Method of diagnosis, prognostic or treatment of neurodegenerative disease

Abstract

Methods for the diagnosis and prognosis of neurodegenerative diseases, such as Alzheimer's disease, are described. Compositions and method for the treatment of neurodegenerative diseases are also described.

Claims

1. A method for an in vitro screening for a modulator of the activity and/or level of a molecule selected from the group consisting of (1) a gene; (2) a transcription of a gene; (3) a translation product of a gene; (4) a fragment or derivative of (1), (2), or (3); (5) heparan sulfate; or a (6) Tau protein, the method comprising: a) contacting a sample of a biological fluid collected from a subject being subject to a Tauopathy, provided that said Tauopathy is different from a prion disease, with a test compound, b) determining the activity and/or level of at least one of the molecules (1)-(6) according to the following (i)-(vi) respectively for (1)-(6): i. for (1), at least one gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 and coding for an heparin-glucosamine 3-O-sulfotransferase, and/ r ii. for (2), at least one transcription product of a gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3 and coding for an heparin-glucosamine 3-O-sulfotransferase, iii. for (3), at least one translation product of a gene selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 3, said translation product being set forth respectively by SEQ ID NO: 2 and SEQ ID NO: 4, iv. for (4), a fragment or derivative of the gene of (i), the transcription product of (ii), or the translation product of (iii), v. for (5), 3-O-sulfated heparan sulfate, vi. for (6), abnormally phosphorylated Tau protein and/or total Tau protein, c) determining the activity and/or level determined in step b), i-vi, in a control sample of a biological fluid collected from a subject with a Tauopathy but not contacted with said test compound, d) comparing said activity and/or level determined in the contacted sample of biological fluid contacted with the test compound in step a) with the activity and/or level determined in the non-contacted sample of biological fluid not contacted with the test compound in step c), wherein an alteration in said activity and/or level of the contacted sample indicates that the test compound is a modulator of said i-vi, provided that the activity and/or the level determined in step b) is one of: (i), (ii), (iii), (iv), (v), both (v) and (iv) together, (iv) and at least one of (i), (ii), and (iii), and (v) and at least one of (i), (ii), and (iii).

2. The method according to claim 1, wherein the subject is a mammal, a human, a mouse, a SAMP8 mouse, a 3xTg-AD mice model of AD, or a Zebra fish.

3. The method according to claim 1, wherein said Tauopathy is Alzheimer's disease.

4. The method according to claim 1, wherein said the level of 3-O-sulfated heparan sulfate is the level of 3-O-sulfated heparan sulfate disaccharide.

Description

DESCRIPTION OF THE FIGURES

(1) FIG. 1 presents the assembly of heparan sulfate (HS) and resulting binding sites for known ligands including FGF, FGFR and antithrombin. Sulfation of the 3-O-position of glucosamine residues is catalyzed by the family of heparan sulfate (glucosamine) 3-O-sulfotransferases HS 3-O-sulfotransferases-1 to -6 (HS3ST1-6). This 3-O-sulfation is the last metabolic modification in the heparan sulfate biosynthesis (Bishop et al., 2007, Heparan sulphate proteoglycans fine-tune mammalian physiology. Nature 446:1030-1037), it is not related to any trophic function of heparan sulfates and is largely the minor sulfated form of these sugars since very lowly expressed in tissues (about 0.2% of total HS).

(2) FIGS. 2A to 2C present the increased total sulfated GAGs (2A) and particularly total HS (2B) sulfate levels in the hippocampus of AD postmortem brains compared to GAGs and HS from age-matched normal control brains (individuals and brains characteristics are described in Table I). The DMMB assay (Huynh et al, neurobiology of aging 2010) was used to detect and quantify the GAGs and HS levels in the postmortem brain samples. FIG. 2A: total GAG (g/mg of tissue). White histogram: control. Black histogram: Patient with AD.

(3) FIG. 2B: total HS (g/mg of tissue). White histogram: control Black histogram: Patient with AD.

(4) FIG. 2C: Left upper square (a): control brain; right upper square (b): plaques and tangles in AD brain. Left lower square (c): plaques in in AD brain; right lower square (d): tangles in AD brain.

(5) TABLE-US-00001 TABLE 1 Characteristics of the subjects providing brains tissues. Senile CERAD/ Age PMD.sup.a Immediate ause of plaques.sup.c/ Braak and Sex (years) (h) Group death.sup.b mm.sup.2 Braak.sup.d M 62 20.2 Control Myocardial infarctation 32 I M 65 8.2 Control Hemotorax trauma 47 0 M 65 8.6 Control Guns shot 51 I F 73 15.3 Control Brochopneumonia 65 II M 61 9.3 Control PuDlmonar trombosis 36 0 F 64 14.3 Control Liver traumatic rupture 41 I M 60 21.0 Control Bronchopneumonia 44 0 F 76 24.0 Control Myocardio infarctation 65 I Mean 67.8 2.9 15.1 2.2 SD M 84 19.0 AD Bronchopneumonia 78 IV F 70 10.3 AD Bronchopneumonia 65 III F 98 14.2 AD Bronchopneumonia 87 III M 84 14.0 AD Aortic rupture 84 IV F 82 9.2 AD Traumatic torax 87 III F 75 19.2 AD Pulmonar trombosis 80 IV F 69 5.4 AD Myocardial infarctation 76 IV M 82 21.2 AD Myocardial infarctation 80 III Mean 76.8 3.5 14.1 2.0 SD .sup.aPMD: post mortem delay. No significant PMD statistical difference (p = 0.7249) was found between the two groups. .sup.bSubjects died from guns shot diagnosis do not have traumatic brain lesions. .sup.cSenile plaques and NFT values represent an arithmetic mean (Mean SEM) calculated from the counts of six fields for each observed region. .sup.dCERAD score (A, B, or C)/Braak and Braak stage (I to VI).

(6) FIG. 3 presents the transcript levels of sulfotransferases and some other enzymes implicated in HS biosynthesis.

(7) NS: No significant change in enzyme expression

(8) ND: the enzyme was not detected

(9) FIGS. 4A to 4H present the colocalization of HS and hyperphosphorylated Tau in hippocampus from AD subjects and age-matched controls.

(10) Cryosections from Alzheimer's disease (AD) and aged matched human hippocampus were incubated with anti-HS (10E4) (FIGS. 4A and B) and anti Tau 262 (FIGS. 4C and D) antibodies, followed by labelling with secondary antibodies targeted with fluoroprobes Alexa 568 and Alexa 488.

(11) Sections were labelled with DAPI (FIGS. 4E and F), the right panel shows overlay (FIGS. 4G and H), scale bar 50 m.

(12) FIG. 5 presents the levels of the 3-OST-2 (HS3ST2) protein in cerebrospinal fluid (CSF) of AD patients compared to the level of phosphorylated tau protein (pTau, Ser231 epitope) in the same samples. Western blot was used to detect and compare the proteins levels in samples.

(13) FIGS. 6A and 6B presents the higher capacity of GAGs extracted from hippocampus of AD to bind to human tau protein compared to GAGs from age-matched normal control brains. An ELISA test was used to compare the capacity of the different GAGs to bind to tau protein. The ELISA competing assay used immobilized heparin to bind au in the absence of competing GAGs. For the assay, GAGs (used from 0.1 to 1000 ng/mL) were added to the ELISA together with the tau protein (used at 100 ng/mL). After 1 h incubation at 4 C. plates were washed and remaining tau signal was recorded in the plate. X-axis: % Tau protein binding to total sulfated GAGs. EC50 stands for the GAG concentration necessary to inhibit 50% of the tau protein binding to immobilized heparin. Y-axis: Control (white histogram), AD (black histogram).

(14) FIG. 6A GAGs binding to Tau protein as determined by the ELISA type competing Signal given by control GAGs was considered as 100% effect.

(15) X-axis: % Tau protein binding to total sulfated GAGs.

(16) Y-axis: Control (white histogram), AD (black histogram).

(17) FIG. 6B Changes in the binding capacities of total GAGs to Tau as determined by the ELISA type competing assay. EC.sub.50 stands for the GAG concentration necessary to inhibit 50% of the factor binding to immobilized heparin.

(18) FIGS. 7A and 7B present the effect of GAG and heparin on in vitro Tau abnormal Tau phosphorylation.

(19) FIG. 7A presents increased effect of GAGs extracted from hippocampus of AD (GAGs-AD) to induce the abnormal pathological phosphorylation of recombinant human tau protein (441-amino acid isoform of human Tau) by glycogen synthase kinase 3 (GSK-3) compared to the effect of GAGs from age-matched brains (GAGs-CT). Antibody Tau396 was used to detect the abnormally phosphorylated tau formation.

(20) x-axis: time (h)

(21) y-axis: pmol P Tau/mol Tau
Black triangles: heparin, black circles: GAGs-AD, white circles: GAGs-CT, white triangles: control.

(22) FIG. 7B presents the effect of heparin, oligosaccharides of heparin (Arixtra) containing 3-O-sulfation and oligosaccharides of heparin lacking of 3-O-sulfation, to induce the abnormal pathological phosphorylation of recombinant human tau protein by GSK-3 Kinase. Antibody Tau396 was used to detect the abnormally phosphorylated tau formation.

(23) x-axis: time (h)

(24) y-axis: pmol P Tau/mol Tau
Black triangles: heparin, black diamonds: Arixtra (3Sulfated), white diamonds: Hexa-Heparine (non 3 Sulfated), white triangles: control.

(25) FIGS. 8A to 8G present the effect of inhibiting sulfation on GAGs, including heparan sulfates, in abnormal phosphorylation in two models of SH-SY5Y differentiated cells.

(26) FIG. 8A presents the effect of inhibiting sulfation of GAGs in wild type differentiated SH-SY5Y cells. Sulfation is inhibited by using chlorate (50 mM), an inhibitor of 3-phosphoadenosine 5-phosphosulfate biosynthesis. Decreased levels of the abnormally phosphorylated Tau epitopes S199, T231, 5262, and 5396 after chlorate treatment were confirmed by western blot analysis.

(27) x-axis: Tau epitope: from left to right by the anti tau199, the anti tau 231, the anti tau 262 or the anti tau396 phosphorylated epitope

(28) y-axis: pTau/ actine

(29) FIG. 8B shows the effect of H.sub.2O.sub.2 (500 mM), in the presence and in the absence of chlorate treatment, on the levels of abnormally phosphorylated Tau epitopes S199, T231, S262, and S396 from 0 to 24 h, as revealed by western blot analysis.

(30) FIG. 8C shows the effect of chlorate treatment (75 mM) on the levels of abnormally phosphorylated Tau epitopes S199 and S396 on wild type cells as revealed by flow cytometry analysis.

(31) x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope

(32) y-axis: pTau/total-Tau

(33) FIG. 8D shows the effect of chlorate (75 mM) treatment on the levels of abnormally phosphorylated Tau epitopes S199 and S396 on wild type H.sub.2O.sub.2 (500 mM) stressed cells as revealed by flow cytometry analysis.

(34) x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope

(35) y-axis: pTau/total-Tau

(36) FIG. 8E shows the effect of chlorate (75 mM) treatment on the levels of abnormally phosphorylated Tau epitopes S199 and S396 on hTauP301L SH-SY5Y cells as revealed by flow cytometry analysis. hTauP301L SH-SY5Y cells are cells permanently transfected with the human Tau (hTau) in where the mutation P301L has been introduced.

(37) x-axis: Tau epitope: from left to right by the anti tau199 (without and with chlorate) or the anti tau396 (without and with chlorate) phosphorylated epitope

(38) y-axis: pTau/total-Tau

(39) FIG. 8F shows the effect of the introduction of the hTauP301L mutation in SH-SY5Y cells in the abnormal phosphorylation (epitope 5396) of Tau.

(40) FIG. 8G shows the effect of silencing the 3-OST-2 (by siRNA set forth by SEQ ID NO 73 for the sense and 74 for the antisense) in hTauP301L SH-SY5Y cells in the abnormal phosphorylation (epitope S396) of Tau. Ctrl: control hTauP301L SH-SY5Y cells; Lipo: lipofectamine treated cells, negative siRNA control, HS3ST2 siRNA at 10, 20, 40 and 80 nM.

(41) FIG. 9 presents the technical advance of transgenic zebrafish model expressing TAU-P301L.

(42) The Driver construct contains the neuronal zebrafish promoter HuC driving the expression of Gal4-VP16, which binds to the UAS on the responder construct. It activates the bidirectional expression of hTAU-P301L and rhodamine (DsRed) via the minimal promoters. UAS-dependent gene expression of Tau and DsRed is indicated in living fish by DsRed fluorescence. Driver and Responder constructs are flanked by To12 transposon sites (FIG. 2) (Paquet et al., 2009).

(43) FIGS. 10A and 10B present Tau phosphorylation in hTau-P301L transgenic zebrafish.

(44) FIG. 10A: Brains form 5 days old zebrafish embryos (wild type (a) versus hTau-P301L transgenic model (b)) were dissected and labeled with anti-Tau AT180 antibody. The marked hyperphosphorylation sites (green) are localized in the transgenic model; in the Telencephalon (Tel), Cerebellum (Cer) and upper region of the spinal cord (SC) (Abbreviations: A: Anterior, P: Posterior, TeO: Optic tectum, Cer: Cerebellum)

(45) FIG. 10B: The level of phosphorylated protein Tau by level of total total proteins in transgenic hTAU-P301L compared to wild type nontransgenic siblings. A 90 fold increase is demonstrated in hyperphosphorylated protein Tau accumulation in transgenic hTAU-P301L compared to nontransgenic siblings.

(46) X-axis: Phosphorylated Tau by total protein.

(47) Y-axis: Left histogram: Wild type protein, right histogram: mutated Tau.

(48) FIG. 11 presents the expression of 3-OST 2 and 4 in transgenic hTAU-P301L zebrafish.

(49) Relative quantities of 3-OST-2 and 3-OST-4 were detected by realtime PCR in the transgenic hTAU-P301L fishes (indicated with DsRed) versus WT. Enzyme expression given by WT was considered as 100%.

(50) X-axis: percentage of relative quantity

(51) Y-axis: from left to right:

(52) White and black histograms of the left side (3-OST-2): White: WT; black: DsRed

(53) White and black histograms of the right side (3-OST-4): White: WT; black: DsRed

(54) FIGS. 12A and 12B present the survival rate of 3-OST-2 morphants after 24 hours of post-injection with decreased level of phosphorylated protein.

(55) FIG. 12A: The survival rate was detected in 3-OST-2 morphans with morpholino concentration of 0.5 mM. The morpholino-mediated knock-down of the 3-OST-2 coding gene in the transgenic hTAU-P301L zebrafish embryos after 24 (hours of post fertilization) hpf was compared to the non-injected embryos used as control.

(56) X-axis: percent of injected

(57) Y-axis: left histogram: fatality, right histogram: survival

(58) FIG. 12B: The level of phosphorylated protein Tau by level of total protein in morphant embryos compared to non-injected controls (pool of n=98, 3 different series of injections).

(59) X-axis: Phosphorylated Tau by g/ml of total protein. Y-axis: MO 3-OST-2

(60) FIGS. 13A to 13F present the morpholino inhibition of 3-OST-2 in Zebrafish model (Paquet et al. 2009) that diminishes the accumulation of abnormally phosphorylated Tau protein in spinal cord as detected by anti-PHF-tau antibody clone AT8.

(61) FIGS. 13A, 13C and 13E: immunostaining of Zebrafish spinal cord expressing mutated Tau protein P301L (FIG. 13A: Tau protein (DsRed), FIG. 13C: hyperphosphorylated Tau protein as detected by anti-PHF-tau antibody clone AT8, 13E: merge 13A and 13C)

(62) FIGS. 13B, 13D and 13F immunostaining of Zebrafish spinal cord expressing mutated Tau protein P301L in which, 3-OST-2 protein has been inhibited (Morphants) (FIG. 13B: DsRed indicative of mutation present, FIG. 13D: hyperphosphorylated Tau protein as detected by anti-PHF-tau antibody clone AT8, FIG. 13F: merge 13B and 13D).

(63) FIGS. 14A to 14F present the inhibition of 3-OST-2 in Zebrafish model (Paquet et al. 2009) that diminishes the accumulation of abnormally phosphorylated Tau protein in the brain of Zebrafish.

(64) FIGS. 14A, 14C and 14E: immunostaining of Zebrafish brain expressing mutated Tau protein P301L corresponding to non injected controls (FIG. 14A: DsRed, FIG. 14C: hyperphosphorylated Tau protein as detected by anti-PHF-tau antibody clone AT8, 14E: merge 14A and 14C)

(65) FIGS. 14B, 14D and 14F immunostaining of Zebrafish brain expressing mutated Tau protein P301L in which, 3-OST-2 protein has been inhibited (Morphants) (FIG. 14B: DsRed, FIG. 14D: hyperphosphorylated Tau protein as detected by anti-PHF-tau antibody clone AT8, 14F: merge 14B and 14D).

(66) FIGS. 15A to 15F present the effect of 3-OST-2 expression inhibition in the abnormal phosphorylation of Tau protein and in axons recovery from the mutation effect

(67) FIGS. 15A, 15C and 15E: immunostaining of Zebrafish axon expressing mutated Tau protein P301L corresponding to non injected controls (FIG. 15A: DsRed, FIG. 15C: hyperphosphorylated Tau protein as detected by anti-pTau231, 15E: merge 15A and 15C). (10, scale bar=50 mm).

(68) FIGS. 15B, 15D and 15F immunostaining of Zebrafish axon expressing mutated Tau protein P301L in which, 3-OST-2 protein has been inhibited (Morphants) (FIG. 15B: DsRed indicative of mutation, FIG. 15D: hyperphosphorylated Tau protein, 15F: merge 15B and 15D).

(69) pTau231 staining is lower and arrows show that axonal abnormalities could had been reversed in 3OST-2 splice morphants compared to DsRed/hTauP301L (10, scale bar=50 mm).

(70) FIGS. 16A to 16F present the effect of 3-OST-2 expression inhibition in the abnormal phosphorylation of Tau protein and in axons recovery from the mutation effect.

(71) FIGS. 16A, 16C and 16E: immunostaining of Zebrafish axon expressing mutated Tau protein P301L corresponding to non injected controls (FIG. 16A: DsRed, FIG. 16C: hyperphosphorylated Tau protein as detected by anti-pTau231, 16E: merge 16A and 16C). (20, scale bar=20 mm).

(72) FIGS. 16B, 16D and 16F immunostaining of Zebrafish axon expressing mutated Tau protein P301L in which, 3-OST-2 protein has been inhibited (Morphants) (FIG. 16B: Tau protein (DsRed), FIG. 16D: hyperphosphorylated Tau protein as detected by anti-pTau231, 16F: merge 16B and 16D).

(73) P-Tau231 staining is lower and axonal abnormalities are apparently in 3OST-2 splice morphants compared to DsRed/hTauP301L (20, scale bar=20 mm in the first row, 50 mm in the second row)

(74) FIGS. 17A and 17B presents the effect of the HS mimetic F6 in an accelerated senescence model of AD (SAMP8 mice). The SAMR1 mice were used as control of (control). F6 was used at high dose (H) and low dose (L) by IP 25 or 50 mg/kg or oral 100 or 200 mg/kg; twice a week for two months. Treatments started when mice were 5 month old and finished when mice where 7 months old. Hyperzine A was used as a positive control drug. FIG. 17A: Spatial learning ability (n=10) % successful mice to reach platform Histograms from left to right: Control, model (SAMP8), huperzine A, F6: IP 50 mg/kg, F6: IP 25 mg/kg, F6: p.o. 200 mg/kg, F6: p.o. 100 mg/kg. FIG. 17B: Spatial Memory ability (n=10). Searching time in platform quadrant At 7 month age (2 months treatment). Histograms from left to right: Control, model (SAMP8), huperzine A, F6: IP 50 mg/kg, F6: IP 25 mg/kg, F6: p.o. 200 mg/kg, F6: p.o. 100 mg/kg. F6 increased spatial retention in Morris water maze after 2 months treatment (7 month aged)

(75) FIG. 18 presents the decrease of the hyperphosphorylated protein Tau (pTau199/202, pathological) in the brains of SAMP8 treated with sulfate heparan F6 at an IP dose of 25 or 50 mg/Kg or p.o. ar 100 or 200 mg/kg as demonstrated by western Blot analysis (WB) of brain (cortex) carried out with a specific antibody of the pathologically phosphorylated protein (pTau 199/202). The study was performed after two months treatment (7 months old mice).

(76) upper WB: Tau199 and lower WB: GADPH

(77) From left to right: Control, Model (SAMP8), Huperzine (anti Alzheimer control), treated SAMP with F6 25 mg/kg ip, treated SAMP with F6 50 mg/kg ip, treated SAMP with F6 100 mg/kg p.o., treated SAMP with F6 200 mg/kg p.o. for 2 months (from 5 month old to seven months old, twice a week).

(78) The arrow in the model indicates an increase of hyperphosphorylated protein Tau compared with the control.

(79) The arrow in the F6 treated (50 mg/kg) indicates a decrease of hyperphosphorylated protein Tau compared with the model.

(80) FIGS. 19A to 19I present the swimming layout (Morris water maze) of SAMR1 mice (7 months old), and SAMP8 mice (7 months old) treated or not with the mimetic of sulfate heparan F6 at an IP dose of 25 mg/Kg (3 mice).

(81) FIGS. 19A, 19D and 19G: control SAMR1 mice (control).

(82) FIGS. 19B, 19E, 19H: model SAMP8 mice.

(83) FIGS. 19C, 19F, 19I: model SAMP8 treated F6 mice.

(84) Treated animals present a significant increase of memory.

(85) FIG. 20 presents the heparin/glycosaminoglycans competition assay towards human Tau protein. x-axis: from left to right: heparin, chondroitin sulfate A (CSA), chondroitin sulfate C (CSC), HS, fucoidan, F6. y-axis: percentage of binding of test compound to hTau Fucoidan and F6 are able to compete with heparin for the binding to human Tau protein.

(86) FIG. 21 presents the Blood Brain Barrier (BBB) permeability studies of F6, CR36, HM2602 and Dextran. x-axis: time (min) y-axis: percentage of transmembrane passage Square: HM-oligosaccharide F6 Triangle (up): HM-oligosaccharide CR36 Diamond: HM2602 Triangle (down): oligo-dextrane

(87) FIG. 22 presents the CSF levels of pTau231 and HS3ST2, as measured by densitometry analysis of western blot gels, correlated with HS sulfate levels in CSF measured by the DMMB method.

(88) All patients have been diagnosed with AD by clinical and biochemical evaluations with increased degree of AD (+, ++, +++). Said presented degree of AD (+,++,+++) was assumed by pTau231 levels in CSF measured by densitometry analysis of the WB.

(89) 3 samples were analyzed each time.

(90) x-axis: from left to right: AD+, AD++ and AD+++. For each AD degree, from left to right histograms: pTau231, HS3ST2, HS. left y-axis: optical density/protein concentration (arbitrary units) right y-axis: total HS amount (g/mL)

(91) This figure shows that the concentration of OST-2, HS and phosphorylated Tau are between is significantly increased with the degree of AD (from AD+ to AD+++).

(92) FIG. 23 presents the percentage of Tau binding to immobilized heparin in the presence of CSF (0.5 ug/well) from AD patients (same patients as in FIG. 5). HS were extracted from CSF, quantified by the DMMB method, and used for this competitive assay in where Tau protein binding to immobilized heparin (in a ELISA plate) is inhibited by HS from the CSF.

(93) Total Tau used in the ELISA assay was commercially available.

(94) These results show that the CSF containing the highest amount of pTau contains also the HS with the highest capacity to inhibit Tau binding to the immobilized heparin.

(95) Each CSF sample was assayed 3 times in the binding test.

(96) This indicates a correlation between the tauopathie and the capacity of CSF HS to bind Total Tau.

(97) FIGS. 24A to 24H present the model of transfer inhibition of Tau aggregates from a cell (SH-SY5Y differentiated cells) to another one with F6 molecule at 0.1 and 10 g/mL. The construct used to express Tau-EYFP in donor cells as previously reopreted: J Biol Chem. 2009 May 8; 284(19):12845-52. Epub 2009 Mar. 11. Propagation of Tau misfolding from the outside to the inside of a cell. Frost B, Jacks R L, Diamond M I)

(98) FIGS. 24A to 24E present the general protocol used for the study.

(99) FIG. 24A: Aggregates donor cells: SH-SY5Y cells are transfected with Tau-EYFP according to Frost B, Jacks R L, Diamond M I. J Biol Chem. 2009 May 8; 284(19):12845-52. Transfected cells produce green Tau aggregates. Recipient cells: wild type SH-SY5Y cells

(100) FIG. 24B: Transfected cells were cultured in the upper chamber of the trans-wells. Non transfected cells were cultured in the bottom chamber of the trans-well. Both aggregates donor cells (Tau-EYF transfected cells) and recipient cells (no transfected cells) are differentiated by culturing them for 7 days in the presence of 10 M 7 days of retinoic acid.

(101) FIG. 24C: Both aggregates donor cells (transfected cells) and recipient cells (no transfected cells) are submitted to an oxidative stress pulse (H.sub.2O.sub.2, 500 M) for 30 min. After this time, the stressor containing medium was replaced by fresh medium containing or not the F6 molecule.

(102) FIG. 24D: Aggregates donor cells and recipient cells are co-cultured 24 hours.

(103) FIG. 24E: Recipient cells are fixed, labeled with bIII-tubulin (red) and examined by microscopy.

(104) Cells were fixed and labeled A) Stressed cells untreated by the drug. B) Stressed cells treated with F6 (10 g/mL). C) Tau aggregates were counted in 10 different fields and in 3 different cultures for each condition.

(105) FIG. 24F: Stressed recipient SH-SY5Y cells not treated by F6 and co-incubated (co-cultured) with stressed SH-SY5Y/Tau-EYFP show to be infected by green Tau aggregates from stressed donor cells (white arrows).

(106) FIG. 24G: Stressed recipient SH-SY5Y cells co-incubated with stressed SH-SY5Y/Tau-EYFP treated with F6 molecule (10 g/mL). Tau aggregates (white arrow) were counted in 10 different fields and in 3 different cultures for each condition.

(107) FIG. 24H: Number of fluorescent Tau aggregates per field in function of the treatment.

(108) x-Axis: from left to right: non stressed, stressed, stressed+F6 (0.1 g/mL), and stressed+F6 (10 g/mL).

(109) y-axis: Number of fluorescent Tau aggregates per field.

(110) F6 molecule markedly decreases the number of fluorescent Tau aggregates.

(111) FIGS. 24A to 24H show that F6 molecule inhibits the transfer of Tau aggregates from a cell (SH-SY5Y differentiated cells) to another one, and thus polysaccharides such as heparan sulfate mimetics, in particular F6 molecule are liable to treat Tauopathies, in particular Alzheimer's disease.

(112) FIG. 25 presents the protective effect of heparan sulfate mimetic F6 in SH-SY5Y cells differentiated with retinoic acid and treated with the peptide Abeta25-35 (25 M).

(113) x-axis: from left to right: control without A, control with A, A+F6 (1 g/mL), A+F6 (10 g/mL);

(114) y-axis: % of viable cells as determined by a MTT test

(115) A p value <0.05 was considered to be statistically significant

(116) Note that *0.05, **0.01 and ***0.001.

(117) FIG. 26 presents the effect of various heparan sulfate mimetics on the survival of SH-SY5Y differentiated cells treated with peptide A42.

(118) x-axis: from left to right: control without A, control with A, A+E5 (10 g/mL); A+F6 (10 g/mL); A+D6 (10 g/mL);

(119) y-axis: % of viable cells as determined by a MTT test

(120) Columns are compared to control+A: p value <0.05 was considered to be statistically significant

(121) Note that *0.05, **0.01 and ***0.001.

(122) FIG. 27 presents the Tau phosphorylation in cells protein extracts after 6 h or 24 h of treatment with A25-35. Effect of heparan mimetics D6 and F6 (10 g/mL) as detected by AT 180.

(123) Heparan sulfate mimetics decrease phosphorylated Tau.

(124) FIG. 28A to 28C present the Tau phosphorylation in A42 stressed cells treated with heparan sulfate mimetics Dx, D4, D5, D6, F6 at 10 g/mL.

(125) FIG. 28A: pTau 396

(126) FIG. 28B: actine

(127) FIG. 28C: pTau 396/ actine in function of various compounds.

(128) x-axis: from left to right: control, A 12 h, A 24 h, dextran, D4, D6, E5, F6.

(129) y-axis: pTau 396/-actine (% of control)

(130) Statistics are done with the average signal from two WB

(131) Heparan sulfate mimetics decrease phosphorylated Tau.

(132) FIG. 29 presents the Tau phosphorylation in A42 stressed cells treated with heparan sulfate mimetics D4, E5 and F6 at 10 g/mL for 24 h.

(133) Heparan sulfate mimetics such as D4, E5 and F6 decrease phosphorylated Tau.

EXAMPLES

Example 1

Brain Tissue Dissection from Control and AD Human Brain Tissue

(134) Post-mortem human brain sampling was performed according to the Consortium to Establish a Registry of AD (CERAD). Two experimental groups were included in the study, an aged group (n=8, control group) with subject ages ranging from 60 to 77 years with a mean of 67.82.9 years, and an AD group (n=8) with subjects ages ranging from 69 to 82 years with a mean of 76.83.5 years. Subjects included in the study received post-mortem evaluation by a board-certified neuropathologist. Post-mortem intervals varied from 8.0 h to 15.2 h for both groups. No significant statistical difference (p=0.1781) was found for post-mortem delay between the two groups. Brains were obtained at autopsy and halved sagitally within 2 h after autopsy. One hemisphere was cut into 2-cm-thick slabs along the frontal plane from which the hippocampus (temporal lobe), cortex, and cerebellum were dissected. Tissues were immediately frozen after dissection in dry ice. Tissue samples were stored at 80 C. until use.

Example 2

Senile Plaques and Neurofibrillary Tangles (NFT) Quantification in Control and AD Human Brain Tissue

(135) Neuropathologic changes in brains were investigated using Consortium to Establish a Registry for Alzheimer's Disease (CERAD) and Braak and Braak guidelines. Senile plaques and NFT were determined on Bielschowskystained sections of middle frontal gyrus, middle temporal gyms, inferior parietal lobule, occipital pole, hippocampal CA1 and enthorinal cortex. Senile plaques were counted using a 10 objective and NFT were counted with a 20 objective. An arithmetic mean was calculated (MeanSEM) from the counts of six fields for senile plaques/mm.sup.2 and NFT/mm.sup.2 for each region. Neuropathologic diagnosis was then made using the guidelines proposed by CERAD and Braak and Braak criteria. AD brains were characterized to be at stage III-V from hippocampal analysis. Control brains were determined to be non AD.

Example 3

Immunohistochemical HS and Tau Co-Localization on Human Hippocampus

(136) Sections (20 m) of human hippocampus from Alzheimer and age-matched control were fixed with 3% acetic acid for 10 min at room temperature (rt). Sections were then incubated for 30 min with 3% BSA dissolved in phosphate-buffered saline (PBS) and permeabilized with 0.2% Triton X100 in PBS for 30 min. HS were stained with an anti-heparan sulfate (10E4 epitope, Seikagaku corp. by AMS Biotechnology) and anti-Tau phosphoSerine 262 (Millipore); dissolved in permeabilization buffer (1:200) and incubated for 1 h 30 min at rt. Fluorescence was introduced by staining tissue slides with a secondary antibody conjugated to an Alexa 568 fluoroprobe (Molecular Probes) and Alexa 488 fluoroprobe (Interchim). Then, sections were DAPI labelled for 3 min with a 1 g/mL DAPI solution and rinsed with methanol. Images were first obtained using a CCD monochrome camera (CFW-1310M, Scion Corporation, USA) fitted to a BH-2 epi-fluorescence optical microscope (Olympus). Image acquisition was obtained from the Scion VisiCapture 2.0 software. Image processing was done using ImageJ software (W. Rasband, National Institute of Mental Health, Maryland, USA). DAPI labelling of nuclei was quantified as the previously described (Blondet et al., 2006).

Example 4

Expression of 3-OST Enzymes in Alzheimer's Disease Hippocampus

(137) Here, it has been investigated if the expression 3-OST enzymes involved in HS biosynthesis were altered in Alzheimer's disease compared to control hippocampus samples (Table 2). Results show a particular over-expression of the 3-OST-2 and 3-OST-4 in the Alzheimer's disease hippocampus. This may suggest the enhanced of 3-O-sulaftion in the HS chains of Alzheimer's disease brains and enhanced expression of 3-OST-2 transcripts can be thought characteristic of the disease. As control experiments, expected expression of glutamine synthetase (GS) and of glyceraldehyde-3-phosphate deshydrogenase (GAPDH), known to be enhanced in Alzheimer's disease brains (Burbaeva et al., 2005), were confirmed, as well the unchanged expression of the chemokine receptor 4 reported to keep stable in Alzheimer's disease compared to age-matched individuals (Cartier et al., 2005). Our results agreeing these expected increases of genes expressions (Table 2) indicate that, as shown by the RIN number, the quality of the biological material was consistent for these studies.

(138) TABLE-US-00002 TABLE 2 Expression of human 3-OST enzymes by real time PCR Relative Expression quantity Relative quantity Alzheimer's control Alzheimer's disease disease Target Enzymes (g/mL) (g/mL) vs Control Heparan 3-OST-1 0.75 0.09 0.96 0.20 NS sulfate 3-OST-2 0.37 0.07 2.06 0.46 ** 3-OST-3a 0.35 0.08 2.17 0.86 * 3-OST-3b 0.58 0.21 1.76 0.43 * 3-OST-4 1.33 0.12 5.04 0.31 *** 3-OST-5 0.10 0.01 0.08 0.02 NS 3-OST-6 ND NS: no significant change in enzyme expression ND: the enzyme was not detected

(139) RNA Extraction and RTqPCR from Control and AD Human Brain Tissue:

(140) Total RNA was extracted from human hippocampus. For quantitative PCR (qPCR), primers (Eurofins, Germany) were designed by Primer3output. qPCR was performed from template cDNA according to the LightCycler FastS art DNA Master SYBR Green kit manufacturer's instructions (Roche, Germany). qPCR conditions were depended on primer set (Table 3). Samples were simultaneously amplified in single runs. Relative quantification of gene expression was performed using the comparative CT method, also referred to as the CT method (Schefe et al., 2006). Two reference genes (-tubulin and TFIID) were used as endogenous controls. Normalization of these genes was accomplished with the Genorm program (Vandesompele et al., 2002).

(141) TABLE-US-00003 TABLE3 OligonucleotidesforrealtimeqPCRinhumanhippocampus Accession Oligonucleotide Oligonucleotide Genename number sequences(sense) sequences(anti-sense) NDST-1 NM_001543 GGAAGTGTGTCCGTGGTTC CCCTGGTAACTGTGCTCCAT (SEQIDNO:11) (SEQIDNO:12) NDST-2 NM_003635.3 CTCCAGTTGTGGAAGGTGGT CTTAGGGCTGGTGGACACAT (SEQIDNO:13) (SEQIDNO:14) NDST-3 NM_004784 CGACCTCCAACACCTACCAT TAGGACTGTGGGGTCTGTCC (SEQIDNO:15) (SEQIDNO:16) NDST-4 NM_022569 GCAACGGTGATTCAGGATCT TGTGCAGCCAAAAGTTCAAG (SEQIDNO:17) (SEQIDNO:18) GLCE NM_015554 GGAAGTGTGTCCGTGGTTCT CCCTGGTAACTGTGCTCCAT (SEQIDNO:19) (SEQIDNO:20) HS2STVar1 NM_012262 CGAAGTCCGAGAAATTGAGC AATGAAGTGCTTGCCGTTTT (SEQIDNO:21) (SEQIDNO:22) HS2STVar2 NM_001134492 CGAAGTCCGAGAAATTGAGC AATGAAGTGCTTGCCGTTTT (SEQIDNO:23) (SEQIDNO:24) HS6ST1 NM_004807 GGCCCTTCATGCAGTACAAT TACAGCTGCATGTCCAGGTC (SEQIDNO:25) (SEQIDNO:26) HS6ST2VarL NM_001077188 CGGGGTTCTCCAAACACTAA GTCTCGGAGGATGGTGATGT (SEQIDNO:27) (SEQIDNO:28) HS6ST2VarS NM_147175 AGGCTCCTTCAGACCCATTT TCGGATTTGGGTTCTGACTC (SEQIDNO:29) (SEQIDNO:30) HS6ST3 NM_153456 CATCTCCCCCTTCACACAGT CTCGTAAAGCTGCATGTCCA (SEQIDNO:31) (SEQIDNO:32) HS3ST1 NM_005114 ACCACATGCAGAAGCACAAG TTGAGGGCCTTGTAGTCCAC (SEQIDNO:33) (SEQIDNO:34) HS3ST2 NM_006043 GGAACCCCACTTCTTTGACA GTCGAGGAGCCTCTTGAGTG (SEQIDNO:7) (SEQIDNO:8) HS3ST3A1 NM_006042 ACGCCCAGTTACTTCGTCAC GAACGTCAAGCTCTCGAAGG (SEQIDNO:35) (SEQIDNO:36) HS3ST3B1 NM_006041 ACGCCCAGTTACTTCGTCAC TCTGCGTGTAGTCCGAGATG (SEQIDNO:37) (SEQIDNO:38) HS3ST4 NM_006040 AAGAGCAAAGGTCGGACTCA ACCCTCTTCCTGTTCCCACT (SEQIDNO:9) (SEQIDNO:10) HS3ST5 NM_153612.3 GCTAGAGGGGAAGGAGAGGA CCATCGACGACATGAAATTG (SEQIDNO:39) (SEQIDNO:40) HS3ST6 NM_001009606.2 CTGTCCCACTTCCTGTTCGT CCTTGGTGGCGTTGAAGTAG (SEQIDNO:41) (SEQIDNO:42) TUBA1A NM_006009.2 GCAACAACCTCTCCTCTTCG GAATCATCTCCTCCCCCAAT (SEQIDNO:43) (SEQIDNO:44) TBP(TFIID) NM_003194.4 TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA (SEQIDNO:45) (SEQIDNO:46)

Example 5

AD Patients for Cerebrospinal Fluid:

(142) Cerebrospinal fluid (CSF) samples were obtained by lumbar puncture from patients with clinical features of AD. Patients and samples were previously described by Sarazin et al. (Habert et al. Brain perfusion SPECT correlates with CSF biomarkers in Alzheimer's disease. Eur J Nucl Med Mol Imaging 2010; 37:589-593). Patients with AD fulfilled the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDSADRDA) criteria for probable AD. All subjects underwent the same clinical, biochemical (CSF biomarker measurements), and neuroimaging procedures. All patients had a routine MRI exploration, including fluid-attenuated inversion recovery (FLAIR), T1- and T2-weighted sequences. They did not show clinical or neuroimaging evidence of focal lesions and no cortical or subcortical vascular lesions. AD patients could display various degrees of cortical and/or subcortical atrophy. They had no medical conditions that would interfere with cognitive performance and no severe depression. All patients were treated with acetylcholine esterase inhibitors from the time of diagnosis. They were living in the community.

(143) CSF Examination

(144) CSF samples obtained by lumbar puncture were centrifuged for 10 min at 1,500 rpm at 4 C. to remove cells, aliquotted into 0.4-ml polypropylene tubes and stored at 80 C. until analysis.

(145) Preparation of Tissue and CSF Protein Extracts for Phosphor-Tau and HS3ST-2 by Western Blotting

(146) Frozen brain tissues were homogenized under liquid nitrogen vapors and the suspended in a Laemmli buffer 4 (1:100 -mercaptoethanol added previously). The mixture was boiled for 5 min and sonicated 5 min. Tubes were then centrifuged 10 min (1,500 rpm at 4 C.). Protein concentrations in tissue homogenates and CSF samples were calculated by using Pierce BCA Protein Assay kit, following manufacturer's instructions and equal amounts of samples were electrophoresed on 10% gels (Invitrogen Corp). After transfer, membranes were blocked with blocking buffer (3% milk in PBS, 0.02% Tween-20) for 40 min and probed with an goat anti-HS3ST2 (T-15, Santa Cruz) 2 hours at room temperature). Membranes were rinsed once in PBST and then washed 3 times for 5 min in same buffer. Secondary antibody was diluted in PBST and incubated 45 min at RT (rabbit anti-goat, Jackson Immuno Research). Membranes were rinsed with PBST and washed 3 times for 5 min in the same buffer. Blots were developed with Immobilon Western Chemiluminiscent HRP Substrate (Millipore) following manufacturer's instructions.

(147) After, the membrane was washed in TBS 1 and then incubated for 2 hours at room temperature with anti-pTau Thr231 (rabbit polyclonal, Millipore, ref 9668, lot NG1863963) diluted in 1% BSA in TBS, 0.1% Tween-20 (TBST). Membranes were washed 3 times in TBST for 5 minutes and then incubated with the secondary antibody (donkey anti-rabbit Jackson ImmunoResearch). Blots were developed with the same reagent.

(148) Glycosaminoglycans (Heparan Sulfates and Chondroitin Sulfate) Extraction and Quantification from Brain and CSF

(149) GAGs were extracted from brain tissue and CSF as follows: Frozen brain tissue samples were reduced to powder, homogenized and suspended in an extraction buffer (50 mM Tris, pH 7.9, 10 mM NaCl, 3 mM MgCl.sub.2 and 1% of Triton X-100) to final 25 mg of tissue per mL of buffer. CSF or brain homogenates were treated by proteinase K (PK) (Merck) (final 50 g/mL of sample) at 56 C. overnight followed by 30 min at 90 C. to inactivate the enzyme. After cooling to room temperature (rt), DNase I (Qiagen) was added (7.5 mU/mL of sample) and samples were incubated overnight at 37 C. Samples were then diluted 1:1 with 4 M NaCl, centrifuged (13 000 g, 20 min) and pellet was discarded. Lipids were eliminated by 1:1 chloroform extraction and total sulfated GAGs were quantified according to the 1-9 dimethyl-methylene blue (DMMB) assay as described (Huynh et al Neurobiol Aging. 2011). Chondroitinase ABC (ChABC) (Sigma-Aldrich) or nitrous acid treatments were used to selectively quantify HS or CS in total GAG samples (Huynh et al 2011). A calibration curve constructed with known amounts of CS standard was included in each assay. The extraction and quantification method was validated in GAGs spiked rodent brain samples as previously described (Huynh et al, Neurobiol Aging. 2011).

(150) GAGs Isolation (Heparan Sulfates and Chondroitin Sulfate) Extraction and Quantification from Brain and CSF

(151) GAGs were isolated as follows: PK/DNAse digested samples were reached to 4 M NaCl final sample concentration and vigorously agitated during 10 min. Proteins were precipitated with TCA treatment (10% final concentration) and supernatants were then cleared by chloroform washing followed by rapid dialysis of the aqueous phase (Slide-A-Lyzer Mini Dialysis Units 3,500 MWCO,

(152) Pierce) against the extraction buffer and then pure water. After freeze drying, material was dissolved in water or in a glycanases digestion buffer (10 mM sodium acetate, 2 mM CaCl.sub.2, pH 7), as required. GAGs were then quantified by following the DMMB protocol. Identities and specific recovery of extracted HS or CS were performed by specific digestion with chondroitinase ABC (ChABC) for HS recovery, or by heparinases I/II/III or by nitrous acid treatment for CS recovery as previously described (Huynh et at, Neurobiol Aging. 2011).

(153) Brain and CSF HS Disaccharide Analysis by LC/MS

(154) Extracted and freeze dried GAGs samples from brain and CSF dissolved in the glycanases digestion buffer (10 mM sodium acetate, 2 mM CaCl.sub.2, pH 7) were simultaneously digested with heparinase I, II, and III cocktail (0.25 mU each, 24 h, 37 C.). After filtration, samples were filtered and injected to LC/MS system composed of a LTQ/orbitrap coupled to a capillary liquid chromatographic system (LC). The used separation and detection method was that described in Methods Enzymol. 2011 ou par la method de Yang et al (Ultra-performance ion-pairing liquid chromatography with on-line electrospray ion trap mass spectrometry for heparin disaccharide analysis. Analytical Biochemistry 415 (2011) 59-66).

Example 6

GAGs from Alzheimer's Disease have Increased Tau Binding Capacities

(155) GAGs from Alzheimer's disease and age-matched control hippocampus were tested for their capacities to bind Tau protein by using the ELISA competition binding assay as described below. FIG. 6A shows a significant increase in the ability of Tau to bind Alzheimer's disease GAGs. This effect was already observed for 0.1 ng/mL GAG. Evaluation of the effective concentration necessary to obtain 50% of Tau binding to polysaccharides (EC50) showed to be decreased on Alzheimer's disease GAGs compared to controls (FIG. 6B) meaning an increase in GAG affinity for Tau in case of disease. These results suggest that, with Alzheimer's disease, GAGs composition changes in hippocampus resulting in more binding of these GAGs to Tau.

(156) Heparin/Glycosaminoglycans Competition Assay Towards Human Tau Protein:

(157) AD and control hippocampus extracted GAGs binding to human Tau protein (R&D systems) was evaluated by an ELISA based competition binding essay (Najjam et al., 1997). ELISA type 96 wells plates were coated with a 2 g/mL BSA-heparin conjugate solution prepared as previously described (Najjam et al., 1997). After washing with PBS/0.05% Tween-20 (washing solution), wells were saturated with 3% BSA in PBS. Then, the assayed protein (in PBS) was added to the plate in a concentration dependent manner in order to determine the protein concentration giving 50% of binding to immobilized heparin (ED.sub.50). From this data, tau protein doses used on the competition assay were fixed at 100 ng/mL. This tau concentration was used to examine changes on the Tau binding extents to immobilized heparin in the presence of soluble competing extracted GAGs (0, 0.01, 0.1, 0.5, 1 10, 100, and 500 ng/mL). Control and AD GAGs, and tau protein were simultaneously added to heparin immobilized wells and plates were incubated 1 h at rt. After washing, the protein remaining bond to the plate was targeted by a corresponding specific antibody (1:1000, 1 h, rt) followed by a peroxidase-labeled secondary antibody (1:5000, 1 h, rt). Peroxidase activity was measured by the tetramethylbenzidine (TMB) detection kit (Pierce). Reference binding (100%) was assigned to signal left when aged group GAGs were used (FIG. 21).

Example 7

Phosphorylation of Human Tau by Brain GSK-3 Kinases in the Presence of Control and AD GAGs or 3-O-Sulfated or not HS Oligosaccharides

(158) Phosphorylation by glycogen synthase kinase 3 (GSK-3). Recombinant hTau41 (Millipore) was incubated for 0 to 24 h with 1 unit/ml of recombinant GSK3 (Millipore) in the presence or absence of 50 mg/ml of heparin, Arixtra, or the heparin hexasaccharide non 3-O-sulfated. Phosphorylation assays (0.050 ml) were carried out at 30 C. and comprised 25 mM Tris-HCl, pH 7.4, 0.1 mM EGTA, 0.1 mM sodium orthovanadate, 2.5 mM PKI (a specific inhibitor of cyclic AMP-dependent protein kinase), protease inhibitors (0.5 mM phenylmethylsulfonyl fluoride, 5 mg/ml aprotinin, 5 mg/ml leupeptin,

(159) and 0.5 mg/ml pepstatin), tau protein (4 mM), 10 mM magnesium acetate, 2 mM [g-.sup.32P]ATP (approximately 100 cpm/nmol) 5 units/ml recombinant reconstituted GSK3. Reactions were initiated with ATP and aliquots were removed at various times ranging from 10 min to 24 h and used for SDS-polyacrylamide gel electrophoresis and immunoblotting. Immunoblots were performed as described (Masato Hasegawa et al., J Bio Chem. (1997) 272 (52), pp. 33118-33124). Alternatively, incorporation of .sup.32P radioactivity was measured after adsorption to Whatman P-81 paper, as described. Heparin and extracted GAGs were included in the assays at 50 mg/ml.

Example 8

Suppression of Glycosaminoglycans Sulfation in a Mutational-Dependent (hTauP301L) and in a Mutational Independent (Oxidative Stress) Cell Model of AD with Tau Hyperphosphorylation

(160) Two cell types were used, (i) a wild type SH-SY5Y cells (mutation-independent model) in where abnormal phosphorylation is induced by oxidative stress and (ii) cells stably transfected with complete human tau protein having the mutation hTAU-P301L (mutation dependent model), characteristic of FTDP-17. As a consequence of the Tau mutation cells present high levels of abnormal phosphorylated Tau.

(161) For the mutation dependent model cells were cultured as previously described (Schaeffer V et al., J Neurobiol 2006, July; 66(8):868-881). For the mutation independent model, human SH-SY5Y neuroblastoma cells were propagated in Dulbeco's modiced Eagle's medium (Gibco) with 5% fetal bovine serum and penicillin/streptomycin (5% CO.sub.2 and 95% air). For both models cells were plated at a density of 10.sup.6 cells/cm.sup.2 on 25 cm.sup.2 dish and incubated under standard conditions for 24 h. Then, cells (both models) were treated with 10 M retinoic acid (RA) for 3 days to induce their neural differentiation.

(162) For the mutation independent models, differentiated cells were then treated with H.sub.2O.sub.2 (500 mM) for 30 min and medium was changed for fresh medium again supplemented with RA. This oxidative treatment induces abnormal tau phosphorylation in cells at Thr231 and Ser396 of Tau.

(163) Six hours after the oxidant elimination.

(164) After 3 days of differentiation, cells from both models were treated with sodium chlorate, an inhibitor of GAGs sulfation, added at final 50 mM concentration in the presence of RA (10 M) to maintain differentiation. Cells were incubated under these conditions for additional 24 h, then, cells were washed, harvested and used for pTau flow cytometry and western blot analysis with anti-tau-pSer199 and anti-tau-pSer396 antibodies (Millipore).

Example 9

Silencing of 3-OST-2 (HS3ST2) in a Mutational-dependent (hTauP301L) and in a Mutational Independent (Oxidative Stress) Cell Model of AD with Tau Hyperphosphorylation

(165) Effect of HS3ST2 and HS3ST4 siRNA silencing was tested in the two described cell models of AD but chlorate treatment was replaced by a siRNA set forth by SEQ ID NO 73 for the sense and 74 for the antisense (10, 20, 40 and 80 nM) transfection with lipofectamine. In all cases cells were plated and incubated under standard conditions to 60% of confluence, siRNA silencing was directly performed in hTauP301L cells and before and after H.sub.2O.sub.2 stress for WT cells. Optionally, silenced cells and controls were differentiated with retinoic acid (10 M) for 3 days. Harvested cells were analyzed by flow cytometry using antibodies anti-tau-pSer199 and anti-tau-pSer396 (Millipore) using well known techniques. At least 10000 cells (events) were analyzed by point. HS3ST2 silencing was confirmed by RTqPCR of HS3ST2 transcripts analysis and by western blot for HS3ST2 protein expression.

(166) Western Blot Analysis.

(167) After harvesting, cells were and incubated in an ice bath for 5 min in a lysis buffer (50 mM Trus-HCl, 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 10 mM NaF, pH 8.0) containing 1 mM Na.sub.3VO.sub.4, and 0.1% protease inhibitor cocktail (Sigam). Lysates were centrifuged and proteins in the supernatants were quantified using the BCA protein assay kit (Pierce). Extracts corresponding to 30 g of proteins electrophoretically separated as described for tissue and CSF protein samples. Abnormally phosphorylated tau was detected by using anti-tau-pSer199 and anti-tau-pSer396 (Millipore) as described above. For analysis of the HS3ST2, previous immunoprecipitation (milteni kit) of the enzyme was required for improving detection in cultured cells. To evaluate protein loading, membranes were immediately stripped and reprobed for -actine. Results were expressed as a ratio of target protein to actine. Independent experiments were normalized to controls.

Example 10

Analysis of Hyperphosphorylation of Tau Protein in Zebrafish

(168) In order to study the expression of 3-OSTs on mutated hyperphosphorylated Tau protein levels, we used a zebrafish transgenic line of hTau-P301L that shows the characteristic features of Taupathies including neuronal loss, Tau hyperphosphorylation, aggregation, tangles formation, and behavior alterations (Paquet et al., 2009). Brains of 5 day old hTau-P301L transgenic embryos were first labeled with antibodies against hyperphosphorylated Tau protein to assess whether the sites of hyperphosphorylation, indicative of Taupathies, were present. As expected we observed a hyperphosphorylation of Tau in the hTau-P301L mutated (FIG. 10A); compared to wild type which showed no Tau hyperphosphorylation at all. Additionally, the hyperphosphorylated Tau was not only localized on cerebellum and on the upper region of the spinal cord, but it was also highly expressed in the telencephalon of the mutant, suggesting that the forebrain may extremely be affected by the misfolding of Tau.

(169) Abnormal phosphorylation is classically expressed as the ratio of abnormal phosphorylated Tau levels compared to total Tau protein levels analyzed in a same sample. In the transgenic zebrafish, the level of abnormal phosphorylated Tau/total Tau protein was determined by the P-Tau and T-Tau ELISA assays, as described below. A 90 fold increase in abnormally hyperphosphorylated Tau protein accumulation by the amount of total Tau protein was observed in transgenic hTAU-P301L compared to WT (FIG. 10B). Additionally, to determine if A42 was present in these fishes, A42 ELISA analyzes were performed. As expected, no A42 was observed in this transgenic hTAU-P301L model of FTD.

(170) Transgenic hTAU-P301L embryos with morpholino-mediated knock-down of the 3-OST-2 coding gene with SEQ ID NO: 5 and the non-injected embryos were screened on the intensity of DsRed fluorescent protein at 24 hpf. With morpholino-mediated knock-down of the 3-OST-2 coding gene in the transgenic hTAU-P301L zebrafish model the level of hyperphosphorylation in Tau protein was investigated. First of all, the obtained zebrafish embryos from the crossing between WT line and transgenic zebrafish carrying the P301L mutation in Tau protein were injected with different morpholino concentrations, respectively 0.3 mM, 0.5 mM and 1 mM. The numbers of living embryos were assessed at 24 hours after injection and survival rates were determined. We observed that the morpholino concentration of 0.5 mM did not give major anomalies or deformities and the rate of survival among morphants was optimal (67% survival rate at 24 hours post-injection). Thus, this concentration was chosen for further analyses (FIG. 12).

(171) Transgenic Zebrafish:

(172) The transgenic line expressing hTAU-P301L was kindly provided by Professor Christian Haas (Paquet et al., 2009). The animals were raised as described. Briefly, Mosaic DsRed-positive larvae were raised and out-crossed with wild-type fish. Zebrafish were maintained at 28 C. under standard conditions as described by Westerfield (1995). Developmental stages were determined as hours of post fertilization (hpf) as described by Kimmel et al. (1995). All experiments were performed in accordance with ethical policies for the care and use of laboratory vertebrate animals (Direction dpartementale des services veterinaries de Paris).

(173) Total RNA Extraction from Zebrafish and qPCR

(174) Total RNA was extracted from a pool of 100 dissected embryos of both WT and DsRed-positive zebrafish samples. The RNA extraction was accomplished by using the RNAeasy minikit (50). To determine the HS3ST2 expressions at the mRNA level, cDNA was synthesized from the isolated RNA by a reverse transcriptase reaction. Briefly, total extracted RNA (1 g) was incubated with random primers (30 g/mL) in a mixture of 5 mM dNTP's and RNase inhibitor (Invitrogen) for 5 min at 65 C. Followed by an incubation with respectively 5 first strand buffer, 1 mM DTT and RNase inhibitor Superscript II Rnase H Reverse Transcriptase (Invitrogen) at 42 C. for 52 min and 15 at 70 C. A mixture with except the transcriptase was served as a negative control. For qPCR, primers were designed by Primer3output and obtained by Eurofins (Gemany) (Table 4). For qPCR, amplifications were performed on the LightCycler (Software version 3.5; Roche Switserland) with FastSart DNA Master SYBR Green I (Roche, Switzerland) used following the standard operating procedures provided by manufacturer. All samples were amplified simultaneously in one assay run. Relative quantification was performed as described above (Vandesompele et al., 2002, Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3:RESEARCH0034).

(175) TABLE-US-00004 TABLE4 Humanandzebrafish(Daniorerio)3-OSTprimers Accession Oligonucleotide Oligonucleotide Enzymes number sequencessense sequencesanti-sense Human 3-OST-1 NM_005114 ACCACATGCAGAAGCACAAG TTGAGGGCCTTGTAGTCCAC (SEQIDNO:33) (SEQIDNO:34) 3-OST-2 NM_006043 GGAACCCCACTTCTTTGACA GTCGAGGAGCCTCTTGAGTG (SEQIDNO:7) (SEQIDNO:8) 3-OST-3a1 NM_006042 ACGCCCAGTTACTTCGTCAC GAACGTCAAGCTCTCGAAGG (SEQIDNO:35) (SEQIDNO:36) 3-OST-3b1 NM_006041 ACGCCCAGTTACTTCGTCAC TCTGCGTGTAGTCCGAGATG (SEQIDNO:37) (SEQIDNO:38) 3-OST-4 NM_006040 AAGAGCAAAGGTCGGACTCA ACCCTCTTCCTGTTCCCACT (SEQIDNO:9) (SEQIDNO:10) 3-OST-5 NM_153612.3 GCTAGAGGGGAAGGAGAGGA CCATCGACGACATGAAATTG (SEQIDNO:39) (SEQIDNO:40) GAPDH NM_002046.3 CCGTCTAGAAAAACCTGCC GCCAAATTCGTTGTCATACC (SEQIDNO:47) (SEQIDNO:48) A-tubulin NM_006009.2 GCAACAACCTCTCCTCTTCG GAATCATCTCCTCCCCCAAT (SEQIDNO:43) (SEQIDNO:44) TFIID NM_003194.4 TGCACAGGAGCCAAGAGTGAA CACATCACAGCTCCCCACCA (SEQIDNO:45) (SEQIDNO:46) Danio 3-OST-1 NM_001080593.1 CGGTGTCTGCACAGCTCTAA CGACCAGCTCAAAGAACCTC rerio (SEQIDNO:49) (SEQIDNO:50) 3-OST-2 NM_001080608 CTCCAGTACTTCCGGCTGTC CTGCTGCTCTCTGGCTTCTT (SEQIDNO:51) (SEQIDNO:52) 3-OST-3X DQ812987.1 CAGGGAACTAATGCCCAAAA TCTCGCACCACGACTATCAG (SEQIDNO:53) (SEQIDNO:54) 3-OST-3Z DQ812988 GAAGAAACTCGGGCTCCTCT CGTCTCCTTCGCTCGATTAC (SEQIDNO:55) (SEQIDNO:56) 3-OST-4 NM_001080589 GCTCTTCACCTGGAAAGCTG AATCCTGCACTTTTGCCATC (SEQIDNO:57) (SEQIDNO:58) 3-OST-5 NM_001039926.1 ACTTTCGGAAGGGTCTGGAT GGTGGAGCTGTGAAGTAGCC (SEQIDNO:59) (SEQIDNO:60) 3-OST-6 DQ812991 CACCTGCATCTCCATCCTCT CTCTCGGCCTGAACTATTGC (SEQIDNO:61) (SEQIDNO:62) 3-OST-7 DQ812992 AAACACCGGGGTATTTCACA TCTTCACCAGCATGTTCTCG (SEQIDNO:63) (SEQIDNO:64) gapdh NM_001115114 GATACACGGAGCACCAGGTT GCCATCAGGTCACATACACG (SEQIDNO:65) (SEQIDNO:66) bactin1 NM_131031 CTCTTCCAGCCTTCCTTCCT CTTCTGCATACGGTCAGCAA (SEQIDNO:67) (SEQIDNO:68) tbp NM_200096 GAGCAACAGAGGCAACAACA GATAGGCGTCATAGGGGTGA (SEQIDNO:69) (SEQIDNO:70)

(176) Morpholino-mediated Knockdown of the HS3ST2 Coding Gene in the Transgenic Zebrafish Line Expressing hTAU-P301L

(177) Morpholino oligonucleotides (MO) were designed to target the flanking region in the zebrafish 3-OST-2 gene in order to block the translation of the HS3ST2 mRNA: 5-ATGGCATATAGGT TCCTGTCAAGCC . . . -3. The morpholino antisense oligonucleotides were designed by Gene Tools (LLC One Summerton Way, Philomath, Oreg., USA). MO HS3ST2-ATG: 5-GGCTTGACAGGAACCTATATGCCAT-3.

(178) Morpholino Injection.

(179) The morpholinos were diluted to three different concentrations in Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM Ca(NO.sub.3), 5 mM HEPES pH 7.6) and co-injected with 0.3 mg/mL dextran rhodamine (Molecular Probes, Eugene, Oreg., USA). Transgenic zebrafish embryos at one-cell or two-cell stage were microinjected with approximately 2 nL of 0.5 mM, or 1 mM morpholino solution using a pressure microinjector and a Zeiss stereomicroscope (Zeiss). The three morpholino solutions were tested for fish viability, anomalies and deformities. Only viable concentrations that did not caused any major anomalies or deformities were used (0.5 mM). Embryos were maintained at 28 C. in fish water. After 20 hpf, embryos were incubated with 1PTU (1-phenyl 2-thiourea), an inhibitor of all tyrosinase-dependent steps in the melanin pathway. The second day, after dechorionation, the DsRed-positive embryos were selected: only embryos showing a significant red fluorescent labeling, characteristic of mutated fish, were considered positive in the presence of the morpholino. Embryos were then fixed or dissected at 48, and 120 hpf.

(180) Analysis of Hyperphosphorylation Tau Protein in Zebrafish by Immunocytochemistry

(181) Zebrafish embryos were anaesthetized with 0.64 mM tricaine (Sigma-Aldrich, St. Louis, Mo., USA) and fixed in 4% paraformaldehyde for 1 hour at rt. 5 dpf embryos were fixed for 1 hour before brains were dissected in PBS. After 6 times washing with phosphate buffer for 5 minutes each, the dissected brains or whole embryos were blocked and permeabilized with 0.2% gelatin (Merck, Darmstadt, Germany) and 0.25% Triton X100 (Sigma-Aldrich, St. Louis, Mo., USA) for 1 hour at rt, followed by incubation of the primary antibodies anti-PHF-Tau antibody clone AT8 (Thermo Scientific) and anti-PHF-Tau antibody clones AT180 (Thermo Scientific) diluted at 1:100 in the buffer containing 0.02% NaN.sub.3. Also anti-DsRed (Clontech) was labeled, diluted at 1:50 in order to select positive DsRed embryos. After, brains or embryos were incubated with the solution of goat anti-mouse biotinylated antibody (Vector, 1:400 dilution) for 1 h30 min at rt, followed by an incubation for 1 hour at rt in a solution of Steptavidine Alexa 488 (Molecular probes, used at 1:400 dilution). Brains or embryos were mounted with 1% of agarose (low melting, Biorad) in PBS buffer. Images of morphant phenotype were captured under bright-field illumination using a stereomicroscope (SteREO Lumar. V12, Zeiss) equipped with a digital camera (DXM 1200F, Nikon) controlled by the ACT-1 software (Version 2.63 Nikon). Combination of fluorescent labelings was imaged using a microscope equipped with an ApoTome system (Zeiss) equipped with an AxioCam MRm camera (Zeiss) controlled by the Axiovision software.

(182) Protein Extraction from Zebrafish and Tau Quantification by ELISA

(183) The embryos resulting from crossing between AB line and transgenic zebrafish carrying the P301L mutated Tau gene were screened for the DsRed fluorescent protein at 24 hpf and at 48 hpf the vitellus was removed. A double volume of ice-cold extraction buffer containing 50 mM Tris HCl pH 8, 150 mM NaCl, 10% Triton X100, 1 mM EDTA, protease inhibitor (cocktail Roche), 10 mM NaF and 1 mM sodium orthovanadate was added to the embryos. Tissues were fragmented by sonication (Branson, Sonifier 250) and homogenized at 4 C. (Stuart rotator SB3). After 30 minutes of centrifugation at 10 000 rpm (Eppendorf Centrifuge, Sigma-202 MK) supernatant was decanted. Protein concentration was measured according to the Bradford method.

(184) Abnormally phosphorylated Tau (P-Tau) was determined with the INNOTEST PHOSPHO-TAU (181P) ELISA (Innogenetics, Gent Belgium). Levels of P-Tau181, characteristic of taupathy associated pathologies, were measured using a combination of monoclonal antibody HT7 (which recognizes amino acids 159-163 in normal Tau and P-Tau) and biotinylated monoclonal antibody AT270 (which recognizes P-Tau containing the phosphorylated threonine 181 residue). A synthetic phosphopeptide, furnished in the ELISA INNOTEST, was used for standardization.

(185) Total Tau (T-tau) was measured by INNOTEST hTAU-Ag ELISA, (Innogenetics, Gent, Belgium). The T-Tau assay utilizes monoclonal antibody (AT120) for capture and biotinylated monoclonal antibodies (HT7 and BT2) for detection (Vanmechelen et al., 2000). Also A42, were determined by INNOTEST -Amyloid (1-42) ELISA, (Innogenetics, Gent, Belgium).

Example 11

Heparan Mimetic Synthesis (F6 and CR36) Inhibits Tau Hyperphosphorylation in Brain of SAMP8 Mice

(186) The general synthesis procedure is disclosed below:

(187) ##STR00010##

(188) TABLE-US-00005 Structural characteristics N glu.sup.b dsS.sup.c dsCM.sup.d HMs.sup.a (ref. NMR) (dp) (NMR) free X(NH.sub.2).sup.e(PheOMe) HM-oligo.CM.sub.L-S.sub.L- 6 to 15 0.22 Low Low X.sub.L (B) Low HM-oligo.CM.sub.M-S.sub.L- 6 to 15 0.17 High High X.sub.H (C) Low HM-oligo.CM.sub.M-S.sub.ML- 6 to 15 0.60 Low High X.sub.H (D) Medium HM-oligo.CM.sub.H-S.sub.L- 6 to 15 0.20 Medium High X.sub.H (E) Low HM-oligo.CM.sub.ML-S.sub.M- 6 to 15 0.88 Medium High X.sub.H (F) Medium .sup.aL: Low, M: Medium, H: High .sup.bPolymerization degree, determined by size exclusion chromatographi .sup.csulfatation degree (dsS), determined by NMR dosage with DMMB .sup.dcarboxymethylation level, estimated by .sup.1H NMR .sup.eAmidation level with Phenylalanine methyl ester (PheOMe), estimated by .sup.1H NMR

(189) Heparan mimetics (HM) used in the present invention are dextran derivatives also known as RGTAs (for ReGeneraTing Agents) because of their tissue regenerative properties. These compounds have the general formula AaXxYy, in where A represents a monomer, including a glucose unit, X represents a RCOOR moiety, including a carboxymethyl moiety, Y represents an O- or N-sulfonate moiety covalently linked to A and having one of next formulas: ROSO.sub.3R, RNSO.sub.3R in where: R represents an alkyl chain with possible aromatic substitutions, including amino acid substitution, and R represents an hydrogen atom or a cation. a represent monomers number, x represents the substitution degree of the X moieties linked to monomer A, and y represents the substitution degree of Y groups on monomer A. CR36, F6, and other molecules responding to this definition are prepared as reported in previous patents. However, the synthesis and structure characterization of the compounds used in this invention is as specified below. The difference between the F6 and the CR36 synthesis is the starting dextran used in their synthesis, carboxymethylation, amidation and sulfations reactions are the same.

(190) Carboxymethylation of Dextran:

(191) For F6, a dextran T5 (MW=5000 Da) was used as starting material. For CR36, a dextran T10 (MW=10000 Da) was used as starting material. Dextran (30 g, 0.185 mol of glucose) was dissolved in 146 mL of water, and separately, 59.2 g of NaOH (1.4 mol) was dissolved in 59 mL of water. Both solutions were cooled to 4 C. The NaOH solution was slowly poured into the dextran solution under stirring and controlling temperature not to exceed 15 C. The reaction mixture was stirred for 20 min and then allowed to cool at 4 C. Monochloroacetic acid (61.3 g, 6.5 mol) was added in small portions with controlling reaction temperature <20 C., and then the reaction mixture was stirred at 50 C. during 40 min. The reaction was then quenched by purified by tangential ultrafiltration of the resulting aqueous solution using a 1000 molecular weight cutoff membrane, followed by freeze-drying as described. For preparation of products with higher carboxymethyl content the same procedure was repeated two or three times in order to obtained desired dsCM.

(192) D6, D4 and E5 are synthesized in a similar way.

(193) Amidation Reactions.

(194) CMD (5 g, dsCM) 1.1, 21.5 mmol of COO.sup.) was dissolved in 136 mL of water, and then 71 mL of acetone was added. The temperature was kept at 40 C. To activate the carboxylic functions, 5.3 g of 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (21.5 mmol) in 20 mL of acetone was added, and the reaction mixture was stirred for 20 min at 40 C. The final solvent was composed by a ratio 60/40 water and acetone. Then, phenyalanine methyl ester (21.5 mmol) was added and the pH was adjusted to 7 by HCl 4 M. The reaction was stirred at 40 C. overnight. The final product was purified by tangential ultrafiltration of the resulting aqueous solution followed by freeze-drying.

(195) SO.sub.3-DMF Mediated Synthesis of Sulfated Polysaccharides in the Presence of 2M2B.

(196) An aqueous 10 g/L solution of CMDPh (24.3 mmol of glucose) was dissolved in 40 mL of formamide and 160 mL of DMF. After complete dissolution, 40 mL of 2M2B (26.5 g, 378.6 mmol) was slowly added. A SO.sub.3-DMF complex (7.4 g, 48.6 mmol) was rapidly added, and the reaction mixture was stirred at 30 C. for 2 h. The reaction was quenched by slowly pouring it into 200 mL of NaHCO.sub.3 and the final product was purified by tangential ultrafiltration followed by freeze drying as described above. Amidated products were not protonated before sulfation.

(197) Product Purification and Structure Characterization.

(198) Product purification was systematically achieved by tangential ultrafiltration on a 1000 normal-molecular-weight cutoff (NMWCO) regenerated cellulose membrane (Pellicon2, 0.5 m.sup.2, Millipore, Mass.) against 5 L of NaCl 1 M and then 20 L of Milli-Q water. The resulting concentrated solution was freezedried. Pure dry products were homogenized to obtain a fine powder by a Universal mill A10 IKA (IKA-WERKE GMBH & CO. KG, Germany). 1H NMR spectra were recorded with a 200 MHz Bruker spectrometer and with a 600 MHz Varian spectrometer from samples in D20 using residual H2O peak as a standard (4.805 ppm). Absolute determination of molecular weights and size distributions were performed on polysaccharide solutions by a size exclusion chromatography (SEC) eluted in 0.1 M LiNO3 coupled to a multiangle laser lightscattering photometer (MALLS; Dawn DSP-F, Wyatt Technology, Santa Barbara, Calif.) connected in series to a differential refractive index detector (RI, ERC 7515A, Erma Cr. Inc., France). An TSK Gel G3000 PWXL (TosoHaas, Cambridge, U.K.) column was used for polysaccharide analysis. Degrees of substitution (ds), defined as the number of substituted carboxymethyl (dsCM), carboxymethyl amide (dsX), and sulfate (dsS) groups.

(199) F6: 0.61 CM, 0.15 L-Phe(OMe), 0.7S

(200) wherein CM corresponds to the carboxymethyl groups (61% from possible 20 to 150% contents), S corresponds to the sulfate groups (70% from possible 20-150% contents); L-Phe(OMe) is present at 15% from possible 0-50% substitutions. CR 36: Prepared from T10, NHX=L-Phe(OMe)) having the following degree of substitution:

(201) 59 CM, 22 L-Phe(OMe), 83S.

(202) wherein CM corresponds to the carboxymethyl groups (59% from possible 20 to 150% contents), S corresponds to the sulfate groups (83% from possible 20-150% contents); L-Phe(OMe) is present at 22% from possible 0-50% substitutions.

(203) Treatment of SAMP8 Mice with F6

(204) A total of 60 5-month-old male SAMP8 and 14 5-month-old SAMR1 (normal control) were fed in clean grade animal houses at 22-24 with the humidity of 555% throughout 12 h light-dark cycle, all mice were fed with standard diet. The mean life spans of SAMP8 and SAMR1 were 152 and 303 months respectively. All mice were adaptively fed for five days, and then 60 SAMP8 mice were divided into six groups according to their weights, with 15 mice in each group: model group, Huperzine A group, F6 high-dose group (F6 H, 50 mg/kg), and F6 low-dose group (F6 L, 50 mg/kg). Huperzine A group was orally administered with 3.86 g/Kg Huperzine A (equivalent to clinical the dose of people, dissolved in normal sodium) once a day; F6 H group was intraperitoneally injected 50 mg.Math.Kg-1 F6 (dissolved in normal sodium) once every four days; F6 L group was intraperitoneally injected 25 mg.Math.Kg-1 F6 (dissolved in normal sodium) once every four days; the model group and SAMR1 normal control group (control) were orally administered with equivalent dose solute (200 L purified water) once a day. All groups were treated for 2 months before perform behavior and molecular biology detection.

(205) Behavior and Molecular Biology Detection:

(206) Determination of the effect of GAGs analogues on the learning and memory ability of SAM Behaviours detections were performed in order: place navigation (day 1-4), spatial probe test (day 5) and foot shock avoidance test (day 8-9). Place navigation Morris water maze (MWM) detection was performed referring to reported literature with minor modifications (reference). The escape latency, swimming distance, residence time in different quadrant, the length of swimming route in different quadrant, total length of swimming route, swimming speed, percentage of successful escape in each group were investigated. Before experiment, mice were first put onto the submerged platform for 15 s (adaptation phase), and then put into water faced to the pool wall in the first and third quadrant respectively. Mice freely swam in MWM for 90 s, and the residence time on the platform longer than 5 s was considered as successfully searching for platform, the time from entering into water to successfully searching for platform was served as the escape latency. If mice did not successfully got platform in 90 s, the escape latency were recorded as 90 s. The mean escape latency every day was calculated to evaluate the ability to acquire spatial memory. All mice were continuously trained for 4 days, and the percentage of mice successfully searching for platform (swim-out rate) in each group every day was calculated.

(207) Spatial Probe Test.

(208) The platform was removed on the day after finishing the place navigation (the fifth day). Each mouse freely swam from the third quadrant for 90 s. The number of annulus crossings (across the actual location where the platform had been located in place navigation determination), the swim distance rate and time rate in the same platform (the percentage of swim distance or time in the platform of the third quadrant compared to total swim distance or time for mice) within 90 s were recorded to evaluate the ability to acquire spatial memory.

(209) Foot Shock Avoidance.

(210) Mice were performed foot shock avoidance test two days after finishing MWM test. The jumping apparatus was square and had eight rooms, with charged copper reticulum in the bottom of each room, its voltage could be controlled and regulated by computer, and a voltage of 40 V was used in this experiment. In the bottom of each room, an insulated circular platform with 5 cm diameter was put in the same side, fenders were put in the surrounding, the top side faced to the observer was transparent, and the other sides were non-transparent. The top of the room was moveable and could put into and take out of mice. Mice could stand in the insulated platform to avoid electric shock. The experiment had two phases: memory acquisition and memory consolidation.

(211) Experiment of Memory Acquisition.

(212) mice were put into room for 2 min to be familiar with the environment, and then put on the copper reticulum at the beginning of the experiment and switched on (40 V) for 5 min. The latency of mice escaping onto the insulated platform for the first time after electric shock, time on platform within 5 min (time in safe area), time underwent electric shock (time in wrong area), times of electric shock and frequency of mice underwent electric shock were recorded as the learning performance to judge the ability of passive avoidance response.

(213) Experiment of Memory Consolidation.

(214) mice were put onto platform to switch on for 5 min the next day after finishing the experiment of memory acquisition, the time when mice jumped down the platform into copper reticulum for the first time (latency), time in safe area (platform), time in wrong area (copper reticulum), frequency of electric shock and numbers of mice underwent electric shock were recorded to evaluate the memory performance.

(215) Western Blot.

(216) After finishing foot shock avoidance test, of mice were collected blood by enucleating eyeball and then sacrificed. The whole brain was taken out on ice and washed with pooled normal sodium to remove blood, and then the left and right cerebral cortex and hippocampal area were respectively separated and put into freezing tubes, and finally preserved in liquid nitrogen. The left hippocampal area and cerebral cortex of three mice in each group were weighed, 1 mL protein lysate [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1% Trition X-100, 1 mM EDTA, 10 mM NaF, 1 mM Na.sub.3VO.sub.4, cocktail inhibitor 1%] were added into 20 mg grinned samples on ice for 30 min, and then centrifuged at 13,000 rpm for 15 min at 4 C., the supernatant was collected and preserved at 80 C. The protein content was determined by using BCA kit. A total of 30 g proteins were collected to perform Western blot. After SDS-PAGE, protein was transferred onto PVDF membrane at 4 C. and blocked for 1 h with 3% BSA, then added with the primary antibody to incubate overnight at 4 C. Following primary antibody were used: Anti-Tau 1 (1:200), anti-Tau5 (1:500), anti-pTau199/202 (1:1,000), anti-pTau231 (1:1,000), anti-pTau404 (1:1,000). The fluorescence-labeled secondary antibody was added and incubated for 1 h in dark at room temperature. Odyssey infrared imaging system was finally used to scan and analyze bands.

(217) Fluorescence Immunohistochemistry.

(218) Sample processing. After finishing foot shock avoidance test, mice were underwent endocardial perfusion with 0.1 M PBS for 5 min and 4% paraformaldehyde (0.1 M PBS, pH 7.4) for 10 min, when the liver and bowels of mice turned white and tail twitched, the whole brain was rapidly taken out and fixed with 4% paraformaldehyde for 24 h, and then put into 20% sucrose solution (in 0.1 M PBS, pH7.4) overnight at 4 C. And then went through dehydration procedures: 50% alcohol for 36 h, 70% alcohol for 48 h, 80% alcohol for 6 h, 95% alcohol for 4 h (2), 100% alcohol for 3 h for (3), dimethyl benzene for 1.5 h (2), paraffin wax for 4 h (2). Finally samples were performed with paraffin imbedding and serial sections with a thickness of 5 M.

(219) Fluorescent Staining:

(220) the formal experiment of fluorescent staining was developed on the basis that no positive staining was observed in non-specific primary immunostaining and non-specific secondary immunostaining of each determined index.

(221) Deparaffinage: dimethyl benzene for 5 min for three times, 100% alcohol for 3 min for twice, 95% alcohol for 1 min, 70% alcohol for 1 min, 50% alcohol for 1 min, washed with water for 5 min.

(222) Antigen retrieval: citrate water bath at 100 C. for 20 min, washed with water for 10 min, washed with PBS for 5 min for once. Antigen blocking: blocked with 3% BSA for 30 min at room temperature. Endogenous biotin blocking: performed according to the instructions of the kit. Blocked with solution A and B for 15 min respectively. The primary antibody: diluted with 1% BSA+0.2% Triton X-100+PBS and incubated overnight at 4 C. Anti Tau 5 (1:100), anti pTau199/202 (1:100), anti pTau231 (1:100), anti pTau262 (1:200), anti pTau396 (1:100), anti CS (1:100), anti cathepsin D (1:100), anti cathepsin B (1:50), anti HS (A04B08) (1:20). The secondary antibody: diluted with 1% BSA+0.2% Triton X-100+PBS (1:200) and incubated for 1 h at room temperature in dark place. HS was referred to reported literature (Ottenheijm et al., 2007), anti-VSV was diluted (1:5) and incubated for 1 h at room temperature and then performed staining.

(223) Signal amplification: performed according to the instructions of the kit, two drips of solution A and B were respectively added into 10 mL PBS and incubated for 30 min at room temperature in dark place. Coloration: a drip of levamisole solution and two drips of solution A, B and C in the kit were respectively added into 5 ml Tris-Hcl (0.1 M, pH 8.2) and incubated for 20 min at room temperature in dark place. DAPI staining: used 1 g.Math.ml-1 DAPI to stain for 3 min at room temperature. Mounting and preserved at 4 C. in dark place. Taking pictures in time.

Example 12

F6 and CR36 Treatment on A42 Neurotoxicity in Differentiated or Undifferentiated SH-SY5Y Cells

(224) F6 and CR36 were assayed on their capacities to modify A42 toxicity in differentiated and in undifferentiated human SH-SY5Y cells (Datki et al., 2003). Undifferentiated SH-SY5Y cells were maintained at 37 C. and 5% CO.sub.2 in DMEM supplemented with 10% FBS. For the assay, cells were seeded in 96 wells plates at 15 000 cells/well and maintained in DMEM supplemented with 10% FBS for 24 h. For the differentiated cells assay, medium was supplemented with 10 M retinoic acid (Sigma-Aldrich) and cells were allowed to differentiate for 3 days. Retinoic acid treatment was not performed for the undifferentiated cells assay. Human A42 peptide (Sigma-Aldrich) was extemporary aggregated in aqueous solution (50 M) by gentle shaking at rt for 3 days. Aggregated A42 was then added to the differentiated or undifferentiated cells at 10 M final concentration. This A42 peptide concentration was fixed by dose-effect experiments to obtain near 50% of cell viability (data not shown). F6, CR36, or control products (LiCl2, heparin, enoxaparin, DMMB) were added to cells at 0.01, 0.1 or 1 g/mL final concentration with 10 M of aggregated A42 peptide and cells were incubated for 1 day. Cell viability was measured by the MTT assay (Mosmann, 1983). Briefly, medium was exchanged and 10 L of a MTT stock solution (5 mg/mL) was added to each well. Cells were incubated for 2 h at rt and the MTT solution was discarded. DMSO was added to each well and optical density was read at 560 nm. Optical density was directly correlated to cell count by means of calibration curves for both, differentiated an undifferentiated cells (data not shown).

Example 12

Blood Brain Barrier (BBB) Passage

(225) The Blood Brain Barrier (BBB) permeability studies were performed in BBB cells prepared as previously described (B. B. Weksler et al.; FASEB J. 2005 November; 19(13):1872-4) in hCMEC/D3 cell monolayers. Briefly, permeability of BBB to molecules of different sizes was measured on Transwell polycarbonate insert filters. HCMEC/D3 cells were seeded on the filters at a confluent density of 2105 cells/cm.sup.2 in EGM-2 medium. After 48 h, assayed molecules including F6, CR36, HM2602 and Oligo-Dextran were added to the upper chamber, the lower chamber was sampled at 10-min intervals and the molecules that passed through the cell-covered inserts was determined using DMMB method for detection of sulfated saccharides (FIG. 22).

(226) Data Analysis

(227) Data analysis was performed by using Prism 5.0 (GraphPad Software Inc., CA) software, data were presented as meanSEM. Paired comparison was performed by using two-sample t test and Mann-Whitney Test, multiple comparison was performed by using Oneway ANOVA.

CONCLUSION

(228) In human Alzheimer hippocampus an increase of GAG binding affinity for Tau was observed. Furthermore in Alzheimer's disease a strong staining with co-localization of HS and hyperphosphorylated Tau was observed which was concentrated around the nuclei. These results showed that HS increased in content in Alzheimer disease. This increase in HS was accompanied with alterations in the structure and composition of HS and together with putative increase in 3-O-sulfation as detected by transcript over-expression. 3-O-sulfation is a HS biosynthetic modification characteristically found in heparin and carried out by 3-O-sulfotransferases (3-OSTs). HS modified by 3-OSTs could then play important roles in Alzheimer's disease. The expression of two 3-OST isoforms was markedly increased in Alzheimer's disease brains. Our results, reinforced by literature data indicating that Tau conformational changes induced by heparin can induce Tau hyperphosphorylation, suggest that this pathological signature of rare sulfation pattern in HS from Alzheimer's disease brains could be involved in pathology. The presence of transcripts corresponding to 3-OST was confirmed in the transgenic hTAU-P301L zebrafish model used in this study. This model is also characterized by abnormal hyperphosphorylation of Tau protein.

(229) Here, it has been demonstrated in vivo that by decreasing the expression of 3-OST-2 by morpholino, accumulation of abnormal Tau hyperphosphorylation was markedly decreased. This strongly suggests an essential requirement for HS in the phosphorylation process. Particularly, HS structure and composition seams to require 3-O-sulfation for pathological Tau modification.

(230) The decreased accumulation of hyperphosphorylated Tau after silencing of 3-OST-2 suggests that 3-O-sulfated HS stimulate interaction between Tau protein with kinases and/or phosphatases or that particular sulfated sequences of HS can regulate the affinity of Tau for kinases and/or phosphatases.

(231) The changes induced in the structures of 3-O-sulfated HS present in Alzheimer disease, followed inhibition of 3-OST-2 may prevent a possible conformational Tau change that promotes microtubule disassembly and polymerization of the protein, this polymerization ends in the formation of insoluble PHFs, These changes might expose Tau to phosphatases, leading to lowered levels of phosphorylated Tau accumulation. Several evidences suggest that oligomeric forms of Tau might also have a role in disease pathogenesis, and dissolution of NFTs using drugs targeting Tau aggregation could conceivably result in increased amounts of available Tau oligomers. Thus, inhibition of 3-OST-2 protects cells from Tau abnormal phosphorylation, from microtubule disassembly and from PHFs formation.

(232) The results of this study suggest the feasibility of targeting Tau phosphorylation by approaches other than inhibition of protein kinases or NFTs disaggregation strategies. The inhibitory effect of the 3-OST-2 morpholino on Tau phosphorylation in vivo, and/or the use of siRNA in cells, permit further studies on the mechanism of the inhibitory effect.

Example 13

A Peptide Neurotoxicity Protection Assay

(233) F6 or other HM were assayed on their capacities to modify Ab42 toxicity in differentiated and in undifferentiated human SH-SY5Y cells (Datki et al., 2003). Undifferentiated SH-SY5Y cells were maintained at 37 C. and 5% CO2 in DMEM supplemented with 10% FBS. For the assay, cells were seeded in 96 wells plates at 15 000 cells/well and maintained in DMEM supplemented with 10% FBS for 24 h. For the differentiated cells assay, medium was supplemented with 10 retinoic acid (Sigma-Aldrich) and cells were allowed to differentiate for 3 days. Retinoic acid treatment was not performed for the undifferentiated cells assay. Human A25-35 peptide or A42 peptide (Sigma-Aldrich), as indicated, was extemporary aggregated (50 M) in aqueous solution by gentle shaking at rt for 3 days. Aggregated A42 was then added to the differentiated or undifferentiated cells at 10 M for A42 or 25 M for A25-35 (final concentrations). The A peptide concentration was fixed by dose-effect experiments to obtain near 50% of cell viability (data not shown). F6 or other molecules were added to cells at 1 or 10 g/mL final concentration with the aggregated A42 peptide and cells were incubated for 1 day. Cell viability was measured by the MTT assay (Mosmann, 1983). Briefly, medium was exchanged and 10 L of a MTT stock solution (5 mg/mL) was added to each well. Cells were incubated for 2 h at rt and the MTT solution was discarded. DMSO was added to each well and optical density was read at 560 nm. Optical density was directly correlated to cell count by means of calibration curves for both, differentiated an undifferentiated cells (data not shown).

(234) Western Blotting of Tau:

(235) protein extracts (30 g of protein) were blotted for detection of p-Tau using antibody Tau180 (commercially available at Thermo Fisher Scientific Inc. I 3747 N Meridian Rd, Rockford, Ill. USA 61101).

(236) Structural features of the Heparan sulfate mimetics used in this study (example 13)

(237) ##STR00011##

Structural Features of Anti-Tau HM

(238) TABLE-US-00006 Nombre of glu. (dp) dsS dsCM ds hydrophobicity Dextran (Dx) ~250 0 0 0 D4 ~50 0.2 0.75 0 E5 ~50 1 0.5 0 D6 8-15 1.2 0.6 0.2 F6 ~33 0.7 0.75 0.15
Results are presented FIGS. 25 to 29.