COMPOSITIONS AND METHODS FOR THE QUALITY CONTROL OF STEM CELL PREPARATIONS
20190241958 ยท 2019-08-08
Inventors
Cpc classification
C12Q2547/00
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods and compositions for assessing the quality and potential of stem cells in a sample. Such methods and compositions are useful for helping to ensure the safety and quality of a population of stem cells before it is used in a subject.
Claims
1. A method of assessing the quality of stem cells in a sample, comprising: a. measuring the expression level of at least one RNA in the sample; b. comparing the expression level of at the at least one RNA to a reference standard; and c. using the comparison to determine the quality of stem cells in the sample.
2. The method of claim 1, wherein the method comprises determining the quantity of unproductive stem cells in the sample.
3. The method of claim 2, wherein the unproductive stem cells are not self-renewing.
4. The method of claim 1, wherein the sample comprises human stem cells.
5. The method of claim 1, wherein the sample comprises mesenchymal stem cells.
6. (canceled)
7. The method of claim 1, wherein the sample comprises adipose tissue.
8-10. (canceled)
11. The method of claim 1, wherein the sample comprises mesodermal tissue differentiated from induced pluripotent stem cells.
12. The method of claim 1, wherein the sample comprises bone marrow-derived stem cells.
13. (canceled)
14. The method of claim 1, wherein the RNA comprises a coding RNA.
15. The method of claim 1, wherein the RNA comprises a non-coding RNA (ncRNA).
16. The method of claim 15, wherein the ncRNA is a microRNA (miRNA).
17. (canceled)
18. The method of claim 2, wherein an increase in the expression level of the RNA compared to the reference standard is correlated with an increase in the quantity of unproductive stem cells in the sample.
19-21. (canceled)
22. The method of claim 18, wherein the RNA is miRNA.
23. (canceled)
24. The method of claim 22, wherein the miRNA is selected from the group consisting of mir-125b1, mir-let7a-2, mir-100, mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1, mir-3619, mir-let7a-3, mir-4763, and mir-let-7b.
25-28. (canceled)
29. A kit for assessing the quality of stem cells in a sample, comprising reagents for measuring the expression level of at least one RNA in the sample.
30. The kit of claim 29, wherein the kit further comprises reagents for separating unproductive stem cells from the sample.
31. The kit of claim 29, wherein the wherein the reagents are for measuring the expression level of at least one coding RNA in the sample.
32. The kit of claim 29, wherein the wherein the reagents are for measuring the expression level of at least one non-coding RNA (ncRNA) in the sample.
33. The kit of claim 29, wherein the reagents are for measuring the expression level of at least one microRNA (miRNA) in the sample.
34. The kit of claim 33, wherein the miRNA is selected from the group consisting of mir-125b1, mir-let7a-2, mir-100, mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1, mir-3619, mir-let7a-3, mir-4763, and mir-let-7b.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
DETAILED DESCRIPTION OF THE INVENTION
[0023] Provided are methods and compositions for assessing the quality and potential of stem cells in a sample. Such methods and compositions are useful for helping to ensure the safety and quality of a population of stem cells before it is used in a subject.
Samples and Stem Cells
[0024] Methods and compositions to assess the quality of stem cells are applicable to samples comprising stem cells, of any origin, from any mammalian organism.
[0025] The quality assessment may be carried out on any type of sample. For example, blood or tissue samples are representative of samples which could require a quality assessment prior to downstream use.
[0026] In some embodiments, the sample being assessed for quality comprises blood, for example prior to a transfusion or extraction of stem cells. In some embodiments, the sample comprises bone marrow cells, and the resident bone marrow stromal stem cells are assessed for quality. In some embodiments, the sample comprises pericytes.
[0027] In some embodiments, the sample being assessed for quality comprises a tissue. Such tissue may require assessment prior to a procedure, for example, prior to transplantation, implantation or graft. The tissue can be from any region or organ of the body. in an exemplary embodiment, the tissue comprises an adipose tissue for transplantation. In a particular example, the sample comprises a stromal vascular fraction from an adipose tissue. In some embodiments, the sample comprises differentiated tissue which requires assessment prior to downstream use. For example, the sample may comprise mesodermal tissue differentiated from induced pluripotent stem cells.
[0028] The quality assessment may also be carried out on a sample of cell or tissue culture media, comprising stem cells. The quality of the stem cells may indicate the need to change or replenish the media.
[0029] These samples discussed above may comprise any type of mammalian stem cell, and accordingly, a wide variety of stem cells can be assessed for quality. In some embodiments, the sample comprises human stem cells. In some embodiments, the sample comprises non-human primate stem cells. In some embodiments, the sample comprises canine stem cells. In some embodiments, the sample comprises feline stem cells. In some embodiments, the sample comprises rodent stem cells. In some embodiments, the sample comprises murine stem cells. In some embodiments, the sample comprises bovine stem cells.
[0030] The sample can comprise any type of stem cell, of any origin. In some embodiments, the sample comprises mesenchymal stem cells. In some embodiments, the sample comprises adipose-derived stem cells. In some embodiments, the sample comprises adipose-derived mesenchymal stem cells. In some embodiments, the sample comprises bone marrow-derived stem cells. In some embodiments, the sample comprises bone marrow-derived mesenchymal stem cells. In some embodiments, the sample comprises cancer stem cells.
Stem Cell Quality
[0031] Provided herein are methods and compositions for assessing the quality of stem cells in a sample. In some embodiments the assessing comprises determining the quantity of productive and/or unproductive stem cells in the sample.
[0032] Productive stem cells are those that meet a certain threshold for quality and safety. Productive stem cells exhibit one or more of the following features associated with being productive: express a set of coding or non-coding RNAs indicative of quality; are self-renewing; are not senescent; are not nearing senescence; have been passaged 6 times or less; exhibit high growth potential; produce proteins of interest; allow for long-term tissue regeneration; induce long-term correction of a disease; exhibit no or only a low chance of immortalization; exhibit no or low tumorigenic potential; and contain few or no proviral integrations. In an exemplary embodiment, productive stem cells are self-renewing. In some embodiments, productive stem cells exhibit at least two, three, four, five, or more of the features associated with being productive.
[0033] In contrast, unproductive stem cells are those that do not meet a certain threshold for quality and safety. Unproductive stem cells exhibit one or more of the following features associated with being unproductive: express a set of coding or non-coding RNAs indicative of their low quality; are not or are minimally self-renewing; are senescent or are nearing senescence; have been passaged greater than 6 times; exhibit low or no growth potential; do not or only minimally produce proteins of interest; do not or only minimally allow for long-term tissue regeneration; do not or only minimally induce long-term correction of a disease; exhibit tumorigenic potential; or contain proviral integrations. In an exemplary embodiment, unproductive stem cells are not self-renewing. In some embodiments, unproductive stem cells exhibit at least two, three, four, five, or more of the features associated with being unproductive.
Methods and RNAs of the Invention
[0034] Provided herein are methods for assessing the quality of stem cells in a sample, for example in vitro or ex vivo. In some embodiments, the method comprises: (a) measuring the expression level of at least one RNA in the sample; (b) comparing the expression level of at the at least one RNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample. In some embodiments the assessing comprises determining the quantity of productive and/or unproductive stem cells in the sample.
[0035] In some embodiments, an increase in the expression level of the RNA compared to the reference standard is correlated with an increase in the quality of the stem cells in the sample and the quantity of productive stem cells in the sample. In specific embodiments, the expression level of the RNA is increased by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or at least 100-fold.
[0036] In some embodiments, a decrease in the expression level of the RNA compared to the reference standard is correlated with an increase in the quality of the stem cells in the sample and the quantity of productive stem cells in the sample. In specific embodiments, the expression level of the RNA is decreased by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or at least 100-fold.
[0037] In some embodiments, an increase in the expression level of the RNA compared to the reference standard is correlated with a decrease in the quality of the stem cells in the sample and the quantity of unproductive stem cells in the sample. In specific embodiments, the expression level of the RNA is increased by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or at least 100-fold.
[0038] In some embodiments, a decrease in the expression level of the RNA compared to the reference standard is correlated with a decrease in the quality of the stem cells in the sample and the quantity of unproductive stem cells in the sample. In specific embodiments, the expression level of the RNA is increased by at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or at least 100-fold.
[0039] The measurement of the expression level of the RNA in the sample can be carried out by any means known to those skill in the art, including, but not limited to, qPCR, Northern Blot, RNA-sequencing, and in situ-hybridization.
[0040] In some embodiments of the invention, the method for assessing the quality of stem cells in a sample comprises: (a) measuring the expression level of at least one coding RNA (a RNA molecule that can be translated into a protein) in the sample; (b) comparing the expression level of at the at least one coding RNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample. In some embodiments, the expression of the coding RNA is upregulated in unproductive stem cells or senescent stem cells. In some embodiments, the expression of the coding RNA is downregulated in unproductive stem cells or senescent stem cells. In particular embodiments, RNA encoding SUZ12, NAP1L1, SMARCD2, SAP18, IGF2BP3, CHD2, CHDR4, SMARCA1, CHD8, HDAC3, HDAC5, HDAC9 or USP6/TRE17 protein is downregulated in unproductive stem cells or senescent stem cells. In one exemplary embodiment, RNA encoding a NAP1L1 protein is downregulated in unproductive stem cells or senescent stem cells. In another exemplary embodiment, RNA encoding a SMARCD2protein is downregulated in unproductive stem cells or senescent stem cells. In another exemplary embodiment, RNA encoding a USP6/TRE17 protein is downregulated in unproductive stem cells or senescent stem cells.
[0041] In some embodiments of the invention, the method for assessing the quality of stem cells in a sample comprises: (a) measuring the expression level of at least one non-coding RNA (ncRNA; a RNA molecule that is not translated into a protein) in the sample; (b) comparing the expression level of at the at least one ncRNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample. Non coding RNAs of the invention, include but are not limited to microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), long non-coding RNA (IncRNA), enhancer RNA (eRNA), and promoter-associated RNA (PAR). In some embodiments, the expression of the ncRNA is upregulated in unproductive stem cells or senescent stem cells. In some embodiments, the expression of the ncRNA is downregulated in unproductive stem cells or senescent stem cells.
[0042] In some embodiments, the method for assessing the quality of stem cells in a sample comprises measuring the expression level of at least one microRNA (miRNA). miRNAs are single-stranded RNA molecules, and are a type of ncRiNA. miRNA is not translate into protein, but can regulate the expression of one or more genes. Typically, miRNAs target particular mRNAs, or groups of mRNAs, thereby preventing their translation (translational repression), or inducing their degradation (mRNA cleavage) or by inducing deadenylation. In particular embodiments of the invention, the method for assessing the quality of stem cells in a sample comprises: (a) measuring the expression level of at least one miRNA in the sample; (b) comparing the expression level of at the at least one miRNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample. In some embodiments, the miRNA is a senescence-associated microRNA (SA-miRNA).
[0043] In the embodiments where the expression level of a miRNA, compared to the reference standard, is correlated with the quality of the stem cells, the miRNA may be transcribed from a chromosome locus that is an oncogenic locus. Alternatively, the miRNA may be transcribed from a chromosome locus that a tumor-suppressive locus. In specific embodiments, the miRNA is transcribed from the chr11:MIR100HG locus, the chr13:MIR17HG locus, or the chr221:MIRLET7BHG locus of the human chromosome.
[0044] In some embodiments, the expression level of a miRNA is increased in unproductive stem cells or senescent stem cells. In such embodiments, the miRNA may be selected from the group consisting of mir-125b1, mir-let7a-2, mir-100, mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1, mir-3619, mir-let7a-3, mir-4763, and mir-let-7b. Alternatively, in some embodiments, the expression level of a miRNA. is decreased in unproductive stern cells or senescent stem cells.
[0045] During miRNA biogenesis, miRNA is initially double stranded, comprising a guide strand and a passenger strand. In some embodiments of the invention presented herein, whether or not a stem cell is marked as productive or unproductive may be associated with a shift in a miRNA's maturation equilibrium between its guide and passenger strands. Thus, in some embodiments of the invention, the method for assessing the quality of stem cells in a sample comprises: (a) measuring the expression level of at least one non-coding miRNA in the sample; (b) assessing if there is a shift in the miRNA's maturation equilibrium between its guide and passenger strands, as compared to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample.
[0046] Thus, as provided herein, a cell marked as unproductive or senescent may be associated with the increased expression of the mature guide strand of a miRNA, with the increased expression of the mature passenger strand of a miRNA, with the decreased expression of the mature guide strand of a miRNA, or with the decreased expression of the mature passenger strand of a miRNA.
[0047] Additionally, as provided herein, the self renewing capacity of a cell may be associated with the increased expression of the mature guide strand of a miRNA, with the increased expression of the mature passenger strand of a miRNA, with the decreased expression of the mature guide strand of a miRNA, or with the decreased expression of the mature passenger strand of a miRNA.
[0048] In some embodiments of the invention, the method for assessing the quality of stem cells in a sample comprises: (a) measuring the expression level of at least one ncRNA in the sample, and measuring at least one coding RNA in the sample; (b) comparing the expression level of at the at least one ncRNA and the at least one coding RNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample. Thus in some embodiments, the expression levels of both coding and ncRNA are measured.
[0049] In an exemplary embodiment, senescence of human adipose derived stem cells correlates with an upregulation of the subset of mature miRNAs from the MIR100HG and MIR17HG cluster. In another exemplary embodiment, senescence of human adipose derived stem cells correlates with a shift in the equilibrium between guide and passenger strands for mir-let7a-2 (
[0050] In the methods provided herein, the expression level of the least one RNA is compared to a reference standard. The reference standard may be coding RNA profiles or ncRNA (e.g. miRNA) profiles from an isolated cell, cell derived from a cell culture, cell line, or stored cell preparation. The reference standard may comprise profiles derived from single cell types, or a plurality of different cell types. Generally, the reference standard is obtained from a cell or cells exhibiting known characteristics, which meet a certain predetermined quality. For example the reference standard may be a self renewing cell, or a population of self renewing cells. Or, the reference standard may be a unproductive or senescent cell, or a population of unproductive or senescent cells.
Applications
[0051] Stem cells exhibit consistent self-renewing (SR) but, upon approaching replicative senescence (SEN), exhibit one or more of the following features associated with being unproductive: express a set of coding or non-coding RNAs indicative of their low quality; are not or are minimally self-renewing; are senescent or are nearing senescence; have been passaged greater than 6 times; exhibit low or no growth potential; do not or only minimally produce proteins of interest; do not or only minimally allow for long-term tissue regeneration; do not or only minimally induce long-term correction of a disease; exhibit tumorigenic potential; or contain proviral integrations. Unproductive and senescent cells would likely not be productive, and could be detrimental if used in stem cell-based therapies. Thus provided herein are methods and compositions that would be useful for helping to ensure the safety and quality of a population of stem cells before it is used in a subject.
[0052] In ensuring the safety and quality of a population of stem cells, the method and compositions provided herein find many clinical applications. Such application include, but are not limited to (1) helping to evaluate the therapeutic potential of stem cells for various clinical applications;(2) screening a population of stem cells prior to bio-banking those stem cells for future uses; (3) assessing the rate of cellular senescence in the stem cells, prior to use in clinical applications, for example for regenerative cell therapies; (4) estimating the yield of viable stem cells from donor tissue; (5) assessing the microenvironment, cell culture media conditions or tissue culture media conditions that can yield sufficient number of productive stem cells; and (6) assessing the rate of cellular senescence in the stem cells for clinical applications and estimate yielding of viable stem cells from donor tissue to procure clinical benefits.
[0053] In some embodiments, the method further comprises separating the unproductive stem cells from a sample, for example prior to bio-banking or treatment of a subject. For example, unproductive stem cells can be FACs sorted from productive stem cells, by using magnetic beads technology, differential attachment assays, visual morphological inspections, or differential migration assays.
[0054] In some embodiments, a sample comprising stem cells is enriched or purified for productive stem cells by sorting productive cells from unproductive cells, or by sorting self renewing stem cells from senescent stem cells. In some embodiments, a sample is enriched or purified such that 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% cells in the sample are the type being selected for. In some cases, the cell population is enriched 2, 3, 4, 5, 6, 7, 8, 9, 10 or more (or any range derivable therein).
[0055] In specific embodiments, purifying or enriching comprises incubating a P-galactosidase substrate with cells and selecting for -galactosidase activity. In some cases, -galactosidase activity is detectable upon cleavage of the -galactosidase substrate by galactosidase. A label or other detectable moiety may be employed for evaluating whether a cell is entering into senescence or for sorting, separating, or selecting senescent cells and non-senescent cells. In particular embodiments, -galactosidase activity is detectable by fluorescence. In some cases, a substrate of -galactosidase is employed and the enzymatic product is detectable, such as by fluorescence.
[0056] In some embodiments unproductive/senescent or productive/self-renewing cells in a sample can be visualized. Visualization can be achieved, for example by in situ hybridization, using labeled probes targeted to specific RNAs, for example labeled probes targeted to miRNAs of interest.
[0057] In some embodiments, the method further comprises discarding the sample if greater than 10% of the cells in the sample comprise unproductive or senescent stem cells. In related embodiments, the method further comprises discarding the sample if greater than 15%, greater than 20%, greater than 25%, greater than 30%, greater than 35%, greater than 40%, greater than 45%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70%, greater than 75%, greater than 80%, greater than 85% of the cells in the sample comprise unproductive or senescent stem cells.
Identification of Candidate RNAs
[0058] Presented herein are methods and compositions that aid in the identification of candidate coding RNAs or non coding RNAs (ncRNAs) useful for determining the quality of stem cells in a sample. In connection with the invention, upon identification of candidate coding RNAs or ncRNAs and subsequent validation of the same, the quality of stem cells in a sample may be assessed, comprising (a) measuring the expression level of at least one RNA in the sample; (b) comparing the expression level of at the at least one RNA to a reference standard; and (c) using the comparison to determine the quality of stem cells in the sample.
[0059] Analysis of expression levels, to differentiate between productive and unproductive cells, or to differentiate between self-renewing (SR) and senescent (SEN) cells, may be carried out using any technique familiar to those with skill in the art. For example, methods involving proteomic analysis, transcriptome analysis, and/or RNA-sequencing (RNA-seq) may be utilized to characterize differential RNA expression levels between unproductive and productive cells, or between SR and SEND cells.
[0060] One exemplary approach to carry out the analysis of differential gene expression levels between SR and SEN cells comprises employing a combination of two-parameters in order to define differential expression levels between genes: 1) the difference in the number reads per kilobase per million mapped reads (dRPKM) and 2) the expression fold-change (FC) level. This approach controls for liabilities of each individual metric; in particular, dRPKM is biased towards highly expressed genes, whereas FC is biased towards lowly expressed genes. In this approach, dRPKM can be defined as: RPKM.sub.SRRPKM.sub.SEN, and FC can be defined as: log.sub.2 RPKM.sub.SR/RPKM.sub.SEN. For each locus, dRPKM and FC are plotted as a point in two-dimensional Euclidean space, and the Euclidean Distance (D) between the origin and the point is taken to represent the differential expression level. This approach can be used separately to evaluate the differential expression of mRNAs and non-coding RNAs, including miRNAs, which are typically expressed at lower levels. In some embodiments, for non-coding RNAs, differentially expressed genes are considered as those with |FC|>0.95 and |dRPKM|>4.07, and for mRNAs differentially expressed genes are considered as those with |FC|>0.58 and |dRPKM|>2.32.
[0061] The set of genes that characterized as both targets of SEN upregulated miRNAs and found to be downregulated in SEN stem cells can be further analyzed for functional relevance. Proteins from annotation categories of interestcell cycle, chromatin, transcription/translation and histone methyltransferasescan be selected for functional enrichment analysis using a network-based approach.
Kits
[0062] The present application also provides kits for assessing the quality of stern cells in a sample and determining the quantity of unproductive stem cells in a sample. In some embodiments, the kits comprise reagents for measuring the expression level of at least one RNA in the sample. In some embodiments, the kits comprise reagents for measuring the expression level of at least one coding RNA in the sample. In some embodiments, the kits comprise reagents for measuring the expression level of at least one ncRNA in the sample. In some embodiments, the kits comprise reagents for measuring the expression level of both at least one coding RNA and at least one ncRNA in the sample. In some embodiments, the kit comprises reagents for assessing the expression level of a miRNA selected from the group consisting of mir-125b1, mir-let7a-2, mir-100, mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1, mir-92a-1, mir-3619, mir-let7a-3, mir-4763, and mir-let-7b, In some embodiments, the kit further comprises reagents for separating unproductive stem cells from the sample.
[0063] The present application also provides articles of manufacture comprising any one of the compositions or kits described herein.
[0064] It is to be understood that the terminology employed herein is used for the purpose of describing particular embodiments only and is not intended to be limiting since the scope of the present invention will be limited only by the appended claims and equivalents thereof. The following examples are for illustrative purposes. These are intended to show certain aspects and embodiments of the present invention but are not intended to limit the invention in any manner.
EXAMPLES
Example 1: Replicative Senescence of Human Adult Adipose-Derived Stem Cells is Associated with Changes in Expression
[0065] This example shows differential gene expression in SR and SEN cells.
Isolation and Culture of hADSCs
[0066] Human adipose derived stem cells (hADSCs) were isolated from human subcutaneous white adipose tissue collected during liposuction procedures. The lipoaspirate was suspended in Hank's Buffered Salt Solution (HBSS, Life technology), 3.5% Bovine Serum Albumin (BSA, Sigma), 1% Collagenase Type II (Sigma) in 1:3 w/v ratio and shaken at 37 C. for 50 min. The cells were filtered through a 70 m mesh cell strainer (BD Falcon #352350), treated with Red Blood Cell Lysis buffer (150 mM NH4Cl, 10 mM KHCO.sub.3, 0.1 mM EDTA, pH 7.3), and expanded ex vivo in DMEM/F12 complete medium (DMEM/F12, 10% FBS, 100 U/ml penicillin, 100 g/ml streptomycin; Life technology) in 10% CO.sub.2 at 37 C. and passaged at 80% confluency, changing medium every 72-96 h. Cumulative population doublings were calculated by summing the population doublings (PD=log.sub.(N,N0)3.33. where N0 is the number of cells plated in the flask and N is the number of cells harvested at this passage) across multiple passages as a function of the number of days it was grown in culture.
Senescence-Associated Beta-Galactosidase (SA -gal) Staining
[0067] The SA-gal activity assay was performed according to manufacturer's instructions (BioVision). The cells were washed with PBS and fixed with fixation solution for 15 min at room temperature. The cells were washed with PBS twice and X-gal staining solution was added with a staining supplement per well and incubated overnight at 37 C. The cells were washed twice with PBS, and the images were captured using a microscope (Nikon, TE300, DXM1200 Digital Camera, Japan).
[0068] As depicted in
Surface Marker Characterization
[0069] Surface CD antigen markers of SEN hADSCs were characterized. 510.sup.5 cells each were incubated for 30 min on ice in the dark with fluorochrome-conjugated antibodies (CD31, CD44, CD45 and CD105; Invitrogen) in PBS with 1% BSA (Sigma), washed and analyzed in a Guava EasyCyte Mini System (Guava Technologies, Millipore). Data analysis was done with FlowJo software (Tree Star, Ashland, Oreg.). CD antigen marker characterization revealed that SEN hADSCs express stromal markers CD29, CD44, CD73, CD90, CD 105 while staying negative for hematopoietic lineage markers CD31, CD34 and CD45 (Zuk, Zhu et al. 2002), indicating phenotypical stability of SEN hADSCs (Table 1,
TABLE-US-00001 TABLE 1 Immunostability of hADSCs in SR and SEN States Expression Chromosome Gene SR SEN Negative Markers 16 CD 11b 5 CD 14 17 CD 31 1 CD 34 1 CD 45 1 CD 106 4 ABC G2 3 CD 10 + + 2 CD 49d + + Stromal Markers 15 CD 13 ++ ++ 10 CD 29 ++ ++ 11 CD 44 ++ ++ 6 CD 73 ++ ++ 11 CD 90 ++ ++ 9 CD 105 + ++ 3 CD 166 ++ ++
[0070]
Proteomic Analysis
[0071] Sample Preparation: Pellets from approximately 10.sup.8 cells were lysed in 0.4 ml of lysis buffer (8M Gu-HCl+DTT). Samples were subsequently alkylated with 45 mM Iodoacetic acid (500 mM stock concentration in 1 M Ammonium Bicarbonate) in the dark fort h at room temperature. Residual alkylation agent was then reacted with 15 mM DTT. Samples were then diluted with 25 mM Tris-HCl 5 mM CaCl.sub.2 to 2.5 mL and added to a glass vial of trypsin (Pierce, 20 g, in 250 l of 25 mM acetic acid). Samples were allowed to digest for 20 hrs at room temperature. Samples were quenched with formic acid and introduced into the mass spectrometer.
[0072] Liquid Chromatography and High-Resolution Mass Spectrometry: Stem cell samples were prepared as described above and 1 g was injected on to a Thermo Scientific Easy nLC system configured with a 10 cm100 pm trap column and a 25 cm100 m ID resolving column. Buffer A was 98% water, 2% methanol, and 0.2% formic acid. Buffer B was 10% water, 10% isopropanol, 80% acetonitrile, and 0.2% formic acid. Samples were loaded at 4 L/rain for 10 min, and a gradient from 0-45% B at 375 nL/min was run over 130 min, for a total run time of 150 min (including regeneration and sample loading). The Thermo Scientific LTQ Orbitrap Velos mass spectrometer was run in a standard Top-10 data-dependent configuration except that a higher trigger-threshold (20 K) was used to ensure that the MS2 did not interfere with the full-scan duty cycle. This ensured optimal fill-scan data for quantification. MS2 fragmentation and analysis were performed in the ion trap mass analyzer. Samples were run in triplicate.
[0073] MS Data Analysis: Protein identification was performed using Thermo Scientific Proteome Discoverer version 1.4 (including Sequest and Percolator algorithms) using the RefSeqHuman sequence database. The Percolator peptide confidence filter was set to high. Protein quantification was performed using Pinpoint version 1.4 software. The Pinpoint quantification workflow included importing the Proteome Discoverer .msf files as spectral libraries. Identified peptides were subsequently quantified in MS .raw files using the Pinpoint peak finding, chromatographic alignment and area calculation algorithms.
[0074] LC-MS/MS Proteome Expression Analysis: is shown in
[0075] where N is the total number of proteins from library j. Normalized protein expression levels for the three individual SR libraries and the three individual SEN libraries were compared using the Student's t test with a P-value cutoff of 0.05 to identify proteins that are differentially expressed between SR and SEN hADSCs.
[0076]
Transcriptome Analysis with RNA-seq
[0077] RNA-sequencing (RNA-seq) was carried out to further assess changes associated with replicative senescence via transcriptome analysis. Expression of MSC-positive and MSC-negative CD markers was assessed. Sequencing tracks were uploaded to the UCSC genome browser.
[0078] Characterization of further gene expression levels with RNA-seq was performed on single replicates of self-renewing (SR) and senescent (SEN) human adult adipose derived mesenchymal stem cells (hADSCs) using the Roche 454 pyrosequencing platform. Individual sequence reads were mapped to the human genome reference sequence (UCSC hg18, NCBI build 36.1) using the program BLAT (Kent 2002). BLAT was used in light of the relatively long sequence reads provided by 454 (avg=216 bp;
[0079]
[0080] Analysis of differential gene expression levels between SR and SEN cells was performed using an approach adopted from a recently developed method that was designed to be accurate at the relatively low sequencing depth provided by 454 and for single replicate experiments (Tarazona, Garcia-Alcalde et al. 2011). This approach employs a combination of two-parameters in order to define differential expression levels between genes: 1) the difference in the number reads per kilobase per million mapped reads (dRPKM) and 2) the expression fold-change (FC) level. This approach controls for liabilities of each individual metric; in particular, dRPKM is biased towards highly expressed genes, whereas FC is biased towards lowly expressed genes. In this approach, dRPKM is defined as: RPKM.sub.SRRPKM.sub.SEN, and FC is defined as: log.sub.2 RPKM.sub.SR/RPKM.sub.SEN. For each locus, dRPKM and FC are plotted as a point in two-dimensional Euclidean space, and the Euclidean Distance (D) between the origin and the point is taken to represent the differential expression level. This approach was used separately to evaluate the differential expression of mRNAs and non-coding RNAs, including miRNAs, which are typically expressed at lower levels. For each class of RNA, empirical distributions of Ed were evaluated to call genes as differentially expressed. For non-coding RNAs, differentially expressed genes are considered as those with |FC|>0.95 and |dRPKM|>4.07, and for mRNAs differentially expressed genes are considered as those with |FC|>0.58 and |dRPKM|>2.32 (
[0081]
[0082]
[0083] Comparative transcriptomic analysis (RNA-seq) between SR and SEN hADSCs revealed a number of ncRNAs that are upregulated in SEN compared to SR hADSCs. Differentially expressed ncRNAs are identified as those that have levels of fold change (log.sub.2 SEN/SR) and differences in the normalized number of reads (dRPKM SEN-SR) as shown in
[0084]
Example 2: DifferentialExpression of microRNAs upon Replicative Senescence of hADSCs
[0085] This example shows differential expression of microRNAs (miRNAs) upon SEN of hADSCs.
[0086] Upregulation of functionally antagonistic MIR17HG and MIR100HG miRNA-bearing loci upon senescence was further investigated. The human chromosome 13 MIR17HG cluster (800 bp) encodes six tightly grouped miRNAs with four distinct seed sequences (Khorshid, Hausser et al. 2013, Hausser and Zavolan 2014): mir-17, mir-18a, mir-19a, mir-20a, mir-19b1, and mir-92a1 (schematically shown in
[0087] miRNAs are frequently transcribed together as polycistronic primary transcripts that are processed into multiple individual mature miRNAs (Stefani and Slack 2008). To identify specific microRNA production from these clusters in SEN hADSCs, the abundance of mature miRNAs originating from both guide strand (mir-5p) and passenger strand (mir-3p/ mir*) by the MystiCq microRNA qPCR Assay System was examined, as described below.
RT-PCR
[0088] The microRNA was isolated using a mirPremier microRNA isolation kit (Sigma-Aldrich). microRNA was quantified with a NanoDrop ND-2000 Spectrophotometer (Thermo Scientific). For miRNA cDNA synthesis, the Mystic microRNA cDNA synthesis Mix kit (Sigma-Aldrich) was used. All microRNA assay primers were bought from Sigma-Aldrich.
Real-Time Quantitative PCR
[0089] Quantification of microRNA expression for candidate genes was performed by real-time quantitative PCR (qRT-PCR) using the LightCycler 480 Real-Time PCR System (Roche). microRNA was reverse transcribed by using the Mystic microRNA cDNA synthesis Mix kit (Sigma-Aldrich). All microRNA assay primers were bought from Sigma-Aldrich. qRT-PCR reactions were performed with the mystic microRNA SYBR green qPCR ReadyMix in a MicroAmp optical 96-well reaction plate. The PCR amplification of microRNA was performed in a LightCycler 480 Real-Time PCR System (Roche) using the following program: Cycle 1, 95 C. for 2 min. Cycle 2, 40 cycles of 95 C. for 5 sec, 60 C. for 30 sec. Relative expression values of microRNA were obtained by normalizing CT values of the microRNA genes in comparison with CT values of the endogenous control (U6) using the CT method.
[0090] Analysis of the MIR17HG cluster has revealed that only mature guide strand miRNAs: mir-17-5p, mir-18a-5p, mir-20a-5p, mir-19b1-5p and mir-92a1-5p, are detected in both SR and SEN hADSCs (
[0091] The MIR100HG cluster gives rise to two guide strand mature miRNAs: mir-125b1-5p and mir-100-5p in SEN hADSCs. No mature passenger strands: mir-125b1-3p and mir-100-3p have been detected in the samples. Both guide mir-let7a-2-5p and passenger mir-let7a-2-3p have been detected in both SR and SEN conditions, where the balance in the stability/maturation preference of guide mir-let7a-2-5p is shifted upon SEN, favoring the production of passenger strand mir-let7a-2-3p (greater than 25-fold upregulation shown in
[0092] Together, these data provide evidence that senescence of hADSCs correlates with a upregulation of the subset of mature miRNAs from the MIR100HG and MIR17HG clusters, and for some of them, such as mir-let7a-2, a notable shift in the maturation equilibrium between guide and passenger strands of microRNA has been observed. These abundantly upregulated mature miRNAs are called herein: senescence-associated micro RNAs (SA-miRNAs).
[0093] ). The meanSD from three independent experiments is shown. The statistical difference was evaluated by Student's t-test and P-value (p) related to experimental measurements and are listed under the graphs, where ***p<0.001, * *p<0.01.
) The meanSD from three independent experiments is shown. The statistical difference was evaluated by Student's t-test and P-values (p) related to experimental measurements are listed under the graphs, where ***p<0.001.
[0094] ). MeanSD from three independent experiments is shown. The statistical difference was evaluated by Student's 1-test and P-values (p) related to experimental measurements are listed under the graphs, where ***p<0.001.
Example 3: Identification of the Targets of SA-microRNAs
[0095] This example characterizes the downstream gene targets of senescence associated miRNAs, using a combination of transcriptome and proteome analysis.
[0096] Despite the availability of miRNA target prediction algorithms, it still remains a challenge to accurately predict the potential target genes of a given miRNA. A number of these prediction algorithms use sequence, contextual, structural and/or evolutionary constraints and rely on subsequent validation of the targets by large scale mRNA expression level assessment (Sethupathy, Megraw et al. 2006). However, transcriptional analysis of miRNA target genes does not fully reveal the extent to which miRNAs can exert control on protein expression levels, which have a tendency to change more dramatically than mRNA levels (Liu 2008, Selbach, Schwanhausser et al. 2008, Hausser and Zavolan 2014).
[0097] Thus, an integrated approach is taken here, as illustrated in
[0098] To relate SA-miRNAs to the downregulation of their target genes at the level of mRNA and/or protein expression, the analysis has been focused on SEN downregulated mRNAs and proteins. SEN downregulated mRNAs are characterized as those that have low levels of fold change (log.sub.2 SEN/SR) and the smallest values for the difference in the normalized number of reads (dRPKM SEN-SR), There are a total of 937 SEN downregulated mRNAs that have been identified in this way (shown in the lower left quadrant of
[0099] Having identified SEN downregulated mRNAs and proteins in this way, the mirSVR prediction algorithm was applied to search for potential target genes of SA-miRNAs (
[0100] Collectively, the SA-miRNA target genes captured by this approach represent numerous biological pathways (
Example 4: Validity and Sensitivity of the integrated Transcriptome and Proteome Approach for the Identification of SA-miRNA Target Genes
[0101] This example further characterizes and validates the identified downstream gene targets of senescence associated miRNAs.
[0102] To verify the validity and sensitivity of the integrated approach for the identification of SA-miRNA target genes, gene expression of two previously established targets of mature mir-100 from the MIR100HG locus, the HOXA1 and SMARCA5 genes was evaluated (Sun, Lee et al. 2011, Chen, Sun et al. 2014). mir-100 directly targets these genes in mammary epithelial cells, imposing epithelial-to-mesenchymal transition (EMT) through downregulation of their expression (see
Example 5: Destabilization of mRNA and Translational Repression Through SA-miRNAs upon Senescence of hADSCs
[0103] This example details the downstream mRNA and protein downregulation in SEN hADSCs.
[0104] The transcriptome analysis revealed 389 downregulated. mRNA representing senescence-associated degradation targets of SA-miRNAs in hADSCs (
[0105] Table 2 provides a list of mRNA targets downregulated in SEN hADSCs through miRNAs.
TABLE-US-00002 TABLE 2 mRNA Targets Downregulated in SEN Through miRNAs Gene Symbol RefSeq ID mirSVR Score SR SEN dRPKM FC D mir-17-5p (MIMAT0000070) TFPI2 NM_006528 0.25 528.90 225.72 303.17 1.23 8.34 IL8 NM_000584 1.18 89.60 8.90 80.69 3.33 7.16 INHBA NM_002192 0.36 282.13 177.25 104.88 0.67 6.75 UPF3A NM_023011 0.31 18.45 1.27 17.18 3.86 5.63 CD36 NM_001127443 0.28 47.21 11.74 35.47 2.01 5.53 MMP1 NM_002421 0.33 69.30 31.02 38.28 1.16 5.38 RPA2 NM_002946 0.64 16.56 1.76 14.79 3.23 5.05 GMPS NM_003875 0.29 13.70 1.24 12.47 3.47 5.03 STC1 NM_003155 1.12 39.40 13.31 26.09 1.57 4.96 ACTL6A NM_004301 0.29 23.69 4.90 18.79 2.27 4.80 DCTN3 NM_024348 0.48 19.61 3.29 16.33 2.58 4.78 LANCL1 NM_001136574 0.63 8.61 0.67 7.93 3.68 4.74 PARP3 NM_001003931 0.44 12.09 1.29 10.80 3.23 4.71 F3 NM_001993 1.18 11.90 1.27 10.63 3.23 4.70 DCBLD2 NM_080927 0.58 63.32 39.36 23.96 0.69 4.63 TPRG1L NM_182752 1.03 35.20 16.26 18.95 1.11 4.39 FBXO28 NM_001136115 0.50 6.41 0.58 5.83 3.47 4.30 URGCP NM_001077663 0.31 7.87 0.84 7.03 3.23 4.28 SLC25A44 NM_014655 0.23 7.84 0.84 7.01 3.23 4.28 FBXO28 NM_015176 0.58 6.18 0.56 5.62 3.47 4.27 MAF1 NM_032272 0.35 18.96 5.13 13.83 1.89 4.23 SQSTM1 NM_003900 0.98 27.66 11.51 16.15 1.27 4.21 M6PR NM_002355 0.85 9.08 1.18 7.90 2.94 4.19 SAR18 NM_016103 1.28 14.67 3.25 11.41 2.17 4.13 ZBTB4 NM_020899 1.05 12.64 2.55 10.08 2.31 4.05 UFD1L NM_001035247 0.98 10.48 1.75 8.72 2.58 4.05 SLC35AS NM_017945 0.76 7.93 1.03 6.89 2.94 4.05 RAD238 NM_002874 0.76 30.48 15.32 15.17 0.99 4.05 MITD1 NM_138798 0.20 14.23 3.34 10.89 2.09 4.03 UFD1L NM_005659 0.99 10.16 1.70 8.46 2.58 4.02 PTP4A1 NM_003463 0.46 20.89 7.77 13.12 1.43 3.98 RRM2 NM_001034 0.73 7.13 0.93 6.21 2.94 3.95 SERPIN88 NM_002640 0.55 6.91 0.90 6.01 2.94 3.92 SLC16A7 NM_004731 0.51 6.58 0.86 5.72 2.94 3.87 GPR1378 NM_003272 0.76 8.88 1.49 7.39 2.58 3.87 MKRN1 NM_013446 1.08 12.33 2.89 9.44 2.09 3.85 NR8P1 NM_013392 0.76 34.15 20.71 13.44 0.72 3.82 PFKP NM_002627 1.29 30.21 17.14 13.07 0.82 3.80 CYTS8 NM_001033553 0.65 5.90 0.77 5.13 2.94 3.77 LSM5 NM_012322 0.42 8.06 1.35 6.71 2.58 3.77 FAM103A1 NM_031452 0.89 11.30 2.65 8.65 2.09 3.75 TPP1 NM_000391 0.68 10.99 2.58 8.42 2.09 3.72 GTDC1 NM_001006636 1.08 6.73 1.13 5.60 2.58 3.58 SLC39A6 NM_012319 0.94 23.60 12.58 11.02 0.91 3.58 ELK3 NM_005230 1.22 13.24 4.23 9.01 1.64 3.57 MYO10 NM_012334 0.28 16.54 6.64 9.90 1.32 3.56 VPS45 NM_007259 0.40 6.43 1.08 5.36 2.58 3.54 PURA NM_005859 1.02 14.18 5.16 9.02 1.46 3.49 MRPL24 NM_145729 1.24 19.55 9.82 9.73 0.99 3.43 MGAT2 NM_002408 0.21 14.33 5.60 8.73 1.36 3.41 ACIN1 NM_014977 0.21 14.16 5.53 8.63 1.36 3.39 TXNIP NM_006472 1.27 27.42 17.63 9.79 0.64 3.35 COMMD10 NM_016144 0.30 20.00 10.66 9.34 0.91 3.35 C1orf9 NM_014283 1.12 9.61 2.68 6.93 1.84 3.35 CCNDBP1 NM_012142 0.34 9.22 2.49 6.73 1.89 3.33 UBE2B NM_003337 0.93 10.83 3.46 7.36 1.64 3.32 NTN4 NM_021229 1.22 23.64 14.28 9.36 0.73 3.31 RSU1 NM_012425 0.21 15.87 7.28 8.59 1.12 3.30 CENPQ NM_018132 1.27 7.49 1.76 5.74 2.09 3.28 SLC35F5 NM_025181 1.02 22.73 13.86 8.87 0.71 3.23 ABR NM_021962 0.34 9.37 2.89 6.48 1.70 3.18 RAB21 NM_014999 0.43 18.73 10.40 8.33 0.85 3.17 TBP NM_003194 0.24 6.80 1.59 5.20 2.09 3.17 GNPDA2 NM_138335 1.25 6.75 1.58 5.17 2.09 3.16 CDCA4 NM_145701 0.22 6.72 1.58 5.14 2.09 3.16 ABTB1 NM_172027 0.27 11.79 4.61 7.18 1.36 3.15 AKTIP NM_022476 0.47 17.71 9.69 8.02 0.87 3.13 YIPF2 NM_024029 0.25 22.38 14.13 8.25 0.66 3.12 MAGT1 NM_032121 0.29 16.10 8.30 7.79 0.95 3.11 GOLGB1 NM_004487 0.34 12.27 5.16 7.11 1.25 3.09 SFRS4 NM_005626 0.24 13.30 6.00 7.30 1.15 3.09 TIPARP NM_015508 0.40 12.20 5.27 6.93 1.21 3.04 CEP120 NM_153223 1.19 7.14 1.93 5.21 1.89 3.04 CHD9 NM_025134 1.00 7.91 2.38 5.52 1.73 3.01 KDSR NM_002035 0.29 10.46 4.09 6.37 1.36 3.00 ATMIN NM_015251 0.60 9.05 3.12 5.93 1.54 2.99 ZFP91 NM_053023 0.61 11.31 4.77 6.53 1.24 2.98 LIN7B NM_022165 1.10 10.29 4.02 6.27 1.36 2.97 UBE3C NM_014671 0.54 14.49 7.62 6.88 0.93 2.93 ACBD5 NM_145698 0.71 9.75 3.81 5.94 1.36 2.91 NAP1L1 NM_004537 0.25 20.71 13.62 7.09 0.60 2.89 NBL1 NM_182744 0.35 13.82 7.36 6.45 0.91 2.84 FGL2 NM_006682 0.77 18.81 12.09 6.71 0.64 2.82 RAB11FIP5 NM_015470 1.13 12.52 6.29 6.23 0.99 2.82 VPS26A NM_001035260 0.69 9.11 3.56 5.55 1.36 2.82 RBL2 NM_005611 1.08 10.07 4.35 5.72 1.21 2.79 PDZD11 NM_016484 1.15 18.70 12.18 6.52 0.62 2.77 SSFA2 NM_006751 0.80 12.51 6.45 6.06 0.95 2.77 NFAT5 NM_138713 0.21 9.93 4.34 5.59 1.20 2.76 VPS26A NM_004896 0.71 8.63 3.37 5.26 1.36 2.75 SSFA2 NM_001130445 0.77 12.23 6.31 5.92 0.95 2.74 CRK NM_005206 0.90 12.79 6.82 5.97 0.91 2.73 DPM2 NM_003863 0.26 11.72 5.89 5.83 0.99 2.73 PPP2R5E NM_006246 1.19 10.00 4.51 5.49 1.15 2.71 ARL1 NM_001177 0.90 18.55 12.29 6.26 0.59 2.71 ATP2B1 NM_001682 0.50 10.31 4.93 5.39 1.07 2.65 CRK NM_016823 0.93 11.88 6.33 5.55 0.91 2.63 ATP2B1 NM_001001323 0.44 10.08 4.82 5.27 1.07 2.62 MGLL NM_001003794 0.24 16.69 10.87 5.82 0.62 2.61 DYNC1U2 NM_006141 1.14 16.12 10.50 5.62 0.62 2.57 RHOT1 NM_001033568 0.34 11.74 6.42 5.32 0.87 2.56 RTCD1 NM_001130841 0.43 10.85 5.78 5.07 0.91 2.51 DNM1L NM_012062 0.53 15.16 9.87 5.28 0.62 2.48 mir-18a-5p (MIMAT0000072) TSPYL2 NM_022117 0.30 665.60 381.06 284.54 0.80 8.19 HIST1H4H NM_003543 0.81 62.31 8.12 54.19 2.94 6.47 BCAR3 NM_003567 1.25 15.32 0.96 14.56 4.02 5.57 MSRB2 NM_012228 0.38 15.73 1.68 14.05 3.23 5.00 NDUFC2 NM_004549 0.75 26.15 6.13 20.02 2.09 4.80 F3 NM_001993 0.34 11.90 1.27 10.63 3.23 4.70 ELOVL1 NM_022821 0.72 36.66 14.33 22.34 1.36 4.68 PCYT1A NM_005017 0.79 21.26 5.75 15.51 1.89 4.38 EGLN2 NM_053046 0.35 10.38 1.35 9.03 2.94 4.33 FBXO28 NM_001136115 0.57 6.41 0.58 5.83 3.47 4.30 FBXO28 NM_015176 0.65 6.18 0.56 5.62 3.47 4.27 MEF2BNB NM_001145784 0.30 12.65 2.12 10.53 2.58 4.26 UQCRQ NM_014402 0.79 24.50 9.58 14.93 1.36 4.13 ZBTB4 NM_020899 1.16 12.64 2.55 10.08 2.31 4.05 B4GALT7 NM_007255 0.48 10.49 1.76 8.74 2.58 4.05 FZD8 NM_031866 0.47 7.31 0.95 6.36 2.94 3.97 PDGFC NM_016205 1.17 12.91 3.03 9.88 2.09 3.91 EPDR1 NM_017549 0.26 30.89 17.53 13.37 0.82 3.83 TPP1 NM_000391 0.41 10.99 2.58 8.42 2.09 3.72 COIL NM_004645 0.23 6.85 1.15 5.73 2.58 3.60 CA12 NM_001218 0.59 18.89 8.40 10.49 1.17 3.59 NT5C3L NM_052935 0.24 16.39 6.40 9.98 1.36 3.59 NAPIL1 NM_139207 0.21 23.85 12.96 10.89 0.86 3.56 PAPSS2 NM_001015860 0.99 20.80 10.23 10.58 1.02 3.55 AP3S1 NM_001284 1.26 22.10 11.77 10.32 0.91 3.49 ACIN1 NM_014977 0.24 14.16 5.53 8.63 1.36 3.39 SNX5 NM_014426 0.27 16.36 7.38 8.98 1.15 3.37 C1orf9 NM_014283 1.04 9.61 2.68 6.93 1.84 3.35 NAE1 NM_003905 1.34 12.85 5.02 7.83 1.36 3.26 TSC22D3 NM_198057 1.10 14.84 6.69 8.15 1.15 3.24 C9orf114 NM_016390 0.71 6.98 1.64 5.34 2.09 3.20 GNPDA2 NM_138335 0.87 6.75 1.58 5.17 2.09 3.16 DDX42 NM_203499 1.09 16.50 8.51 7.99 0.95 3.15 GCLC NM_001498 0.99 12.91 5.57 7.33 1.21 3.12 VPS4B NM_004869 0.33 11.50 4.49 7.00 1.36 3.12 SORBS3 NM_005775 0.31 9.12 2.92 6.20 1.64 3.10 DUSPS NM_004419 0.28 13.31 6.00 7.31 1.15 3.09 NDFIP1 NM_030571 0.90 15.12 7.60 7.52 0.99 3.08 NTSC2 NM_001134373 0.31 8.29 2.65 5.64 1.64 2.99 HSBP1L1 NM_001136180 0.30 10.34 4.04 6.30 1.36 2.98 ITGA2 NM_002203 0.63 11.52 5.01 6.50 1.20 2.96 MKI67IP NM_032390 0.27 19.37 12.23 7.14 0.66 2.91 PRKAR2A NM_004157 0.47 9.79 3.82 5.96 1.36 2.91 RBL2 NM_005611 0.61 10.07 4.35 5.72 1.21 2.79 SEL1L3 NM_015187 0.80 17.64 11.34 6.30 0.64 2.73 PPP2R5E NM_006246 0.32 10.00 4.51 5.49 1.15 2.71 ENDOD1 NM_015036 0.24 8.28 3.23 5.04 1.36 2.70 XPO6 NM_015171 0.35 14.64 8.92 5.71 0.71 2.61 mir-19a-3p (MIMAT0000073) IL8 NM_000584 0.46 89.60 8.90 80.69 3.33 7.16 IL33 NM_033439 0.59 35.40 1.12 34.28 4.98 7.13 NGFRAP1 NM_206915 0.66 34.92 3.15 31.77 3.47 6.08 NGFRAP1 NM_014380 0.65 31.96 3.41 28.56 3.23 5.82 UPF3A NM_023011 0.29 18.45 1.27 17.18 3.86 5.63 BCAR3 NM_003567 0.22 15.52 0.96 14.56 4.02 5.57 NDUFB2 NM_004546 0.43 68.00 30.66 37.34 1.15 5.35 RPS27L NM_015920 0.62 78.82 47.61 31.22 0.73 5.02 FAM129B NM_022833 1.14 87.20 56.11 31.09 0.64 5.00 PRKRA NM_003690 0.95 15.60 1.66 13.93 3.23 4.99 STAMBPL1 NM_020799 0.54 14.26 1.52 12.74 3.23 4.89 EMC7 NM_020154 0.53 46.72 20.18 26.54 1.21 4.88 ACTL6A NM_004301 0.52 23.69 4.50 18.79 2.27 4.80 RAP1B NM_001010942 1.15 55.53 30.38 25.15 0.87 4.73 PARP3 NM_001003931 0.78 12.09 1.29 10.80 3.23 4.71 F3 NM_001993 1.04 11.90 1.27 10.63 3.23 4.70 MEDAG NM_032849 1.18 53.08 29.21 23.87 0.86 4.66 DCBLD2 NM_080927 0.32 63.32 39.36 23.96 0.69 4.63 SLC31A2 NM_001860 1.22 13.14 1.71 11.42 2.94 4.58 CCNC NM_005190 0.41 19.08 3.95 15.13 2.27 4.53 WDR44 NM_019045 1.34 8.12 0.73 7.39 3.47 4.51 RALA NM_005402 0.42 35.93 16.20 19.73 1.15 4.45 TPRG1L NM_182752 0.55 35.20 16.26 18.95 1.11 4.39 POLE4 NM_019896 0.75 18.60 4.36 14.24 2.09 4.37 GNAQ NM_002072 0.27 17.69 4.15 13.54 2.09 4.30 SLC25A44 NM_014655 0.39 7.84 0.84 7.01 3.23 4.28 FBXO28 NM_015176 0.23 6.18 0.56 5.62 3.47 4.27 PPTC7 NM_139283 0.70 7.60 0.81 6.79 3.23 4.25 TSN NM_004622 0.68 17.48 4.45 13.02 1.97 4.20 FAM69A NM_001006605 0.96 8.97 1.17 7.80 2.94 4.17 COX6C NM_004374 0.84 25.30 9.89 15.41 1.36 4.17 ZBTB4 NM_020899 0.90 12.64 2.55 10.08 2.31 4.05 UFD1L NM_001035247 0.69 10.48 1.75 8.72 2.58 4.05 RAD23B NM_002874 0.90 30.48 15.32 15.17 0.99 4.05 UFD1L NM_005659 0.71 10.16 1.70 8.46 2.58 4.02 PTP4A1 NM_003463 0.21 20.89 7.77 13.12 1.43 3.98 C2orf76 NM_001017927 0.26 13.63 3.20 10.43 2.09 3.98 FZD8 NM_031866 0.64 7.31 0.95 6.36 2.94 3.97 KLHL12 NM_021633 0.74 6.98 0.91 6.07 2.94 3.93 POU4F1 NM_006237 0.78 11.54 2.39 9.15 2.27 3.92 BMPER NM_133468 0.73 6.86 0.89 5.96 2.94 3.91 GPR137B NM_003272 0.95 8.88 1.49 7.39 2.58 3.87 PIK3IP1 NM_001135911 0.63 14.06 3.80 10.26 1.89 3.85 RBM26 NM_022118 0.27 6.45 0.84 5.61 2.94 3.85 RPL27A NM_000990 0.20 21.76 9.33 12.43 1.22 3.83 NRBP1 NM_013392 0.96 34.15 20.71 13.44 0.72 3.82 PIK3IP1 NM_052880 0.67 13.61 3.68 9.93 1.89 3.81 REP15 NM_001029874 0.30 11.37 2.67 8.70 2.09 3.76 BMP6 NM_001718 1.04 22.51 10.75 11.76 1.07 3.71 TMEM167B NM_020141 0.55 12.24 3.31 8.93 1.89 3.68 SUPV3L1 NM_003171 0.43 7.33 1.23 6.10 2.58 3.67 RAB3B NM_002867 0.90 26.41 14.89 11.52 0.83 3.62 GNRH1 NM_001083111 0.28 10.11 2.37 7.74 2.09 3.62 VDAC3 NM_005662 0.20 30.78 19.10 11.68 0.69 3.61 GTDC1 NM_001006636 0.23 6.73 1.13 5.60 2.58 3.58 ELK3 NM_005230 1.08 13.24 4.23 9.01 1.64 3.57 NCBP2 NM_007362 0.61 13.12 4.20 8.93 1.64 3.56 NAP1L1 NM_139207 0.49 23.85 12.96 10.89 0.88 3.56 CCNA2 NM_001237 0.65 6.48 1.08 5.39 2.58 3.54 SDC1 NM_002997 1.15 18.60 8.53 10.07 1.12 3.52 PHLDA1 NM_007350 0.43 18.83 8.73 10.10 1.11 3.52 PURA NM_005859 1.19 14.18 5.16 9.02 1.46 3.49 RAB13 NM_002870 1.02 29.19 18.43 10.76 0.66 3.49 SAP18 NM_005870 0.51 12.38 3.96 8.42 1.64 3.49 PSMD9 NM_002813 0.31 12.16 3.89 8.27 1.64 3.46 MGAT2 NM_002408 0.39 14.33 5.60 8.73 1.36 3.41 BOLA3 NM_212552 0.37 14.02 5.48 8.54 1.36 3.38 TMEM106C NM_001143842 0.41 8.15 1.91 6.24 2.09 3.37 SNXS NM_014426 0.89 16.36 7.38 8.98 1.15 3.37 C1orf9 NM_014283 1.18 9.61 2.68 6.93 1.84 3.35 ANTXR2 NM_058172 0.40 17.71 8.68 9.03 1.03 3.34 UBE2O2 NM_003339 1.01 10.54 3.37 7.17 1.64 3.28 SEC14L1 NM_003003 0.66 7.07 1.66 5.41 2.09 3.21 ABR NM_021962 0.97 9.37 2.89 6.48 1.70 3.18 ATXN10 NM_013236 1.11 16.33 8.20 8.12 0.99 3.18 RAB21 NM_014999 0.45 18.73 10.40 8.33 0.85 3.17 TROVE2 NM_004600 0.88 11.98 4.68 7.30 1.36 3.17 UBE2V1 NM_001032288 0.43 18.21 9.96 8.25 0.87 3.17 NDFIP2 NM_019080 1.04 11.68 4.56 7.12 1.36 3.14 YTHDF2 NM_016258 1.11 9.31 2.98 6.33 1.64 3.13 AKTIP NM_022476 0.36 17.71 9.69 8.02 0.87 3.13 GCLC NM_001498 0.23 12.91 5.57 7.33 1.21 3.12 VPS4B NM_004869 1.18 11.50 4.49 7.00 1.36 3.12 GLRX5 NM_016417 1.06 15.48 7.78 7.70 0.99 3.11 SETD7 NM_030648 0.31 12.92 5.63 7.30 1.20 3.11 NDFIP1 NM_030571 1.10 15.12 7.60 7.52 0.99 3.08 SPRY2 NM_005842 0.27 11.04 4.32 6.73 1.36 3.07 UBA3 NM_003968 1.26 20.77 12.89 7.88 0.69 3.06 TIPARP NM_015508 1.06 12.20 5.27 6.93 1.21 3.04 INSIG1 NM_196337 1.01 12.38 5.58 6.80 1.15 2.99 ATMIN NM_015251 1.02 9.05 3.12 5.93 1.54 2.99 HNRNPF NM_001098206 1.10 22.48 14.90 7.58 0.59 2.98 ZFP91 NM_053023 0.65 11.31 4.77 6.53 1.24 2.98 ARL6IP1 NM_015161 0.76 10.29 4.02 6.27 1.36 2.98 ITGA2 NM_002203 0.84 11.52 5.01 6.50 1.20 2.96 ACBD5 NM_145698 1.14 9.75 3.81 5.94 1.36 2.91 NAPIL1 NM_004537 0.36 20.71 13.62 7.09 0.60 2.89 INSIG1 NM_005542 1.02 11.18 5.04 6.14 1.15 2.86 FMR1 NM_002024 1.10 12.33 6.18 6.13 0.99 2.80 UTRN NM_007124 0.22 11.04 5.13 5.91 1.11 2.79 PIP4K2B NM_003559 0.30 7.68 2.65 5.03 1.54 2.79 SECISBP2L NM_014701 0.70 11.40 5.61 5.80 1.02 2.73 TMEM189UBE2V1 NM_199203 0.43 13.31 7.28 6.03 0.87 2.73 SEL1L3 NM_015187 0.81 17.64 11.34 6.30 0.64 2.73 PPP2RSE NM_006246 1.23 10.00 4.51 5.49 1.15 2.71 IERSL NM_203434 0.24 16.24 10.06 6.16 0.69 2.71 CS NM_004077 0.76 13.05 7.14 5.91 0.87 2.71 DYNC1LI2 NM_006141 0.93 16.12 10.50 5.62 0.62 2.57 NECAP1 NM_015509 0.31 10.96 5.85 5.13 0.91 2.53 RTCD1 NM_001130841 0.29 10.85 5.78 5.07 0.91 2.51 RUFY1 NM_025158 0.52 10.85 5.78 5.07 0.91 2.51 DNM1L NM_012062 0.27 15.16 9.87 5.28 0.62 2.48 TNIP1 NM_006058 0.48 13.47 8.36 5.11 0.69 2.45 mir-20a-5p (MIMAT0000075) TFIP2 NM_006528 1.23 528.90 225.72 303.17 1.23 8.34 IL8 NM_000584 1.18 89.60 8.90 80.69 3.33 7.16 INHBA NM_002192 0.36 282.13 177.25 104.88 0.67 6.75 NGFRAP1 NM_014380 0.35 31.96 3.41 28.56 3.23 5.82 UPF3A NM_023011 0.31 18.45 1.27 17.18 3.86 5.63 CD36 NM_001127443 0.28 47.21 11.74 35.47 2.01 5.53 MMP1 NM_002421 0.31 69.30 31.02 38.28 1.16 5.38 RPA2 NM_002946 0.63 16.56 1.76 14.79 3.23 5.05 GMPS NM_003875 0.29 13.70 1.24 12.47 3.47 5.03 STC1 NM_003155 1.12 39.40 13.31 26.09 1.57 4.96 ACTL6A NM_004301 0.29 23.69 4.90 18.79 2.27 4.80 DCTN3 NM_024348 0.48 19.61 3.29 16.33 2.58 4.78 LANCL1 NM_001136574 0.63 2.61 0.67 7.93 3.68 4.74 PARP3 NM_001003931 0.43 12.09 1.29 10.80 3.23 4.71 F3 NM_001993 1.18 11.90 1.27 10.63 3.23 4.70 DCBLD2 NM_080927 0.58 63.32 39.36 23.96 0.69 4.63 TPRG1L NM_182752 1.02 35.20 16.26 18.95 1.11 4.39 NDUFA4 NM_002489 1.00 41.52 22.13 19.39 0.91 4.37 ADI1 NM_018269 0.42 20.08 5.43 14.65 1.89 4.31 FBXO28 NM_001136115 0.50 6.41 0.58 5.83 3.47 4.30 URGCP NM_001077663 0.31 7.87 0.84 7.03 3.23 4.28 SLC25A44 NM_014655 0.23 7.84 0.84 7.01 3.23 4.28 FBXO28 NM_015176 0.58 6.18 0.56 5.62 3.47 4.27 UBA6 NM_018227 0.35 15.66 3.30 12.37 2.25 4.27 MAF1 NM_032272 0.36 18.96 5.13 13.63 1.89 4.23 SQSTM1 NM_003900 0.98 27.66 11.51 16.15 1.27 4.21 M6PR NM_002355 0.85 9.08 1.18 7.90 2.94 4.19 SAR1B NM_016103 1.28 14.67 3.25 11.41 2.17 4.13 ZBTB4 NM_020899 1.05 12.64 2.55 10.08 2.31 4.05 UFD1L NM_001035247 0.98 10.48 1.75 8.72 2.58 4.05 SLC3SA5 NM_017945 0.75 7.93 1.03 6.89 2.94 4.05 RAD23B NM_002874 0.76 30.48 15.32 15.17 0.99 4.05 MITD1 NM_138798 0.20 14.23 3.34 10.89 2.09 4.03 UFD1L NM_005659 0.99 10.16 1.70 8.46 2.58 4.02 PTP4A1 NM_003463 0.46 20.89 7.77 13.12 1.43 3.98 RRM2 NM_001034 0.73 7.13 0.93 6.21 2.94 3.95 SERPINB8 NM_002640 0.52 6.91 0.90 6.01 2.94 3.92 SLC16A7 NM_004731 0.51 6.58 0.86 5.72 2.94 3.87 GPR137B NM_003272 0.76 8.88 1.49 7.39 2.58 3.87 ERRFI1 NM_018948 0.41 12.41 2.91 9.50 2.09 3.86 MKRN1 NM_013446 1.08 12.33 2.89 9.44 2.09 3.86 NRBP1 NM_013392 0.76 34.15 20.71 13.44 0.72 3.82 PFKP NM_002627 1.29 30.21 17.14 13.07 0.82 3.80 CYTSB NM_001033553 0.65 5.90 0.77 5.13 2.94 3.77 LSM5 NM_012322 0.42 8.06 1.35 6.71 2.58 3.77 LYRM5 NM_001001660 0.87 11.41 2.67 8.73 2.09 3.76 GTDC1 NM_001006636 1.08 6.73 1.13 5.60 2.58 3.58 SLC39A6 NM_012319 0.94 23.60 12.58 11.02 0.91 3.58 ELK3 NM_005230 1.22 13.24 4.23 9.01 1.64 3.57 MYO10 NM_012334 0.28 16.54 6.64 9.90 1.32 3.56 PURA NM_005859 1.02 14.18 5.16 9.02 1.46 3.49 TXNDC12 NM_015913 0.64 14.57 5.70 8.88 1.36 3.43 MRPL24 NM_145729 1.24 19.55 9.82 9.73 0.99 3.43 MGAT2 NM_002408 0.21 14.33 5.60 8.73 1.36 3.41 ACIN1 NM_014977 0.21 14.16 5.53 8.63 1.36 3.39 C4orf33 NM_001099783 0.81 8.15 1.91 6.24 2.09 3.37 TXNIP NM_006472 1.27 27.42 17.63 9.79 0.64 3.35 COMMD10 NM_016144 0.30 20.00 10.66 9.34 0.91 3.35 C1orf9 NM_014283 1.06 9.61 2.68 6.93 1.84 3.35 CCND8P1 NM_012142 0.34 9.22 2.49 6.73 1.89 3.33 UBE2B NM_003337 0.93 10.83 3.46 7.36 1.64 3.32 NTN4 NM_021229 1.21 23.64 14.28 9.36 0.73 3.31 RSU1 NM_012425 0.21 15.87 7.28 8.59 1.12 3.30 CENPQ NM_018132 1.27 7.49 1.76 5.74 2.09 3.28 COPG2 NM_012133 0.46 7.47 1.75 5.72 2.09 3.27 SLC35F5 NM_025181 1.02 22.73 13.86 8.87 0.71 3.23 ABR NM_021962 0.34 9.37 2.89 6.48 1.70 3.18 RAB21 NM_014999 0.43 18.73 10.40 8.33 0.85 3.17 TBP NM_003194 0.24 6.80 1.59 5.20 2.09 3.17 GNPDA2 NM_138335 1.25 6.75 1.58 5.17 2.09 3.16 CDCA4 NM_145701 0.22 6.72 1.58 5.14 2.09 3.16 ABTB1 NM_172027 0.27 11.79 4.61 7.18 1.36 3.15 HMGN4 NM_006353 0.78 6.58 1.54 5.04 2.09 3.13 AKTIP NM_022476 0.47 17.71 9.69 8.02 0.87 3.13 YIPF2 NM_024029 0.25 22.38 14.13 8.25 0.66 3.12 MAGT1 NM_032121 0.29 16.10 8.30 7.79 0.95 3.11 GOLGB1 NM_004487 0.34 12.27 5.16 7.11 1.25 3.09 SFRS4 NM_005626 0.24 13.30 6.00 7.30 1.15 3.09 DCAF16 NM_017741 0.85 7.40 2.00 5.40 1.89 3.08 TIPARP NM_015508 0.40 12.20 5.27 6.93 1.21 3.04 CEP120 NM_153223 1.19 7.14 1.93 5.21 1.89 3.04 CHD9 NM_025134 1.00 7.91 2.38 5.52 1.73 3.01 KDSR NM_002035 0.29 10.46 4.09 6.37 1.36 3.00 ATMIN NM_015251 0.60 9.05 3.12 5.93 1.54 2.99 ZFP91 NM_053023 0.61 11.31 4.77 6.53 1.24 2.98 LIN7B NM_022165 1.10 10.29 4.02 6.27 1.36 2.97 UBE3C NM_014671 0.54 14.49 7.62 6.88 0.93 2.93 AC8D5 NM_145698 0.71 9.75 3.81 5.94 1.36 2.91 NAP1L1 NM_004537 0.24 20.71 13.62 7.09 0.60 2.89 NBL1 NM_182744 0.36 13.82 7.36 6.45 0.91 2.84 FGL2 NM_006682 0.77 18.81 12.09 6.71 0.64 2.82 RAB11FIP5 NM_015470 1.13 12.52 6.29 6.23 0.99 2.82 VPS26A NM_001035260 0.69 9.11 3.56 5.55 1.36 2.82 MAPKSP1 NM_021970 0.30 9.07 3.55 5.53 1.36 2.81 RBL2 NM_005611 1.07 10.07 4.35 5.72 1.21 2.79 PDZD11 NM_016484 1.15 18.70 12.18 6.52 0.62 2.77 SSFA2 NM_006751 0.80 12.51 6.45 6.06 0.95 2.77 VPS26A NM_004896 0.70 8.63 3.37 5.26 1.36 2.75 SSFA2 NM_001130445 0.77 12.23 6.31 5.92 0.95 2.74 CRK NM_005206 0.91 12.79 6.82 5.97 0.91 2.73 DPM2 NM_003863 0.26 11.72 5.89 5.83 0.99 2.73 PPP2R5E NM_006276 1.19 10.00 4.51 5.49 1.15 2.71 ARL1 NM_001177 0.90 18.55 12.29 6.26 0.59 2.71 ATP281 NM_001682 0.52 10.31 4.93 5.39 1.07 2.65 CRK NM_016823 0.93 11.88 6.33 5.55 0.91 2.63 ATP281 NM_001001323 0.46 10.08 4.82 5.27 1.07 2.62 MGLL NM_001003794 0.24 16.69 10.87 5.82 0.62 2.61 DYNC1LI2 NM_006141 1.14 16.12 10.50 5.62 0.62 2.57 RHOT1 NM_001033568 0.34 11.74 6.42 5.32 0.87 2.56 RTCD1 NM_001130841 0.62 10.85 5.78 5.07 0.91 2.51 DNM1L NM_012062 0.50 15.16 9.87 5.28 0.62 2.48 mir-100-5p (MIMAT0000098) RAP1B NM_001010942 1.14 55.53 30.38 25.15 0.87 4.73 FZDS NM_031866 1.14 7.31 0.95 6.36 2.94 3.97 EPDR1 NM_017549 0.37 30.89 17.53 13.37 0.82 3.83 PL5283 NM_001130929 0.39 13.47 3.65 9.83 1.89 3.80 SIAH2 NM_005067 1.15 6.92 1.16 5.76 2.58 3.61 TSC22O3 NM_198057 0.60 14.84 6.69 8.15 1.15 3.24 C9orf123 NM_033428 0.92 9.37 3.66 5.71 1.36 2.86 mir-125b-5p (MIMAT0000423) RPA2 NM_002946 0.41 16.56 1.76 14.79 3.23 5.05 PRKRA NM_003690 0.22 15.60 1.66 13.93 3.23 4.99 STC1 NM_003155 0.56 39.40 13.31 26.09 1.57 4.96 ACTL6A NM_004301 0.28 23.69 4.90 18.79 2.27 4.80 SNRPB NM_003091 0.62 29.19 7.90 21.29 1.89 4.80 TMEM50A NM_014313 0.44 43.86 19.78 24.09 1.15 4.73 PLIN3 NM_005817 0.32 38.73 16.86 21.86 1.20 4.61 MLF2 NM_005439 0.34 24.20 6.55 17.65 1.89 4.55 CCNC NM_005190 0.42 19.08 3.95 15.13 2.27 4.53 RABL6 NM_024718 0.36 9.10 0.97 8.13 3.23 4.42 DSTN NM_006870 0.22 56.15 35.73 20.41 0.65 4.40 ANPEP NM_001150 0.32 58.88 39.09 19.79 0.59 4.35 ESRRA NM_004451 0.93 10.49 1.37 9.13 2.94 4.34 SLC35A5 NM_017945 0.24 7.93 1.03 6.89 2.94 4.05 TIMM17B NM_005834 0.28 13.63 3.20 10.43 2.09 3.98 RRM2 NM_001034 0.35 7.13 0.93 6.21 2.94 3.95 TRIB1 NM_025195 0.30 6.42 0.84 5.58 2.94 3.85 HAX1 NM_006118 0.25 19.83 7.75 12.08 1.36 3.84 TCTA NM_022171 0.26 8.44 1.41 7.03 2.58 3.82 ZNF828 NM_001164145 0.96 6.17 0.80 5.36 2.94 3.84 KIAAD174 NM_014761 0.65 20.94 9.05 11.90 1.21 3.77 OSBPL9 NM_148909 1.22 9.94 2.33 7.61 2.09 3.60 NTSC3L NM_052935 0.45 16.39 6.40 9.98 1.36 3.59 TBC1D1 NM_015173 0.40 10.47 2.67 7.80 1.97 3.56 PSMD9 NM_002813 0.95 12.16 3.89 8.27 1.64 3.46 TXNIP NM_006472 0.45 27.42 17.63 9.79 0.64 3.35 PRRC1 NM_130809 0.96 10.49 3.24 7.25 1.70 3.32 FIBP NM_198897 0.83 19.64 10.47 9.17 0.91 3.32 MRPL10 NM_145255 0.21 7.40 1.74 5.67 2.09 3.26 TSC22D3 NM_198057 0.71 14.84 6.69 8.15 1.15 3.24 MED15 NM_015889 0.22 11.93 4.66 7.27 1.36 3.17 ABTB1 NM_172027 0.30 11.79 4.61 7.18 1.36 3.15 DDX42 NM_203499 0.48 16.50 8.51 7.99 0.95 3.15 ZSWIM6 NM_020928 1.26 8.94 2.76 6.18 1.70 3.13 VPS4B NM_004869 1.11 11.50 4.49 7.00 1.36 3.12 GOLGB1 NM_004487 0.23 12.27 5.16 7.11 1.25 3.09 OAZ2 NM_002537 0.40 14.86 7.92 6.94 0.91 2.94 PSMG3 NM_001134340 0.22 9.97 3.90 6.07 1.36 2.93 TAF9B NM_015975 1.04 8.67 3.39 5.28 1.36 2.76 HAS1 NM_001523 0.35 16.13 10.18 5.95 0.66 2.66 MRPS10 NM_018141 0.21 15.73 9.93 5.80 0.66 2.62 SLC39A9 NM_018375 0.84 13.90 8.43 5.47 0.72 2.56 RTCD1 NM_001130841 0.43 10.85 5.78 5.07 0.91 2.51 mir-92a-1-Sp (MIMAT0004507) H2AFZ NM_002106 0.30 68.35 35.26 33.09 0.95 5.14 RAP1B NM_001010942 0.22 55.53 30.38 25.15 0.87 4.73 TMEMSQA NM_014313 1.03 43.86 19.78 24.09 1.15 4.73 ATPIF1 NM_178191 0.24 25.56 7.88 17.67 1.70 4.48 MEA1 NM_014623 0.51 44.85 24.54 20.31 0.87 4.43 ZFAND3 NM_021943 0.20 8.55 0.91 7.63 3.23 4.36 EGLN2 NM_053046 0.37 10.38 1.35 9.03 2.94 4.33 LOC729991 NM_001145784 0.46 12.65 2.12 10.53 2.58 4.26 NR3C1 NM_001020825 0.64 26.80 10.96 15.84 1.29 4.19 PA2G4 NM_006191 0.81 22.68 8.09 14.59 1.49 4.14 MRPS18B NM_014046 0.25 18.57 5.94 12.63 1.64 4.01 PTP4A1 NM_003463 0.51 20.89 7.77 13.12 1.43 3.98 SERPINB8 NM_002640 0.49 6.91 0.90 6.01 2.94 3.92 TCTA NM_022171 0.21 8.44 1.41 7.03 2.58 3.82 CYTSB NM_001033553 0.21 5.90 0.77 5.13 2.94 3.77 TPP1 NM_000391 0.55 10.99 2.58 8.42 2.09 3.72 HIST1H28M NM_003521 0.29 17.42 6.81 10.61 1.36 3.67 IP6K2 NM_001005911 0.59 10.42 2.44 7.98 2.09 3.65 ABCF1 NM_001025091 0.27 18.69 7.89 10.80 1.24 3.65 SIAH2 NM_005067 0.63 6.92 1.16 5.76 2.58 3.61 OSBPL9 NM_148909 0.54 9.94 2.33 7.61 2.09 3.60 IP6K2 NM_001146179 0.56 9.89 2.32 7.57 2.09 3.59 C17orf49 NM_001142798 0.24 20.07 10.08 9.99 0.99 3.47 AIDA NM_022831 0.21 24.98 15.15 9.83 0.72 3.38 DPT NM_001937 1.04 7.49 1.76 5.74 2.09 3.28 CCDC92 NM_025140 0.33 7.22 1.69 5.53 2.09 3.23 NOL10 NM_024894 0.59 14.08 6.08 8.00 1.21 3.23 MED15 NM_015889 0.24 11.93 4.66 7.27 1.36 3.17 C20orf132 NM_213632 0.24 11.75 4.59 7.16 1.36 3.15 AKTIP NM_022476 0.25 17.71 9.69 8.02 0.87 3.13 TPBG NM_006670 0.21 12.96 6.27 6.71 1.05 2.94 SRR NM_021947 0.95 9.41 3.68 5.73 1.36 2.86 POGK NM_017542 0.87 7.39 2.36 5.03 1.64 2.85 DDX24 NM_020414 0.26 20.20 13.39 6.81 0.59 2.83 DPM2 NM_003863 0.32 11.72 5.89 5.83 0.99 2.73 let-7a-2-3p (MIMAT0010195) IL8 NM_000584 0.31 89.60 8.90 80.69 3.33 7.16 IL33 NM_033439 1.22 35.40 1.12 34.28 4.98 7.13 RPS25 NM_001028 1.27 268.93 142.20 126.74 0.92 7.05 SFRS13A NM_054016 0.29 14.40 0.99 13.41 3.86 5.38 NDUFB2 NM_004546 0.37 68.00 30.66 37.34 1.15 5.35 H2AFZ NM_002106 0.26 68.35 35.26 33.09 0.95 5.14 RPA2 NM_002946 0.24 16.56 1.76 14.79 3.23 5.05 SNRPB NM_198216 0.67 33.43 9.04 24.38 1.89 4.98 STC1 NM_003155 1.19 39.40 13.31 26.09 1.57 4.96 FGFR1OP NM_007045 1.26 15.11 1.61 13.50 3.23 4.95 SRGN NM_002727 0.72 64.01 36.31 27.70 0.82 4.86 NME1 NM_198175 0.30 52.74 26.50 26.24 0.99 4.82 SNRP8 NM_003091 0.82 29.19 7.90 21.29 1.89 4.80 RAP1B NM_001010942 0.48 55.53 30.38 25.15 0.87 4.73 SERPINE2 NM_006216 0.41 69.92 44.34 25.57 0.66 4.72 PARP3 NM_001003931 0.66 12.09 1.29 10.80 3.23 4.71 F3 NM_001993 0.29 11.90 1.27 10.63 3.23 4.70 ELOVL1 NM_022821 0.40 36.66 14.33 22.34 1.36 4.68 TNFRSF10D NM_003840 0.26 57.91 33.52 24.39 0.79 4.68 ANKRD1 NM_014391 0.21 30.17 10.76 19.40 1.49 4.53 BASP1 NM_006317 0.59 50.43 28.72 21.71 0.81 4.51 WDR44 NM_019045 0.40 8.12 0.73 7.39 3.47 4.51 TXNDC11 NM_015914 0.23 9.35 1.00 8.35 3.23 4.45 MEA1 NM_014623 1.13 44.85 24.54 20.31 0.87 4.43 ESRRA NM_004451 0.69 10.49 1.37 9.13 2.94 4.34 ADI1 NM_018269 0.52 20.08 5.43 14.65 1.89 4.31 UBA6 NM_016227 0.23 15.66 3.30 12.37 2.25 4.27 GOSR2 NM_054022 0.48 12.34 2.07 10.27 2.58 4.24 CCDC51 NM_024661 0.24 12.03 2.02 10.02 2.58 4.21 SAR1B NM_016103 0.38 14.67 3.25 11.41 2.17 4.13 COPS7A NM_016319 0.58 26.65 11.51 15.14 1.21 4.10 KCTD9 NM_017634 0.27 26.65 11.60 15.04 1.20 4.09 RAD23B NM_002874 0.66 30.48 15.32 15.17 0.99 4.05 GNG5 NM_005274 0.99 41.76 26.36 15.40 0.66 4.00 PTP4A1 NM_003463 0.82 20.89 7.77 13.12 1.43 3.98 FZD8 NM_031866 0.59 7.31 0.95 6.36 2.94 3.97 SERPINB8 NM_002640 0.92 6.91 0.90 6.01 2.94 3.92 PDGFC NM_016205 0.41 12.91 3.03 9.88 2.09 3.91 GPR137B NM_003272 0.43 8.88 1.49 7.39 2.58 3.87 TRIB1 NM_025195 0.38 6.42 0.84 5.58 2.94 3.85 PTPLAD1 NM_016395 0.32 15.33 4.73 10.60 1.70 3.81 KIAAD174 NM_014761 0.54 20.94 9.05 11.90 1.21 3.77 HMGN1 NM_004965 0.24 33.75 20.95 12.80 0.69 3.74 BMP6 NM_001716 0.26 22.51 10.75 11.76 1.07 3.71 DHX36 NM_020865 0.64 10.76 2.52 8.23 2.09 3.69 TPM3 NM_001043352 0.57 24.53 12.71 11.82 0.95 3.69 BAG3 NM_004281 1.28 7.05 1.18 5.87 2.58 3.63 COIL NM_004645 1.05 6.88 1.15 5.73 2.58 3.60 WSB1 NM_015626 0.94 22.86 11.79 11.07 0.95 3.60 DENR NM_003677 0.85 19.45 8.93 10.53 1.12 3.58 TBC1D1 NM_015173 0.58 10.47 2.67 7.80 1.97 3.56 NAPIL1 NM_139207 0.52 23.85 12.96 10.89 0.88 3.56 PAPSS2 NM_001015880 0.94 20.80 10.23 10.58 1.02 3.55 SDC1 NM_002997 0.48 18.60 8.53 10.07 1.12 3.52 PURA NM_005859 0.22 14.18 5.16 9.02 1.46 3.49 MPPE1 NM_023075 0.80 6.13 1.03 5.10 2.58 3.49 AP3S1 NM_001284 0.31 22.10 11.77 10.32 0.91 3.49 DCTN2 NM_006400 1.31 22.62 12.38 10.24 0.87 3.47 SEC62 NM_003262 0.46 16.23 6.96 9.27 1.22 3.44 SFRS13A NM_006625 0.29 17.03 7.68 9.35 1.15 3.42 DCAF12 NM_015397 0.59 9.17 2.48 6.69 1.89 3.33 GM2A NM_000405 0.37 9.13 2.47 6.66 1.89 3.32 UBE2B NM_003337 0.41 10.83 3.46 7.36 1.64 3.32 FAM24A NM_001029888 0.23 13.03 5.09 7.94 1.36 3.28 PSMAS NM_002790 1.18 8.80 2.38 6.42 1.89 3.28 DEPDC7 NM_001077242 0.23 7.38 1.73 5.65 2.09 3.26 RNF152 NM_173557 1.23 7.17 1.68 5.49 2.09 3.23 RHBDL2 NM_017821 1.28 7.05 1.65 5.39 2.09 3.21 ANP32B NM_006401 1.34 17.62 9.39 8.23 0.91 3.17 TROVE2 NM_004600 0.92 11.98 4.68 7.30 1.36 3.17 TBP NM_003194 1.24 6.80 1.59 5.20 2.09 3.17 RPF1 NM_025065 1.25 11.80 4.61 7.19 1.36 3.15 METTL3 NM_019852 0.27 6.62 1.55 5.07 2.09 3.14 YTHDF2 NM_016258 0.27 9.31 2.96 6.33 1.64 3.13 VPS4B NM_004869 0.77 11.50 4.49 7.00 1.36 3.12 SNX2 NM_003100 1.21 11.27 4.40 6.86 1.36 3.09 SFRS4 NM_005626 1.17 13.30 6.00 7.30 1.15 3.09 KLHL7 NM_001031710 0.94 8.97 2.87 6.10 1.64 3.08 SPRY2 NM_005842 0.31 11.04 4.32 6.73 1.36 3.07 INSIG1 NM_198337 0.75 12.38 5.58 6.80 1.15 2.99 CSTF3 NM_001033506 1.28 10.37 4.05 6.32 1.36 2.98 LIN7B NM_022165 0.61 10.29 4.02 6.27 1.36 2.97 STXBP1 NM_001032221 0.24 10.11 3.95 6.16 1.36 2.95 MFSD1 NM_022736 1.12 9.87 3.86 6.01 1.36 2.92 STXBP1 NM_003165 0.22 9.79 3.83 5.96 1.36 2.91 PRKAR2A NM_004157 1.19 9.79 3.82 5.96 1.36 2.91 NAPIL1 NM_004537 0.39 20.71 13.62 7.09 0.60 2.89 C1QBP NM_001212 1.34 20.04 13.05 6.99 0.62 2.87 SLC33A1 NM_004733 0.22 7.48 2.39 5.09 1.64 2.87 INSIG1 NM_005542 0.76 11.18 5.04 6.14 1.15 2.86 LZIC NM_032368 0.42 12.88 6.47 6.41 0.99 2.86 ANKRD17 NM_032217 0.50 9.11 3.56 5.55 1.36 2.82 FMR1 NM_002024 1.08 12.33 6.19 6.13 0.99 2.80 ATP2B1 NM_001682 0.24 10.31 4.93 5.39 1.07 2.65 ATP2B1 NM_001001323 0.20 10.08 4.82 5.27 1.07 2.62 FAHD1 NM_031208 0.67 10.76 5.41 5.35 0.99 2.62 DYNC1LI2 NM_006141 0.53 16.12 10.50 5.62 0.62 2.57 RHOT1 NM_001033568 0.21 11.74 6.42 5.32 0.87 2.56
[0106] Similarly, 418 out of 8367 targets predicted by mirSVR targets show downregulation at the level of protein expression based on the results of the LC-MS/MS proteomic analysis, Table 3.
TABLE-US-00003 TABLE 3 Protein Targets Downregulated in SEN Gene Symbol RefSeq ID mirSVR Score SR SEN Diff Mean P-value mir-17-5p (MIMAT0000070) FPR1 NP_002020 0.21 9.26E06 2.59E06 6.67E06 7.93E05 SH3GLB1 NP_057093 0.44 1.92E05 6.38E06 1.28E05 1.18E04 DNALI1 NP_003453 0.20 3.16E05 1.51E05 1.65E05 1.61E04 RCN2 NP_002893 0.21 1.11E05 6.78E05 4.30E06 3.58E04 IGFBP7 NP_001544 0.23 1.20E05 4.12E06 7.89E06 3.70E04 CA10 NP_001076002 0.67 2.84E05 7.68E06 2.08E05 4.35E04 ZEB2 NP_055610 0.54 3.21E05 8.87E06 2.32E05 5.33E04 KIAA1598 NP_060800 1.25 5.37E05 3.34E05 2.03E05 5.48E05 NUP205 NP_055950 1.28 2.54E05 1.12E05 1.43E05 5.66E04 MAP2 NP_002365 0.33 8.61E05 3.58E05 5.03E05 5.76E04 FGDS NP_689749 1.18 1.52E05 9.77E05 5.40E06 6.26E04 COL1SA1 NP_001846 0.83 3.44E05 1.26E05 2.18E05 7.09E04 AHNAK NP_001611 1.29 2.98E03 2.02E03 9.63E04 7.28E04 U2AF1 NP_001020374 0.24 7.00E05 3.10E05 3.90E05 9.26E04 TCTEXID1 NP_689878 0.89 1.36E05 5.81E06 7.81E06 1.10E03 ESR1 NP_000116 0.40 3.86E05 1.47E05 2.39E05 1.11E03 KTN1 NP_001072989 0.32 2.25E04 1.51E04 7.40E05 1.18E03 ANTXR1 NP_444262 0.48 1.15E05 5.19E06 6.26E06 1.19E03 TAOK2 NP_057235 1.12 1.14E04 7.57E05 3.85E05 1.25E03 VASP NP_003361 0.22 1.75E05 8.17E05 9.37E06 1.26E03 ATXN2 NP_002964 1.08 1.17E05 5.04E06 6.65E06 1.31E03 SIN3A NP_001138829 0.54 1.10E04 8.09E05 2.93E05 1.35E03 CHD2 NP_001262 0.78 4.19E05 1.49E05 2.70E05 1.49E03 RIT1 NP_008843 0.50 1.67E05 7.30E06 9.41E06 1.52E03 RB1 NP_000312 0.72 3.99E04 2.18E04 1.81E04 1.56E03 HN1 NP_057269 1.29 1.86E05 9.90E06 8.73E06 1.64E03 SUV39H2 NP_001180353 0.48 4.11E04 2.37E04 1.74E04 1.80E03 CHD4 NP_001264 0.73 9.12E06 2.78E06 6.34E06 1.97E03 ARID5B NP_115575 0.30 2.46E05 1.97E05 4.90E06 2.14E03 DYNC1U2 NP_006132 1.14 2.42E05 1.46E05 9.64E06 2.14E03 FTL NP_000137 0.64 8.54E06 3.95E06 4.59E06 2.24E03 TGM2 NP_004604 1.09 2.95E04 2.21E04 7.42E05 2.46E03 ETF1 NP_004721 0.31 3.52E05 2.30E05 1.22E05 2.47E03 CCT5 NP_036205 0.44 3.76E05 2.72E05 1.04E05 2.60E03 NEB NP_001157980 0.23 4.45E04 2.92E04 1.53E04 2.63E03 ARID1B NP_059989 0.40 2.15E04 1.20E04 9.52E05 2.93E03 DSTYK NP_955749 0.23 1.00E04 4.89E05 5.15E05 3.28E03 ANKRD11 NP_037407 0.23 4.89E05 3.12E05 1.78E05 3.56E03 DDX43 NP_061135 0.39 5.40E05 3.45E05 1.95E05 3.62E03 TRIM22 NP_006065 0.99 8.68E06 3.86E06 4.82E06 3.69E03 CHD9 NP_079410 1.00 4.29E04 9.94E05 3.30E04 3.92E03 PDE8A NP_002596 0.24 8.89E05 6.25E05 2.64E05 4.05E03 RBBP6 NP_008841 0.46 2.61E05 1.61E05 1.00E05 4.07E03 GPD2 NP_001076581 0.29 7.59E05 2.22E05 5.37E05 4.20E03 ZHX2 NP_055758 0.75 5.23E05 3.02E05 2.21E05 4.43E03 CTSA NP_001121167 0.94 4.21E05 3.13E05 1.08E05 4.60E03 CCDC88A NP_001129069 0.83 9.08E05 6.46E05 2.62E05 4.77E03 TIAM1 NP_003244 1.25 6.62E05 3.46E05 3.16E05 4.82E03 TOPORS NP_005793 1.08 2.14E04 1.49E04 6.42E04 4.91E03 ACCS NP_115981 0.47 1.63E05 9.45E06 6.80E06 4.91E03 NPM1 NP_002511 1.06 5.48E05 2.47E05 3.01E05 5.35E03 JAK3 NP_000206 0.65 2.73E05 1.11E05 1.62E05 5.41E03 MSR1 NP_619729 1.11 3.63E05 2.64E05 9.85E06 5.53E03 RPS6KA5 NP_004746 1.31 5.24E05 1.51E05 3.73E05 6.19E03 CIR1 NP_004873 0.22 2.56E05 9.07E06 1.65E05 6.52E03 HNRNPC NP_112604 0.97 1.38E04 6.56E05 7.23E05 6.56E03 HSPA8 NP_006588 1.28 7.15E04 5.35E04 1.79E04 7.09E03 SEPT2 NP_004395 1.02 1.94E04 1.50E04 4.31E05 7.52E03 FLG2 NP_001014364 0.33 1.98E05 1.42E05 5.58E06 7.83E03 COQ2 NP_056512 0.62 6.27E05 4.40E05 1.86E05 8.19E03 PAFAH1B2 NP_002563 0.94 2.13E05 1.48E05 6.49E06 8.73E03 NKTR NP_005376 0.31 1.04E04 7.38E05 3.07E05 8.45E03 PLEKHO2 NP_001181988 0.53 4.92E05 3.09E05 1.83E05 8.52E03 SEC24D NP_055637 0.62 3.76E05 2.56E05 1.21E05 8.52E03 LMAN1 NP_005561 0.37 2.14E04 1.42E04 7.19E05 9.04E03 ITSN1 NP_001001132 0.41 1.95E05 7.95E06 1.15E05 9.45E03 ZNF362 NP_689706 0.84 2.62E05 8.99E06 1.73E05 9.47E03 GKAP1 NP_001129425 0.70 2.58E05 1.20E05 1.38E05 9.93E03 RBL1 NP_899662 0.77 2.40E05 1.08E05 1.32E05 9.96E03 MAGI3 NP_001136254 1.21 6.99E05 4.91E05 2.08E05 1.00E02 RAB5B NP_002859 0.98 4.41E04 3.03E04 1.38E04 1.03E02 PDIK1L NP_690048 0.92 1.71E05 6.95E06 1.02E05 1.08E02 CALD1 NP_149129 1.32 4.01E04 2.30E04 1.71E04 1.13E02 IKBIP NP_710154 0.85 1.08E04 6.84E05 3.96E05 1.15E02 H2AFV NP_619541 0.31 7.13E06 3.77E06 3.36E06 1.17E02 TMMCC1 NP_001017395 0.47 9.96E05 1.66E05 8.31E05 1.24E02 SORL1 NP_003096 0.81 3.49E05 2.19E05 1.29E85 1.35E02 KIAA1109 NP_056127 0.21 2.99E04 2.46E04 5.31E05 1.40E02 KCNJ8 NP_004973 0.85 1.61E05 8.29E06 7.83E06 1.46E02 VASH2 NP_001129947 0.47 1.92E04 9.82E05 9.34E05 1.51E02 IQCE NP_689771 0.20 8.70E05 4.53E05 4.18E05 1.53E02 LATS2 NP_055387 0.21 1.61E04 1.04E04 5.69E05 1.57E02 IFRD1 NP_001541 0.91 1.05E04 8.19E05 2.34E05 1.57E02 TRPS1 NP_054831 0.25 6.73E05 5.49E05 1.24E05 1.60E02 NEFH NP_066554 0.21 2.58E05 1.94E05 6.45E06 1.65E02 ACSM5 NP_060358 0.37 8.77E05 5.29E05 3.47E05 1.68E02 BDH1 NP_976059 0.50 3.36E05 2.66E05 6.98E06 1.74E02 MTHFD1 NP_005947 0.98 5.37E05 4.33E05 1.03E05 1.76E02 CCDC150 NP_001074008 0.27 5.16E05 4.72E05 4.38E06 1.77E02 TACC2 NP_008928 0.91 2.17E05 1.54E05 6.30E06 1.82E02 SULF1 NP_055985 0.65 1.11E05 6.48E06 4.57E06 1.85E02 SMARCA5 NP_003592 0.32 2.66E04 1.80E04 8.64E05 1.89E02 ERG NP_001129626 0.79 2.57E05 1.33E05 1.24E05 1.92E02 EPB41L4B NP_060694 0.70 2.20E05 1.54E05 6.58E06 1.94E02 MAP3K12 NP_006292 0.63 1.80E05 1.04E05 7.59E06 1.97E02 ANKRD42 NP_872409 0.44 3.12E05 2.07E05 1.05E05 2.04E02 SYNC NP_001155180 0.44 2.68E04 1.83E04 8.50E05 2.05E02 SYNE2 NP_878918 0.51 1.38E04 1.02E04 3.66E05 2.08E02 PLIN1 NP_001138783 0.51 5.44E06 3.29E06 2.16E06 2.14E02 UBE3C NP_055486 1.29 2.87E05 2.02E05 8.44E06 2.15E02 PXDN NP_036425 0.98 5.53E06 3.89E06 1.64E06 2.31E02 NAP1L1 NP_004528 0.25 1.93E05 8.63E06 1.07E05 2.35E02 CD109 NP_598000 0.44 3.01E05 1.72E05 1.28E05 2.44E02 ANKS1B NP_690001 1.06 2.50E04 2.06E04 4.33E05 2.51E02 SEZ6 NP_849191 0.47 4.24E05 2.42E05 1.81E05 2.58E02 C3orf70 NP_001020437 0.42 5.92E05 1.97E05 3.95E05 2.64E02 WAC NP_567823 0.92 1.16E03 7.24E04 4.41E04 2.65E02 CYP2U1 NP_898898 0.58 3.03E05 2.67E05 3.66E06 2.78E02 HNRNPA1 NP_002127 0.61 6.01E05 4.06E05 1.94E05 2.80E02 MYO5B NP_001073936 0.79 4.18E04 1.79E04 2.38E04 2.82E02 DPP8 NP_569118 0.38 5.25E05 2.21E05 3.04E05 2.83E02 NECAB3 NP_112509 0.21 5.21E06 4.05E06 1.16E06 2.96E02 GOLGB1 NP_004478 0.34 1.10E05 5.72E06 5.31E06 2.96E02 AP4E1 NP_031373 0.99 1.63E05 9.88E06 6.44E06 2.97E02 KAT2B NP_003875 1.10 4.13E04 3.74E04 3.89E05 3.12E02 DDX5 NP_004387 0.89 3.92E05 2.32E05 1.60E05 3.15E02 PDIA5 NP_006801 0.40 3.02E05 1.97E05 1.06E05 3.28E02 SETDB2 NP_001153780 0.30 9.39E05 6.74E05 2.64E05 3.37E02 CLUL1 NP_055225 0.44 1.31E05 9.54E06 3.52E06 3.38E02 KIF5C NP_004513 0.65 3.74E05 2.77E05 9.65E06 3.40E02 DOCKS NP_079216 0.37 1.15E05 6.57E06 4.96E06 3.42E02 ZMYM1 NP_079048 0.70 9.78E05 5.86E05 3.92E05 3.44E02 SNRPD3 NP_004166 0.32 5.81E05 3.88E05 1.93E05 3.45E02 CPNE1 NP_690904 0.86 2.21E05 1.71E05 4.99E06 3.47E02 KIF23 NP_004847 1.22 3.96E06 1.79E06 2.17E06 3.52E02 ZNF462 NP_067047 0.68 2.38E04 1.93E04 4.46E05 3.55E02 TAGAP NP_473455 0.94 4.99E05 3.21E05 1.78E05 3.69E02 BCL6 NP_001124317 0.32 2.67E05 2.01E05 6.50E06 3.80E02 ZEB1 NP_001121600 0.32 7.96E06 5.67E06 2.29E06 3.82E02 RBM20 NP_001127835 0.82 2.52E05 1.78E05 7.44E06 4.00E02 AHCTF1 NP_056261 1.06 1.25E04 1.01E04 2.43E05 4.08E02 LASP1 NP_006139 0.36 5.47E05 4.39E05 1.09E05 4.14E02 TLR8 NP_619542 0.72 8.64E06 4.37E06 4.27E06 4.20E02 KLHL2 NP_001154993 1.08 4.48E05 1.86E05 2.62E05 4.33E02 CAB39L NP_112187 0.44 1.99E05 1.25E05 7.32E06 4.40E02 RALYL NP_001093861 1.20 3.22E05 1.78E05 1.45E05 4.43E02 PIP4K2C NP_001139731 0.52 4.63E05 3.60E05 1.03E05 4.54E02 SKI NP_003027 0.59 1.92E05 1.43E05 4.92E06 4.56E02 ZC3H11A NP_055642 0.23 1.57E04 8.50E05 7.22E05 4.59E02 DPY19L1 NP_056098 0.23 3.63E05 2.16E05 1.47E05 4.62E02 PCDH15 NP_001136239 0.77 1.09E05 7.87E06 3.00E06 4.72E02 PRDM6 NP_001129711 1.22 1.93E04 1.51E04 4.26E05 4.72E02 FAF2 NP_055428 0.46 9.62E06 8.20E06 1.42E06 4.90E02 TMEM87A NP_056312 0.47 2.92E05 2.12E05 8.01E06 4.95E02 mir-18a-5p (MIMAT0000072) CTNNA1 NP_001894 0.52 8.46E05 6.23E05 2.23E05 1.01E05 ANXA5 NP_001145 0.36 7.40E04 3.08E04 4.32E04 4.28E05 PCSK6 NP_612193 0.24 3.60E05 1.05E05 2.55E05 6.86E05 EPDR1 NP_060019 0.26 2.78E05 1.43E05 1.35E05 9.83E05 RNASE9 NP_001103831 1.12 1.94E05 7.13E06 1.22E05 1.41E04 MATR3 NP_061322 1.21 4.91E05 2.33E05 2.57E05 1.49E04 ANXA7 NP_001147 0.72 3.71E05 7.51E06 2.96E05 1.93E04 VCP NP_009057 0.67 1.82E04 1.41E04 4.14E05 2.31E04 LRBA NP_006717 0.74 5.36E05 3.31E05 2.05E05 5.55E04 HNRNPR NP_005817 0.32 9.09E05 5.69E05 3.40E05 8.82E04 ALS2CR11 NP_001161693 0.39 2.70E05 1.68E05 1.02E05 9.11E04 NRP1 NP_003864 0.30 5.15E05 2.84E05 2.31E05 9.36E04 BCAR3 NP_003558 1.25 5.82E05 4.24E05 1.57E05 1.02E03 TLL2 NP_036597 0.64 1.37E05 8.27E06 5.39E06 1.09E03 TCTEX1D1 NP_689878 1.06 1.36E05 5.81E06 7.81E06 1.10E03 ESR1 NP_000116 0.70 3.86E05 1.47E05 2.39E05 1.11E03 UBA6 NP_060697 0.59 2.59E05 1.32E05 1.27E05 1.24E03 TAOK2 NP_057235 0.40 1.14E04 7.57E05 3.85E05 1.25E03 COL8A2 NP_005193 0.21 5.78E05 3.13E05 2.65E05 1.28E03 EXOSC10 NP_001001998 1.12 5.72E05 4.32E05 1.40E05 1.42E03 CHD2 NP_001262 0.67 4.19E05 1.49E05 2.70E05 1.49E03 RIT1 NP_008843 0.89 1.67E05 7.30E06 9.41E06 1.52E03 ALB NP_000468 0.57 1.15E03 7.41E04 4.08E04 2.18E03 RC3H2 NP_001094058 0.45 2.38E04 9.35E05 1.44E04 2.44E03 DDX3Y NP_001116137 0.25 1.47E05 5.02E06 9.64E06 2.54E03 CCTS NP_036205 0.68 3.76E05 2.72E05 1.04E05 2.60E03 RUVBL1 NP_003698 1.13 1.80E04 1.49E04 3.07E05 2.68E03 CCDC8 NP_114429 0.71 3.31E05 2.15E05 1.16E05 2.85E03 ABCC3 NP_003777 0.48 1.84E05 6.58E06 1.19E05 2.98E03 TARDBP NP_031401 0.35 2.35E05 1.80E05 5.47E06 3.25E03 ACACB NP_001084 0.31 4.19E05 3.38E05 8.10E06 3.30E03 DDX43 NP_061135 0.23 5.40E05 3.45E05 1.95E05 3.62E03 HNRNPUL1 NP_008971 0.46 3.21E05 1.89E05 1.32E05 3.66E03 ACACA NP_942131 0.47 2.59E05 1.28E05 1.31E05 4.07E03 RBBP6 NP_008841 1.24 2.61E05 1.61E05 1.00E05 4.07E03 KCTD12 NP_612453 0.35 2.45E05 1.42E05 1.03E05 4.32E03 ZHX2 NP_055758 0.78 5.23E05 3.02E05 2.21E05 4.43E03 MAFB NP_005452 0.23 4.03E05 2.23E05 1.81E05 4.46E03 CCDC88A NP_001129069 0.34 9.08E05 6.46E05 2.62E05 4.77E03 STXBP3 NP_009200 0.53 1.47E05 8.20E06 6.50E06 4.98E03 SEC24C NP_940999 0.22 2.01E04 1.09E04 9.14E05 5.67E03 RPS6KA5 NP_004746 0.98 5.24E05 1.51E05 3.73E05 6.19E03 ARF6 NP_001654 1.10 2.23E05 1.46E05 7.69E06 6.32E03 AKR1D1 NP_005980 0.27 4.21E05 2.83E06 3.92E05 6.39E03 SEPT2 NP_004395 0.25 1.94E04 1.50E04 4.31E05 7.52E03 NRL NP_006168 0.21 6.69E05 3.30E05 3.39E05 8.47E03 TPM3 NP_705935 0.31 7.60E05 5.26E05 2.34E05 8.49E03 CDK5RAP2 NP_060719 0.25 4.41E05 2.89E05 1.52E05 9.06E03 ITSN1 NP_001001232 0.34 1.95E05 7.95E06 1.15E05 9.45E03 FBXO30 NP_115521 0.31 1.44E05 6.49E06 7.90E06 9.70E03 SEL1L3 NP_056002 0.80 3.16E05 1.67E05 1.49E05 9.76E03 MAGI3 NP_001136254 0.53 6.99E05 4.91E05 2.08E05 1.00E02 RAB5B NP_002859 0.22 4.41E04 3.03E04 1.38E04 1.03E02 EFS NP_005855 0.81 4.56E05 1.85E05 2.70E05 1.06E02 PDIK1L NP_690048 0.57 1.71E05 6.95E06 1.02E05 1.08E02 PABPC4 NP_001129125 0.30 3.90E05 2.92E05 9.81E06 1.11E02 ANKLE2 NP_055929 0.33 2.09E04 1.24E04 8.45E05 1.68E02 FAM46B NP_443175 0.23 4.06E05 1.83E05 2.23E05 1.69E02 CX3CL1 NP_002987 0.26 2.71E05 1.67E05 1.04E05 1.75E02 TAF15 NP_631961 0.76 2.13E05 1.39E05 7.48E06 1.86E02 EPB41L4B NP_060894 0.21 2.20E05 1.54E05 6.58E06 1.94E02 CDC42 NP_001782 1.21 1.34E04 7.02E05 6.37E05 2.05E02 SYNC NP_001155180 0.64 2.68E04 1.83E04 8.50E05 2.05E02 ICT1 NP_001536 0.28 3.12E04 1.33E04 1.80E04 2.14E02 NAP1L1 NP_004528 0.21 1.93E05 8.63E06 1.07E05 2.35E02 CTH NP_001893 0.39 1.33E05 5.24E06 8.09E06 2.38E02 PSME4 NP_055429 0.97 1.37E05 9.08E06 4.58E06 2.41E02 NAA50 NP_079422 0.69 3.77E05 2.07E05 1.71E05 2.43E02 HNRNPA1 NP_002127 0.92 6.01E05 4.06E05 1.94E05 2.80E02 DOCK5 NP_079216 0.74 1.15E05 6.57E06 4.96E06 3.42E02 SNRPD3 NP_004166 1.11 5.81E05 3.88E05 1.93E05 3.45E02 GMIP NP_057657 1.20 2.21E05 1.71E05 4.99E06 3.47E02 CIRH1A NP_116219 0.35 6.90E06 4.55E06 2.35E06 3.49E02 VSIG4 NP_009199 0.22 4.58E05 1.93E05 2.65E05 3.67E02 TNK2 NP_001010938 0.29 4.98E05 3.22E05 1.76E05 3.72E02 TMCC2 NP_055673 0.53 1.31E05 7.49E06 5.61E06 3.84E02 PPP1R9A NP_001159633 0.35 1.44E05 5.21E06 9.20E06 3.87E02 MKI57 NP_002408 0.29 2.97E04 2.61E04 3.63E05 4.01E02 AHCTF1 NP_056261 0.50 1.25E04 1.01E04 2.43E05 4.08E02 PYGB NP_002853 0.23 3.97E06 1.59E06 2.38E06 4.22E02 KCNA1 NP_000208 0.40 1.53E05 8.08E06 7.20E06 4.32E02 CENP8D1 NP_659476 0.45 1.09E05 8.18E06 2.70E06 4.49E02 TBC1D22B NP_060242 0.36 4.74E05 2.69E05 2.05E05 4.53E02 MAP4K3 NP_003609 0.77 4.64E05 3.07E05 1.57E05 4.55E02 RIMS2 NP_055492 1.15 9.44E05 6.87E05 2.58E05 4.69E02 PRDM6 NP_001129711 1.15 1.93E04 1.51E04 4.26E05 4.72E02 MYO1H NP_001094891 0.29 3.09E05 2.39E05 6.93E06 4.91E02 PDCD6 NP_037364 0.85 5.74E06 3.26E06 2.48E06 4.97E02 mir-19a-3p (MIMAT0000073) CTNNA1 NP_001894 1.18 8.46E05 6.23E05 2.23E05 1.01E05 PKD1L1 NP_612152 0.99 1.20E04 6.22E05 5.76E05 1.24E05 DNAJA2 NP_005871 0.68 5.65E06 3.04E06 2.61E06 2.88E05 SCN9A NP_002968 0.48 9.38E05 5.27E05 4.11E05 4.48E05 PCSK6 NP_612193 0.27 3.60E05 1.05E05 2.55E05 6.86E05 ABCA5 NP_758424 1.12 2.19E05 7.82E06 1.40E05 9.05E05 SETX NP_055861 0.76 8.11E05 3.78E05 4.33E05 9.14E05 JAG2 NP_002217 0.51 3.58E05 1.21E05 2.37E05 1.09E04 OR12D3 NP_112221 0.95 1.58E05 5.97E06 9.85E06 1.54E04 ANXA7 NP_001147 0.61 3.71E05 7.51E06 2.96E05 1.93E04 COL1A2 NP_000080 1.14 8.86E04 4.01E04 4.85E04 1.98E04 CRABP1 NP_004369 0.39 1.04E04 2.69E05 7.68E05 2.12E04 RCN2 NP_002893 0.46 1.11E05 6.78E06 4.30E06 3.58E04 ZEB2 NP_055610 0.40 3.21E05 8.87E06 2.32E05 5.33E04 KIAA1598 NP_060800 0.80 5.37E05 3.34E05 2.03E05 5.48E04 GRK6 NP_002073 0.88 2.45E05 1.25E05 1.21E05 7.26E04 DNM3 NP_001129599 1.27 3.87E05 2.77E05 1.09E05 7.91E04 E2F7 NP_976328 1.02 1.93E05 6.30E06 1.30E05 9.19E04 NRP1 NP_003864 0.44 5.15E05 2.84E05 2.31E05 9.36E04 BCAR3 NP_003558 0.22 5.82E05 4.24E05 1.57E05 1.02E03 TLL2 NP_036597 0.70 1.37E05 8.27E06 5.39E06 1.09E03 ESR1 NP_000116 0.41 3.86E05 1.47E05 2.39E05 1.11E03 ANTXR1 NP_444262 0.39 1.15E05 5.19E06 6.26E06 1.19E03 CS NP_004068 0.76 1.49E04 8.20E05 6.70E05 1.20E03 DBN1 NP_004386 1.16 7.88E05 4.24E05 3.65E05 1.36E03 PBX2 NP_002577 0.80 2.00E05 5.62E06 1.44E05 1.39E03 CHD2 NP_001262 1.00 4.19E05 1.49E05 2.70E05 1.49E03 GRB10 NP_005302 0.74 1.86E05 9.90E06 8.73E06 1.62E03 SETD7 NP_085151 0.31 8.13E05 1.71E05 6.42E05 1.66E03 NCBP1 NP_002477 0.62 1.11E03 5.55E04 5.51E04 1.75E03 IGFBP3 NP_001013416 1.11 1.22E03 5.43E04 6.80E04 1.81E03 PABPC1L2B NP_001035971 0.35 6.46E05 4.61E05 1.85E05 1.84E03 LRRC16A NP_060110 0.31 1.95E05 1.37E05 5.84E06 1.87E03 ANXA4 NP_001144 0.93 1.77E04 9.63E05 8.11E05 2.01E03 ARID5B NP_115575 0.75 2.46E05 1.97E05 4.90E06 2.14E03 DYNC1U2 NP_006132 0.93 2.42E05 1.46E05 9.64E06 2.14E03 TGM2 NP_004604 0.32 2.95E04 2.21E04 7.42E05 2.46E03 DDX3Y NP_001116137 0.98 1.47E05 5.02E06 9.64E06 2.54E03 ZC3H13 NP_055885 1.05 8.71E06 3.87E06 4.84E06 2.54E03 KIF1B NP_055889 0.34 2.81E05 1.50E05 1.31E05 2.56E03 MECOM NP_001098547 1.10 2.44E05 1.48E05 9.65E06 2.74E03 CCDC8 NP_114429 0.24 3.31E05 2.15E05 1.16E05 2.85E03 FAM178A NP_001129595 0.46 3.30E05 2.15E05 1.15E05 2.92E03 DAAM1 NP_055807 1.22 2.64E04 1.03E04 1.61E04 2.92E03 ABCC3 NP_003777 1.04 1.84E05 6.58E06 1.19E05 2.98E03 HIVEP2 NP_006725 0.24 1.31E04 8.79E05 4.35E05 3.01E03 POP1 NP_001139333 0.36 1.01E04 4.89E05 5.17E05 3.43E03 ANKRD11 NP_037407 0.33 4.89E05 3.12E05 1.78E05 3.56E03 CAND1 NP_060918 1.11 2.76E04 1.33E04 1.43E04 3.62E03 HNRNPUL1 NP_008971 0.87 3.21E05 1.89E05 1.32E05 3.66E03 FAM84B NP_777571 0.41 5.26E05 2.78E05 2.48E05 3.77E03 PLCXD2 NP_695000 0.74 2.19E05 1.50E05 6.91E06 3.92E03 ACACA NP_942131 0.31 2.59E05 1.28E05 1.31E05 4.07E03 GPD2 NP_001076581 0.22 7.59E05 2.22E05 5.37E05 4.20E03 RPSA NP_001012321 0.69 2.06E04 1.70E04 3.60E05 4.69E03 CCDC88A NP_001129069 1.06 9.08E05 6.46E05 2.62E05 4.77E03 CLTC NP_004850 0.50 1.30E03 1.17E03 1.33E04 4.87E03 HUWE1 NP_113584 0.22 1.66E04 1.18E04 4.77E05 5.01E03 MTF2 NP_001157864 1.00 3.63E05 2.65E05 9.79E06 5.41E03 PPM1K NP_689755 0.41 1.85E05 1.20E05 6.48E06 5.71E03 TTF2 NP_003585 0.48 1.06E05 4.96E06 5.63E06 5.99E03 RPS6KAS NP_004746 1.02 5.24E05 1.51E05 3.73E05 6.19E03 PALMD NP_060204 0.20 9.34E06 6.89E06 2.45E06 6.21E03 SUZ12 NP_056170 1.03 2.65E05 1.54E05 1.12E05 6.65E03 TRIO NP_009049 0.41 3.60E05 1.71E05 1.89E05 7.69E03 ZBBX NP_078963 0.20 1.34E05 5.73E06 7.62E06 4.95E03 CXCL12 NP_954637 0.48 2.43E04 1.60E04 8.23E05 7.98E03 TUB NP_003311 0.68 1.56E05 1.23E05 3.24E06 8.01E03 AHSG NP_001613 0.97 7.72E05 3.88E05 3.84E05 8.29E03 PAFAH1B2 NP_002563 0.61 2.13E05 1.48E05 6.49E06 8.43E03 H2AFY NP_001035248 0.21 2.91E04 1.62E04 1.29E04 8.71E03 KIAA1841 NP_001123465 0.31 4.35E05 2.68E05 1.67E05 8.98E03 CDK5RAP2 NP_060719 0.29 4.41E05 2.89E05 1.52E05 9.06E03 FECH NP_000131 0.21 3.31E05 1.02E05 2.29E05 9.07E03 ITSN1 NP_001001132 1.21 1.95E05 7.95E06 1.15E05 9.45E03 MED13L NP_056150 0.97 8.49E05 4.77E05 3.72E05 9.63E03 SEL1L3 NP_056002 0.81 3.16E05 1.67E05 1.49E05 9.76E03 GKAP1 NP_001129425 0.30 2.58E05 1.20E05 1.38E05 9.93E03 RBL1 NP_899662 0.42 2.40E05 1.08E05 1.32E05 9.96E03 DDX3X NP_001180345 1.07 2.18E05 1.46E05 7.15E06 1.03E02 ARFGAP3 NP_055385 0.93 5.09E05 3.47E05 1.62E05 1.03E02 RAB5B NP_002859 0.47 4.41E04 3.03E04 1.38E04 1.03E02 ZNF518A NP_055618 1.20 9.54E04 4.97E04 4.56E04 1.04E02 PDIK1L NP_690048 0.81 1.71E05 6.95E06 1.02E05 1.08E02 IGF2BP3 NP_006538 0.93 1.92E05 1.32E05 5.99E06 1.11E02 CALD1 NP_149129 0.70 4.01E04 2.30E04 1.71E04 1.13E02 BCL3 NP_005169 0.31 2.10E05 1.24E05 8.55E06 1.14E02 ATP8A1 NP_006086 0.39 1.06E04 4.58E05 5.98E05 1.14E02 ZBTB11 NP_055230 1.11 1.34E04 1.05E04 2.90E05 1.48E02 IQCE NP_6897771 0.87 8.70E05 4.53E05 4.18E05 1.53E02 SAP18 NP_005861 0.51 1.81E04 1.19E04 6.25E05 1.55E02 AKAP1 NP_003479 0.23 2.57E05 1.36E05 1.20E05 1.57E02 TRPS1 NP_054831 0.22 6.73E05 5.49E05 1.24E05 1.60E02 SPATS2L NP_001093894 0.63 1.62E05 1.11E05 5.11E06 1.66E02 RELN NP_005036 1.28 4.53E06 3.30E06 1.23E06 1.69E02 FAM46B NP_443175 0.94 4.06E05 1.83E05 2.23E05 1.69E02 RNF141 NP_057506 1.09 2.10E04 1.25E04 8.45E05 1.77E02 SULF1 NP_055985 0.85 1.11E05 6.48E06 4.57E06 1.85E02 ERG NP_001129626 0.36 2.57E05 1.33E05 1.24E05 1.92E02 MAP3K12 NP_006292 0.88 1.80E05 1.04E05 7.59E06 1.97E02 EIF4E3 NP_001128123 0.20 2.58E05 1.35E05 1.23E05 2.01E02 ANKRD42 NP_872409 1.25 3.12E05 2.07E05 1.05E05 2.04E02 ZNHIT6 NP_060423 0.38 7.97E05 1.50E05 6.48E05 2.20E02 LBR NP_002287 0.90 1.08E05 4.98E06 5.83E06 2.21E02 EEF1A1 NP_001393 1.30 1.81E03 1.44E03 3.64E04 2.21E02 RFTN1 NP_055965 0.54 3.05E04 1.25E04 1.79E04 2.25E02 MAP7D2 NP_001161937 0.60 2.26E05 1.26E05 1.00E05 2.27E02 PXDN NP_036425 0.73 5.53E06 3.89E06 1.64E06 2.31E02 NAPIL1 NP_004528 0.50 1.93E05 8.63E06 1.07E05 2.35E02 CSMD2 NP_443128 0.33 8.05E05 5.85E05 2.21E05 2.39E02 CMYA5 NP_705838 0.69 4.96E05 3.41E05 1.55E05 2.42E02 ANKS1B NP_690001 0.82 2.50E04 2.06E04 4.33E05 2.51E02 C3orf70 NP_001020437 0.91 5.92E05 1.97E05 3.95E05 2.64E02 WAC NP_567823 0.90 1.16E03 7.24E04 4.41E04 2.65E02 ATP6V0A1 NP_001123493 0.93 5.56E05 3.58E05 1.98E05 2.69E02 DPM1 NP_003850 0.35 9.42E05 4.33E05 5.09E05 2.72E02 SNX18 NP_001138899 0.23 1.32E05 9.50E06 3.69E06 2.74E02 CYP2U1 NP_898898 1.06 3.03E05 2.67E05 3.66E06 2.78E02 HNRNPA1 NP_002127 1.11 6.01E05 4.06E05 1.94E05 2.80E02 MYO5B NP_001073936 0.64 4.18E04 1.79E04 2.38E04 2.82E02 AFTPH NP_060127 1.31 2.39E05 8.29E06 1.56E05 2.85E02 NECAB3 NP_112509 0.71 5.21E06 4.05E06 1.16E06 2.96E02 AP4E1 NP_031373 0.28 1.63E05 9.88E06 6.44E06 2.97E02 INSM2 NP_115983 1.00 7.83E05 5.52E05 2.31E05 3.04E02 CASP1 NP_150637 1.22 9.13E05 8.01E05 1.12E05 3.09E02 PDE4A NP_006193 0.44 3.28E05 1.91E05 1.37E05 3.10E02 VANGL2 NP_065068 0.28 2.13E05 1.59E05 5.36E06 3.10E02 ARHGAP11A NP_055598 1.19 3.57E05 2.67E05 9.02E06 3.11E02 CGNL1 NP_116255 0.72 2.45E05 2.08E05 3.77E06 3.15E02 CLUL1 NP_055225 1.19 1.31E05 9.54E06 3.52E06 3.38E02 KIF5C NP_004513 0.68 3.74E05 2.77E05 9.65E06 3.40E02 PPP1R12A NP_001137357 1.09 1.25E04 8.27E05 4.26E05 3.42E02 DOCK5 NP_079216 0.80 1.15E05 6.57E06 4.96E06 3.42E02 SNRPD3 NP_004166 0.50 5.81E05 3.88E05 1.93E05 3.45E02 PPP1R9A NP_001159633 0.23 1.44E05 5.21E06 9.20E06 3.87E02 RBM20 NP_001127835 0.48 2.52E05 1.78E05 7.44E06 4.00E02 AHCTF1 NP_056261 1.10 1.25E04 1.01E04 2.43E05 4.08E02 PYGB NP_002853 0.31 3.97E06 1.59E06 2.38E06 4.22E02 CAB39L NP_112187 0.44 1.99E05 1.25E05 7.32E06 4.40E02 TBC1D22B NP_060242 0.36 4.74E05 2.69E05 2.05E05 4.53E02 MAP4K2 NP_003609 1.22 4.64E05 3.07E05 1.57E05 4.55E02 ZC3H11A NP_055642 0.87 1.57E04 8.50E05 7.22E05 4.59E02 FAM193A NP_003695 0.40 9.01E05 5.01E05 3.99E05 4.70E02 POSTN NP_006466 0.71 2.83E04 2.17E04 6.56E05 4.71E02 PCDH15 NP_001136239 0.87 1.09E05 7.87E06 3.00E06 4.72E02 CEP350 NP_055625 1.15 7.84E05 6.00E05 1.84E05 4.94E02 PDCD6 NP_037364 0.49 5.74E06 3.26E06 2.48E06 4.97E02 mir-20a-5p (MIMAT0000075) SH3GLB1 NP_057093 0.44 1.92E05 6.38E06 1.28E05 1.18E04 DNAU1 NP_003453 0.20 3.16E05 1.51E05 1.65E05 1.61E04 LCA5L NP_689718 0.32 5.13E05 1.36E05 3.77E05 1.87E04 CCDC141 NP_775919 0.46 1.84E05 8.26E06 1.01E05 3.15E04 RCN2 NP_002893 0.21 1.11E05 6.78E06 4.30E06 3.58E04 IGFBP7 NP_001544 0.23 1.20E05 4.12E06 7.89E06 3.70E04 CA10 NP_001076002 0.66 2.84E05 7.68E06 2.08E05 4.35E04 ZEB2 NP_055610 0.56 3.21E05 8.87E06 2.32E05 5.33E04 KIAA1598 NP_060800 1.25 5.37E05 3.34E05 2.03E05 5.48E04 NUP205 NP_055950 1.28 2.54E05 1.12E05 1.43E05 5.66E04 MAP2 NP_002365 0.33 8.61E05 3.58E05 5.03E05 5.76E04 FGD5 NP_689749 1.19 1.52E05 9.77E06 5.40E06 6.26E04 COL15A1 NP_001846 0.83 3.44E05 1.26E05 2.18E05 7.09E04 AHNAK NP_001611 1.29 2.98E03 2.02E03 9.63E04 7.28E04 U2AF1 NP_001020374 0.24 7.00E05 3.10E05 3.90E05 9.26E04 TCTEX1D1 NP_689878 0.89 1.36E05 5.81E06 7.81E06 1.10E03 ESR1 NP_000116 0.40 3.86E05 1.47E05 2.39E05 1.11E03 KTN1 NP_001072989 0.31 2.25E04 1.51E04 7.40E05 1.18E03 ANTXR1 NP_444262 0.48 1.15E05 5.19E06 6.26E06 1.19E03 UBA6 NP_060697 0.35 2.59E05 1.32E05 1.27E05 1.24E03 TAOK2 NP_057235 1.12 1.14E04 7.57E05 3.85E05 1.25E03 VASP NP_003361 0.22 1.75E05 8.17E06 9.37E06 1.26E03 ATXN2 NP_002964 1.08 1.17E05 5.04E06 6.65E06 1.31E03 SIN3A NP_001138829 0.54 1.10E04 8.09E05 2.93E05 1.35E03 CHD2 NP_001262 0.78 4.19E05 1.49E05 2.70E05 1.49E03 RIT1 NP_006843 0.50 1.67E05 7.30E06 9.41E06 1.52E03 RB1 NP_000312 0.72 3.99E04 2.18E04 1.81E04 1.56E03 HN1 NP_057269 1.29 1.86E05 9.90E06 8.73E06 1.64E03 SUV39H2 NP_001180353 0.48 4.11E04 2.37E04 1.74E04 1.80E03 CHD4 NP_001264 0.73 9.12E06 2.78E06 6.34E06 1.97E03 ARID5B NP_115575 0.30 2.46E05 1.97E05 4.90E06 2.14E04 DYNC1LI2 NP_006132 1.14 2.42E05 1.46E05 9.64E06 2.14E03 FTL NP_000137 0.64 8.54E06 3.95E06 4.59E06 2.24E03 TGM2 NP_004604 1.09 2.95E04 2.21E04 7.42E05 2.46E03 ETF1 NP_004721 0.30 3.52E05 2.30E05 1.22E05 2.47E03 CCT5 NP_036205 0.44 3.76E09 2.72E05 1.04E05 2.60E03 NEB NP_001157980 0.24 4.45E04 2.92E04 1.53E04 2.63E03 ARID1B NP_059989 0.98 2.15E04 1.20E04 9.52E05 2.93E03 DSTYK NP_955749 0.24 1.00E04 4.89E05 5.15E05 3.28E03 ANKRD11 NP_037407 0.23 4.89E05 3.12E05 1.78E05 3.56E03 TRIM22 NP_006065 0.99 8.68E06 3.86E06 4.82E06 3.69E03 CHD9 NP_079410 1.00 4.29E04 9.94E05 3.30E04 3.92E03 PDE8A NP_002596 0.24 8.89E05 6.25E05 2.64E05 4.05E03 PBBP6 NP_008841 0.43 2.61E05 1.61E05 1.00E05 4.07E03 GPD2 NP_001076581 0.29 7.59E05 2.22E05 5.37E05 4.20E03 ZHX2 NP_055758 0.76 5.23E05 3.02E05 2.21E05 4.43E03 CTSA NP_001121167 0.34 4.21E05 3.13E05 1.08E05 4.60E03 CCDC88A NP_001129069 0.83 9.08E05 6.46E05 2.62E05 4.77E03 TIAM1 NP_003244 1.25 6.62E05 3.46E05 3.16E05 4.82E03 TOPORS NP_005793 1.08 2.14E04 1.49E04 6.42E05 4.91E03 ACCS NP_115981 0.47 1.63E05 9.45E06 6.80E06 4.91E03 NPM1 NP_002511 1.05 5.48E05 2.47E05 3.01E05 5.35E03 JAK3 NP_000206 0.65 2.73E05 1.11E05 1.62E05 5.41E03 MSR1 NP_619729 1.11 3.63E05 2.64E05 9.85E06 5.53E03 RPS6KA5 NP_004746 1.29 5.24E05 1.51E05 3.73E05 6.19E03 CIR1 NP_004873 0.22 2.56E05 9.07E06 1.65E05 6.52E03 HNRNPC NP_112604 0.97 1.38E04 6.56E05 7.23E05 6.56E03 NDUFA4 NP_002480 1.00 9.62E06 7.11E06 2.52E06 6.68E03 HSPA8 NP_006588 1.28 7.15E04 5.35E04 1.79E04 7.09E03 SEPT2 NP_004395 1.01 1.94E04 1.50E04 4.31E05 7.52E03 FLG2 NP_001014364 0.33 1.98E05 1.42E05 5.58E06 7.83E03 COQ2 NP_056512 0.62 6.27E05 4.40E05 1.86E05 8.19E03 PAFAH1B2 NP_002563 0.34 2.13E05 1.48E05 6.49E06 8.43E03 NKTR NP_005376 0.31 1.04E04 7.38E05 3.07E05 8.45E03 PLEKHO2 NP_001181988 0.40 4.92E05 3.09E05 1.83E05 8.52E03 SEC24D NP_055637 0.63 3.76E05 2.56E05 1.21E05 8.52E03 UMAN1 NP_005561 0.37 2.14E04 1.42E04 7.19E05 9.04E03 ZNF362 NP_689706 0.84 2.62E05 8.99E06 1.73E05 9.47E03 FBXO30 NP_115521 0.60 1.44E05 6.49E06 7.90E06 9.70E03 GKAP1 NP_001129425 0.70 2.58E05 1.20E05 1.38E05 9.93E03 RBL1 NP_899662 0.77 2.40E05 1.08E05 1.32E05 9.96E03 MAGI3 NP_001136254 1.21 6.99E05 4.91E05 2.08E05 1.00E02 RAB5B NP_002859 0.96 4.41E04 3.03E04 1.38E04 1.03E02 PDIK1L NP_690048 0.93 1.71E05 6.95E06 1.02E05 1.08E02 CALD1 NP_149129 1.32 4.01E04 2.30E04 1.71E04 1.13E02 IKBIP NP_710154 0.84 1.08E04 6.84E05 3.96E05 1.15E02 H2AFV NP_619541 0.31 7.13E06 3.77E06 3.36E06 1.17E02 TMCC1 NP_001017395 0.47 9.96E05 1.66E05 8.31E05 1.24E02 SORL1 NP_003096 0.81 3.49E05 2.19E05 1.29E05 1.35E02 KIAA1109 NP_056127 0.21 2.99E04 2.46E04 5.31E05 1.40E02 KCNJ8 NP_004973 0.85 1.61E05 8.29E06 7.83E06 1.46E02 VASH2 NP_001129947 0.47 1.92E04 9.82E05 9.34E05 1.51E02 IQCE NP_689771 0.20 8.70E05 4.53E05 4.18E05 1.53E02 LATS2 NP_055387 0.21 1.61E04 1.04E04 5.65E05 1.57E02 IFRD1 NP_001541 0.90 1.05E04 8.19E05 2.34E05 1.57E02 TRPS1 NP_054831 0.25 6.73E05 5.49E05 1.24E05 1.60E02 NEFH NP_066554 0.22 2.58E05 1.94E05 6.45E06 1.65E02 ACSM5 NP_060358 0.37 8.77E05 5.29E05 3.47E05 1.68E02 BDH1 NP_976059 0.50 3.36E05 2.66E05 6.98E06 1.74E02 MTHFD1 NP_005947 0.98 5.37E05 4.33E05 1.03E05 1.76E02 CCDC150 NP_001074008 0.27 5.16E05 4.72E05 4.38E06 1.77E02 BTF3 NP_001032726 0.20 1.83E05 1.47E05 3.53E06 1.80E02 TACC2 NP_008928 0.91 2.17E05 1.54E05 6.30E06 1.82E02 SULF1 NP_055985 0.65 1.11E05 6.48E06 4.57E06 1.85E02 SMARCA5 NP_003592 0.32 2.66E04 1.80E04 8.64E05 1.89E02 CHGA NP_001266 0.63 3.87E05 2.07E05 1.80E05 1.91E02 ERG NP_001129626 0.79 2.57E05 1.33E05 1.24E05 1.92E02 EPB41L4B NP_060894 0.70 2.20E05 1.54E05 6.58E06 1.94E02 MAP3K12 NP_006292 0.63 1.80E05 1.04E05 7.59E06 1.97E02 ANKRD42 NP_872409 0.44 3.12E05 2.07E05 1.05E05 2.04E02 SYNC NP_001155180 0.44 2.68E04 1.83E04 8.50E05 2.05E02 SYNE2 NP_878918 0.51 1.38E04 1.02E04 3.66E05 2.08E02 PLIN1 NP_001138783 0.51 5.44E06 3.29E06 2.16E06 2.14E02 UBE3C NP_055486 1.29 2.87E05 2.02E05 8.44E06 2.15E02 PXDN NP_036425 0.98 5.53E06 3.89E06 1.64E06 2.31E02 MAP7D3 NP_078873 0.64 6.86E06 5.91E06 9.46E07 2.35E02 NAP1L1 NP_004528 0.24 1.93E05 8.63E06 1.07E05 2.35E02 CD109 NP_598000 0.44 3.01E05 1.72E05 1.28E05 2.44E02 ANKS1B NP_690001 1.06 2.50E04 2.06E04 4.33E05 2.51E02 SEZ6 NP_849191 0.48 4.24E05 2.42E05 1.81E05 2.58E02 GAK NP_005246 0.25 6.45E05 2.78E05 3.67E05 2.63E02 WAC NP_567823 0.92 1.16E03 7.24E04 4.41E04 2.65E02 CYP2U1 NP_898898 0.58 3.03E05 2.67E05 3.66E06 2.78E02 MYO5B NP_001073936 0.79 4.18E04 1.79E04 2.38E04 2.82E02 DPP8 NP_569118 0.38 5.25E05 2.21E05 3.04E05 2.83E02 NECAB3 NP_112509 0.21 5.21E06 4.05E06 1.16E06 2.96E02 GOLGB1 NP_004478 0.34 1.10E05 5.72E06 5.31E06 2.96E02 AP4E1 NP_031373 0.99 1.63E05 9.88E06 6.44E06 2.97E02 KAT2B NP_003875 1.10 4.13E04 3.74E04 3.89E05 3.12E02 DDX5 NP_004387 0.89 3.92E05 2.32E05 1.60E05 3.15E02 PDIA5 NP_006801 0.40 3.02E05 1.97E05 1.06E05 3.28E02 SETDB2 NP_001153780 0.30 9.39E05 6.74E05 2.64E05 3.37E02 CLUL1 NP_055225 0.44 1.31E05 9.54E06 3.52E06 3.38E02 KIF5C NP_004513 0.66 3.74E05 2.77E05 9.65E06 3.40E02 PPP1R12A NP_001137357 1.02 1.25E04 8.27E05 4.26E05 3.42E02 DOCKS NP_079216 0.40 1.15E05 6.57E06 4.96E06 3.42E02 ZMYM1 NP_079048 0.70 9.78E05 5.86E05 3.92E05 3.44E02 SNRPD3 NP_004166 0.32 5.81E05 3.88E05 1.93E05 3.45E02 CPNE1 NP_690904 0.89 2.21E05 1.71E05 4.99E06 3.47E02 KIF23 NP_004847 1.22 3.96E06 1.79E06 2.17E06 3.52E02 TAGAP NP_473455 0.94 4.99E05 3.21E05 1.78E05 3.69E02 BCL6 NP_001124317 0.32 2.67E05 2.01E05 6.50E06 3.80E02 ZEB1 NP_001121600 0.32 7.96E06 5.67E06 2.29E06 3.82E02 RBM20 NP_001127835 0.82 2.52E05 1.78E05 7.44E06 4.00E02 AHCTF1 NP_056261 1.06 1.25E04 1.01E04 2.43E05 4.08E02 LASP1 NP_006139 0.36 5.47E05 4.39E05 1.09E05 4.14E02 TLR8 NP_619542 0.72 8.64E06 4.37E06 4.27E06 4.20E02 EXOSC3 NP_057126 1.08 3.52E05 2.12E05 1.39E05 4.23E02 KLHL2 NP_001154993 1.08 4.48E05 1.86E05 2.62E05 4.33E02 CAB39L NP_112187 0.44 1.99E05 1.25E05 7.32E06 4.40E02 RALYL NP_001093861 1.19 3.22E05 1.78E05 1.45E05 4.43E02 CENPBD1 NP_659476 0.42 1.09E05 8.18E06 2.70E05 4.49E02 PIP4K2C NP_001139731 0.52 4.63E05 3.60E05 1.03E05 4.54E02 SKI NP_003027 0.59 1.92E05 1.43E05 4.92E06 4.56E02 ZC3H11A NP_055642 0.23 1.57E04 8.50E05 7.22E05 4.59E02 DPY19L1 NP_056098 0.23 3.63E05 2.16E05 1.47E05 4.62E02 ZNF528 NP_115799 0.49 1.74E05 9.52E06 7.87E06 4.67E02 PCDH15 NP_001136239 0.77 1.09E05 7.87E06 3.00E06 4.72E02 PRDM6 NP_001129711 1.22 1.93E04 1.51E04 4.26E05 4.72E02 FAF2 NP_055428 0.46 9.62E06 8.20E06 1.42E06 4.90E02 TMEM87A NP_056312 0.21 2.92E05 2.12E05 8.01E05 4.95E02 mir-100-5p (MIMAT0000098) EPDR1 NP_060019 0.37 2.78E05 1.43E05 1.35E05 9.83E05 CCDC141 NP_775919 0.59 1.84E05 8.26E06 1.01E05 3.15E04 ST5 NP_631896 0.36 2.01E05 5.56E06 1.45E05 1.28E03 TARDBP NP_031401 0.92 2.35E05 1.80E05 5.47E06 3.25E03 HNRNPH2 NP_062543 0.41 3.11E05 1.32E05 1.79E05 5.38E03 PTPRN2 NP_570857 0.21 4.39E05 2.90E05 1.49E05 5.59E03 VNN1 NP_004657 0.97 6.24E06 3.95E06 2.29E06 1.35E02 SMARCA5 NP_003592 1.27 2.66E04 1.80E04 8.64E05 1.89E02 HOXA1 NP_005513 0.84 2.82E06 1.53E06 1.30E06 3.08E02 NOP56 NP_006383 0.29 8.98E05 6.46E05 2.52E05 3.27E02 TBC1D22B NP_060242 0.51 4.74E05 2.69E05 2.05E05 4.53E02 mir-125b-5p (MIMAT0000423) PLCB2 NP_004564 0.44 1.96E05 1.38E05 5.79E06 1.27E05 COL1A2 NP_000080 0.37 8.86E04 4.01E04 4.85E04 1.98E04 ACSBG2 NP_112186 0.40 1.96E05 9.43E06 1.02E05 3.52E04 ZEB2 NP_055610 0.59 3.21E05 8.87E06 2.32E05 5.33E04 KIAA1598 NP_060800 0.55 5.37E05 3.34E05 2.03E05 5.48E04 CALCA NP_001029124 0.52 3.54E04 1.72E04 1.81E04 1.28E03 EXOSC10 NP_001001998 0.65 5.72E05 4.32E05 1.40E05 1.42E03 RIT1 NP_008843 0.51 1.67E05 7.30E06 9.41E05 1.52E03 RB1 NP_000312 0.51 3.99E04 2.18E04 1.81E04 1.56E03 MUC5B NP_002449 0.21 4.56E05 2.80E05 1.76E05 1.84E03 ZC3H13 NP_055885 0.36 8.71E06 3.87E06 4.84E06 2.54E03 HIVEP2 NP_006725 0.38 1.31E04 8.79E05 4.35E05 3.01E03 NAIF1 NP_931045 0.25 1.89E05 1.24E05 6.51E06 4.23E03 SLC25A35 NP_958928 0.99 3.38E05 1.70E05 1.69E05 4.77E03 CASC3 NP_031385 0.26 1.08E04 5.58E05 5.20E05 5.14E03 PLIN3 NP_005808 0.32 1.89E05 1.49E05 3.94E06 5.70E03 ARNTL NP_001025444 0.75 8.34E05 4.87E05 3.48E05 6.16E03 AKR1S1 NP_005980 0.40 4.21E05 2.83E06 3.92E05 6.39E03 RGAG1 NP_065820 0.32 7.88E06 5.32E06 2.57E06 7.03E03 TRIO NP_009049 0.83 3.60E05 1.71E05 1.89E05 7.69E03 KIAA1B41 NP_001123465 0.62 4.35E05 2.68E05 1.67E05 8.98E03 CDK5RAP2 NP_060719 0.72 4.41E05 2.89E05 1.52E05 9.06E03 ITSN1 NP_001001132 0.26 1.95E05 7.95E06 1.15E05 9.45E03 EML6 NP_001034842 0.29 3.57E05 2.41E05 1.16E05 1.01E02 TOMM40 NP_006105 0.21 4.57E05 2.96E05 1.61E05 1.13E02 IKBIP NP_710154 0.38 1.08E04 6.84E05 3.96E05 1.15E02 MYO15A NP_057323 0.42 4.59E05 3.44E05 1.15E05 1.33E02 ARHGEF2 NP_004714 0.33 2.66E04 1.75E04 9.17E05 1.46E02 VASH2 NP_001129947 0.49 1.92E04 9.82E05 9.34E05 1.51E02 TRPS1 NP_054831 0.31 6.73E05 5.49E05 1.24E05 1.60E02 BDH1 NP_976059 0.47 3.36E05 2.66E05 6.98E06 1.74E02 RNF141 NP_057506 0.77 2.10E04 1.25E04 8.45E05 1.77E02 HNRNPA2B1 NP_112533 0.32 1.33E04 7.21E05 6.06E05 1.84E02 PDZD3 NP_079067 1.09 4.08E05 7.18E06 3.36E05 1.93E02 MAP3K12 NP_006292 0.21 1.80E05 1.04E05 7.59E06 1.97E02 PNPT1 NP_149100 0.90 1.12E05 7.93E06 3.30E06 1.99E02 MTMR14 NP_001070993 0.78 1.15E05 0.00E+00 1.15E05 2.00E02 ANKRD42 NP_872409 1.11 3.12E05 2.07E05 1.05E05 2.04E02 PTPRS NP_002841 0.28 1.16E05 4.98E06 6.62E06 2.40E02 ANPEP NP_001141 0.32 6.21E04 5.01E04 1.20E04 2.44E02 CYP24A1 NP_000773 0.73 3.33E04 2.35E04 9.80E05 2.90E02 NECAB3 NP_112509 0.39 5.21E06 4.05E06 1.16E06 2.96E02 GOLGB1 NP_004478 0.23 1.10E05 5.72E06 5.31E06 2.96E02 ENTPD1 NP_001767 0.22 3.15E05 2.39E05 7.61E06 3.01E02 PPCDC NP_068595 0.29 1.78E05 1.41E05 3.69E06 3.17E02 GMIP NP_057657 0.41 2.21E05 1.71E05 4.99E06 3.47E02 KIF23 NP_004847 0.45 3.96E06 1.79E06 2.17E06 3.52E02 RBM20 NP_001127835 0.79 2.52E05 1.78E05 7.44E06 4.00E02 PCDH15 NP_001136239 0.38 1.09E05 7.87E05 3.00E06 4.72E02 PDCD6 NP_037364 0.63 5.74E06 3.26E06 2.48E06 4.97E02 mir-92a-1-5p (MIMAT0004507) YWHAH NP_003396 0.24 6.61E05 1.92E05 4.68E05 8.56E06 COL1A1 NP_000079 0.75 2.23E03 6.76E04 1.55E03 7.25E05 ABCA5 NP_758424 0.39 2.19E05 1.82E06 1.40E05 9.05E05 CNTN5 NP_780775 0.20 1.04E04 2.67E05 7.73E05 1.95E04 VIM NP_003371 0.29 5.05E02 3.74E02 1.31E02 2.04E04 LMO7 NP_056667 0.25 1.74E05 7.66E06 9.71E06 4.43E04 ANO10 NP_060545 0.27 4.65E05 2.48E05 2.18E05 6.53E04 ANXA2 NP_001129487 0.30 7.03E03 4.42E03 2.61E03 1.26E03 LRCH4 NP_002310 0.50 4.52E05 2.59E05 1.93E05 1.30E03 ATXN2 NP_002964 0.25 1.17E05 5.04E06 6.65E06 1.31E03 SIN3A NP_001138829 0.39 1.10E04 8.09E05 2.93E05 1.35E03 CHD2 NP_001262 0.43 4.19E05 1.49E05 2.70E05 1.49E03 PPEF2 NP_006230 0.29 4.69E05 2.04E05 2.65E05 1.78E03 CANX NP_001737 0.39 6.95E04 4.89E04 2.06E04 2.12E03 FTL NP_000137 0.50 8.54E06 3.95E06 4.59E06 2.24E03 HNRNPK NP_112553 0.91 3.12E04 1.97E04 1.15E04 2.68E03 MECOM NP_001098547 1.28 2.44E05 1.48E05 9.65E06 2.74E03 FA2H NP_077282 0.25 1.67E04 8.13E05 8.53E05 3.09E03 NETO1 NP_620416 0.84 2.85E05 1.99E05 8.57E06 3.44E03 HNRNPUL1 NP_008971 0.42 3.21E05 1.89E05 1.32E05 3.66E03 PLCXD2 NP_695000 0.25 2.19E05 1.50E05 6.91E06 3.92E03 BGN NP_001702 0.22 8.52E05 6.24E05 2.28E05 4.83E03 NFYC NP_055038 0.23 1.29E04 4.74E05 8.18E05 4.89E03 HUWE1 NP_113584 0.34 1.66E04 1.18E04 4.77E05 5.01E03 JAK3 NP_000206 0.35 2.73E05 1.11E05 1.62E05 5.41E03 RRBP1 NP_004578 0.32 1.90E04 1.31E04 5.93E05 5.62E03 SEC24C NP_940999 0.51 2.01E04 1.09E04 9.14E05 5.67E03 PPM1K NP_689755 0.48 1.85E05 1.20E05 6.48E05 5.71E03 HAVCR2 NP_116171 0.72 2.08E05 1.18E05 9.02E05 6.39E03 LMAN2 NP_006807 1.18 4.87E05 3.50E05 1.36E05 7.56E03 KIAA1841 NP_001123465 1.04 4.35E05 2.68E05 1.67E05 8.98E03 CDK5RAP2 NP_060719 0.23 4.41E05 2.89E05 1.52E05 9.06E03 CRKL NP_005198 0.27 1.82E05 1.50E05 3.17E06 9.78E03 HDAC1 NP_004955 0.61 7.01E04 5.89E04 1.12E04 1.02E02 CALD1 NP_149129 0.24 4.01E04 2.30E04 1.71E04 1.13E02 NLRC3 NP_849172 0.28 2.54E05 1.32E05 1.22E05 1.16E02 RPTN NP_001116437 0.41 3.03E05 1.89E05 1.14E05 1.57E02 TRPS1 NP_054831 0.92 6.73E05 5.49E05 1.24E05 1.60E02 PDZRN3 NP_055824 0.38 1.62E05 1.11E05 5.11E06 1.66E02 VAT1 NP_006364 0.39 3.54E04 2.80E04 7.40E05 1.67E02 TAF15 NP_631961 0.92 2.13E05 1.39E05 7.48E06 1.86E02 TJAP1 NP_001139489 0.35 1.13E05 7.93E06 3.34E06 1.88E02 ERG NP_001129626 0.25 2.57E05 1.33E05 1.24E05 1.92E02 DPYSL3 NP_001378 0.70 4.92E05 4.25E05 6.66E06 2.04E02 PLIN1 NP_001138783 0.55 5.44E06 3.29E06 2.16E06 2.14E02 ADCY4 NP_640340 0.21 5.82E05 3.42E05 2.39E05 2.46E02 ANKS1B NP_690001 0.35 2.50E04 2.06E04 4.33E05 2.51E02 PPFIA4 NP_055868 0.71 6.09E06 3.38E06 2.70E06 2.57E02 DNAH5 NP_001360 1.06 1.68E04 1.00E04 6.79E05 2.57E02 CYP2B6 NP_000758 0.48 1.25E04 1.02E04 2.37E05 2.64E02 PPARGC1B NP_001166170 0.29 4.56E04 2.20E04 2.36E04 2.76E02 FGD6 NP_060821 0.29 2.34E04 1.85E04 4.90E05 2.86E02 INTS4 NP_291025 0.26 7.03E05 4.90E05 2.12E05 2.87E02 GALM NP_620156 1.00 4.36E05 2.69E05 1.67E05 2.95E02 PCOLCE NP_002584 0.39 2.64E05 1.90E05 7.33E05 3.01E02 CPNE1 NP_690904 0.34 2.21E05 1.71E05 4.99E06 3.47E02 NCSTN NP_056146 0.35 3.96E06 2.91E06 1.05E06 3.85E02 C12orf54 NP_689532 0.27 1.44E05 5.22E06 9.19E06 3.87E02 EBPL NP_115954 0.66 1.71E04 1.13E04 5.88E05 4.00E02 BEST2 NP_060152 0.37 3.37E05 2.02E05 1.35E05 4.13E02 TBC1D22B NP_060242 0.58 4.74E05 2.69E05 2.05E05 4.53E02 SKI NP_003027 0.27 1.92E05 1.43E05 4.92E06 4.56E02 let-7a-2-3p (MIMAT0010195) YWHAH NP_003396 0.58 6.61E05 1.92E05 4.68E05 8.56E06 PLCB2 NP_004564 0.46 1.96E05 1.38E05 5.97E06 1.27E05 DNAJA2 NP_005871 0.32 5.65E06 3.04E06 2.61E06 2.88E05 CASS4 NP_065089 0.86 3.14E05 2.08E05 1.06E05 4.54E05 PCSK6 NP_612193 0.77 3.60E05 1.05E05 2.55E05 6.86E05 ELF1 NP_001138825 0.21 5.78E05 1.47E05 4.31E05 1.24E04 COL10A1 NP_000484 0.22 1.90E05 1.02E05 8.82E06 1.39E04 ANXA7 NP_001147 0.26 3.71E05 7.51E06 2.96E05 1.93E04 ZEB2 NP_055610 0.65 3.21E05 8.87E06 2.32E05 5.33E04 LRBA NP_006717 0.70 5.36E05 3.31E05 2.05E05 5.55E04 DST NP_056363 0.28 4.49E05 2.06E05 2.43E05 6.40E04 AHNAK NP_001611 1.14 2.98E03 2.02E03 9.63E4 7.28E04 DNM3 NP_001129599 0.38 3.87E05 2.77E05 1.09E05 7.91E04 NAPA NP_003818 0.48 6.33E04 4.23E04 2.10E04 9.95E04 CDH11 NP_001788 0.81 1.18E05 5.32E06 6.52E06 1.05E03 TCTEX1D1 NP_689878 0.64 1.36E05 5.81E06 7.81E06 1.10E03 ESR1 NP_000116 0.21 3.86E05 1.47E05 2.39E05 1.11E03 KTN1 NP_001072989 0.30 2.25E04 1.51E04 7.40E05 1.18E03 ANTXR1 NP_444262 0.28 1.15E05 5.19E06 6.26E06 1.19E03 CS NP_004068 1.16 1.49E04 8.20E05 6.70E05 1.20E03 KLHL7 NP_001165899 0.94 2.59E05 1.32E05 1.27E05 1.24E03 UBAG NP_060597 0.23 2.59E05 1.32E05 1.27E05 1.24E03 THAP11 NP_065190 1.34 5.92E05 3.28E05 2.63E05 1.30E03 LRCH4 NP_002310 0.46 4.52E05 2.59E05 1.93E05 1.30E03 RB1 NP_000312 1.17 3.99E04 2.18E04 1.81E04 1.56E03 GRB10 NP_005302 0.72 1.86E05 9.90E06 8.73E06 1.62E03 HN1 NP_057269 0.98 1.86E05 9.90E06 8.73E06 1.64E03 NCBP1 NP_002477 0.30 1.11E03 5.55E04 5.51E04 1.75E03 PLEKHAS NP_001137293 0.57 3.64E04 2.05E04 1.60E04 1.76E03 H1F0 NP_005309 0.63 6.34E03 2.55E03 3.78E03 1.93E03 DYNC1U2 NP_006132 0.53 2.42E05 1.46E05 9.64E06 2.14E03 ZNF10 NP_056209 0.59 3.19E05 1.85E05 1.34E05 2.40E03 RC3H2 NP_001094058 0.23 2.38E04 9.35E05 1.44E04 2.44E03 GTF2IRD1 NP_005676 0.77 2.30E05 4.49E06 1.85E05 2.46E03 COL3A1 NP_000081 0.81 6.74E04 4.16E04 2.58E04 2.49E03 ZC3H13 NP_055885 1.04 8.71E06 3.87E06 4.84E06 2.54E03 HNRNPK NP_112553 0.26 3.12E04 1.97E04 1.15E04 2.68E03 MECOM NP_001098547 0.34 2.44E05 1.48E05 9.65E06 2.74E03 FAM178A NP_001129595 0.21 3.30E05 2.15E05 1.15E05 2.92E03 ARID1B NP_059989 0.53 2.15E04 1.20E04 9.52E05 2.93E03 HIVEP2 NP_006725 0.55 1.31E04 8.79E05 4.35E05 3.01E03 ANKRD11 NP_037407 0.81 4.89E05 3.12E05 1.78E05 3.56E03 SP140 NP_009168 0.30 2.28E05 1.50E05 7.79E06 3.63E03 SRP72 NP_008878 0.31 2.90E05 2.02E05 8.86E06 3.80E03 ARHGAP36 NP_659404 0.95 7.17E05 5.47E05 1.70E05 3.92E03 RBBP6 NP_008841 0.33 2.61E05 1.61E05 1.00E05 4.07E03 CCDC88A NP_001129069 0.39 9.08E05 6.46E05 2.62E05 4.77E03 PSIP1 NP_001121689 0.40 1.86E05 1.20E05 6.55E06 4.77E03 PKP4 NP_003619 0.25 3.67E04 2.64E04 1.03E04 5.07E03 HNRNPH2 NP_062543 0.83 3.11E05 1.32E05 1.79E05 5.38E03 METTL6 NP_689609 0.38 3.63E05 2.65E05 9.81E06 5.44E03 PPM1K NP_689755 0.27 1.85E05 1.20E05 6.48E06 5.71E03 AKAP12 NP_005091 0.51 1.08E04 7.54E05 3.26E05 5.86E03 STAC2 NP_945344 0.23 1.84E05 1.33E05 5.12E06 6.01E03 NPVF NP_071433 0.78 2.44E05 1.16E05 1.28E05 6.07E03 RPS6KAS NP_004746 0.40 5.24E05 1.51E05 3.73E05 6.19E03 SUZ12 NP_056170 0.38 2.65E05 1.54E05 1.12E05 6.65E03 EIF4ENIF1 NP_062817 1.14 7.04E05 4.89E05 2.15E05 7.11E03 MMRN2 NP_079032 0.87 1.06E05 3.89E06 6.70E06 7.43E03 TRIO NP_009049 0.78 3.60E05 1.71E05 1.89E05 7.69E03 FLG2 NP_001014364 1.24 1.98E05 1.42E05 5.58E06 7.83E03 PAFAH1B2 NP_002563 0.88 2.13E05 1.48E05 6.49E06 8.43E03 TPM3 NP_705935 0.89 7.60E05 5.26E05 2.34E05 8.49E03 SEC24D NP_055637 0.44 3.76E05 2.56E05 1.21E05 8.52E03 DOCK8 NP_001177387 0.37 8.39E06 2.33E06 6.06E06 8.83E03 KIAA1841 NP_001123465 1.24 4.35E05 2.68E05 1.67E05 8.98E03 ITSN1 NP_001001132 0.80 1.95E05 7.95E06 1.15E05 9.45E03 MED13L NP_056150 0.99 8.49E05 4.77E05 3.72E05 9.63E03 RAB5B NP_002859 0.37 4.41E04 3.03E04 1.38E04 1.03E02 ZNF518A NP_055618 0.93 9.54E04 4.97E04 4.56E04 1.04E02 KIDINS220 NP_065789 0.31 4.02E05 2.65E05 1.36E05 1.12E02 SYT13 NP_065877 0.52 1.06E04 4.56E05 6.00E05 1.12E02 CALD1 NP_149129 0.23 4.01E04 2.30E04 1.71E04 1.13E02 ATP8A1 NP_006086 0.22 1.06E04 4.58E05 5.98E05 1.14E02 IKBIP NP_710154 0.38 1.08E04 6.84E05 3.96E05 1.15E02 UBE2F NP_542409 0.68 1.33E05 5.30E06 7.98E06 1.33E02 SORL1 NP_002096 0.25 3.49E05 2.19E05 1.29E05 1.35E02 IFRD1 NP_001541 0.45 1.05E04 8.19E05 2.34E05 1.57E02 AKAP1 NP_003479 0.97 2.57E05 1.36E05 1.20E05 1.57E02 TRPS1 NP_054831 0.37 6.73E05 5.49E05 1.24E05 1.60E02 RALGAPA1 NP_055805 0.66 6.20E05 4.65E05 1.55E05 1.67E02 TMEM131 NP_056163 0.77 3.41E05 2.31E05 1.10E05 1.68E02 RNF141 NP_057506 0.57 2.10E04 1.25E04 8.45E05 1.77E02 BTF3 NP_001032726 1.01 1.83E05 1.47E05 3.53E06 1.80E02 HNRNPA2B1 NP_112533 0.41 1.33E04 7.21E05 6.06E05 1.84E02 SULF1 NP_055985 1.07 1.11E05 6.48E06 4.57E06 1.85E02 SMARCA5 NP_0035925 1.28 2.66E04 1.80E04 8.64E05 1.89E02 S100A6 NP_055439 0.24 7.28E06 4.17E06 3.10E06 1.92E02 PICALM NP_009097 1.03 3.28E05 1.87E05 1.41E05 2.12E02 ZNHIT6 NP_060423 0.39 7.97E05 1.50E05 6.48E05 2.20E02 NAP1L1 NP_004528 0.53 1.93E05 8.63E06 1.07E05 2.35E02 ANP32B NP_006392 1.34 1.17E05 8.69E06 2.99E06 2.37E02 PSME4 NP_055429 0.42 1.37E05 9.08E06 4.58E06 2.41E02 NAAS0 NP_079422 0.24 3.77E05 2.07E05 1.71E05 2.43E02 HKDC1 NP_079406 0.30 1.14E05 3.39E06 8.06E06 2.48E02 GAK NP_005246 0.74 6.45E05 2.78E05 3.67E05 2.63E02 CORO1C NP_055140 0.77 4.36E04 2.07E04 2.29E04 2.63E02 CYP2B6 NP_000758 0.37 1.25E04 1.02E04 2.37E05 2.64E02 NODAL NP_060252 0.79 1.28E05 9.55E06 3.27E06 2.68E02 C5orf34 NP_940968 0.29 1.59E04 5.98E05 9.92E05 2.72E02 INVS NP_899068 0.61 6.32E05 4.35E05 1.97E05 2.73E02 ANO5 NP_001136121 0.44 5.54E06 2.55E06 2.99E06 2.91E02 HOXA1 NP_005513 1.07 2.82E06 1.53E06 1.30E06 3.08E02 VANGL2 NP_065068 1.31 2.13E05 1.59E05 5.36E06 3.10E02 ARHGAP11A NP_055598 0.96 3.57E05 2.67E05 9.02E06 3.11E02 SETDB2 NP_001153780 1.11 9.39E05 6.74E05 2.64E05 3.37E02 KIF5C NP_004513 0.71 3.74E05 2.77E05 9.65E06 3.40E02 DOCK5 NP_079216 0.43 1.15E05 6.57E06 4.96E06 3.42E02 PCBP4 NP_065151 0.78 2.36E05 1.54E05 8.20E06 3.43E02 PSMC6 NP_002797 0.27 1.59E04 1.11E04 4.72E05 3.45E02 NID1 NP_002499 0.86 2.41E05 1.01E05 1.40E05 3.46E02 KIF23 NP_004847 1.27 3.96E06 1.79E06 2.17E06 3.52E02 BCL6 NP_001124317 1.32 2.67E05 2.01E05 6.50E06 3.80E02 ZEB1 NP_001121600 1.05 7.96E06 5.67E06 2.29E06 3.82E02 FKBP11 NP_001137254 0.26 3.22E05 2.04E05 1.17E05 3.85E02 FBXO38 NP_110420 1.13 4.95E05 3.38E05 1.56E05 3.91E02 RBM20 NP_001127835 0.29 2.52E05 1.78E05 7.44E06 4.00E02 FBXO25 NP_036305 0.30 7.09E05 5.34E05 1.75E05 4.22E02 ST18 NP_055497 0.57 3.33E05 1.47E05 1.86E05 4.27E02 RALYL NP_001093861 1.30 3.22E05 1.78E05 1.45E05 4.43E02 MTM1 NP_000243 0.48 5.43E06 2.91E06 2.52E06 4.47E02 CENPBD1 NP_659476 0.33 1.09E05 8.18E06 2.70E06 4.49E02 TBC1D22B NP_060242 0.37 4.74E05 2.69E05 2.05E05 4.53E02 PIP4K2C NP_001139731 0.28 4.63E05 3.60E05 1.03E05 4.54E02 MAP4K3 NP_003609 0.99 4.64E05 3.07E05 1.57E05 4.55E02 PCDH15 NP_001136239 1.15 1.09E05 7.87E06 3.00E06 4.72E02 PRDM6 NP_001129711 0.22 1.93E04 1.51E04 4.26E05 4.72E02 DSCAML1 NP_065744 0.75 1.45E05 1.17E05 2.72E06 4.84E02 CEP350 NP_055625 0.79 7.84E05 6.00E05 1.84E05 4.94E02 HMGB1 NP_002119 1.16 8.94E06 5.10E06 3.84E06 4.96E02 PDCD6 NP_037364 0.60 5.74E06 3.26E06 2.48E06 4.97E02
[0107] The heatmaps of representative targets of the individual SA-miRNAs are shown in
[0108] Specifically,
[0109] Both downregulated mRNA (
[0110] These results indicate that under physiological conditions many of the SA-miRNA target genes can be subjected to concurrent regulation by multiple co-expressing miRNAs from clusters with opposing biological roles: e.g. oncogenic versus tumor-suppressive.
Example 6: Regulation of SA-miRNA Gene Targets by microRNA
[0111] This example details the combinatorial regulation of particular SA-miRNA gene targets, (NAP1L1, SMARCD2 and USP6), by the microRNA from oncogenic MIR17HG and tumor-suppressive MIR100HG gene clusters.
[0112] To address the aspect of what function the targeting of mRNA by multiple miRNAs from the same cluster or from clusters with opposing biological activity serve, the idea that co-expression of multiple miRNAs induces stronger downregulation of their common targets was tested. Three SA-miRNA target genes that exemplify the following co-targeting arrangements were investigated: 1) a chromatin chaperone, NAP1L1 (Li, Gadue et al. 2012) targeted by multiple miRNAs from antagonistic MIG17HG and MIR100HG clusters (
[0113] To demonstrate the regulatory effects of mir-let-7a-5p, 18a-5p and Mir-19a-3p, mir-19a-5p on NAP1L1, SMARCD2 and USP6 expression in vitro luciferase assays were performed, as below.
Luciferase Assay
[0114] The luciferase reporter constructs were built as previously described (Anbazhagan, Priyamvada et al. 2014). NAP1L1-1 (350 bp, 2713-3062) and NAP1L1-2 (675 bp, 3362-5037) from the 3 UTR of human NAR1L1 gene, USP6-1 (675 bp, 6220-6895) and USP6-2 (527 bp, 7420-7945) from the 3UTR of human USP6 gene and SMARCD2 (525bp, 1913-2438) from the 3 UTR of human SMARCD2 gene were amplified using the primer sets (shown in Table). Purified PCR products were cloned into multiple cloning sites of the pmirGLO dual-luciferase miRNA target expression vector (Promega) downstream of the firefly luciferase gene. The primer sequences were flanked by SacI and SalI sites to generate pmirGLO-NAP1L1-1, pmirGLO-NAP1L1-2, pmirGLO-SMARCD2, pmirGLO-USP6-1 and pmirGLO-USP6-2.
TABLE-US-00004 TABLE4 LuciferasevectorpmirGLOconstructionprimers 3UTRofgene Primers NAP1L1-1 Forward5 CCCGAGCTCGCTTAAAGTATGAGTATGTCACT3 (2713-3062) Reverse5 CCCGTCGACAAAACAAATCTTGGACCTTGTGA3 NAP1L1-2 Forward5 CCCGAGCTCTGAAGCAGTATTAGCATCACT3 (3362-5037) Reverse5 CCCGTCGACTATTATTTCACCATCACCATTTACA3 SMARCD2 Forward5 CCCGAGCTCCTGCTCAGGGATCTTTCTTCCC3 (1913-2438) Reverse5 CCCGTCGACAAAAAAAGTGGCTCCCACATAGA3 USP6-1 Forward5 CCCGAGCTCATATGTAGTGAGTATAGAGTTTACCCAA3 (6220-6895) Reverse5 CCCGTCGACTTTGCATGTGTTCTCTCTTTTTTAAAGT3 USP6-2 Forward5 CCCGAGCTCAAATTGAAATCCTTTTCAGAAAAAA3 (7420-7945) Reverse5 CCCGTCGACAAAAACAGCACATAGAGGC3
[0115] For this, corresponding 3UTRs of: (1) NAP1L1 (3UTR 2713-3062 and a portion of 3UTR 3362-5037) shown in
[0116] Mimic miRNA Transfection Studies
[0117] The hADSCs were seeded on 4-well slides at a density of 110.sup.4 cells/well one day before transfection with 5 pmol and 10 pmol each of different microRNA mimics to SA-miRNA using Fugene 6 (Promega). 48 h after transfection, SA--gal staining was performed according to manufacturer's instructions (BioVision), RNA extraction and the subsequent real-time qPCR were performed to detect target gene expression.
[0118] The ready-to-use microRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature microRNA (miRNA) molecules. When transfected into cells, they can regulate gene expression in different manners, including translational repression, mRNA cleavage and deadenylation, imitating the native miRNA. The relative luciferase activity was measured as previously described (Anbazhagan, Priyamvada et al. 2014). 110.sup.4 293T cells were seeded per well into 96-well plates one day before transfection with 500 ng pmirGLO/pmirGLO-UTR constructs alone or in combination with 1 pmol different microRNA mimics to SA-miRNA (Sigma, MISSION microRNA Mimic), using Fugene6 (Promega) according to manufacturer's instructions. Forty-eight hours post-transfection, cells were lysed in a passive lysis buffer (Promega). The luciferase activity was then determined using the Dual Luciferase Assay Kit (Promega). Renilla luciferase activity was used as a control. Subsequently, the firefly luciferase activity was normalized to renilla luciferase activity. The 3-UTR activity was calculated as a ratio of firefly luciferase to renilla luciferase. The experiments were repeated in triplicate.
[0119] It was observed that luciferase activity in cells transfected with pGL3-NAP1L1-3UTR was significantly reduced as compared with cells transfected with the control pGL3 vector only by mir-let-7a-2-3p (47%) and mir-19a-3p (81%) as shown in
[0120] In a similar experiment, two composite 3UTR parts of the USP6 gene (
[0121] The ability of pairs of miRNAs to synergistically regulate mutual targets in order to facilitate more effective target repression was investigated, a phenomenon known as cooperating miRNAs (Hausser and Zavolan 2014). Although each single SA-miRNA efficiently downregulated the NAP1L1, SMARCD2 and USP6 UTRs in transient transfection experiments (
[0122]
[0123]
[0124] These data support that of miRNA cooperativity might imply a much more sophisticated mechanism of regulation of miRNA targets than was initially anticipated. For example, selective, physiologically-relevant expression of cooperating miRNAs could be adopted by cells to facilitate distinctive and fine-tuned gene expression patterns to meet the requirements of different biological scenarios and this phenomenon is unlikely to be appropriately tested in transient transfection experiments.
Example 7: Network-based Functional Enrichment Analysis of SA-miRNA Targets
[0125] This example details molecular pathways regulated by the identified SA-miRNAs.
[0126] Since clustered SA-miRNAs are co-expressed at different levels upon senescence in hADSCs (
Network-Based Functional Enrichment Analysis
[0127] The set of genes that were characterized as both targets of SEN upregulated miRNAs (
[0128] SA-miRNA targets that were found to be downregulated at the mRNA (
[0129] The network functional enrichment analysis resulted in the elucidation of four clearly defined function-specific sub-networks, each of which corresponds to a distinct functional category, along with the inter-relationships between these functional groups (
[0130] Specifically,
[0131] These data indicate that SA-miRNAs jointly regulate molecular pathways not only by co-targeting individual genes, but also by targeting different components of the pathways that interconnect and could be relevant to senescence of hADSCs.