Preparative electrophoretic method for targeted purification of genomic DNA fragments

Abstract

A sample containing particles having high-molecular-weight (HMW) DNA is entrapped in a gel matrix, and the gel matrix is exposed to a lysis reagent configured to release the HMW DNA from the particles. The HMW DNA may be purified by subjecting the gel matrix to an electrophoretic field that removes the HMW DNA from the particles, lysis reagents, and/or other sample constituents, from the gel matrix such that the HMW DNA remains. The gel matrix may be subjected with DNA cleavase reagents configured to cleave at specific DNA sequences within the HMW DNA to liberate defined segments of the DNA as fragments of reduced size. The gel matrix may also be subjected to an electrophoretic field, which moves and separates the DNA fragments from uncleaved DNA of the HMW DNA, which remains substantially immobile. The electrophoretically separated DNA fragments may be isolated from the gel matrix.

Claims

1. A method for isolating fragments of genomic DNA regions of interest using an electrophoretic cassette comprising: loading a sample containing particles having high-molecular-weight (HMW) DNA in a first well of a gel matrix of an electrophoresis cassette; loading a lysis reagent into a second well of the gel matrix of the electrophoresis cassette; applying an electrophoretic field to the gel matrix such that: the lysis reagent is delivered to the first well so as to lyse the particles and release the HMW DNA from the particles; cellular components are electrophoresed from the first well, and the HMW DNA is removed from the particles and trapped in a wall of the fist well; emptying and refilling the first well with a custom CRISPR-Cas9 cleavage reagent configured to cleave at specific DNA sequences within the HMW DNA so as to liberate defined segments of the DNA as fragments of reduced size; subjecting the gel matrix to an electrophoretic field, the field being configured to move and thereby separate the DNA fragments from uncleaved DNA of the HMW DNA which remains substantially immobile; and isolating the electrophoretically separated DNA fragments from the gel matrix.

2. The method of claim 1, wherein emptying and refilling additionally comprises emptying and refilling the second well with the CRISPR-Cas9 cleavage reagent.

3. The method of claim 1, wherein isolating the electrophoretically separated DNA fragments is by electroelusion.

4. The method of claim 1, wherein the uncleaved remainder of the HMW DNA remains entrapped in the gel matrix.

5. The method of claim 1, wherein the particles are contained in a liquid suspension and comprise at least one of intact cells selected from the group consisting of: animal, plant, bacterial, fungal, archebacterial, protozoan, and intact virus particles.

6. The method of claim 1, wherein the gel matrix comprises an agarose hydrogel at a concentration between 0.2% and 5% (weight/volume).

7. The method of claim 1, wherein the lysis reagent comprises an anionic detergent at a concentration between 0.05% and 10%.

8. The method of claim 7, wherein the anionic detergent is sodium dodecyl sulfate (SDS).

9. The method of claim 1, wherein the size of the HMW DNA is >10 megabase pairs in length, and the size of the DNA fragments is <2 megabase pairs in length.

10. The method of claim 1, wherein the particles are contained in a liquid suspension and comprise bacteria, plant, or fungal cells, and wherein the method further comprises subjecting the gel matrix to other enzymatic reagent treatments configured to remove the cell walls prior to exposing the gel matrix with the entrapped sample to the lysis reagent.

11. The method of claim 1, wherein the DNA fragments are isolated from the gel matrix by electroelution into an elution module containing liquid buffer.

12. A method for isolating fragments of genomic DNA regions of interest using an electrophoresis cassette comprising: loading a sample containing particles having high-molecular-weight (HMW) DNA in a first well of a gel matrix of an electrophoresis cassette; loading a lysis reagent into a second well of the gel matrix of the cassette; applying an electrophoretic field to the gel matrix such that: the lysis reagent is delivered to the first cavity so as to lyse the particles and release the HMW DNA from the particles; cellular components are electrophoresed from the first well; and the HMW DNA are removed from the particles and trapped in a wall of the first well; emptying and refilling the first well with a custom CRISPR-Cas9 cleavage reagent configured to cleave at specific DNA sequences within the HMW DNA so as to liberate defined segments of the DNA as fragments of reduced size; incubating the cassette at a suitable temperature for a suitable period of time to allow efficient cleavage of the HMW DNA; applying an electric field to the matrix so that digested DNA fragments are electrophoresed into the matrix and separated according to their size; and isolating the electrophoretically separated DNA fragments from the gel matrix.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 illustrates a schematic view of a preparative electrophoresis cassette and size selection process as described in US Publication No. 2015/00101932, herein incorporated by reference in its entirety.

(2) FIG. 2 illustrates a cassette of the type described in co-pending PCT Application No. PCT/US2015/055833, hereinafter referred to as the '833 PCT, herein incorporated by reference in its entirety.

(3) FIGS. 3A-E illustrate a schematic view of a system and method for obtaining targeted DNA fragments from HMW DNA according to some embodiments of the present disclosure.

(4) FIG. 4 illustrates a schematic diagram of targeting sites, the relevant coding regions, and some common breakpoints giving rise to the NPM1-ALK fusion rearrangement.

DETAILED DESCRIPTION OF SOME OF THE EMBODIMENTS

(5) FIGS. 3A-E illustrates embodiments of the present disclosure which utilize a gel electrophoresis cassette (e.g., as illustrated in FIGS. 1 and 2). FIG. 1 shows a schematic view of a commercial preparative electrophoresis cassette and size selection process using that cassette. In the left side of FIG. 1, the sample nucleic acids are electrophoresed downward from a sample well through an agarose filled separation channel, where they are separated by size. After separation, the separation electrodes are turned off, and the elution electrodes are turn on, thereby electroeluting the separated nucleic acids sideways into a set of elution modules to the right of the separation channel. The eluted nucleic acids are in liquid electrophoresis buffer and can be removed from the elution modules using manual or automated pipetting means.

(6) The cassette of FIG. 1 is modified, as shown in FIG. 2, to provide a cassette of the type described in the '833 PCT. In this cassette, a sample well is provided along with a reagent well upstream of the sample well (i.e., upstream corresponding to the side proximal to the negative separation electrode). In some embodiments, the reagent well is larger in volume than the sample well, and slightly wider and deeper than the sample well to ensure that the sample well is completely surrounded by the reagents from the reagent well during the electrophoretic purification step.

(7) The exemplary workflow, according to some embodiments of the disclosure, shown in FIGS. 3A-E, is as follows (for simplicity of illustration, only the separation channel and elution channels are shown in the figure). FIG. 3A shows the cassette immediately after sample loading. Preferably, the sample is a cell suspension. Examples of preferred samples can be any of whole blood, purified white blood cells, suspensions of cultured cells, suspensions of microorganisms, suspension of cells prepared from buccal swab, and samples prepared from solid tissues that have been enzymatically treated to disperse the tissue into a suspension of single cells. Preferably, the sample cell suspension is loaded in an isopycnic loading solution so that the cells will neither float nor sink during purification electrophoresis.

(8) Also in FIG. 3A, a lysis reagent is loaded in the reagent well. In some embodiments, the reagent well and sample well are physically isolated and cannot mix during loading. In some embodiments, the lysis reagent comprises negatively charged components that can be electrophoresed through the gel matrix into the sample well where they will gently lyse the cells without any mixing or stirring of the sample well components. In this way, lysis occurs in a shear-free fashion, and very HMW DNA is generated. Preferred lysis reagents include anionic detergents such as SDS and sodium sarcosyl, and detergent-tolerant proteases, such as proteinase K, chelating agents such as EDTA and EGTA, and mixtures of the above.

(9) After loading the sample and reagent wells, an electrophoretic field can be applied using separation electrodes. During the initial phases of electrophoresis, the lysis reagents are delivered to the sample well where cells are lysed rapidly and gently with little or no viscous shear flow. In some embodiments, proteins and other cellular components are denatured and/or degraded by the lysis reagents, and coated with negative charge by the anionic detergent in the lysis reagent. As a result, such contaminants are rapidly electrophoresed from the sample well. However, since cell lysis is quick and gentle, the cellular DNA remains largely undegraded, and is of such large size (estimated to be >10 megabases) that it will not electrophorese into the separation gel column. The end of the purification electrophoresis is shown schematically in FIG. 3B, with the HMW DNA trapped in the downstream wall of the sample well, and the detergent micelles and the detergent-protein complexes at the bottom of the gel.

(10) Although the DNA becomes trapped in the gel matrix during this purification step, it is processable by DNA modification enzymes such as restriction enzymes, transposases, polymerases, and exonucleases as described in the '833 PCT. In FIG. 3C, the sample and reagent wells are emptied, the reagent well refilled with buffer that is compatible with CRISPR-Cas9 cleavage buffer (see example below), and the sample well is refilled with the custom CRISPR-Cas9 cleavage reagents that are configured to cleave at sequences that surround DNA regions of interest for downstream analyses, for instance, by DNA sequencing. The cassette is incubated at a suitable temperature for a suitable period of time to allow efficient cleavage of the HMW DNA. Preferably, the DNA fragments released by the customized CRISPR-Cas9 reagents are less than about 5 megabases in size, and more preferably, less than about 2 megabases in size, so that the released DNA can be reliably separated from the uncleaved DNA which remains trapped at the lip of the sample well.

(11) In FIG. 3D, after cleavage of the sample DNA, the reagent well can be emptied and refilled with a purification reagent. In some embodiments, the purification reagent is similar to or identical to the lysis reagent. Separation electrodes can then be activated. Accordingly, the Cas9-gRNA complexes can then be denatured and/or degraded as the lysis reagent is electrophoresed through the sample well.

(12) Although it is anticipated that the inventive method is particularly useful for long-range genomic analyses, the method can be applicable for targeted selection of both small (“small” here meaning from about 10 to about 5000 bp in length) and large (“large” here meaning from 5000 bp up to mid-single megabase pairs in length) DNA fragments. In either case, a pair customized CRISPR/Cas9 cleavage reagents is configured for each genomic DNA fragment to be recovered for analysis.

(13) For some embodiments corresponding to samples comprising cells with cell walls (e.g., bacteria, fungi, and plants), the sample is loaded in an isotonic reagent mixture containing enzymes configured to digest the cell walls, thereby converting the original sample cells into spheroplasts. In some such embodiments, the sample well is loaded without adding lysis reagent to the reagent well, so that cell wall digestion can take place for an extended period, without the chance for diffusion of the lysis reagent into the sample well prior to the electrophoresis purification step.

(14) The following examples are presented to help illustrate and support some of the embodiments of the present disclosure, and are not to be considered as limiting.

Example 1: Custom Cas9 gRNA Cleavase Reagents for Isolation of Long DNA Fragments from the HLA Locus

(15) Background HLA molecules are encoded by class I (HLA-A, -B, -C) and II (HLA-DRB1/3/4/5, -DQB1, -DPB1) genes. These genes produce diverse peptides to T-cell receptors, which regulate T cell development, self-tolerance and adaptive immunity. HLA molecules are immunogenic and can become the target of cellular and humoral immune response in the allogeneic transplant setting, and so HLA typing has become the standard of care for assessing the immunological compatibility between a transplant donor and recipient. HLA typing at single-base resolution has been performed using Sanger sequencing, which is labor-intensive and costly. Due to the large number of single nucleotide variants (SNV) that need to be phased into separate haplotypes, cis-trans ambiguities frequently arise that can only be resolved by additional testing including PCR with sequence specific primers. Several next-generation sequencing (NGS) technologies, including Illumina and Ion-torrent, have lowered the cost of HLA typing, but they are unable to directly phase SNVs over distances greater than a few hundred base pairs. Third generation sequencers such as those produced by Pacific Biosciences (PacBio) and Oxford Nanopore can inexpensively obtain long reads from single DNA molecules. This may, in principle, allow haplotype-resolved sequencing of the HLA locus; however, there is currently no established methodology for selecting specific long DNA fragments from the genome. This can be accomplished by inventive methods of the present application. To do so the following steps are performed.

(16) Oligonucleotides encoding gRNAs to cut long fragments from the HLA-A locus. DNA oligonucleotides encoding the targeting sequence of gRNAs and flanking bases are configured to cut the 5′ and 3′ ends of the HLA-A locus. One or more gRNAs can be targeted to each end (here, we target two). In this example, the targeting sequences and a small amount of constant gRNA sequence are ordered from IDT technologies and then cloned into the DR274 vector [PMID: 23360964], which encodes the constant region of the gRNA downstream of a T7 promoter. The resulting plasmid is PCR amplified and an in vitro transcription reaction is performed to produce gRNAs with the following sequences are produced:

(17) TABLE-US-00001 5′ ggNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCTTTTT,
where the “N”'s represent the gRNA targeting sequence, and the 2 g's that are 5′ to these N's are required for T7 transcription start.

(18) For example, to target the HLA-A gene, we use the following targeting sequences: For gRNAs 5′ of HLA-A:

(19) 5HLA-A-TS1

(20) 5′-GAAAAGAACAGTTACGTAGC-3′ (SEQ ID NO: 2), which is just upstream of a AGG PAM sequence and resides at chromosome 6 chr6:29,941,185-29,941,204 (all coordinates are from the human reference genome assembly version GRCh38).

(21) 5HLA-A-TS2

(22) 5′-CCAGAAGCTTCACAAGACCG-3′ (SEQ ID NO: 3) , which is just upstream of an AGG PAM and resides at chr6:29,941,096-29,941,115. Target sites 5HLA-A-TS1 and 5HLA-A-TS2 are configured to cleave genomic sites that flank the consensus HLA-A coding start (chr6:29,942,553) on the 5′ side by approximately 1350 and 1440 bp, respectively.
3HLA-A-TS1
5′-ATTCCTTATATTCACCCCCA-3′ (SEQ ID NO: 4) which is just upstream of a GGG PAM and resides at chr6:29949521-29949540
3HLA-A-TS2
5′-CATTCCTTATATTCACCCCC-3′ (SEQ ID NO: 5) which is just upstream of an AGG PAM and resides at chr6:29949520-29949539

(23) 3HLA-A-TS1 and 3HLA-A-TS2 overlap each other and are configured to cleave at a position that flanks the end of the HLA-A consensus coding region (chr6:29,945,453) on the 3′ side by approximately 4090 bp.

(24) Targeted Cas9 cleavage products from these HLA-A target sites are predicted to be approximately ˜8330 bp (5HLA-A-TS1 to 2HLA-A-TS1 or 2) and 8420 bp (5HLA-A-TS2 to 3HLA-A-TS1 or 2) in length.

(25) To clone each of these targeting sequences into the DR274 vector [PMID: 23360964], two primers are ordered for each targeting sequence and annealed together. These primers include some sequence from the constant portion of the gRNA or the flanking T7 promoter to facilitate cloning, and are as follows:

(26) TABLE-US-00002 5HLA-A-TS1F 5′-TAGG GAAAAGAACAGTTACGTAGC-3 5HLA-A-TS1R 5′-AAAC GCTACGTAACTGTTCTTTTC-3 5HLA-A-TS2F 5′-TAGG TTGAAAGCAGCAGAATTCTT-3 5HLA-A-TS2R 5′-AAAC AAGAATTCTGCTGCTTTCAA-3 3HLA-A-TS1F 5′-TAGG ATTCCTTATATTCACCCCCA-3 3HLA-A-TS1R 5′-AAAC TGGGGGTGAATATAAGGAAT-3 3HLA-A-TS2F 5′-TAGG TCTATCAACAAATTGCTAGG-3 3HLA-A-TS2R 5′-AAAC CCTAGCAATTTGTTGATAGA-3

(27) Cloning of gRNA encoding oligonucleotides into a vector with a T7 promoter. The plasmid vector DR274 is cut with BsaI, purified on an agarose gel, and the cleaned up using a Qiagen gel purification kit. 100 uM of each gRNA encoding oligonucleotide is annealed to its complement in the following reaction:

(28) TABLE-US-00003 ddH20 6 ul 10X ligation buffer 4 ul each oligo 5 ul total 20 ul
This reaction is heated at 100° C. for 3-5 min. After, the heat block is turned off and allowed to cool. The annealed oligonucleotides are then phosphorylated using the following reaction:

(29) TABLE-US-00004 Annealed oligo 1 ul 10x ligation buffer 1 ul T4 polynucleotide kinase 1 ul(10 unit) ddH20 7 ul Total 10 ul
This reaction is mixed by gentle vortexing and incubated at 37° C. for 30 min. Next, the annealed, phosphorylated, oligonucleotides are ligated into the plasmid encoding the T7 promoter using the following reaction:

(30) TABLE-US-00005 DR274 plasmid digested with Bsa1 1 ul T4 DNA ligase 1 ul 10x T4 Ligation buffer 2 ul ddH20 16 ul Total 30 ul

(31) At 15° C. overnight, or room temperature 2 hours.

(32) Next, 1 ul of the plasmid mix is transformed into E. coli, and plated on rich media (LB) agar plates supplemented with ampicillin. Amp′ clones are selected, and plasmids containing desired guide RNA sequences are verified by colony PCR and Sanger sequencing. The correct clones are grown in 1 ml LB+amp liquid medium, overnight at 37° C. and plasmids are isolated from the cultures using a Qiagen DNA purification kit.

(33) PCR amplification of gRNAs from plasmid template. To create the gRNAs from the plasmid template, the T7 promoter and gRNA region of the plasmid are amplified by PCR and then used as a template in an in vitro transcription reaction. The PCR primers are as follows: forward 4989 GTTGGAACCTCTTACGTGCC (SEQ ID NO: 30)

(34) rev 5008 AAAAGCACCGACTCGGTG (SEQ ID NO: 31). The PCR reaction is set up as follows:

(35) TABLE-US-00006 Final amount/ Component Amount (per reaction) concentration Phusion HF buffer 5 μl 0.5 x Phusion GC buffer 5 μl 0.5   10 mM dNTP 1 μl 0.2 mM of each forward 4989 25 μM 1 μl 0.5 μM rev 5008 25 μM 1 μl 0.5 μM gRNA encoding Plasmid 1 μl 50 ng digested with Dra1 Phusion DNA Polymerase 0.5 μl 1 units ddH2O 35.5 μl TOTAL volume 50 μl
This reaction is cycled as follows: 98° C. 30 s 1 cycle, (98° C., 10 s, 60° C. 30 s, 72° C. 30 s×35 cycles), 72° C. 5 min, 4° C. indefinitely.
This PCR will yield a 369 bp PCR fragment which is then purified with Qiagen column.

(36) RNA synthesis reaction using Mmessage Mmachine T7 in vitro transcription kit (AMBION CAT #1344). To create gRNA from the DNA fragment, an in vitro transcription reaction is performed as follows:

(37) TABLE-US-00007 10 x reaction buffer 2 ul 2x NTP/CAP 10 ul PCR product 150 ng Enzyme mix 2 ul Add H.sub.20 to 20 ul Incubate 4 hr at 37° C.
To recover the RNA, add 0.5 ul of Turbo DNAse (2 units/ul) and incubate 15 minutes at 37° C. Then add 30 ul of 50 mM EDTA pH 8.0. Heat to 80° C. for 15 minute to kill DNAse and recover the RNA using BIO-RAD Micro-Bio-spin Columns (cat #732-6250). Equilibrate the micro Bio-Spin P30 column in TE by filling with 500 ul of TE and spin 2 minutes at 1000 g. Then load 50 ul of sample onto column, spin 4 minutes at 1000 g. The sample will elute in ˜50 ul. The gRNA should be at a concentration of approximately ˜200 ng/ul for a total yield ˜10 ug of RNA.

(38) In vitro reconstitution of custom functional Cas9-gRNA complexes. To form active gRNA-Cas9 complexes, mix 2.5 ul of cas9 protein (3.18 ug/ul, New England Biolabs cat #M0386M (20 uM cas9 protein)) with 10 ul of RNA (2000 ng) in a total of 80 ul of 1×NEB buffer 4 (New England Biolabs, 50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Mg-acetate, 1 mM DTT, pH 7.9). Pre-incubate at 37 for 15 minutes. The concentration of reconstituted cas9 is 0.63 uM (0.1 ug/ul).

Example 2. Targeted Excision and Recovery of Long DNA Fragments from the Human HLA Locus Using the Inventive Electrophoretic Method

(39) This example uses the preparative electrophoresis system described in the '833 PCT, an example of which is also shown in FIG. 2, right. A schematic workflow for this example is shown in FIGS. 3A-E, where only the separation gel and the elution modules are shown, for reasons of simplicity of illustration. An inventive cassette containing a 0.75% agarose in 0.5×KBB buffer (51 mM Tris (base), 29 mM TAPS (acid), 0.1 mM EDTA (acid), pH 8.7) is used. The total volumes of the reagent and sample wells were 350 and 90 ul, respectively.

(40) Preparation of Human WBCs from whole blood by selective lysis of the RBCs. All steps are performed at room temperature. To 12 mL whole blood (ACD anticoagulant) add 36 mL Red Blood Cell (RBC) lysis buffer (155 mM ammonium chloride; 10 mM NaHCO.sub.3; 1 mM Na.sub.2EDTA) was added. The solution was rocked for 3 minutes and white cells pelleted by centrifugation 400×g for 4 minutes. The pink supernatant was decanted, and the red pellet resuspended by vortexing in 25 mL of RBC lysis buffer. After a second spin and decantation, the pink pellet was resuspended in 900 uL RBC lysis buffer.

(41) Measurement of WBC DNA concentration by Qubit. A Qubit HS assay (Life Technologies) was used. WBCs were lysed by mixing 40 uL of WBCs with 160 uL of TE/50 mM NaCl/1% SDS, followed by incubation at 65° C. for 3 minutes. TE (800 uL) was added, and after vortexing to reduce viscosity, 1 or 2.5 uL of the DNA was added to 199 uL of Qubit reagent, per the vendor's protocol.

(42) Targeted recovery of HLA fragments by custom-gRNA-Cas9 reagents and preparative electrophoresis. Purified WBCs (containing 10-12 ug of genomic DNA) were loaded into the empty sample well of the cassette in RBC lysis buffer. Total volume of the loaded sample was 80 ul. Lysis buffer (10 mM Tris-HCl, pH7.5, 1 mM EDTA, 3% SDS, 5% glycerol, 50 ug/mL each bromophenol blue and phenol red), 320 ul, was added to the empty reagent well. See FIG. 3A.

(43) Cell lysis and DNA purification was carried out by electrophoresis in a SageELF instrument (Sage Science, Inc.) using the separation electrodes at 100V for 40 minutes. See FIG. 3B.

(44) After purification electrophoresis, the reagent and sample wells were emptied. The reagent well was reloaded with 320 ul of 1×NEB buffer 4. The sample well was reloaded with 80 ul of 1×NEB buffer #4 containing the reconstituted custom Cas9-gRNA reagent mixture described in Example 1 at a concentration of 5 pM (total concentration of Cas9 protein) in a total volume of 80 ul. The cassette was incubated at 37 C for 60 minutes to allow cleavage of the HLA target sites within the immobilized genomic DNA. See FIG. 3C.

(45) After cleavage, the reagent and sample wells were emptied, the reagent well was refilled with 320 ul 0.5×KBB+3% sodium sarcosyl. The sample well was filled with 80 ul of the same buffer, additionally containing 200 ug/ml proteinase K. The cassette was incubated at 37 C for 30 minutes to allow digestion of the Cas9 protein reagent (see FIG. 3D).

(46) After digestion, the cassette was electrophoresed in a SageELF instrument in separation mode using a program of 60V continuous field for 1 hour. See FIG. 3E.

(47) After separation electrophoresis, electroelution is carried out in the ELF instrument for 45 minutes using a voltage of 50V. At the end of elution, a 25V field is applied in the reverse direction for 5 seconds to help release the eluted DNA from the ultrafiltration membrane of the elution modules. The targeted fragments can be removed from the elution modules in electrophoresis buffer by manual or automated liquid handling means (Elution and recovery from elution modules not shown in FIGS. 3A-E).

Example 3: Custom gRNA-Cas9 Constructions for Targeted Isolation of Human Protein Coding Sequences (Exon Isolation)

(48) Guide RNA design. We designed/configured gRNAs for cleaving all human exons (along with some flanking non-exon sequence on each side of the exon) into fragments 200-500 bp in length. gRNAs are picked by examining all 20 bp DNA sequences that are immediately 5′ of an NGG site and then pairs that flank exons are chosen from this set. For exons longer than 500 base pairs, gRNAs are also configured internal to the exon so that the exon sequences are cut into 2 or more fragments less than 500 base pairs in length. gRNAs that have an exact match, or a 1 or 2 bp mismatch at an off-target genome site are discarded.

(49) Massively Parallel Oligonucleotide Synthesis and Amplification. A library of gRNA encoding nucleotides was ordered from Custom Array (Bothell, Wash., USA). The format is

(50) TABLE-US-00008 5′CGCTCGCACCGCTAGCTAATACGACTCACTATAGGNNNNNNNNN NNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTT,
where the “N”'s represents the targeting sequence, and the underlined sequence is the T7 promoter. This library is amplified by performing PCR with the following primers:

(51) TABLE-US-00009 forward: 5′CGCTCGCACCGCTAGCTAATACGACT-3, and reverse 5′AAAAAGCACCGACTCGGTGCCACTTTT-3′.
The PCR product is expected to be 134 bp and is gel purified.

(52) Production of gRNA by in vitro transcription using Mmessage Mmachine T7 (AMBION CAT #1344). To create gRNA from the DNA fragment, an in vitro translation reaction is performed as follows:

(53) TABLE-US-00010 10 x reaction buffer 2 ul 2x NTP/CAP 10 ul Amplified library product 150 ng Enzyme mix 2 ul Add H.sub.20 to 20 ul Incubate 4 hr at 37° C.

(54) To recover the RNA, add 0.5 ul of Turbo DNAse (2 units/ul) and incubate 15 minutes at 37° C. Then add 30 ul of 50 mM EDTA pH 8.0. Heat to 80° C. for 15 minute to kill DNAse and recover the RNA using BIO-RAD Micro-Bio-spin Columns (CAT #732-6250). Equilibrate the micro Bio-Spin P30 column in TE by filling with 500 ul of TE and spin 2 minutes at 1000 g. Then load 50 ul of sample onto column, spin 4 minutes at 1000 g. The sample will elute in ˜50 ul. The gRNA library should be at a concentration of approximately ˜200 ng/ul for a total yield ˜10 ug of RNA.

(55) In vitro reconstitution of custom functional Cas9-gRNA complexes. To cleave genomic DNA, mix 2.5 ul of cas9 protein (3.18 ug/ul, New England Biolabs cat #M0386M (20 uM cas9 protein)) with 10 ul of RNA (2000 ng) in a total of 80 ul of 1×NEB buffer 4 (New England Biolabs, 50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Mg-acetate, 1 mM DTT, pH 7.9). Pre-incubate at 37 for 15 minutes. The concentration of reconstituted cas9 is 0.63 uM (0.1 ug/ul).

(56) Targeted excision and purification of exon-containing gDNA by preparative electrophoresis. Purification of total genomic DNA from human WBC's was carried out as described in Example 2. Targeted excision was also carried out as described in Example 2 with the two exceptions: (1) The cleavage step utilized a higher concentration of reconstituted gRNA-Cas9 complexes: 80 ul of reconstituted gRNA-Cas9 complexes at a concentration of 0.63 uM, reflecting the 20,000-fold higher number of cleavages needed to excise all exon-containing DNA, relative to the 8 sites used for the HLA-A case in Example 2. (2) The preparative gel cassette utilized a 2% agarose gel (instead of the 0.75% gel used for example 2), for better size resolution of the expected 200-500 bp targets.

Example 4—Characterization of Translocation Breakpoints by Targeted Genomic DNA Sequencing

(57) Cytogenetic studies led to the discovery that specific chromosome rearrangements were associated with human tumors. The first reproducible chromosome abnormality in a specific human cancer was the Philadelphia chromosome associated with chronic myelogenous leukemia. Later molecular studies showed that this rearrangement led to a fusion protein that consisted of c-abl, the homologue of the v-abl oncogene and a gene called bcr (breakpoint cluster region). This bcr-abl fusion protein is oncogenic and is the target of the highly successful therapeutic called Gleevec.

(58) There are now hundreds if not thousands of chromosomal translocations associated with various tumors. A common site of chromosome breakage occurs within the gene encoding anaplastic lymphoma kinase (ALK) that resides on chromosome 2p23. It is translocated to a variety of different chromosomes in many different tumors PMID: 23814043. However, it is most commonly rearranged in a subset of non-Hodgkin lymphomas, where a translocation involving ALK and the nucleophosmin (NPM1) gene on chromosome 5q35 is observed PMID: 25869285. This translocation allows the formation of a NPM1-ALK fusion gene that is the target of the therapeutic crizotinib [PMID: 24491302]. The precise site of breakage in these translocations can be variable and therefore difficult to detect by conventional NGS. The ability to obtain a large DNA fragment containing the rearranged locus for sequence analysis would reduce the need for laborious cytogenetic assays.

(59) Oligonucleotides encoding gRNAs to cut long fragments encompassing the NPM1-ALK translocation. To isolate this fragment, DNA oligonucleotides encoding gRNAs are configured to cut 5′ of the NPM1 gene on chromosome 5q35 and 3′ to the ALK gene on chromosome 2p23. In cells with the NPM1-ALK t(2;5) translocation, these gRNAs will direct Cas9 to cut a large fragment containing the rearranged junction. Two or more gRNAs can be targeted to each end to insure cutting at the designated region and excision of the NPM1-ALK containing fragment.

(60) Short oligonucleotides encoding the targeting sequence are cloned into the DR274 vector [PMID: 23360964] that encodes the constant region of the gRNA downstream of the T7 promoter. After in vitro transcription, gRNAs with the following sequence are produced: After in vitro transcription, gRNAs with the following sequence are produced:

(61) TABLE-US-00011 5′ ggNNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCA AGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCG AGTCGGTGCTTTTT,
where the “N”'s represent the gRNA targeting sequence, and the 5′ g's are required for T7 transcription.

(62) In this example, we use the following targeting sequences:

(63) For gRNAs 5′ side of NPM1:

(64) NPM1-TS1

(65) 5′ CAAGTCACCCGCTTTCTTTC 3′ (SEQ ID NO: 18), which is just upstream of a AGG PAM sequence and resides at chr5:171,387,031-171,387,050, which is approximately 900 bp upstream of the start of the NPM1 coding sequence (chr5: 171,387,949), and is about 4750 bp upstream of the start of 910 bp-long NPM1 intron 5 (chr5: 171,391,799), where many NPM1-ALK breakpoints occur.
NPM1-TS2
5′GACTTTGGAGATGTTTTCTC3′ (SEQ ID NO: 19) which is just upstream of an AGG PAM and resides at chr5:171,387,185-171,387,204, which is approximately 750 bp upstream of the start of the NPM1 coding sequence, and ˜4600 bp upstream of the start of NPM1 intron 5.
For gRNA's on the 3′ side of ALK:
ALK-TS1
5′-GAAGAAAACATGGCACAAAT-3′ (SEQ ID NO: 20) which is just upstream of a GGG PAM and resides at chr2: 29,190,272-29,190,291, which is 2930 bp downstream (3′) from the end of the ALK coding sequence (chr2: 29,193,225), and 33240 bp downstream (3′) from the end of the 1940-bp-long ALK intron 19, where many NPM1-ALK breakpoints occur.
ALK-TS2
5′-CAATGGGTCAGATAACTCAA-3′ (SEQ ID NO: 21) which is just upstream of a GGG PAM and resides at chr2: 29,190,518-29,190,537, which is ˜2700 bp downstream (3′) from the end of the ALK coding sequence.

(66) FIG. 4, shows a schematic diagram of the targeting sites, the relevant coding regions, and some common breakpoints giving rise to the NPM1-ALK fusion rearrangement (Morris, et al., (1994) Science 263:1281; Duyster, et al, (2001) Oncogene 20:5623).

(67) Taking into consideration the possible variation in fragment size due the alternative gRNA target sites on either end of the fusion, and also the variation in the position of translocation breakpoints within the 910 bp NPM1 intron 5 and 1940 bp ALK intron 19, digestion of NMP1-ALK fusion genes with the custom gRNA-Cas9 complexes described above should produce fragments between 37.5 kb and 40.8 kb in length.

(68) To clone each of these targeting sequences into the DR274 vector two primers are ordered for each targeting sequence and annealed together. These primers include some sequence from the constant portion of the gRNA or the flanking T7 promoter to facilitate cloning, and are as follows:

(69) TABLE-US-00012 NPM1-TS1F 5′-TAGGCAAGTCACCCGCTTTCTTTC-3 NPM1-TS1R 5′-AAACGAAAGAAAGCGGGTGACTTG-3 NPM1-TS2F 5′-TAGGACTTTGGAGATGTTTTCTC-3 NPM1-TS2R 5′-AAACGAGAAAACATCTCCAAAGT-3 ALK-TS1F 5′-TAGGAGGGGCGCCCAATTTTGTCT-3 ALK-TS1R 5′-AAACAGACAAAATTGGGCGCCCCT-3 ALK-TS2F 5′-TAGGTCTATCAACAAATTGCTAGGAGG-3 ALK-TS2R 5′-AAAC CCTAGCAATTTGTTGATAGA-3

(70) Cloning of gRNA encoding oligonucleotides into a vector with a T7 promoter. The plasmid vector DR274 [ref] is cut with BsaI, purified on an agarose gel, and the cleaned up using a Qiagen gel purification kit. 100 uM of each gRNA encoding oligonucleotide is annealed to its complement in the following reaction:

(71) TABLE-US-00013 ddH20 6 ul 10X ligation buffer 4 ul each oligo 5 ul total 20 ul
This reaction is heated at 100° C. for 3-5 min. After, the heat block is turned off and allowed to cool. The annealed oligonucleotides are then phosphorylated using the following reaction:

(72) TABLE-US-00014 Annealed oligo 1 ul 10x ligation buffer 1 ul T4 polynucleotide kinase 1 ul(10 unit) ddH20 7 ul Total 10 ul
This reaction is mixed by gentle vortexing and incubated at 37° C. for 30 min.

(73) Next, the annealed, phosphorylated, oligonucleotides are ligated into the plasmid encoding the T7 promoter using the following reaction:

(74) TABLE-US-00015 DR274 plasmid digested with Bsa1 1 ul T4 DNA ligase 1 ul 10x T4 Ligation buffer 2 ul ddH20 16 ul Total 30 ul

(75) At 15° C. overnight, or room temperature 2 hours.

(76) Next, 1 ul of the plasmid mix is transformed into E. coli, and plated on rich media (LB) agar plates supplemented with ampicillin. Amp.sup.r clones are selected, and plasmids containing desired guide RNA sequences are verified by colony PCR and Sanger sequencing. The correct clones are grown in 1 ml LB+amp liquid medium, overnight at 37° C. and plasmids are isolated from the cultures using a Qiagen DNA purification kit.

(77) PCR amplification of gRNAs from plasmid template. To create the gRNAs from the plasmid template, the T7 promoter and gRNA region of the plasmid are amplified by PCR and then used as a template in an in vitro transcription reaction. The PCR primers are as follows: forward 4989 GTTGGAACCTCTTACGTGCC (SEQ ID NO: 30), rev 5008 AAAAGCACCGACTCGGTG (SEQ ID NO: 31). The PCR reaction is set up as follows:

(78) TABLE-US-00016 Final amount/ Component Amount (per reaction) concentration Phusion HF buffer 5 μl 0.5 x Phusion GC buffer 5 μl 0.5   10 mM dNTP 1 μl 0.2 mM of each forward 4989 25 μM 1 μl 0.5 μM rev 5008 25 μM 1 μl 0.5 μM gRNA encoding Plasmid 1 μl 50 ng digested with Dra1 Phusion DNA Polymerase 0.5 μl 1 units ddH2O 35.5 μl TOTAL volume 50 μl
This reaction is cycled as follows: 98° C. 30 s 1 cycle, (98° C., 10 s, 60° C. 30 s, 72° C. 30 s×35 cycles), 72° C. 5 min, 4° C. indefinitely. This PCR will yield a 369 bp PCR fragment which is then purified with Qiagen column.

(79) RNA synthesis reaction using Mmessage Mmachine T7 in vitro transcription kit (AMBION CAT #1344). To create gRNA from the DNA fragment, an in vitro transcription reaction is performed as follows:

(80) TABLE-US-00017 10 x reaction buffer 2 ul 2x NTP/CAP 10 ul PCR product 150 ng Enzyme mix 2 ul Add H.sub.20 to 20 ul Incubate 4 hr at 37° C.

(81) To recover the RNA, add 0.5 ul of Turbo DNAse (2 units/ul) and incubate 15 minutes at 37° C. Then add 30 ul of 50 mM EDTA pH 8.0. Heat to 80° C. for 15 minute to kill DNAse and recover the RNA using BIO-RAD Micro-Bio-spin Columns (caT #732-6250). Equilibrate the micro Bio-Spin P30 column in TE by filling with 500 ul of TE and spin 2 minutes at 1000 g. Then load 50 ul of sample onto column, spin 4 minutes at 1000 g. The sample will elute in ˜50 ul. The gRNA should be at a concentration of approximately ˜200 ng/ul for a total yield ˜10 ug of RNA.

(82) In vitro reconstitution of custom functional Cas9-gRNA complexes. To form active gRNA-Cas9 complexes, mix 2.5 ul of cas9 protein (3.18 ug/ul, New England Biolabs cat #M0386M (20 uM cas9 protein)) with 10 ul of RNA (2000 ng) in a total of 80 ul of 1×NEB buffer 4 (New England Biolabs, 50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Mg-acetate, 1 mM DTT, pH 7.9). Pre-incubate at 37 for 15 minutes. The concentration of reconstituted cas9 is 0.63 uM (0.1 ug/ul).

(83) Targeted excision and purification of genomic NPM1-ALK fusion fragments by preparative electrophoresis. Purification of total genomic DNA from human WBC's was carried out as described in Example 2. Targeted excision using the NPM1-ALK translocation-specific Cas9 targeting complexes were also carried out as described in Example 2.

(84) After digestion, the cassette was electrophoresed in a SageELF instrument in separation mode using a program of 60V continuous field for 1 hour, followed by a 2 hour period of pulsed-field electrophoresis at 80V using the waveform for resolving 5-430 kb DNA described in the Pippin Pulse User Manual (http://www.sagescience.com/product-support/pippin-pulse-support/).

(85) After separation electrophoresis, electroelution is carried out in the ELF instrument for 45 minutes using a voltage of 50V. At the end of elution, a 25V field is applied in the reverse direction for 5 seconds to help release the eluted DNA from the ultrafiltration membrane of the elution modules. The targeted fragments can be removed from the elution modules in electrophoresis buffer by manual or automated liquid handling means (Elution and recovery from elution modules not shown in FIGS. 3A-E).

(86) Any and all references to publications or other documents, including but not limited to, patents, patent applications, articles, webpages, books, etc., presented anywhere in the present application, are herein incorporated by reference in their entirety.

(87) As noted elsewhere, the disclosed embodiments have been presented for illustrative purposes only and are not limiting. Other embodiments are possible and are covered by the disclosure, which will be apparent from the teachings contained herein. Thus, the breadth and scope of the disclosure should not be limited by any of the above-described embodiments but should be defined only in accordance with claims supported by the present disclosure and their equivalents. Moreover, embodiments of the subject disclosure may include methods, compositions, systems and apparatuses/devices which may further include any and all elements from any other disclosed methods, compositions, systems, and devices, including any and all elements corresponding to isolating nucleic acid from a biological sample (e.g., containing nucleic acid and non-nucleic acid elements). In other words, elements from one or another disclosed embodiments may be interchangeable with elements from other disclosed embodiments. Moreover, some further embodiments may be realized by combining one and/or another feature disclosed herein with methods, compositions, systems and devices, and one or more features thereof, disclosed in materials incorporated by reference. In addition, one or more features/elements of disclosed embodiments may be removed and still result in patentable subject matter (and thus, resulting in yet more embodiments of the subject disclosure). Furthermore, some embodiments correspond to methods, compositions, systems, and devices which specifically lack one and/or another element, structure, and/or steps (as applicable), as compared to teachings of the prior art, and therefore represent patentable subject matter and are distinguishable therefrom (i.e. claims directed to such embodiments may contain negative limitations to note the lack of one or more features prior art teachings).

(88) When describing the nucleic acid processing, terms such as linked, bound, connect, attach, interact, and so forth should be understood as referring to linkages that result in the joining of the elements being referred to, whether such joining is permanent or potentially reversible. These terms should not be read as requiring the formation of covalent bonds, although covalent-type bond might be formed.

(89) All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms.

(90) The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.”

(91) The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.

(92) As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of” “only one of” or “exactly one of” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law.

(93) As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.

(94) In the claims, as well as in the specification above, all transitional phrases such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases “consisting of” and “consisting essentially of” shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.