GLYCAN ARRAYS ON PTFE-LIKE ALUMINUM COATED GLASS SLIDES AND RELATED METHODS
20190277843 ยท 2019-09-12
Inventors
Cpc classification
C40B50/14
CHEMISTRY; METALLURGY
C40B40/12
CHEMISTRY; METALLURGY
International classification
C40B40/12
CHEMISTRY; METALLURGY
Abstract
Aluminum coated glass slides provide a novel glycan array platform. Specifically, aluminum coated glass slides increase sensitivity of fluorescent based assay methods. Additionally, aluminum coated glass slides allows for mass spectroscopic analysis of carbohydrates and provide a platform for examining activity of cellulases. The unique properties of ACG slides include: the metal oxide layer on the surface can be activated for grafting organic compounds such as modified oligosaccharides; the surface remains electrically conductive, and the grafted oligosaccharides can be simultaneously characterized by mass spectrometry and carbohydrate-binding assay; and the slides are more sensitive than transparent glass slides in binding analysis.
Claims
1. A method for characterization of carbohydrates immobilized on a PTFE-like aluminum-coated transparent solid substrate, the method comprising: (a) providing an array comprising a plurality of carbohydrates immobilized at discrete locations on a surface of a PTFE-like aluminum-coated transparent solid substrate; and (b) performing mass spectroscopic analysis to characterize the carbohydrates immobilized at each discrete location.
2. The method of claim 1, wherein the mass spectroscopic characterization of the immobilized carbohydrates comprises a time-of-flight mass spectrometry (MS-TOF).
3. The method of claim 1, further comprising: (c) then performing a binding analysis of suspected carbohydrate binding moieties.
4. The method of claim 3, wherein the suspected carbohydrate binding moieties are cellulase proteins.
5. The method of claim 3, further comprising: (d) incubating the cellulase proteins with the bound carbohydrates immobilized on the array surface under conditions suitable for the cellulases to hydrolyze the carbohydrates.
6. The method of claim 5, further comprising: (e) characterizing the products of the cellulase proteins remaining immobilized on the array surface following hydrolysis by the cellulases.
7. The method of claim 5, wherein the cellulases are selected from the group consisting of 1,4--glucosidases, exoglucanases (1,4--D glucan cellobiohydrolases) and endoglucanases (1,4--D glucan glucanohydrolases).
8. A method for analysis of binding reactions between the carbohydrates and molecules suspected of specifically binding the carbohydrates, the method comprising: (a) providing an array comprising a plurality of carbohydrates immobilized at discrete locations on a surface of an aluminum-coated transparent solid substrate or a PTFE-like aluminum-coated transparent solid substrate; (b) contacting the array with one or more molecules suspected of binding to one or more of the plurality of carbohydrates immobilized on the array surface; and (c) identifying the presence or absence of binding reactions at one or more discrete locations on the array surface.
9. The method of claim 8, wherein the molecules suspected of specifically binding the carbohydrates are proteins labeled with a detectable label.
10. The method of claim 9, wherein the protein labels comprise fluorescent dyes.
11. The method of claim 10, wherein the fluorescent dyes comprise amine-reactive cyanine dyes.
12. The method of claim 8, wherein the binding of a molecule to a carbohydrate on the array is representative of a biological process.
13. The method of claim 12, wherein the biological process is selected from the group consisting of protein folding, protein secretion, protein stabilization, viral infection, bacterial infection, cancer metastasis, inflammatory response, innate immunity, adaptive immunity, a receptor-mediated signaling process, and biofuel production.
14. The method of claim 8, wherein the carbohydrates are polysaccharides, or oligosaccharides, or carbohydrate portions of a glycoconjugate, or cellobiose, or cellotriose, or cellotetraose, or GloboH, or Gb5.
15. The method of claim 8, wherein a mass spectroscopic characterization of the carbohydrates immobilized on the array is performed prior to the binding analysis.
16. The method of claim 8, wherein a mass spectroscopic characterization of the carbohydrates immobilized on the array is performed prior to and following the binding analysis, wherein the one or more molecules suspected of binding to one or more of the plurality of carbohydrates immobilized on the array surface comprises a cellulose protein enzyme capable of hydrolyzing one or more carbohydrates on the array, and further wherein the binding reaction is performed under conditions suitable for the cellulose to hydrolyze the carbohydrate.
17. The method of claim 16, wherein the cellulases are selected from the group consisting of 1,4--glucosidases, exoglucanases (1,4--D glucan cellobiohydrolases) and endoglucanases (1,4--D glucan glucanohydrolases).
18. A method for fabricating an array of carbohydrates immobilized on an aluminum coated transparent solid substrate or a PTFE-like aluminum-coated transparent solid substrate, the method comprising: (a) immobilizing a plurality of carbohydrates at discrete locations on a surface of an aluminum coated transparent solid substrate or a PTFE-like aluminum-coated transparent solid substrate, wherein the substrate is conductive or semiconductive of an electrical field, wherein the array is suitable for performing mass spectroscopic characterization of the immobilized carbohydrates, and wherein the array is suitable for performing analysis of binding reactions between the carbohydrates and molecules suspected of specifically binding the carbohydrates.
19. The method of claim 18, wherein the carbohydrates are immobilized by a non-covalent bond.
20. The method of claim 19, wherein the carbohydrates are polyfluorinated.
21. The method of claim 18, wherein the carbohydrates are immobilized by a covalent bond.
22. The method of claim 21, wherein the carbohydrates are modified with a phosphonic acid functional group.
23. The method of claim 18, further comprising: (b) performing a characterization of carbohydrates immobilized on the array surface by mass spectrometry, wherein observation of one or more of a high signal/noise (S/N) ratio, low laser fluence rate, or a low fragmentation of signal, in an absence of matrix material is indicative of the array being suitable for performing mass spectroscopic characterization of the immobilized carbohydrates.
24. The method of claim 23, further comprising: (c) performing a carbohydrate binding assay on the array by contacting the array with a carbohydrate-binding protein, wherein detection of specific binding at one or more discrete locations on the array is indicative of the array being suitable for performing analysis of binding reactions between the carbohydrates and molecules suspected of specifically binding the carbohydrates.
25. The method of claim 24, wherein the carbohydrate is selected from a sugar, or a glycoprotein, or a glycolipid, or mannose, each comprising internal or nonreducing terminal alpha-mannosyl groups and the binding molecule is Concanavalin A.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0064] The above-mentioned features and objects of the present disclosure will become more apparent with reference to the following description taken in conjunction with the accompanying drawings wherein like reference numerals denote like elements and in which:
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
DETAILED DESCRIPTION OF THE INVENTION
[0096] In the following detailed description of embodiments of the present disclosure, reference is made to the accompanying drawings in which like references indicate similar elements, and in which is shown by way of illustration specific embodiments in which the present disclosure may be practiced. These embodiments are described in sufficient detail to enable those skilled in the art to practice the present disclosure, and it is to be understood that other embodiments may be utilized and that logical, mechanical, electrical, functional, and other changes may be made without departing from the scope of the present disclosure. The following detailed description is, therefore, not to be taken in a limiting sense, and the scope of the present disclosure is defined only by the appended claims. As used in the present disclosure, the term or shall be understood to be defined as a logical disjunction and shall not indicate an exclusive disjunction unless expressly indicated as such or notated as xor.
[0097] This disclosure incorporates by reference U.S. Patent Publication No. 2007/0213278, filed Dec. 22, 2006.
[0098] As used herein, the term Teflon or PTFE refers to polytetrafluoroethylene.
[0099] Effective adhesion between sugar molecules and the substrate surfaces have been achieved through covalent bonding. Physical adsorption of sugar derivatives on fluorous surfaces may also be feasible for sufficient adhesion. Porous silicon plates also acted as a matrix in DIOS MS, and mass spectra were obtained with a high signal-to-noise (S/N) ratio without fragmentation. The preparation of porous silicon plates requires the usage of corrosive acid, which is not environmentally friendly, and the quality of the plates is difficult to control. On the other hand, porous aluminum oxide exists naturally on the surface of aluminum; the electrochemical anodization of aluminum-coated glass (ACG) slides can be carried out in mildly acidic aqueous solution. Silylation reactions on silicon surfaces can also be used on aluminum surfaces under proper conditions. The freshly cut surface of plate aluminum has a shiny metallic texture. When exposed to air, the surface gradually oxidizes and turns opaque as a layer of aluminum oxide (called native oxide) is formed. Native aluminum oxide (NAO) grown on aluminum surfaces has no orientation compared to that of anodized aluminum oxide (AAO). The thickness of NAO on aluminum surfaces is just a few nanometers. In contrast, the thickness of AAO could grow quickly (within 15-20 min) to the micrometer range with the growing direction aligned to an applied electric field. In a few trial experiments, pure aluminum plates were fabricated (with a thickness of 1 mm) and the AAO layer was grown to 2 mm on the surface of the plate. This surface with a thick layer of AAO became nonconductive (like ceramics) and was not suitable for our study. However, in all cases, the amorphous oxide layers on the aluminum surfaces could be modified chemically, and the substrate remained electrically conductive only when the thickness of the oxide layer on the surface was in the nanometer range.
[0100] According to implementations illustrated in
[0101] Cellulases are of current interest because of their application to biofuel production. Cellobiose or cellotriose with fluorogenic or chromogenic groups are commonly used as substrates for the investigation of cellulase activity and specificity. However, during enzymatic hydrolysis, the fluorogenic or chromogenic leaving group generated in the reaction showed signal only at high pH, but, cellulases exhibit their optimum activity at low pH (4-6). Poly-fluorinated cellobiose was immobilized non-covalently on the PTFE-like ACG slides, and conducted the enzymatic hydrolysis at pH 4-6 in situ. The hydrolyzed products remaining on the slide surface were then identified by MS-TOF.
[0102] Moreover, the recently developed aluminum coated glass (ACG) slides were oxidized and reacted with a functionalized alkyl monoethoxysilane to form a covalent handle, followed by coupling with a glycan containing the photo-cleavable linker. This glycan array with a photo-cleavable linker on the ACG slide surfaces can be characterized by time-of-flight mass spectrometry (MS-TOF) without matrix, and used for binding evaluation of fluorescence-tagged proteins. The fluorescence intensity of sugar-protein complex on ACG-slide is higher than on glass slides. A new method is therefore disclosed for fabricating stable poly-fluorinated (also called the PTFE-like) ACG slides, and the use of these slides for non-covalent arraying glycans as substrates for the study of cellulase activities by using mass spectrometry as a detector. Moreover, by using the property of phosphonic acid to chelate with the aluminum oxide surface easily, the carbohydrate with a phosphonic acid linker was used to create covalent bonding glycan array.
[0103] According to implementations, a new generation of carbohydrate array on PTFE-like ACG slides have has been developed for immobilizing sugars. Mannose and lactose with a built-in photocleavable linker immobilized on the ACG slide surfaces were subjected to MALDI MS analysis to characterize the molecular weight of the immobilized sugars. A proportional correlation was observed between the quantity of mannose (m/z) and the fluorescence intensity of its protein binding. In protein-binding assays of mannose-ACG and Globo H-ACG slides, higher fluorescence intensity and sensitivity was observed than with glass slides, perhaps due to the material properties, surface morphologies, and binding-site architectures between proteins and the immobilized sugars on the slide surfaces.
[0104] With mass spectrometry, this glycan array can be used as an effective analytical tool to identify and differentiate various types of cellulases and their efficiency. The unique properties of aluminum oxide coated glass slides make it possible to conveniently and non-covalently or covalently array glycans via phosphonate chemistry and the glycan array can be characterized with MS spectrometry without the use of matrix.
[0105] According to implementations,
[0106] According to implementations and as illustrated in
[0107] According to implementations and as illustrated in
[0108] Artisans will readily appreciate both the utility of the apparatuses disclosed herein, as well as the various experimental methods based on the Examples and other disclosure provided here. Such devices and methods are expressly contemplated in this disclosure.
EXAMPLES
Example 1: Surface Properties of ACG Slides
[0109] A layer of pure aluminum (99.999%) at least 100 nm thick was coated onto the micro glass slides by using various coating techniques, such as magnetron sputtering, cathode arc evaporation, and thermal coating. These slides were either used without further manipulation or electrically anodized before usage. According to implementations,
[0110] As can be seen, the ACG slide produced by cathode arc evaporation has a coating of large granules and a high surface roughness. Slides with high surface roughness affect the surface-wetting property. The magnetron-sputtered ACG slide gave an acceptable surface roughness; however, it required a long coating time to achieve the desired coating thickness and was used only at the early stages of this study. Thermal coated ACG slides achieved the desired coating thickness in a relatively short time. It gave the smoothest surface with a surface roughness of 10 nm. With subsequent surface-anodization treatment, the ACG slide provided a stable surface for grafting. Only the anodized slide surfaces were covered with 100% aluminum oxide, as shown in
[0111] According to implementations of experimental data shown in
[0112] The thickness of coated aluminum on the glass slide needs to be >100 nm so that the substrate remains non-transparent within the visible region. When a transparent substrate was used, part of the fluorescent light passed through the substance, and the scanner detected only a portion of the Cy3 fluorescence. The instrument detected more fluorescent light when a nontransparent ACG slide was used as the background substrate.
[0113]
Example 2: Surface Activation
[0114] In the screening experiments, plasma of oxygen, argon, and mixed gases of oxygen and argon were tested for slide-surface activation. The residues (CO, CO.sub.2, and H.sub.2O) were removed under vacuum. It is the removal of this surface contamination that contributed to the success of grafting the desired organic compounds chemically. The surface was gauged with an attenuated total reflectance Fourier transform infrared (ATR/FTIR) spectrometer. The ATR/FTIR spectra showed AlOH peaks at around 800-1100 cm.sup.1, as illustrated in
[0115] The hydrophilic surface after plasma treatment gradually became hydrophobic, possibly because the oxide layer on the surface reformes. Disappearance of AlOH from the substrate surface was traced by ATR/FTIR spectroscopy. The AlOH peak intensity in the 800-1100 cm.sup.1 region decreased significantly over a matter of hours, as shown in
[0116] As shown in
Example 3: Mannose with PCL Immobilized on the Activated Surface of the ACG Slide
[0117] As shown in
Example 4: Mass Spectrometric Analysis of the Sugar Derivative Grafted on the ACG Slides
[0118] The matrix-free porous silicon surfaces (DIOS) produced molecular-ion peaks with negligible sample fragmentation. The ACG slide dimensions (75.525.41 mm.sup.3) fit well in the ultraflex mass spectrometry instrument; slides at each step of the treatment were analyzed, as shown in
[0119]
[0120]
[0121]
[0122] It is theorized that under high vacuum, UV excimer laser energy vaporizes aluminum oxide clusters to the gas phase; ultraviolet photon ionization produces sparse mass spectra with relatively light aluminum oxide clusters. The majority of the oxide clusters in the gas phase under vacuum consisted of AlO(Al.sub.2O.sub.3).sub.n, even though the aluminum oxide clusters could exist in many different forms. In
Example 5: Semiquantitative Comparison of the Content of Mannose with its Protein-Binding Capability
[0123] The optimization of the plasma gas treatment on the same type of ACG slide was evaluated by the fluorescence intensity of the immobilized sugar-protein binding.
[0124]
[0125] A semiquantitative comparison of the content of the immobilized mannose and the mannose-protein binding capability are given in
[0126] The differences in fluorescence intensity in
[0127] MS analysis of the same mannose-ACG slide (
[0128]
[0129]
Example 6: Utility of ACG Slides on Carbohydrate Microarrays
[0130] By using the synthetic route shown in
[0131] For further utilization of this newly fabricated substrate, the NH.sub.2-ACG surface was modified through conversion into NHS-ACG by treatment with disuccinimidyl suberate (DSS) in DMF and diisopropylethylamine. With glass slides as reference, a Globo H derivative with an amine functional group was arrayed on the NHS-ACG slide (
[0132]
Example 7: Factors Affecting Fluorescence Intensity-Substrate Property and Surface Morphology
[0133] The optical properties of substrates apparently affect the fluorescence intensity. Fluorescence (Cy3) is the sole light source in a protein-binding assay. Glass as well as porous silicon both pass and reflect light to different extents. On the contrary, aluminum-coated glass can be fabricated such that it becomes completely nontransparent and minimizes the waste of light provided by the light source.
[0134] The surface morphology of the substrate could affect the grafting density in immobilizing sugars. The NAO surface showed only 75% oxide content. On the contrary, the AAO surface contains 100% aluminum oxide, thus providing a stable surface and leading to a steady immobilizing density of the final slide for assay.
[0135] Substrate stability may also be affected by the way in which the surface is chemically treated. An example is the surface with cross-linked amines versus that with a monolayer of amine functional groups, both of which were made by activating the ACG slide with either 3-aminopropyltriethoxysilane (APTES) or 3-aminopropyldimethylethoxysilane (APDMES). Various chemical treatments of the ACG slide surface are under investigation.
Example 8: Factors Affecting Fluorescence Intensity-Binding-Site Architectures/Interactions of Proteins with Sugars Immobilized on the Substrate Surface
[0136] Under our experimental conditions, both concanavalin A and streptavidin exist as tetramers of their quaternary structures. The ratio of the dimensions of mannose to ConA is about 1:400 (corresponding to their molecular weight of 265 vs. 104 kDa). Owing to the geometric constraint, only two binding sites per tetramer of biotinylated ConA are available for mannose binding on the surface. On the high-density mannose array surface, each ConA tetramer would bind two molecules of mannose, and the two mannose molecules would probably be grafted on the surface not too far away from each other. As the chain length of the mannose derivative increases, the grafted mannose becomes further away from the substrate, and a high degree of randomness of the interaction could occur when both the grafting density and the amount of immobilized sugar-protein binding increase. Furthermore, the flexible docking of the streptavidin-Cy3 complex to biotinylated ConA was allowed. A similar geometric restriction can also be illustrated for Globo H, IgG monoclonal antibody VK9 (from mouse), and its goat anti-mouse IgG protein. The binding-site architecture between sugar and proteins could affect the density of the fluorescence-tagged protein and, thus, the fluorescence intensity in the sugar-protein-binding assay.
[0137] One purpose of studying the surface immobilization of sugars is to mimic the ligand interactions that occur on the cell surface of biological entities, for example, the existence and overexpression of the sugar antigen Globo H on the surfaces of normal and malignant cells. The sugar antigens, when overly populated on the cell surfaces, could result in massive polyvalent carbohydrate-protein interactions and greatly impact the provided biological function of the living entities. This study provides a more precise quantitative measurement and comparison of such a biological system.
Example 9: Preparation of PTFE-Like ACG Slides
[0138] To prepare the PTFE-like ACG slides, triethoxysilane 1 and phosphonic acid derivatives 3 were synthesized and used for reaction with the oxidized aluminum surface. Fabrication of silane based slide involves a two-step chemical reaction. The first step was to functionalize the aluminum oxide surface to amino groups by using compound 1 (FIG. 14) as a grafting reagent. This step was conducted under a moisture-free environment to avoid side reactions. In the second step, amide bond formation took place between NHS activated polyfluoro hydrocarbon compound 2 (
[0139] As illustrated in
[0140] As shown in
Example 10: Creation of Non-Covalent Bond Glycan Array on the PTFE-Like ACG Slides
[0141] With this encouraging result, the phosphoric acid based slide was used to create the glycan array for the experimental procedures outlined in
[0142] As shown in experimental implementations illustrated by the data shown in
[0143] According to implementations of experimental data in
[0144] The effect of laser fluence rate and matrix on this new surface was also investigated. Taking the labile carbohydrate Globo H as an example, it often loses a fucose moiety when used in MALDI-MS. By using mass spectrometry as a detector, the results were showed in table 1. Without adding matrix, a high signal to noise (S/N) ratio (22) in very low laser fluence rate (9%) is observed, and under this low laser fluence rate, no fragmented signal was found. When the fluence rate increase to 10%, the S/N ratio enhance to 40 without any fragmentation.
[0145]
TABLE-US-00001 TABLE 1 S/N ratio of Globo H under different laser fluence rate with or without matrix addition. Matrix-assisted Matrix-free Desorption/Ionization Desorption/Ionization Fluence Frag. Fluence Frag. Rate GH S/N S/N Rate GH S/N S/N 11% 7.3 0 9% 22 0 13% 61 6 10% 40 0 14% 157 13 12% 218 5 15% 316 25 16% 275 10 18% 1690 87 18% 375 17 19% 1956 108 19% 741 64 25% 3128 168 25% 2184 356 35% 1445 125 35% 1514 373 (Fluence: the laser power (or fluence rate) applied on the slide surface; GH S/N: the Signal/Noise ratio for globo H; Frag. S/N: the Signal/Noise ratio for the peak of fragmentation of globo H.)
Example 11: Cellulase Activity Studies
[0146] From the previous studies, poly-fluorinated carbohydrate immobilized on the PTFE-like ACG slide is easily ionized/desorbed by low laser energy. High S/N mass spectrum without fragmentation is therefore obtained, making the devices of the present disclosure suitable for glycosidase specificity and activity studies.
[0147] Enzymatic hydrolysis of the immobilized poly-fluorinated cellobiose 8 (see
[0148] Under MS-TOF analysis, the clean background baseline allowed calculation of the percentage of hydrolyzed components for each sample. As shown in the MS-TOF results in
[0149] These results (
TABLE-US-00002 TABLE 2 Enzymatic hydrolysis of poly-fluorinated cellobiose 8, the percentage showed hydrolyzed patterns of the reaction in solution/on the ACG slide. Triose Biose Glucose F-tail A. Niger 18/0 64/1 18/0 0/0 T. Reesei 0/0 7/69 93/25 0/7 T. Viride 0/0 3/77 58/17 38/6
[0150] According to implementations of experimental data shown in
[0151] The enzyme from T. viride functions the best for cellobiose in solution, and that from T. reesei hydrolyzed the disaccharide most effectively among the three enzyme sources on the slide. In solutions, the enzyme from A. niger seems to also act as a synthetase that the overall reaction produced 8% of cellotriose (MW 1093) detected as sodium adduct at m/z of 1116.3 [M+Na].sup.+. The enzyme from A. niger was characterized as a typical endo-type cellulose which cleaved five glucose units in length at a time. It did not hydrolyze either cellobiose or p-nitrophenyl--D-glucoside. To further understand the mode of action, poly-fluorinated (C.sub.8F.sub.17) cellotriose 9 (
[0152] Using the same analytical procedure, the results (
[0153] The cellulase from T. viride could effectively degrade the newspaper material and T. reesei could hydrolyze the crystalline form of cellulose. In general, the enzymatic hydrolysis on the ACG slide surface is more site-specific but much slower than that in solution, as indicated by the data shown in
Example 12: Cellulase Specificity Studies and Define the Cellulase Type by Using Glycan Array Combined with Mass Spectrometry
[0154] Cellulases are usually divided into several subclasses of isozymes based upon their function: 1,4--glucosidases [EC 3.2.1.74], which cleave cellobiose into individual glucose molecule, exoglucanases (1,4--D-glucan cellobiohydrolase [EC 3.2.1.91]), which cleaves cellobiose units from the end of the cellulose chain, and endoglucanases (1,4--D-glucan glucanohydrolase [EC 3.2.1.6]), which cleave the chain randomly at internal positions, creating new ends for exoglucanases. HPLC analysis of the products of hydrolysis of MUF-glucosides is often used to determine the hydrolytic specificity of these purified enzymes. From the above results, the devices and methods of this disclosure serve as another platform for studying the specificity of various types of cellulases.
[0155] To verify, the exoglucanases (L3) and endoglucanase (44A) were prepared according methods well known in the literature with minor modifications. First, enzymatic hydrolysis reactions were conducted in solution with the purified enzymes using substrates 8, 9 and 10. At the completion of the reaction, the solution mixtures were transferred to the PTFE-like ACG slide, and prepared by using the same washing procedures before being subjected to MS-TOF assay.
[0156]
[0157] As shown according to the implementations of experimental data shown in
[0158] For comparison and as illustrated according to implementations shown in
Example 13: Creation of Covalent Bond Glycan Array on PTFE-Like ACG Slides
[0159] There are several functionalized glass slides are commercial available for glycan array, for example glass slides coated with: amine, carboxylate, N-hydroxysuccinimide (NHS), avidin, epoxy, aldehyde, chelating nickel group, etc. When creating glycan array on these surfaces, suitable buffer and repeated blocking and washing steps are needed. According to implementations, substrates with a phosphonic acid functional group are easy to chelating on the ACG slide and can tolerate repeated washing steps. Accordingly, a novel method for effective glycan array preparation is hereby disclosed.
[0160] Mannose with phosphonic acid compound 21 was synthesized via the scheme illustrated in
[0161] Compound 21 was dissolved in methanol. A solution of this sugar derivative was spotted robotically onto the PTFE-like ACG slide surface. After incubation, without blocking, the slides were rinsed repeatedly with distilled water, and used for protein binding analysis by using Alexa 488-labeled Concanavalin A as a protein source. Different incubation times were evaluated and 15 minutes was determined to be enough for the sugar derivative to chelate on the ACG slide. Different concentrations of compound 21 were also spotted on the ACG slide wherein the result was an ACG slide comparable to the NHS coated glass slide, as illustrated in
Example 14: Materials and Methods
[0162] All chemicals and anhydrous solvents were purchased from a commercial source and used without further purification. Molecular Sieves (MS) for glycosylation were AW-300 (Aldrich). FluoroFlash SPE cartridge was purchased from Sigma. Reactions were monitored with analytical thin-layer chromatography (TLC) in EM silica gel 60 F254 plates and visualized under UV (254 nm) and/or by staining with KMnO.sub.4 or p-Anisadehyde. .sup.1H NMR spectra were recorded on a Bruker ULTRASHIELD-600 PLUS (600 MHz) spectrometer at 298K. Chemical shifts (in ppm) were assigned according to the internal standard signal of CDCl.sub.3 (6=7.24 ppm). .sup.13C NMR spectra were obtained with Bruker ULTRASHIELD-600 PLUS spectrometer and were calibrated with CDCl.sub.3 (=77.00 ppm). Coupling constants (J) are reported in hertz (Hz) Splitting patterns are described by using the following abbreviations: s, singlet; brs, broad singlet, doublet; t, triplet; m, multiplet.
Substrate Materials
[0163] Micro glass slides (75.525.41 mm.sup.3) were cleaned in piranha solution, a mixture of concentrated H.sub.2SO.sub.4 and 30% H.sub.2O.sub.2 (70:30 v/v), at 120 C. for 30 min, rinsed with plenty of deionized water until pH 7, and purge dried with high-quality nitrogen gas. The high-purity aluminum targets (99.999% pure) were obtained from Summit-Tech Resource Corp. (Hsin-Chu, Taiwan). These raw materials were provided to vendors Cheng-Jen Corp. (Kao-Hsiung, Taiwan) and Yujay-Tech Corp. (Chin-Ju, Taiwan) for the fabrication of ACG slides by using different coating techniques such as magnetron sputtering, cathode arc evaporation, and thermal evaporation. The fabricated ACG slides were either used directly or anodized with a DC current at 20 V (Keithley 2400 Model) at 48 C in 0.3M aqueous oxalic acid for 60-90 s. The surface properties of the fabricated ACG slides are shown in
Fabrication of NH.SUB.2.-ACG Slides
[0164] The ACG slide was washed with acetone and water consecutively on a multishaker (FMS2 FINEPCR) for 2-3 min, purge-dried with high-purity nitrogen gas, and further dried in an oven at 100 C. for 10-15 min. Surface activation was conducted by a plasma cleaner (Harrick PDC 32 G, 200-600 mTorr) with oxygen, argon, or mixed gases at room temperature for 10 min. Immediately after plasma treatment, APDMES (0.8 mL) was placed evenly on the surface (in bulk), which was covered with a sealed petri dish and heated directly on a hot plate at 658 C for 40 mini h. When the reaction was completed, the sample slide was rinsed thoroughly, sonicated in methanol for 3 min (20% power), and purge-dried with high-purity nitrogen gas. The surface with aminosilane-grafted substrate was used for amide-linkage formation in situ with the mannose derivative compound 27 and HBTU. The commercial NH.sub.2-glass slides (#40004 from Corning Inc.) were used for comparison of protein binding.
Fabrication of NHS-ACG Slides
[0165] ACG slides coated by thermal evaporation were further anodized in 0.2M oxalic acid for 90 s, rinsed with deionized water, and activated by argon plasma as usual. Without any contamination, the slide was assembled in a designed PTFE sealed, heat-transferable reaction cell, and APTES (1 mL, bulk) was immediately added to the cell. The PTFE cell was covered with a glass plate. Under moisture-free conditions, the cell was heated at 658 C for 30 min and rinsed thoroughly with methylene chloride and methanol. The slides were then purge-dried with nitrogen gas. Beforehand, a saturated solution of DSS (0.5 g; CAS #68528-80-30) in DMF (4 mL) and diisopropylethylamine (220 mL) was prepared. A portion (1.33 mL) of this saturated solution was added to each reaction cell. The NHS-ACG slide was formed within 3 h with constant swirling at room temperature. The slide was rinsed thoroughly with ethyl acetate and purge-dried with high-quality nitrogen gas. After the PTFE cell was dried and disassembled, the slide was ready for Globo H-NH.sub.2 microarray.
ACG Slides Preparation-Fabrication of the Silane Based PTFE-Like ACG Slides
[0166] In a moisture-free condition, the argon plasma activated ACG slide was reacted with 3-aminopropyltriethylsilane in bulk at 65 C. for 30 minutes then washed with methylene chloride thoroughly and dried by nitrogen gas under atmospheric condition. The silanated ACG slide was immersed in a solvent mixture (DMF/IPA/DIPEA 12/6/1 volume ratio) of N-succimidyl 3-perfluorooctylpropionate (0.05 wt %) solution for two hours at room temperature. After the reaction, the slide was rinsed with IPA thoroughly, and purged dried with nitrogen gas. Water contact angle (>115) measurement was quickly checked for the completion of the slide fabrication.
ACG Slides Preparation-Fabrication of the Phosphonic Acid Based PTFE-Like ACG Slides.
[0167] The aluminum coated glass slide was washed by acetone and water for three times, and then dried by dry clean air. The clean slide was then activated and cleaned by oxygen plasma (Harrick plasma, PDC-32G) for 15 mins. After activation, the slide was immersed into 3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,10-heptadecafluorodecylphosphonic acid (HDFDPA) 3 solution (1M, 65% 2-propanol in H.sub.2O, pH=6.17) immediately. The solution was vibrated by gentle sonication (50 W) for 15 mins. Following the ultrasonic treatment, the slide was removed from the solution and then immersed into another pure 2-propanol solution for 15 mins. The solution was also sonicated to assist the removal of excess phosphonic acid on the slide surface. The slide was dried by dry nitrogen and reduced pressure. Upon the completion of the reaction, the slide was washed thoroughly with IPA, and nitrogen purge dried. Water contact angle (115) measurement was quickly checked for the completion of the slide fabrication.
Reference-Controlled NHS-Glass Slides
[0168] NHS-glass slides (from SCHOTF, North America) were used directly. The NH.sub.2-glass slide (#40004 from Corning, Inc.) was modified by using the same preparation method for the NHS-ACG slide. The slide was assembled in a designed PTFE sealed, heat-transferable reaction cell. A portion (1.33 mL) of saturated DSS solution was added for reaction with the NH.sub.2-glass surface. After constant swirling at room temperature for 3 h, the slide was rinsed thoroughly with ethyl acetate and purge-dried with high-quality nitrogen gas. After the PTFE cell was dried and disassembled, the slides were ready for Globo HNH.sub.2 microarray.
Chemical Materials
[0169] All chemicals employed in the synthesis of 6 were purchased from Aldrich or the specified individual chemical companies and used without any further purification.
Synthesis
[0170] ##STR00002##
Preparation of 3.
[0171] Diethyl 3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,10-heptadecafluorodecylphosphonate (Si): 1,1,1,2,2,3,3,4,4,5,5,6,6,7,7,8,8-heptadecafluoro-10-iododecane (1.02 g, 1.78 mmol) and P(OEt).sub.3 (15 ml, excess) was added to 50 ml round bottom flask. The mixture was heated to 120 C. under nitrogen for 40 hours and then purified with FluoroFlash SPE cartridge. The remaining light yellow oil was chromatographed with Ethyl Acetate/Hexane to give product. (0.96 g, 92%). .sup.1H NMR (600 MHz, CDCl.sub.3): (ppm) 4.10-4.00 (m, 4H, CH.sub.2CH.sub.3), 2.35-2.23 (m, 2H, CH.sub.2CF.sub.2), 1.92-1.86 (m, 2H, PCH.sub.2), 1.25 (t, J=7.2 Hz, 6H, CH.sub.2CH.sub.3). .sup.13C NMR (150 MHz, CDCl.sub.3): (ppm) 121-106 (m, CF coupling unsolved), 62.28 (d, .sup.2J.sub.cp=6 Hz, CH.sub.2CH.sub.3), 25.33 (t, .sup.2J.sub.cF=23 Hz, CH.sub.2CF.sub.2), 17.24 (d, .sup.2J.sub.cp=148 Hz, PCH.sub.2), 16.38, .sup.3J.sub.cp=6 Hz, CH.sub.2CH.sub.3), HRMS calcd for C.sub.14H.sub.14F.sub.17O.sub.3P: [M+H].sup.+, 585.0487; found: 585.0433.
[0172] 3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,10-heptadecafluorodecylphosphonic acid (3): Bromotrimethylsilane (0.74 mL, 5.75 mmol) was added via syringe to a solution of Si (1.12 g, 1.92 mmol) in anhydrous CH.sub.2Cl.sub.2 (15 ml) under nitrogen. The mixture was stirred for 30 hours. Volatiles were removed in vacuo completely to give white powder. The white powder can be used for next experiment directly without further purification. (0.99 g, 97%). .sup.1H NMR (600 MHz, MeOD): (ppm) 2.48-2.42 (m, 2H, CH.sub.2CF.sub.2), 1.99-1.96 (m, 2H, PCH.sub.2). .sup.13C NMR (150 MHz, MeOD): (ppm) 121-106 (m, CF coupling unsolved), 25.55 (t, .sup.2J.sub.cF=23 Hz, CH.sub.2CF.sub.2), 18.26 (d, .sup.2J.sub.cp=143 Hz, PCH.sub.2). HRMS calcd for C.sub.10H.sub.5F.sub.17O.sub.3P: [MH], 526.9699; found: 526.9669.
##STR00003##
Preparation of Polyfluorinated Mannose 4.
[0173] 2,5-dioxopyrrolidin-1-yl 4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,1,11-heptadecafluoroundecyl carbonate (S2): To a stirred solution of 4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heptadecafluoroundecan-1-ol (214 mg, 0.45 mmol) and DSC (184 mg, 0.72 mmol) in acetonitrile was added triethylamine (0.5 ml, 3.60 mmol) at 0 C. under nitrogen and then the solution warmed up slowly to room temperature and stirred for 16 hours. The reaction was washed with H.sub.2O three times. The organic layer was dried over Na.sub.2SO.sub.4, filtered and concentrated under reduced pressure. The product was purified by flash chromatography to give white solid. (242 mg, 87%). .sup.1H NMR (600 MHz, CDCl.sub.3): (ppm) 4.40 (t, 2H, J=6.3 Hz, CH.sub.2O), 2.83 (s, 4H), 2.27-2.18 (m, 2H, CH.sub.2CH.sub.2F), 2.10-2.05 (m, 2H, FCH.sub.2). .sup.13C NMR (150 Mhz, CDCl.sub.3): (ppm) 168.73 (NCO), 151.65 (OCO), 121-106 (m, CF coupling unsolved), 69.87 (OCH.sub.2), 25.66 (FCH.sub.2), 20.12 (FCH.sub.2CH.sub.2)
[0174] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -D-mannopyranoside (4): To a stirred solution of S2 (250 mg, 0.40 mmol) and 5-Aminopentyl -D-manno-pyranoside (112 mg, 0.39 mmol) in CH.sub.2Cl.sub.2 was added triethylamine (0.2 mL) at 0 C. under nitrogen and then the ice bath was removed. The reaction warmed up to room temperature and stirred overnight. The solvent was removed in vacuo and the product was purified by FluoroFlash SPE cartridge and flash chromatography to give white solid. (253 mg, 83%). 1H NMR (600 MHz, CDCl.sub.3): (ppm) 7.97 (s, 1H, NH), 4.72 (d, J=1.6 Hz, 1H, 1-H of Man), 4.10 (t, J=6.2 Hz, 2H, OCH.sub.2), 3.82-3.80 (m, 1H), 3.77-3.76 (m, 1H), 3.73-3.70 (m, 2H), 3.69-3.66 (m, 1H), 3.59 (t, J=9.6 Hz, 1H), 3.52-3.49 (m, 1H), 3.42-3.38 (m, 1H), 3.08 (t, J=7.1 Hz, 1H, OCH.sub.2), 2.32-2.23 (m, 2H, CH.sub.2CH.sub.2F), 1.94-1.89 (m, 2H, FCH.sub.2), 1.63-1.54 (m, 2H), 1.51-1.46 (m, 2H), 1.42-1.32 (m, 4H), .sup.13C NMR (150 MHz, CDCl.sub.3): (ppm) 157.44 (NCO), 120-105 (m, CF coupling unsolved), 100.12 (1-C of Man), 73.19, 71.25, 70.87, 67.22, 67.04, 62.80, 61.51, 40.27 (CH.sub.2N), 29.41, 19.10, 26.20, 25.63, 24.86, 20.07. HRMS calcd for C.sub.23H.sub.28F.sub.17NO.sub.8: [M+Na].sup.+, 806.1598; found: 806.1643.
##STR00004## ##STR00005##
Synthesis of Polyfluorinated 5, 6, and 7.
[0175] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecaflourododecoxycarbonyl-amino)pentyl] -D-lactoside (5): The solution of S3 (44 mg, 0.10 mmol) and S2 (76 mg, 0.12 mmol) in DMF (5 mL) was added Et.sub.3N (28 L, 0.20 mmol) at 0 C. After stirring at room temperature overnight, the reaction mixture was concentrated in vacuo and purified by column chromatography and FluoroFlash SPE cartridge to give 5 as white foamy solid (29 mg, 30%). Rf: 0.68 (EtOAc:MeOH=5:1). .sup.1H NMR (600 MHz, MeOD): 4.36 (d, J=7.6 Hz, 1H), 4.27 (d, J=7.8 Hz, 1H), 4.15 (bt, 1H), 4.10 (t, J=6.0 Hz, 2H), 3.90-3.40 (m, 12H), 3.39 (m, 1H), 3.25 (t, J=8.1 Hz, 1H), 3.09 (t, J=6.9 Hz, 2H), 2.31-2.26 (m, 2H), 1.93-1.90 (m, 2H), 1.64-1.62 (m, 2H), 1.52-1.49 (m, 2H), 1.42-1.40 (m, 2H). .sup.13C NMR (150 MHz, MeOD): 157.53, 120.62-110.33 (m, CF coupling unresolved), 103.79, 102.93, 79.38, 75.79, 75.16, 75.13, 73.52, 73.46, 71.26, 69.38, 69.00, 62.90, 61.19, 60.62, 40.36, 29.29, 29.05, 27.33 (t), 22.96, 20.18. MS (ESI) Calcd for C.sub.29H.sub.38F.sub.17NO.sub.13Na+: 954.1970 [M+Na].sup.+; found: 954-1964.
[0176] (4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -D-galactopyranosyl-(1.fwdarw.3)-2-acetamido-2-deoxy--D-galac topyra-nosyl-(1.fwdarw.3)--D-galactopyranosyl-(1.fwdarw.4)--D-galacto-pyranosyl-(1.fwdarw.4)--glucopyranoside (6): Compound 6 was prepared from compound S4 according to the procedure as described for 5 in 55% yields after purification by column chromatography and FluoroFlash SPE cartridge. Rf: 0.18 (EtOAc:MeOH=1:1). White foamy solid. .sup.1H NMR (600 MHz, MeOD): 4.72 (d, J=8.4 Hz, 1H), 4.44 (d, J=.sub.70.0 Hz, 1H), 4.37 (d, J=7.4 Hz, 1H), 4.31 (d, J=7.7 Hz, 1H), 4.29 (m, 1H), 4.19 (d, J=2.1 Hz, 1H), 4.13 (t, d, J=6.0 Hz, 2H), 4.09 (m, 1H), 4.01 (bs, 1H), 3.95-3.67 (m, 20H), 3.60-3.42 (m, 11H), 3.26 (t, J=8.6 Hz, 1H), 3.12 (t, J=7.0 Hz, 2H), 2.34-2.26 (m, 2H), 2.01 (s, 3H), 1.98-1.91 (m, 2H), 1.69-1.64 (m, 2H), 1.55-1.52 (m, 2H), 1.46-1.43 (m, 2H). .sup.13C NMR (150 MHz, MeOD): 173.69, 157.44, 120.11-108.43 (m, CF coupling unresolved), 105.22, 104.06, 102.91, 102.80, 101.38, 80.11, 79.83, 79.34, 78.55, 75.38, 75.11, 75.05, 74.97, 74.94, 73.46, 73.24, 73.17, 71.17, 71.07, 71.00, 69.31, 69.21, 68.87, 68.14, 68.07, 62.81, 61.21, 60.50, 60.16, 51.98, 40.26, 29.22, 28.97, 22.87, 21.95, 20.08, 19.47. MS (MALDI) Calcd for C.sub.49H.sub.71F.sub.17N.sub.2O.sub.28Na+: 1481.382 [M+Na]+; found: 1481.452. [0174] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -L-fucopyranosyl-(1-2)--galactopyranosyl-(1.fwdarw.3)-2-acetamido-2-deoxy--galactopyranosyl-(1-3)--D-galactopyranosyl-(1.fwdarw.4)--D-galacto-pyranosyl-(1.fwdarw.4)--D-glucopyranoside (7): Compound 7 was prepared from compound S5 according to the procedure as described for 5 in 88% yields after purification by column chromatography and FluoroFlash SPE cartridge. Rf: 0.18 (EtOAc:MeOH=1:1). White foamy solid. .sup.1H NMR (600 MHz, MeOD): 5.26 (d, J=3.8 Hz, 1H), 4.96 (d, J=3.8 Hz, 1H), 4.58 (d, J=7.9 Hz, 1H), 4.44 (d, J=7.0 Hz, 1H), 4.30 (d, J=7.6 Hz, 1H), 4.29 (m, 1H), 4.17-4.10 (m, 5H), 4.01 (bs, 1H), 3.93-3.69 (m, 24H), 3.68-3.53 (m, 8H), 3.44-3.41 (m, 1H), 3.26 (t, J=8.6 Hz, 1H), 3.12 (t, J=7.0 Hz, 2H), 2.32-2.28 (m, 2H), 2.04 (s, 3H), 1.97-1.93 (m, 2H), 1.69-1.64 (m, 2H), 1.56-1.52 (m, 2H), 1.47-1.42 (m, 2H), 1.27 (d, J=6.5 Hz, 3H). .sup.13C NMR (150 MHz, MeOD): 173.17, 157.55, 104.20, 104.07, 102.93, 102.59, 101.54, 99.78, 80.05, 79.26, 78.81, 77.83, 76.82, 75.50, 75.21, 75.09, 74.23, 73.56, 73.41, 72.25, 71.33, 71.22, 70.25, 69.41, 69.32, 69.09, 68.37, 68.33, 66.83, 62.91, 61.31, 61.26, 60.65, 60.25, 51.82, 40.37, 29.32, 29.07, 22.97, 22.18, 20.19, 15.40. MS (MALDI) Calcd for C.sub.55H.sub.81F.sub.17N.sub.2O.sub.32Na+: 1627.440 [M+Na]+; found: 1627.526.
##STR00006##
Synthesis of Polyflouro-Cellobioside 8.
[0177] 5-Azidopentyl 2,3,6,2,3,4,6-hepta-O-acetyl--D-cellobioside (S7): A suspension of the compound S6 (1.01 g, 1.29 mmol), s-azido-1-pentanol (0.84 g, 6.47 mmol), and 3 molecular sieves in CH.sub.2Cl.sub.2 (10 mL) was stirred at room temperature for 1 h. The reaction mixture was cooled to 0 C. and treated dropwise with BF.sub.3.Et.sub.2O (33 L, 0.26 mmol). After stirring at 0 C. for 2 h, saturated aqueous NaHCO.sub.3 was added and the reaction mixture was filtered with Celite. The mixture was diluted with CH.sub.2Cl.sub.2 and then washed with brine. The organic phase was dried over Na.sub.2SO.sub.4 and evaporated the solvent and purified by chromatography (Hexane:EtOAc=3:1.fwdarw.2:1.fwdarw.1:1) to give S7 as a white foamy solid (330 mg, 34%). Rf: 0.48 (Hexane:EtOAc=1:1). .sup.1H NMR (600 MHz, CDCl.sub.3): 5.16 (t, J=9.4 Hz, 1H), 5.13 (t, J=9.4 Hz, 1H), 5.04 (t, J=9.7 Hz, 1H), 4.91-4.85 (m, 2H), 4.50-4.47 (m, 2H), 4.42 (d, J=8.2 Hz, 1H), 4.34 (dd, J=12.5, 4.3 Hz, 1H), 4.06 (dd, J=12.0, 4.7 Hz, 1H), 4.01 (dd, J=12.3, 1.9 Hz, 1H), 3.81 (m, 1H), 3.74 (t, J=9.5 Hz, 1H), 3.64-3.62 (m, 1H), 3.56 (m, 1H), 3.43 (m, 1H), 3.23 (t, J=6.8 Hz, 2H), 2.10 (s, 3H), 2.06 (s, 3H), 2.01 (s, 3H), 2.00 (s, 3H), 1.99 (s, 3H), 1.98 (s, 3H), 1.96 (s, 3H), 1.59-1.54 (m, 4H), 1.40-1.35 (m, 2H). .sup.13CNMR (150 MHz, CDCl.sub.3): 170.54, 170.34, 170.26, 169.86, 169.60, 169.34, 169.08, 100.81, 100.64, 76.51, 72.94, 72.67, 72.49, 71.96, 71.61, 71.56, 69.73, 67.76, 61.84, 61.54, 51.33, 28.94, 28.52, 23.14, 21.08, 20.90, 20.69, 20.57. HRMS (ESI) Calcd for C.sub.31H.sub.45N.sub.3O.sub.18Na.sup.+: 770.2590 [M+Na]+; found: 770.2570 .
[0178] (4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarb-onyl-amino)pentyl] 2,3,6,2,3,4,6-hepta-O-acetyl--D-cellobioside (S8): A suspension of S7 (50 mg, 0.07 mmol), catalytic amount of Pd/C in 5% formic acid in MeOH (5 mL) was stirred under H.sub.2 balloon for 2 h. After filtration through Celite, the filter cake was washed with MeOH. The filtrate was evaporated and co-evaporated with toluene. The residue underwent to next step without purification.
[0179] The residue described above was dissolved in CH.sub.2Cl.sub.2 (5 mL) and then Compound S2 (50 mg, 0.08 mmol) was added. The mixture was cooled to 0 C. Triethylamine (19 .mu.L, 0.13 mmol) was added and the solution continued stirring at room temperature for 12 h. The reaction mixture was concentrated and purified by chromatography (Hexane:EtOAc=1:1) to give S8 as a white foamy solid (49 mg, 60% in two steps). .sup.1H NMR (600 MHz, CDCl.sub.3): 5.14 (t, J=9.5 Hz, 1H), 5.11 (t, J=9.5 Hz, 1H), 5.03 (t, J=, 9.5 Hz, 1H), 4.91-4.84 (m, 2H), 4.76 (br, 1H), 4.50 (dd, J=12.0, 1.7 Hz, 1H), 4.48 (d, J=7.9 Hz, 1H), 4.40 (d, J=8.0 Hz, 1H), 4.34 (dd, J=12.5, 4.3 Hz, 1H), 4.09 (t, J=6.1 Hz, 2H), 4.05 (dd, J=12.0, 4.9 Hz, 1H), 4.01 (dd, J=12.5, 2.2 Hz, 1H), 3.80 (m, 1H), 3.73 (t, J=9.5 Hz, 1H), 3.64-3.61 (m, 1H), 3.55-3.53 (m, 1H), 3.43 (m, 1H), 3.12 (m, 2H), 2.18-2.13 (m, 2H), 2.09 (s, 3H), 2.05 (s, 3H), 2.00 (2s, 6H), 1.98 (s, 3H), 1.97 (s, 3H), 1.95 (s, 3H), 1.92-1.88 (m, 2H), 1.56-1.52 (m, 2H), 1.49-1.44 (m, 2H), 1.34-1.29 (m, 2H). .sup.13C NMR (150 MHz, CDCl.sub.3): 170.51, 170.35, 170.25, 169.84, 169.62, 169.33, 169.06, 156.25, 120.18-108.01 (m, CF coupling unresolved), 100.78, 100.62, 76.47, 72.91, 72.68, 72.45, 71.94, 71.60, 71.56, 69.77, 67.74, 63.17, 61.76, 61.52, 40.83, 29.68, 29.49, 28.92, 27.99, 27.84, 27.69, 23.02, 21.03, 20.84, 20.64, 20.53, 20.33. HRMS (ESI) Calcd for C.sub.43H.sub.52F.sub.17NO.sub.20Na+: 1248.2703 [M+Na]+; found: 1248.2675.
[0180] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -D-cellobioside (8): The solution of S8 (222 mg, 0.18 mmol) and NaOMe (50 mg, 0.09 mmol) in MeOH (7 mL) was stirred at room temperature overnight. The mixture was neutralized with Amberlyst-15 ion-exchange resign for 5 min and filtered through a sintered funnel packed with Celite. The filter pad was rinsed with methanol after filtration. The combined filtrates were concentrated under reduced pressure and then purified by flash column chromatography (EtOAc:MeOH=10:1.fwdarw.8:1) to give 8 as a white solid (123 mg, 73%). Rf: 0.47 (EtOAc:MeOH=5:1). .sup.1H NMR (600 MHz, MeOD): 4.40 (d, J=7.9 Hz, 1H), 4.27 (d, J=7.8 Hz, 1H), 4.10 (t, J=6.1 Hz, 2H), 3.89-3.86 (m, 4H), 3.65 (dd, J=11.8, 5.7 Hz, 1H), 3.57-3.53 (m, 2H), 3.50 (t, J=9.0 Hz, 1H), 3.39-3.32 (m, 3H), 3.30 (m, 1H), 3.22 (m, 2H), 3.09 (t, J=6.7 Hz, 2H), 2.32-2.23 (m, 2H), 1.94-1.89 (m, 2H), 1.66-1.61 (m, 2H), 1.53-1.48 (m, 2H), 1.43-1.38 (m, 2H). .sup.13C NMR (150 MHz, MeOD): 157.51, 120.11-108.43 (m, CF coupling unresolved), 103.20, 102.79, 79.31, 76.69, 76.43, 75.03, 73.47, 69.95, 69.29, 61.00, 60.74, 60.42, 40.32, 29.52, 28.95, 27.36, 27.21, 27.07, 22.86, 20.07. HRMS (ESI) Calcd for C.sub.29H.sub.38F.sub.17NO.sub.13Na.sup.+: 954.1964 [M+Na].sup.+; found: 954.1966.
##STR00007##
Synthesis of Polyflouro-Cellotrioside 9
[0181] para-Methoxyphenyl 2,3,4,6-tetra-O-acetyl--glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--D-glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-benzyl--glucopyranoside (S10): According to similar procedures reported by Vesalla, a suspension of S6 (1.68 g, 2.16 mmol), S9 (1.0 g, 1.8 mmol) and 3 mol. sieves in CH.sub.2Cl.sub.2 (20 mL) was stirred at room temperature for 1 h. The reaction mixture was cooled to 40 C. and treated dropwise with TMSOTf (98 l, 0.54 mmol). After stirring at 40 C. for 2 h, saturated aqueous NaHCO.sub.3 was added and the reaction mixture was filtered with Celite. The mixture was diluted with CH.sub.2Cl.sub.2 and then washed with brine. The organic phase was dried over Na.sub.2SO.sub.4 and evaporated the solvent and purified by chromatography (Hexane:EtOAc=3:1-2:1-1:1) to give S10 as a white foamy solid (1.86 g, 88%). R.sub.f: 0.55 (Hexane:EtOAc=1:1). .sup.1H NMR (600 MHz, CDCl.sub.3): 7.38-7.25 (m, 15H), 7.00 (d, J=9.1 Hz, 2H), 6.81 (d, J=9.1 Hz, 2H), 5.10-5.05 (m, 2H), 5.00-4.98 (m, 2H), 4.94-4.91 (m, 2H), 4.85-4.82 (m, 2H), 4.78 (d, J=11.6 Hz, 1H), 4.72 (d, J=11.6 Hz, 2H), 4.64 (d, J=8.2 Hz, 1H), 4.49 (d, J=12.0 Hz, 1H), 4.39 (d, J=7.9 Hz, 1H), 4.37 (dd, J=12.5, 4.3 Hz, 1H), 4.23 (dd, J=12.0, 2.0 Hz, 1H), 4.01 (dd, J=12.0, 2.2 Hz, 1H), 3.95 (t, J=9.2 Hz, 1H), 3.90 (dd, J=12.0, 4.6 Hz, 1H), 3.78 (s, 3H), 3.78-3.62 (m, 6H), 3.46-3.44 (m, 1H), 3.19-3.16 (m, 1H), 2.08 (s, 3H), 2.02 (s, 3H), 2.00 (s, 3H), 1.99 (s, 3H), 1.98 (s, 3H), 1.97 (s, 3H), 1.95 (s, 3H). .sup.13C NMR (150 MHz, CDCl.sub.3): 170.71 170.46, 170.42, 170.01, 169.68, 169.53, 169.22, 155.53, 151.64, 139.42, 138.34, 138.01, 128.79, 128.48, 128.38, 128.35, 128.26, 128.20, 127.86, 127.40, 127.13, 118.70, 114.71, 102.91, 101.04, 100.15, 82.77, 81.60, 76.39, 75.20, 74.92, 74.89, 73.85, 73.11, 72.67, 72.37, 72.09, 71.65, 67.99, 67.93, 61.98, 61.70, 55.85, 20.93, 20.88, 20.75. HRMS (ESI) Calcd for C.sub.60H.sub.70O.sub.24Na.sup.+: 1197.4149 [M+Na]+; found: 1197.4142.
[0182] para-Methoxyphenyl 2,3,4,6-tetra-O-acetyl--D-glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--D-glucopyranosyl-(14)-2,3,6-tri-O-acetyl--D-glucopyranoside (S11): A suspension of S10 (1.01 g, 0.86 mmol), catalytic amount of Pd(OH).sub.2 in MeOH/EA (1/1, 10 mL) was stirred under H.sub.2 balloon for 12 h. After filtration through Celite, the filter cake was washed with MeOH. The filtrate was evaporated and the residue underwent to next step without purification.
[0183] The residue described above was dissolved in pyridine (5 mL) and acetic anhydride (5 mL). The mixture was stirred at room temperature overnight. The solution was added MeOH to destroy the excess acetic anhydride and then concentrated in vacuo. CH.sub.2Cl.sub.2 was added and the reaction mixture was washed with 1M aqueous HCl, saturated aqueous NaHCO.sub.3 and brine. The organic phase was dried over Na.sub.2SO.sub.4 concentrated and purified by chromatography (Hexane:EtOAc=1:1) to give S11 as a white foamy solid (794 mg, 90% in two steps). Rf: 0.24 (Hexane:EtOAc=1:1). .sup.1H NMR (600 MHz, CDCl.sub.3): 6.88 (d, J=9.0 Hz, 2H), 6.76 (d, J=9.0 Hz, 2H), 5.19 (t, J=9.2 Hz, 1H), 5.11-5.07 (m, 3H), 5.02 (t, J=9.7 Hz, 1H), 4.88-4.81 (m, 4H), 4.50 (dd, J=12.0, 2.0 Hz, 1H), 4.46 (d, J=8.0 Hz, 1H), 4.44 (d, J=8.0 Hz, 1H), 4.37 (dd, J=12.0, 2.0 Hz, 1H), 4.32 (dd, J=12.5, 4.3 Hz, 1H), 4.10-4.06 (m, 2H), 4.00 (dd, J=12.5, 2.0 Hz, 1H), 3.80 (t, J=9.5 Hz, 1H), 3.73 (t, J=9.5 Hz, 1H), 3.72 (s, 3H), 3.67-3.64 (m, 1H), 3.61-3.55 (m, 2H), 2.11 (s, 3H), 2.07 (s, 3H), 2.05 (s, 3H), 2.02 (s, 3H), 2.00 (s, 3H), 1.99 (s, 3H), 1.97 (2s, 6H), 1.96 (s, 3H), 1.94 (s, 3H). .sup.13C NMR (150 MHz, CDCl.sub.3): 170.53, 170.27, 170.23, 169.79, 169.57, 169.32, 169.10, 155.77, 150.88, 118.69, 114.53, 100.80, 100.57, 100.07, 76.44, 76.13, 72.89, 72.81, 72.77, 72.65, 72.41, 72.02, 71.75, 71.55, 71.52, 67.70, 62.15, 61.49, 55.67, 20.86, 20.80, 20.70, 20.57, 20.50. HRMS (ESI) Calcd for C.sub.45H.sub.58O.sub.27Na+: 1053.3058 [M+Na]+; found: 1053.3051. [0182] 5-Azidopentyl 2,3,4,6-tetra-O-acetyl--glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--D-glucopyranoside (S12): Compound S11 (866 mg, 0.84 mmol) was dissolved in acetone-H.sub.2O (20 mL 3:1), and the mixture was cooled (ice-water bath). A solution of CAN (2.3 g, 4.20 mmol) in acetone/H.sub.2O (10 mL 3:1) was added, and the mixture was stirred at room temperature for 30 min. The mixture was concentrated to a volume of 10 mL, diluted with CH.sub.2Cl.sub.2, washed with saturated aqueous NaHCO.sub.3, dried (Na.sub.2SO.sub.4), filtered, and concentrated. The residue was then dissolved in CH.sub.2Cl.sub.2, and treated with trichloroacetonitrile (1.0 mL) and Cs.sub.2CO.sub.3 (250 mg, 0.77 mmol). After stirring at room temperature for 12 h, the reaction was washed with water, brine, dried (Na.sub.2SO.sub.4), filtered, and concentrated. A suspension of the tricholoroacetimidate compound, 5-azido-1-pentanol (0.54 g, 4.20 mmol), and 3 molecular sieves (1.5 g) in CH.sub.2Cl.sub.2 (10 mL) was stirred at room temperature for 1 h. The reaction mixture was cooled to 0 C. and treated dropwise with BF.sub.3.Et.sub.2O (0.11 mL, 0.84 mmol). After stirring at 0 C. for 2 h, saturated aqueous NaHCO.sub.3 was added and the reaction mixture was filtered with Celite. The mixture was diluted with CH.sub.2Cl.sub.2 and then washed with brine. The organic phase was dried over Na.sub.2SO.sub.4 and evaporated the solvent and purified by chromatography (Hexane:EtOAc=3:1.fwdarw.2:1.fwdarw.1:1) to give S12 as a white foamy solid (210 mg, 24% in three steps). Rf: 0.31 (Hexane:EtOAc=1:1). .sup.1H NMR (600 MHz, CDCl.sub.3): 5.12-5.05 (m, 3H), 5.00 (t, J=9.7 Hz, 1H), 4.87-4.79 (m, 3H), 4.48 (dd, J=11.8, 2.0 Hz, 1H), 4.43 (d, J=7.9 Hz, 1H), 4.42 (d, J=7.9 Hz, 1H), 4.38 (d, J=8.0 Hz, 1H), 4.35 (dd, J=12.0, 2.0 Hz, 1H), 4.31 (dd, J=12.5, 4.3 Hz, 1H), 4.07 (dd, J=12.1, 5.2 Hz, 1H), 3.99 (dd, J=12.5, 2.0 Hz, 1H), 3.80-3.74 (m, 1H), 3.71 (dt, J=10.0, 9.5 Hz, 2H), 3.60-3.58 (m, 2H), 3.55-3.52 (m, 2H), 3.45-3.40 (m, 1H), 3.21 (t, J=6.8 Hz, 2H), 2.09 (s, 3H), 2.08 (s, 3H), 2.04 (s, 3H), 1.99 (s, 3H), 1.98 (s, 3H), 1.97 (s, 3H), 1.96 (s, 3H), 1.95 (s, 3H), 1.94 (2s, 6H), 1.60-1.52 (m, 4H), 1.42-1.33 (m, 2H). .sup.13C NMR (150 MHz, CDCl.sub.3): 170.52, 170.31, 170.21, 169.82, 169.79, 169.54, 169.31, 169.10, 100.79, 100.59, 100.55, 76.49, 76.14, 72.87, 72.67, 72.41, 71.75, 71.62, 71.53, 67.72, 62.14, 61.72, 61.48, 51.34, 28.91, 28.50, 23.12, 20.87, 20.68, 20.55, 20.48. HRMS (ESI) Calcd for C.sub.43H.sub.61N.sub.3O.sub.26Na+: 1058.3436 [M+Na]+; found: 1058.3419. [0183] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] 2,3,4,6-tetra-O-acetyl--glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--glucopyranosyl-(1.fwdarw.4)-2,3,6-tri-O-acetyl--D-glucopyranoside (S13): Compound S13 was prepared from compound S12 according to the procedure as described for S8 in 55% yields (two steps) after column chromatography (Hexane:EtOAc=1:1-2:3). White solid. R.sub.f: 0.41 (Hexane:EtOAc=1:1). .sup.1H NMR (600 MHz, CDCl.sub.3): 5.13-5.06 (m, 3H), 5.01 (t, J=9.7 Hz, 1H), 4.88-4.81 (m, 4H), 4.79 (br, 1H), 4.50 (dd, J=11.8, 1.3 Hz, 1H), 4.44 (d, J=7.2 Hz, 1H), 4.43 (d, J=7.6 Hz, 1H), 4.38 (d, J=8.1 Hz, 1H), 4.36 (dd, J=12.0, 1.8 Hz, 1H), 4.32 (dd, J=12.5, 4.3 Hz, 1H), 410-4.06 (m, 3H), 4.02 (dd, J=12.0, 4.8 Hz, 1H), 3.99 (dd, J=12.4, 2.0 Hz, 1H), 3.79-3.74 (m, 1H), 3.72 (dt, J=11.5, 9.6 Hz, 2H), 3.63-3.58 (m, 1H), 3.56-3.50 (m, 2H), 3.43-3.40 (m, 1H), 3.11 (m, 1H), 2.20-2.10 (m, 2H), 2.10 (s, 3H), 2.09 (s, 3H), 2.05 (s, 3H), 1.99 (s, 3H), 1.98 (2s, 6H), 1.97 (s, 3H), 1.96 (s, 3H), 1.94 (2s, 6H), 1.91-1.86 (m, 2H), 1.54-1.52 (m, 2H), 1.48-1.43 (m, 2H), 1.34-1.26 (m, 2H). .sup.13C NMR (150 MHz, CDCl.sub.3): 170.53, 170.35, 170.22, 169.81, 169.58, 169.32, 169.11, 153.25, 120.2-108.01 (m, CF coupling unresolved), 100.79, 100.58, 100.55, 76.47, 76.14, 72.88, 72.70, 72.66, 72.39, 72.00, 71.75, 71.63, 71.54, 71.34, 69.76, 67.69, 63.67, 63.18, 62.13, 61.65, 61.48, 40.84, 29.50, 28.93, 27.99, 27.84, 27.70, 23.02, 20.89, 20.76, 20.67, 20.54, 20.48, 20.34. HRMS (ESI) Calcd for C.sub.55H.sub.68F.sub.17NO.sub.2sNa+: 1536.3656 [M+Na]+; found: 1536.3548.
[0184] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -D-glucopyranosyl-(1.fwdarw.4)--D-glucopyranosyl-(1.fwdarw.4)--D-glucopyranoside (9): Compound 9 was prepared from compound S13 according to the procedure as described for 8 in 50% yields after purification by column chromatography (EtOAc:MeOH=3:1-1:1) and FluoroFlash SPE cartridge. White solid. R.sub.f: 0.66 (EtOAc:MeOH=3:1). .sup.1H NMR (600 MHz, MeOD): 4.44 (d, J=8.0 Hz, 1H), 4.39 (d, J=7.8 Hz, 1H), 4.27 (d, J=7.9 Hz, 1H), 4.10 (t, J=6.1 Hz, 1H), 3.91-3.84 (m, 6H), 3.67-3.63 (m, 3H), 3.58-3.48 (m, 7H), 3.39-3.32 (m, 3H), 3.30 (m, 1H), 3.22 (m, 2H), 3.09 (t, J=6.9 Hz, 1H), 2.31-2.26 (m, 2H), 1.97-1.90 (m, 2H), 1.65-1.61 (m, 2H), 1.52-1.48 (m, 2H), 1.43-1.37 (m, 2H). .sup.13C NMR (150 MHz, MeOD): 157.71, 120.11-108.43 (m, CF coupling unresolved), 103.44, 103.21, 103.05, 79.40, 79.00, 76.95, 76.66, 75.47, 75.25, 75.02, 73.75, 73.48, 70.19, 69.56, 63.07, 61.26, 60.58, 60.30, 40.50, 29.45, 29.20, 27.61, 27.46, 27.32, 23.10, 20.32. HRMS (ESI) Calcd for C.sub.35H.sub.48F.sub.17NO.sub.18Na.sup.+: 1116.2492 [M+Na].sup.+; found: 1116.2520.
[0185] [(4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,12,12,12-nonadecafluorododecoxycarbonyl-amino)pentyl] -D-glucopyranosyl-(1.fwdarw.4)--D-glucopyranosyl-(1.fwdarw.4)--D-glucopyranosyl-(1.fwdarw.4)--D-glucopyranoside (10): Compound 10 was prepared from according to the procedure as described for 9 in 86% yields after purification by column chromatography. 4.47 (d, J=8.0 Hz, 1H), 4.46 (d, J=8.0 Hz, 1H), 4.42 (d, J=7.8 Hz, 1H), 4.30 (d, J=7.9 Hz, 1H), 4.10 (t, J=6.1 Hz, 2H), 3.91-3.89 (m, 9H), 3.68-3.63 (m, 3H), 3.60-3.50 (m, 14H), 3.39-3.25 (m, 14H), 3.12 (t, J=6.9 Hz, 2H), 2.33-2.26 (m, 2H), 1.96-1.90 (m, 2H), 1.70-1.61 (m, 2H), 1.55-1.52 (m, 2H), 1.43-1.37 (m, 2H). HRMS (ESI) Calcd for C.sub.41H.sub.58F.sub.17NO.sub.23Na+: 1255.3128 [M+Na].sup.+; found: 1255.3225.
Mass Spectrometry
[0186] The immobilized slide was analyzed with a Bruker Ultraflex MALDI-TOF mass spectrometer equipped with a nitrogen pulsed laser (355 nm). Each data point was collected at the average of 500-1000 shots of the laser beam, and the laser fluence was applied at 40-95%, with the best results obtained mostly at 50-80%. A standard aqueous solution of mannose-NH.sub.2 was manually deposited on a defined area of the ACG slide and used to calibrate the data obtained from the immobilized sugars on the same slide substrate. For quantitative comparison of the grafted mannose derivatives at different concentrations, all analyses were made at a single measurement of 500 shots at 80% fluence. The variation in average peak intensity with S/N ratio was plotted.
Protein-Binding Assay
[0187] Mannose-protein-binding assay of immobilized mannose with biotinylated ConA and Cy3-tagged streptavidin. The same slide used for MS analysis was washed again with distilled water under mild sonication and then rinsed with PBS (phosphate-buffered saline) buffer. Biotin-labeled ConA (Invitrogen C 21420) was diluted 500-1000 times in PBST buffer (PBS with 0.05% Tween 20). The protein solution (50 mL) was applied to each array substrate and incubated in a Whatman 16-pad incubation chamber. These slides were wrapped with foil and incubated for 1 h in a shaker at room temperature. After the incubation, the slides were washed three times with PBST buffer. Streptavidin-Cy3 (Sigma S 6402) was diluted in PBS buffer 100 times, and the slides were covered with aluminum foil and incubated again with streptavidin-Cy3 for another hour. After the second incubation, the slides were washed with PBST buffer and distilled water and then purge-dried with high-quality nitrogen gas. The array pattern was analyzed in reflective mode with 540-nm laser light by using the fluorescence light scanner, ArrayWoRx, made by Applied Precision. The best block on each slide was selected for statistical fluorescence-intensity analysis.
[0188] Globo H-protein-binding assay of immobilized Globo H with monoclonal antibody VKg (IgG) from mouse and Cy3-tagged secondary antibody. The Globo H microarray slides were blocked with aqueous ethanolamine (50 mM) to remove the unreacted NHS on the slide surface. The slides were assembled again in the reaction cell and washed with PBS buffer (pH 7.4). Next, a solution of VK9 (1 mL, 50 g/mL in each cell), the anti-Globo H monoclonal antibody (IgG) from mouse, in PBST (pH 7.4) was added to the cell. The binding experiment was conducted with constant shaking for 1 h. The slide was washed three times (with 10 minutes constant swirling each time) with PBST buffer (pH 7.4). Cy3-tagged goat anti-mouse IgG for VK9 was added to the cell, and the mixture was incubated with shaking in the dark for 1 h. The protein-bound slides were washed five times each with PBST buffer (pH 7.4), PBS buffer (pH 7.4), and water and then purge-dried with nitrogen gas.
MS-TOF Analysis and Glycan Array Preparation of 4-MS-TOF Analysis of the Poly-Fluorinated Mannose Adsorbed on the PTFE-Like ACG Slides
[0189] Compound 4 was dissolved in methanol/water (6/4) solvent mixture at approximately 10 mM, 1 mM, 100 uM in series. The solutions (1 L each) were spotted manually, and also, microarrayed on the slides with the BioDot AD3200 instrument (Agilent Technology) by robotic pin (Array It, SMP4), a deposition of approximately 1.1 nL of the solution per spots of the array. The slides were stored in 30% humidity chamber overnight then analyzed by mass spectroscopy. The blank and poly-fluorinated mannose slides, which contain both silane based and phosphonic acis based ACG slides, were analyzed with Bruker Ultraflex MALDI-TOF mass spectrometer equipped with a nitrogen pulsed laser (355 nm). Equal volume of BSA Trypsin digested (1 pmoel/L) solution was mixed homogeneously with DHB (dihydroxybenzoic acid, 10 mg in 1:1 acetonitrile/water) solution, and was used as the standard for MS-TOF mass calibration. Each data point was collected at the average of 500 shots of the laser beam, and the laser fluence between 2 to 20% was applied. Most of the experiments were carried out under positive polarized electrical field.
[0190]
[0191]
Fluorescence-Tagged Con A/Mannose Binding of the Poly-Fluorinated Mannose Adsorbed on the PTFE-Like ACG Slides.
[0192] 100 L of Alex 488-tagged Concanavalin A in phosphate-BSA buffer (25 g/mL, pH 6.5) was applied on the ACG slide surface immobilized with mannose derivative. These slides with Con A solution were incubated at room temperature for approximately 2 hours. After incubation, the slides were washed three times each with 12 ml of Phosphate-BSA buffer, PBST buffer, and de-ionized water in petri dishes with gentle swirling. Then nitrogen purge dried and analyzed by Array WoRx (Applied Precision) in reflective mode of the fluorescence light scanner at 530 nm. FIG. S1(c) and FIG. S2(c) show the results of these bioassay.
On-Chip Analysis by MALDI-TOF (Ultra-Flex II) (Reaction in Eppendorf)
[0193] Cellulase was prepared (5 U/mL in 25 mM pH 5.05 NaOAc buffer solution). Substrate was also dissolved in NaOAc buffer solution (25 mM, pH 5.05) to give 0.5 mM substrate solution. Add 100 uL cellulase solution to 100 uL substrate solution in eppendorf to have a 2.5 U/mL cellulase solution with 0.25 mM substrate. This solution was incubated in 37 C. for 18 hours. Add 100 L incubated solution onto the slide loaded in FAST Frame. Put the slide in dry box to remove the water, and then use high vacuum to remove trace water. 100 L water was used to rinse each well of the FAST Frame multi-slide plate to solve and remove the salt of the buffer solution. Remove any residual water on the plate by high vacuum and then analyzed the slide by MALDI-TOF Ultra-Flex II.
On-Chip Analysis by MALDI-TOF (Ultra-Flex II) (Reaction on Chip Directly)
[0194] Cellulase was prepared (5 U/mL in 25 mM pH 5.05 NaOAc buffer solution). Substrate was also dissolved in NaOAc buffer solution (25 mM, pH 5.05) to give 0.5 mM substrate solution. Add 50 L cellulase solution to 50 L substrate solution onto the glass slide which was loaded in FAST Frame multi-slide plate to have a 2.5 U/mL cellulase solution with 0.25 mM substrate. The well of the plate was sealed and the whole assembly was incubated in 37 C. for 18 hours. Put the slide in dry box to remove the water, and then use high vacuum to remove trace water. 100 uL water was used to rinse each well of the FAST Frame multi-slide plate to solve and remove the salt of the buffer solution. Remove any residual water on the plate by high vacuum and then analyzed the slide by MALDI-TOF Ultra-Flex II.
Cellulase Purification and MS-TOF Analysis of Cellulase Activity, Cloning, Expression and Purification of Exoglucanase and Endoglucanase
[0195] The genomic DNA of Sulfolobus solfataricus (ATCC 35092) and Clostridium thermocellum (ATCC 27405) were obtained from the ATCC biological resource center. The Sso7d (NCBI accession number: AAK42090) gene fragment was amplified directly from the Sulfolobus solfataricus genome by polymerase chain reaction (PCR) with forward 5 GGAATFCCATATGGCAACAGTAAAGTFCAAG 3 (SEQ ID NO: 1) and reverse 5 CGGGATCCCTTCTTTTGCTTCTCTAACATTTG 3 (SEQ ID NO: 2) primers. The PCR product encoding Sso7d was digested with NdeI and BamHI and subsequently cloned into expression vector pET-28a (Novagen) to generate pET-28-Sso7d. A two sticky-ends linker, generated by denaturing and annealing with 5 GATCTGATCTGTACGACGATGACGATAAGGGATCTATCGAAGGTCGTG 3 (SEQ ID NO: 3) and 5 GATCCACGACCTFCGATAGATCCCTFATCGTCATCGTCGTACAGATCA 3 (SEQ ID NO: 4) primers, was inserted into the BamHI cleaved pET-28-Sso7d to generate pET-28-Sso7d-Fxa. The functional domains of CtCbhA (NCBI accession number: X80993) gene fragment was amplified directly from the Clostridium thermocellum genome by polymerase chain reaction (PCR) with forward 5 GAAGATCTATACTFCCGCAGCCTGATG 3 (SEQ ID NO: 5) and reverse 5 ACGCGTCGACTTAGGTTTCACTGTCTGTGTACTG 3 (SEQ ID NO: 6) primers. The PCR product encoding CtCbhA was digested with BglII and SalI and subsequently cloned into BamHI and SalI cleaved pET-28-Sso7d-Fxa to generate pET-28-Sso7d-Fxa-CtCbhA. The functional domains of CtCel44A (NCBI accession number: D83704) gene fragment was amplified directly from the Clostridium thermocellum genome by polymerase chain reaction (PCR) with forward 5 GAAGATCTGAACCTGCAAAAGTGGTFGAC 3 (SEQ ID NO: 7) and reverse 5 ACGCGTCGACTTAGGGCTCCGCAGCTFCAAGCAC 3 (SEQ ID NO: 8) primers.
[0196] The PCR product encoding CtCel44A was digested with BglII and SalI and subsequently cloned into BamHI and SalI cleaved pET-28-Sso7d-Fxa to generate pET-28-Sso7d-Fxa-CtCel44 . All DNA constructs were verified by nucleotide sequencing. The correct constructs were transformed into Escherichia coli strain BL21 (DE3) competent cell for protein expression. The 10 ml overnight culture of a single transformant was used to inoculate 1 liter of fresh LB medium containing 30 g/ml kanamycin at 30 C. The incubated temperature was changed to 16 C. until the cells were grown to A.sub.600 nm=0.8-1. One hour later isopropyl-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM. After 16 h, the cells were harvested by centrifugation at 7,000g for 15 min to collect the cell paste. The cell pellet was resuspended immediately in the lysis buffer containing 20 mM Tris-HCl, 400 mM NaCl, 10 mM imidazole, pH 7.5. The cell suspension was disrupted by Constant Cell Disruption System (CONSTANT SYSTEM Ltd., UK) and centrifuged at 17,000g to remove cell debris. The cell-free extract was loaded onto a Ni.sup.2+NTA column, which had been previously equilibrated with lysis buffer. The column was washed with lysis buffer, subsequently the His6-tagged protein was eluted by a linear gradient from 10 mM to 300 mM imidazole. The purified His.sub.6-tagged Sso7d fusion CtCbhA and CtCel44A proteins were concentrated and changed to stored buffer (50 mM Tris-HCl, 100 mM NaCl, pH 8.0) by 30 kDa cut-off size membrane of Amicon-Ultra-15 (Millipore, Mass., USA) for storage at 80 C.
[0197] According to implementations, the devices and methods (e.g., mass spectroscopy) of the present disclosure are operational in an environment comprising numerous general purpose or special purpose computing systems or configurations. Examples of well known computing systems, environments, or configurations that may be suitable for use with the invention include, but are not limited to, personal computers, server computers, hand-held or laptop devices, multiprocessor systems, microprocessor-based systems, set top boxes, programmable consumer electronics, network PCs, minicomputers, mainframe computers, telephony systems, distributed computing environments that include any of the above systems or devices, and the like.
[0198] The devices and methods of the present disclosure may be described in the general context of computer-executable instructions, such as program modules, being executed by a computer. Generally, program modules include routines, programs, objects, components, data structures, etc., that perform particular tasks or implement particular abstract data types. The system may also be practiced in distributed computing environments where tasks are performed by remote processing devices that are linked through a communications network. In a distributed computing environment, program modules may be located in both local and remote computer storage media including memory storage devices. The computer programs are stored in a memory medium or storage medium or they may be provided to a processing unit through a network or I/O bus.
[0199] In one aspect, the devices and methods of the present disclosure include at least one central processing unit (CPU) or processor. The CPU can be coupled to a memory, ROM or computer readable media containing the computer-executable instructions. Computer readable media can be any available media that can be accessed by the system and includes both volatile and nonvolatile media, removable and non-removable media implemented in any method or technology for storage of information such as computer readable instructions, data structures, program modules or other data. Computer storage media includes, but is not limited to, RAM, ROM, EEPROM, flash memory, portable memory or other memory technology, CD-ROM, digital versatile disks (DVD) or other optical disk storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store the desired information and which can be accessed by the fingerprint generation and matching systems. Communication media typically embodies computer readable instructions, data structures, program modules or other data in a modulated data signal such as a carrier wave or other transport mechanism and includes any information delivery media. By way of example, and not limitation, communication media includes wired media such as a wired network or direct-wired connection, and wireless media such as acoustic, RF, infrared and other wireless media. Combinations of any of the above should also be included within the scope of computer readable media. The computer readable media may store instructions or data which implement all or part of the system described herein.
[0200] While the apparatus and method have been described in terms of what are presently considered to be the most practical and preferred embodiments, it is to be understood that the disclosure need not be limited to the disclosed embodiments. It is intended to cover various modifications and similar arrangements included within the spirit and scope of the claims, the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structures. The present disclosure includes any and all embodiments of the following claims.
[0201] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0202] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.