAGAACTTaTATTTCCAGGGACAGATCCAGTTGGYGCAGTC (as shown in SEQ ID NO: 11) FVH_VIII GGCGAGAACTTaTATTTCCAGGGACAGGTCCAACTCCAGCAGCC (as shown in SEQ ID NO: 12) FVH_IX GGCGAGAACTTaTATTTCCAGGGACAGGTGCAACTGAAGCAGTC (as shown in SEQ ID NO: 13) RVH_I AGGAGGTGTGGTTTTGGCGCTCGAGACGGTGACCGT (as shown in SEQ ID NO: 14) RVH_II AGGAGGTGTGGTTTTGGCGCTCGAGACTGTGAGAGT (as shown in SEQ ID NO: 15) RVH_III AGGAGGTGTGGTTTTGGCGCTCGAGACAGTGACCAG (as shown in SEQ ID NO: 16) RVH_IV AGGAGGTGTGGTTTTGGCGCTCGAGACGGTGACTGA (as shown in SEQ ID NO: 17)

(84) The forward primer of the light chain variable region of the antibody was FVK_Mix (nine 10 μM primers FVKFK_I-IX were mixed in equal volumes).

(85) The reverse primer of the light chain variable region of the antibody was RVK_Mix (three 10 μM primers RVK of M_I-III were mixed in equal volumes).

(86) The forward and reverse primers of the light chain variable region of the antibody are seen in the following table.

(87) TABLE-US-00013 FVK_I GGCGAGAACTTaTATTTCCAGGGAGAAAWTGTGCTCACCCAGTC (as shown in SEQ ID NO: 18) FVK_II GGCGAGAACTTaTATTTCCAGGGACAAATTGTTCTCACCCAGTC (as shown in SEQ ID NO: 19) FVK_III GGCGAGAACTTaTATTTCCAGGGARACATTGTGCTGACCCAATC (as shown in SEQ ID NO: 20) FVK_IV GGCGAGAACTTaTATTTCCAGGGAGAAACAACTGTGACCCAGTC (as shown in SEQ ID NO: 21) FVK_V GGCGAGAACTTaTATTTCCAGGGAGATATTGTGATGACSCAGGC (as shown in SEQ ID NO: 22) FVK_VI GGCGAGAACTTaTATTTCCAGGGARRTRTTGTGATGACCCARAC (as shown in SEQ ID NO: 23) FVK_VII GGCGAGAACTTaTATTTCCAGGGAGATATCCAGATGACACAGAC (as shown in SEQ ID NO: 24) FVK_VIII GGCGAGAACTTaTATTTCCAGGGAGACATTGTGATGACMCAGTC (as shown in SEQ ID NO: 25) FVK_IX GGCGAGAACTTaTATTTCCAGGGAGACATCCAGATGACHCAGTC (as shown in SEQ ID NO: 26) RVK_I AGGAGCGGCGTCAGCTCTTTTCAGCTCCAGCTTGGTCCC (as shown in SEQ ID NO: 27) RVK_II AGGAGCGGCGTCAGCTCTTTTTATTTCCAGTCTGGTCCC (as shown in SEQ ID NO: 28) RVK_III AGGAGCGGCGTCAGCTCTTTTKATTTCCARCTTKGTSCC (as shown in SEQ ID NO: 29)

(88) The PCR experiment results are as shown in FIG. 1.

(89) 3. The Light and Heavy Chain Variable Regions of the Antibody were Reconstituted to Form a Complete Full-Length Antibody Sequence by Overlap PCR, and In-Vitro Cell-Free Expression was Conducted.

(90) 1) The template fragments (5′ UTR, IgG1Fc-3′ UTR, and IgKc-3′ UTR) used for overlap PCR were obtained by PCR.

(91) PCR amplification of 5′ UTR fragment system is as follows:

(92) TABLE-US-00014 System (50 μl) 5× Q5 reaction buffer  10 μl 10 nM mixed nucleotide   1 μl Pd2p_up-F (20 μM) 1.25 μl  (final concentration 0.5 μM) TEV-R (20 μM) 1.25 μl  (final concentration 0.5 μM) Plasmid PD2P-1.06   1 μl GC enhancer  10 μl Q5 high-fidelity DNA polyase  0.5 μl  Nuclease-free water  25 μl

(93) Pd2p_up-F:

(94) TABLE-US-00015 ATCGGTGATGTCGGCGATATAG (as shown in SEQ ID NO: 30);

(95) TEV-R:

(96) TABLE-US-00016 TCCCTGGAAATATAAGTTCTCGCC  (as shown in SEQ ID NO: 31).

(97) PCR Conditions:

(98) TABLE-US-00017 98° C. (pre-denature) 30 s 1× 98° C. (denature) 10 s 35×  57° C. (anneal) 30 s 72° C. (extend) 30 s 72° C. (final extend) 2 min 1×  4° C. (maintain) ∞

(99) PCR amplification of IgG1Fc-3′ UTR fragment system is as follows:

(100) TABLE-US-00018 Component System (50 μl) 5× Q5 reaction buffer  10 μl 10 nM mixed nucleotide   1 μl IgG1Fc_F2 (20 μM) 1.25 μl  (final concentration 0.5 μM) Pd2p-R (20 μM) 1.25 μl  (final concentration 0.5 μM) Plasmid PGM-IgG1Fc-3′UTR   1 μl GC enhancer  10 μl Q5 high-fidelity DNA polyase  0.5 μl  Nuclease-free water  25 μl

(101) PCR Conditions:

(102) TABLE-US-00019 98° C. (pre-denature) 30 s 1× 98° C. (denature) 10 s 35×  57° C. (anneal) 30 s 72° C. (extend) 30 s 72° C. (final extend) 2 min 1×  4° C. (maintain) ∞

(103) IgG1Fc_F2:

(104) TABLE-US-00020 GCCAAAACCACACCTCCT (as shown in SEQ ID NO: 32);

(105) Pd2p-r:

(106) TABLE-US-00021 AGCAGCCGGATCGTCGAGTTCG (as shown in SEQ ID NO: 33).

(107) PCR amplification of IgKc-3′ UTR fragment system is as follows:

(108) TABLE-US-00022 Component System (50 μl) 5× Q5 reaction buffer  10 μl 10 nM mixed nucleotide  1 μl IgKc-F2 (20 μM) 1.25 μl  (final concentration 0.5 uM) Pd2p-R (20 μM) 1.25 μl  (final concentration 0.5 uM) Plasmid PGM-IgKc-3′UTR  1 μl GC enhancer  10 μl Q5 high-fidelity DNA polyase  0.5 μl  Nuclease-free water  25 μl

(109) IgKc-f2:

(110) TABLE-US-00023 AGAGCTGACGCCGCTCCT (as shown in SEQ ID NO: 34);

(111) Pd2p-r:

(112) TABLE-US-00024 AGCAGCCGGATCGTCGAGTTCG (as shown in SEQ ID NO: 35).

(113) PCR Conditions:

(114) TABLE-US-00025 98° C. (pre-denature) 30 s 1× 98° C. (denature) 10 s 35×  57° C. (anneal) 30 s 72° C. (extend) 30 s 72° C. (final extend) 2 min 1×  4° C. (maintain) ∞

(115) The PCR results are as shown in FIG. 2.

(116) 2) The variable regions of the light and heavy chains of the antibody were reconstructed into a complete full-length antibody sequence by overlapping PCR

(117) TABLE-US-00026 Component 50 μl System 10× Thermo Pol reaction buffer  5 μl  10 mM mixed nucleotide  1 μl  pD2P_F (10 μM) 1.25 μl (0.5 μM) pD2P_R (10 μM) 1.25 μl (0.5 μM) Template DNA 1 μl + 2 μl + 1 μl (5′ UTR + light/heavy chain variable region + IgG1Fc-3′ UTR or IgKc-3′ UTR) Vent DNA polyase  0.25 μl   Nuclease-free water 37.25 μl  

(118) pD2P_F:

(119) TABLE-US-00027 ATCGAGATCTCGCGAAATTAATACGA(as shown SEQ ID NO: 36);

(120) pD2P_R:

(121) TABLE-US-00028 AGCAGCCGGATCGTCGAGTTCG(as shown SEQ ID NO: 37).

(122) Overlapping PCR Conditions:

(123) TABLE-US-00029 95° C. (pre-denature) 30 s 1x 95° C. (denature) 10 s 35x  57° C. (anneal) 30 s 72° C. (extend) 30 s 72° C. (final extend) 2 min 30 s 1x  4° C. (maintain) ∞

(124) The PCR results are as shown in FIG. 3.

(125) 3) In-vitro cell-free expression

(126) 1 μL of each PCR product of the complete full-length antibody sequences of the light and heavy chains of the antibody obtained by overlap PCR were added into 60 μl of ProteinFactory Rxn (protein factory 1.0) reaction system. After standing for 3-20 hours at 20-30° C., the protein expression can be completed to obtain an anti-PDL1 antibody.

(127) 4. Affinity Screening of an Antibody after Obtaining an Expressed Antibody

(128) 1) One day in advance, CHO-K1 cells over-expressing PDL1 (10000 cells/well) and CHO-K1 cells over-expressing GFP (2000 cells/well) were taken and mixed in an F-12 culture medium to be inoculated in a 96-well plate with 100 μl/well for culture overnight under the conditions of 37° C. and 5% CO.sub.2.

(129) 2) The culture medium in the culture plate was aspirated and discarded, and then 40 μl of antibody protein was added in each well to be incubated for 30 min under the conditions of 37° C. and 5% CO.sub.2.

(130) 3) The protein was aspirated and discarded, and Goal pAb to Ms lgG (Aleax Flour 647, cat: ab150115, abcam) with a working concentration of 0.2 μg/ml and Hoechest 33342 with a working concentration of 0.2 μg/ml were taken and added into the F-12 culture medium (50 μl/well) to be incubated for 30 min under the conditions of 37° C. and 5% CO.sub.2.

(131) 4) The culture medium was aspirated and discarded, and 50 μl of F-12 culture medium was added.

(132) 5) High-content shooting was performed and an average fluorescence value (see FIG. 4) was analyzed. The analysis method is as follows:

(133) a) cell nuclei stained with Hoechest 33342 were found by using 350 nm exciting light, and a fluorescence value was adjusted to find total cells.

(134) b) Cells with green fluorescent light were found by using 488 nm exciting light in the cells output in a), and a fluorescence value was adjusted to output CHO-K1-GFP.

(135) c) CHO-K1-GFP in b) was deducted from the total number of cells, and the rest was CHO-K1-PDL1.

(136) d) By using 647 nm exciting light, a red fluorescence value on a cell membrane was detected, and an average red fluorescence value on a CHO-K1-GFP membrane and an average red fluorescence value on a CHO-K1-PDL1 membrane were counted.

(137) e) Affinity screening of antibodies was performed by counting a ratio of the average red fluorescence value on the CHO-K1-PDL1 membrane to the average red fluorescence value on the CHO-K1-GFP membrane. The antibody with a higher ratio was selected, so as to obtain the anti-PDL1 antibody with high affinity.

Example 3

(138) The method for screening B lymphocytes secreting the anti-PDL1 antibody provided in this example is basically the same as that in example 1, except for the step of spreading the transfected B lymphocytes. The operation method in this example is as follows:

(139) 1) One day before transfection, a Poly-D-Lysine solution (gibco, REF: A3890401) was diluted to a working concentration of 50 μg/ml using sterile DPBS. In other examples, a semi-solid culture medium or gelatin or the like can also be used in this step.

(140) 2) The diluent was added into a six-well plate (this step can increase the adherence of cells), with 2 ml/well.

(141) 3) The cells were incubated for 1 hour at room temperature.

(142) 4) The diluent was discarded, and the six-well plate was washed three times with sterile water to ensure that the residual Poly-D-Lysine solution diluent was removed.

(143) 5) The six-well plate was opened and placed in a biosafety cabinet.

(144) 6) After the six-well plate was completely dried, CHO-K1 cells over-expressing PDL1 were spread in the six-well plate.

(145) 7) The transfected B lymphocytes were spread into a dish. After culture for 6-48 h, the culture medium was gently aspirated and discarded, and Goat pAb to Ms lgG (Aleax Flour 647, abeam, cat: ab150115) staining solution prepared with a fresh culture medium was added, with a working concentration of 0.2 μg/ml, to avoid disturbing B cells. After incubation for 30 min under the conditions of 37° C. and 5% CO.sub.2, the staining solution was gently sucked and discarded, and a fresh culture medium was changed. The process of changing the solution should avoid disturbing B cells.

(146) The other steps are the same as in example 1.

Example 4

(147) The method for screening B lymphocytes secreting the anti-PDL1 antibody provided in this example is basically the same as that in example 1, except that the first fluorescent molecule is PA-GFP protein; in addition, in this example, in the step of high-content cell imaging, the green fluorescent light (the range of the wavelength is 500 nm-600 nm) generated by the candidate cells after being irradiated using intense violet light (350-400 nm) is improved by 100 times; when sorting with flow cytometry, the wavelength range of the exciting light is 450 nm-550 nm (the maximum wavelength of the exciting light is 504 nm), and the wavelength range of the emitting light is 480 nm-600 nm (the maximum wavelength of the emitting light is 517 nm). Photo-activated B lymphocytes secreting the target antibodies and having PA-GFP proteins are labeled and sorted.

Example 5

(148) The method for screening B lymphocytes secreting the anti-PDL1 antibody provided in this example is basically the same as that in example 1. The first fluorescent molecule is Kaede protein; in the step of high-content cell imaging, the candidate cells with green fluorescent light after being irradiated using intense violet light (350-400 nm) to generate green fluorescent light (the range of the wavelength is 500 nm-600 nm) are photo-converted so that the green fluorescent light becomes red fluorescent light (range of the wavelength is 550 nm-650 nm); when sorting with flow cytometry, the wavelength range of the exciting light is 500 nm-600 nm (the maximum wavelength of the exciting light is 572 nm), and the wavelength range of the emitting light is 550 nm-650 nm (the maximum wavelength of the emitting light is 580 nm). Photo-activated B lymphocytes secreting the target antibodies and having Kaede proteins are labeled and sorted.

(149) The above descriptions are only preferred embodiments of the present application, and are not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modifications, equivalent replacements, improvements and the like made within the spirit and principles of the present application shall be included within the protective scope of the present application.

SEQUENCE LISTING

(150) <110> Suzhou Institute of Nano-Tech and Nano-Bionics (SINANO), Chinese Academy of Sciences

(151) <120> A SCREENING METHOD

(152) <160> 37

(153) <170> patentin version 3.5

(154) <210> 1

(155) <211> 29

(156) <212> DNA

(157) <213> Artificial sequence

(158) <400> 1

(159) agcagtggtatcaacgcagagtacrgrgg 29

(160) <210> 2

(161) <211> 56

(162) <212> DNA

(163) <213> Artificial sequence

(164) <400> 2 agcagtggtatcaacgcagagtacttttttttttttttttttttttttttttttvn 56

(165) <210> 3

(166) <211> 56

(167) <212> DNA

(168) <213> Artificial sequence

(169) <400> 3

(170) agcagtggtatcaacgcagagtacttttttttttttttttttttttttttttttvn 56

(171) <210> 4

(172) <211> 23

(173) <212> DNA

(174) <213> Artificial sequence

(175) <400> 4

(176) aagcagtggtatcaacgcagagt

(177) <210> 5

(178) <211> 44

(179) <212> DNA

(180) <213> Artificial sequence

(181) <400> 5

(182) ggcgagaacttatatttccagggagawgtgcagctggtggagtc

(183) <210> 6

(184) <211> 44

(185) <212> DNA

(186) <213> Artificial sequence

(187) <400> 6

(188) ggcgagaacttatatttccagggacaggtgcagctgaagsagtc

(189) <210> 7

(190) <211> 44

(191) <212> DNA

(192) <213> Artificial sequence

(193) <400> 7

(194) ggcgagaacttatatttccagggagargtgaagctggtggartc

(195) <210> 8

(196) <211> 44

(197) <212> DNA

(198) <213> Artificial sequence

(199) <400> 8

(200) ggcgagaacttatatttccagggacaggtccaactgcagcagcc 44

(201) <210> 9

(202) <211> 44

(203) <212> DNA

(204) <213> Artificial sequence

(205) <400> 9

(206) ggcgagaacttatatttccagggasaggtycagctgcarcagtc

(207) <210> 10

(208) <211> 44

(209) <212> DNA

(210) <213> Artificial sequence

(211) <400> 10

(212) ggcgagaacttatatttccagggacaagtgcagatgaaggagtc

(213) <210> 11

(214) <211> 44

(215) <212> DNA

(216) <213> Artificial sequence

(217) <400> 11

(218) ggcgagaacttatatttccagggacagatccagttggygcagtc

(219) <210> 12

(220) <211> 44

(221) <212> DNA

(222) <213> Artificial sequence

(223) <400> 12

(224) ggcgagaacttatatttccagggacaggtccaactccagcagcc

(225) <210> 13

(226) <211> 44

(227) <212> DNA

(228) <213> Artificial sequence

(229) <400> 13

(230) ggcgagaacttatatttccagggacaggtgcaactgaagcagtc

(231) <210> 14

(232) <211> 36

(233) <212> DNA

(234) <213> Artificial sequence

(235) <400> 14

(236) aggaggtgtggttttggcgctcgagacggtgaccgt

(237) <210> 15

(238) <211> 36

(239) <212> DNA

(240) <213> Artificial sequence

(241) <400> 15

(242) aggaggtgtggttttggcgctcgagactgtgagagt

(243) <210> 16

(244) <211> 36

(245) <212> DNA

(246) <213> Artificial sequence

(247) <400> 16

(248) aggaggtgtggttttggcgctcgagacagtgaccag

(249) <210> 17

(250) <211> 36

(251) <212> DNA

(252) <213> Artificial sequence

(253) <400> 17

(254) aggaggtgtggttttggcgctcgagacggtgactga 36

(255) <210> 18

(256) <211> 44

(257) <212> DNA

(258) <213> Artificial sequence

(259) <400> 18

(260) ggcgagaacttatatttccagggagaaawtgtgctcacccagtc 44

(261) <210> 19

(262) <211> 44

(263) <212> DNA

(264) <213> Artificial sequence

(265) <400> 19

(266) ggcgagaacttatatttccagggacaaattgttctcacccagtc 44

(267) <210> 20

(268) <211> 44

(269) <212> DNA

(270) <213> Artificial sequence

(271) <400> 20

(272) ggcgagaacttatatttccagggaracattgtgctgacccaatc 44

(273) <210> 21

(274) <211> 44

(275) <212> DNA

(276) <213> Artificial sequence

(277) <400> 21

(278) ggcgagaacttatatttccagggagaaacaactgtgacccagtc 44

(279) <210> 22

(280) <211> 44

(281) <212> DNA

(282) <213> Artificial sequence

(283) <400> 22

(284) ggcgagaacttatatttccagggagatattgtgatgacscaggc

(285) <210> 23

(286) <211> 44

(287) <212> DNA

(288) <213> Artificial sequence

(289) <400> 23

(290) ggcgagaacttatatttccagggarrtrttgtgatgacccarac

(291) <210> 24

(292) <211> 44

(293) <212> DNA

(294) <213> Artificial sequence

(295) <400> 24

(296) ggcgagaacttatatttccagggagatatccagatgacacagac

(297) <210> 25

(298) <211> 44

(299) <212> DNA

(300) <213> Artificial sequence

(301) <400> 25

(302) ggcgagaacttatatttccagggagacattgtgatgacmcagtc

(303) <210> 26

(304) <211> 44

(305) <212> DNA

(306) <213> Artificial sequence

(307) <400> 26

(308) ggcgagaacttatatttccagggagacatccagatgachcagtc 44

(309) <210> 27

(310) <211> 39

(311) <212> DNA

(312) <213> Artificial sequence

(313) <400> 27

(314) aggagcggcgtcagctcttttcagctccagcttggtccc 39

(315) <210> 28

(316) <211> 39

(317) <212> DNA

(318) <213> Artificial sequence

(319) <400> 28

(320) aggagcggcgtcagctctttttatttccagtctggtccc 39

(321) <210> 29

(322) <211> 39

(323) <212> DNA

(324) <213> Artificial sequence

(325) <400> 29

(326) aggagcggcgtcagctcttttkatttccarcttkgtscc 39

(327) <210> 30

(328) <211> 22

(329) <212> DNA

(330) <213> Artificial sequence

(331) <400> 30

(332) atcggtgatgtcggcgatatag 22

(333) <210> 31

(334) <211> 24

(335) <212> DNA

(336) <213> Artificial sequence

(337) <400> 31

(338) tccctggaaatataagttctcgcc

(339) <210> 32

(340) <211> 18

(341) <212> DNA

(342) <213> Artificial sequence

(343) <400> 32

(344) gccaaaaccacacctcct

(345) <210> 33

(346) <211> 22

(347) <212> DNA

(348) <213> Artificial sequence

(349) <400> 33

(350) agcagccggatcgtcgagttcg

(351) <210> 34

(352) <211> 18

(353) <212> DNA

(354) <213> Artificial sequence

(355) <400> 34

(356) agagctgacgccgctcct

(357) <210> 35

(358) <211> 22

(359) <212> DNA

(360) <213> Artificial sequence

(361) <400> 35

(362) agcagccggatcgtcgagttcg

(363) <210> 36

(364) <211> 26

(365) <212> DNA

(366) <213> Artificial sequence

(367) <400> 36

(368) atcgagatctcgcgaaattaatacga

(369) <210> 37

(370) <211> 22

(371) <212> DNA

(372) <213> Artificial sequence

(373) <400> 37

(374) agcagccggatcgtcgagttcg 22