Mutant Strain of Filamentous Fungus and Use Therefor

20190169239 ยท 2019-06-06

Assignee

Inventors

Cpc classification

International classification

Abstract

A filamentous fungus mutant strain showing improved secretory protein production and a method of producing a protein using the filamentous fungus are provided. The method of producing a protein comprises a step of culturing a filamentous fungus mutant strain in which a function of tubulin is reduced or lost and collecting a protein from a culture product.

Claims

1. A method of producing a protein, the method comprising a step of culturing a filamentous fungus mutant strain in which a function of tubulin is reduced or lost and collecting a protein from a culture product.

2. The method according to claim 1, wherein the reduction or loss of the function of tubulin is a reduction or loss of expression of tubulin compared to that in a parent strain.

3. The method according to claim 1, wherein the tubulin is -tubulin and/or -tubulin.

4. The method according to claim 1, wherein the reduction or loss of the function of tubulin is acquired by deleting or inactivating a gene encoding the tubulin.

5. The method according to claim 4, wherein the gene encoding the tubulin is a gene encoding -tubulin and/or -tubulin.

6. The method according to claim 5, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (a) to (f): (a) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3; (b) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 or 3 and encoding a protein having a function as -tubulin; (c) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions and encoding a protein having a function as -tubulin; (d) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4; (e) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and (f) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin.

7. The method according to claim 5, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (g) to (l): (g) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13; (h) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 and encoding a protein having a function as -tubulin; (i) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 under stringent conditions and encoding a protein having a function as -tubulin; (j) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14; (k) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and (l) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin.

8. The method according to claim 1, wherein the filamentous fungus is a filamentous fungus belonging to Acremonium, Aspergillus, Chrysosporium, Fusarium, Humicola, Myceliophthora, Neurospora, Penicillium, Piromyces, Talaromyces, Thermoascus, Thielavia, or Trichoderma.

9. The method according to claim 8, wherein the filamentous fungus is a Trichoderma filamentous fungus.

10. (canceled)

11. The method according to claim 1, wherein the protein is one or more selected from the group consisting of cellulase, xylanase, protease, lipase, exoglucanase, endoglucanase, -glucosidase, mannase, arabinase, arabinofuranosidase, galactase, and amylase.

12. The method according to claim 11, wherein the protein is cellulase and/or xylanase.

13. The method according to claim 12, wherein the filamentous fungus mutant strain is cultured in the presence of a cellulase inducer selected from the group consisting of cellulose, sophorose, and a cellooligosaccharide, and cellulase or xylanase is collected from a culture product.

14.-15. (canceled)

16. A mutant strain of a Trichoderma filamentous fungus wherein a function of tubulin is reduced or lost, wherein the secretory protein productivity is improved compared to that of a parent fungal strain.

17. The mutant strain according to claim 16, wherein the reduction or loss of the function of tubulin is a reduction or loss of expression of tubulin compared to that in a parent strain.

18. The mutant strain according to claim 16, wherein the tubulin is -tubulin and/or -tubulin.

19. The mutant strain according to claim 16, wherein the reduction or loss of the function of tubulin is acquired by deleting or inactivating a gene encoding the tubulin.

20. The mutant strain according to claim 19, wherein the gene encoding the tubulin is a gene encoding -tubulin and/or -tubulin.

21. The mutant strain according to claim 20, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (a) to (0: (a) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3; (b) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 or 3 and encoding a protein having a function as -tubulin; (c) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions and encoding a protein having a function as -tubulin; (d) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4; (e) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and (f) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin.

22. The mutant strain according to claim 20, wherein the gene encoding -tubulin is represented by the following polynucleotides (g) to (l): (g) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13; (h) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 and encoding a protein having a function as -tubulin; (i) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 under stringent conditions and encoding a protein having a function as -tubulin; (j) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14; (k) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and (l) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin.

23. The mutant strain according to claim 16, wherein the filamentous fungus is Trichoderma reesei.

24.-25. (canceled)

Description

BRIEF DESCRIPTION OF DRAWINGS

[0021] FIG. 1 is a graph showing protein productivity when Trichoderma reesei PC-3-7 strain and PC-3-7tubB strain were cultured using crystalline cellulose as a carbon source. The solid line connecting black squares indicates the PC-3-7 strain, and the broken line connecting black circles indicates the PC-3-7tubB strain. The values are relative values with respect to the maximum production amount of PC-3-7 strain assumed as 100%.

[0022] FIG. 2 is a graph showing protein productivity when Trichoderma reesei PCD-10 strain and PCD-10tubB strain were cultured using crystalline cellulose as a carbon source. The solid line connecting black squares indicates the PCD-10 strain, and the broken line connecting black circles indicates the PCD-10tubB strain. The values are relative values with respect to the maximum production amount of PCD-10 strain assumed as 100%.

[0023] FIG. 3 is a graph showing protein productivity when Trichoderma reesei PC-3-7 strain and PC-3-7tubB strain were cultured using crystalline cellulose and glucose as carbon sources. The solid line connecting black squares indicates the PC-3-7 strain, and the broken line connecting black circles indicates the PC-3-7tubB strain. The values are relative values with respect to the maximum production amount of PC-3-7 strain assumed as 100%.

[0024] FIG. 4 is a graph showing protein productivity when Trichoderma reesei PC-3-7 strain and PC-3-7tubB strain were cultured using crystalline cellulose and xylan as carbon sources. The solid line connecting black squares indicates the PC-3-7 strain, and the broken line connecting black circles indicates the PC-3-7tubB strain. The values are relative values with respect to the maximum production amount of the PC-3-7 strain assumed as 100%.

DETAILED DESCRIPTION OF THE INVENTION

[0025] The present invention relates to a provision of a filamentous fungus mutant strain showing improved secretory protein production and a method of producing a protein using the filamentous fungus.

[0026] The present inventors diligently studied to solve the above-described problems and, as a result, found that secretory protein production is improved in a filamentous fungus mutant strain that has lost the function of tubulin and that efficient protein production is possible by using the fungal strain.

[0027] According to the present invention, a filamentous fungus showing improved secretory production of a protein such as cellulase or xylanase is provided, and use of the filamentous fungus allows to produce the protein more efficiently.

[0028] In the present specification, amino acid sequence and nucleotide sequence identities are calculated by a Lipman-Pearson method (Lipman, D. J., Pearson, W. R.: Science, 1985, 227: 1435-1441). Specifically, the identity is calculated by performing analysis using a homology analysis (Search homology) program of genetic information processing software Genetyx-Win (Software Development Co.) and setting the unit size to compare (ktup) at 2.

[0029] In the present specification, one or several used in connection with deletion, substitution, addition, or insertion of amino acid(s) or nucleotide(s) in an amino acid sequence or a nucleotide sequence can be, for example, 1 to 12, preferably 1 to 8, and more preferably 1 to 4, unless otherwise defined. In the present specification, the term addition of amino acid(s) or nucleotide(s) includes addition of one or several amino acids or nucleotides to one end or both ends of a sequence.

[0030] In the present specification, the team stringent conditions relating to hybridization refers to conditions allowing a gene comprising a nucleotide sequence having a sequence identity of about 80% or more or about 90% or more to be verified, unless otherwise defined. Examples of the stringent conditions include the conditions described in Molecular Cloning: A LABORATORY MANUAL THIRD EDITION (Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press, 2001). A person skilled in the art of hybridization can appropriately make stringent conditions by regulating, for example, the salt concentration of a hybridization solution and the temperature, depending on, for example, the nucleotide sequence, the concentration and the length of a probe. In one example, the stringent conditions are preferably 5SSC and 70 C. or more and more preferably 5SSC and 85 C. or more for hybridization solution; and preferably 1SSC and 60 C. or more and more preferably 1SSC and 73 C. or more for washing condition. The combinations of SSC and temperature conditions are merely examples, and a person skilled in the art can achieve appropriate stringency by appropriately combining the above-mentioned factors or other ones determining the stringency of hybridization.

[0031] In the present specification, the terms upstream and downstream of a gene refer to a region extending from the 5 side and the 3 side, respectively, of a targeted gene or region. The upstream and the downstream of a gene are not limited to the upstream region and the downstream region from the translation initiation site of the gene, unless otherwise defined.

<Construction of Filamentous Fungus Mutant Strain>

[0032] In the filamentous fungus mutant strain of the present invention, the function of tubulin is reduced or lost.

[0033] Tubulin is a protein forming a microtubule and a centrosome, which are major protein fibers that form a cytoskeleton, and as structural proteins of tubulin, three types, -tubulin, -tubulin, and -tubulin, are known. -tubulin and -tubulin have similar structures, - and -tubulins form a heterodimer, and the heterodimer is polymerized to form a protofilament. Further, -tubulin is known to be responsible for formation of a centrosome.

[0034] In the present invention, the term tubulin encompasses -, -, and -tubulins unless especially specified and preferably refers to - or -tubulin, and more preferably -tubulin.

[0035] For example, -tubulin of Trichoderma reesei is registered in the NCBI database as Tubulin alpha chain 1 (TRIREDRAFT_120830: SEQ ID NO: 2) and Tubulin alpha chain 2 (TRIREDRAFT_120789: SEQ ID NO: 4); and -tubulin is registered as Tubulin beta chain 1 (TRIREDRAFT_21742: SEQ ID NO: 6) and Tubulin beta chain 2 (TRIREDRAFT_122886: SEQ ID NO: 8). In addition, Hypothetical protein (TRIREDRAFT_58421: SEQ ID NO: 10), Hypothetical protein (TRIREDRAFT_124181: SEQ ID NO: 12), and WD40 repeat-like protein (TRIREDRAFT_65771: SEQ ID NO: 14) are registered as those including -tubulin domains.

[0036] Examples of -tubulin of filamentous fungi other than Trichoderma reesei include Tubulin alpha-1 chain (NCBI-Protein ID: XP_657920) and Tubulin alpha-2 chain (NCBI-Protein ID: XP_680839) of Aspergillus nidulans; tubulin alpha-2 (NCBI-Protein ID: XP_963223) and alpha tubulin (NCBI-Protein ID: XP_958904) of Neurospora crassa; and tubulin/FtsZ family protein (NCBI-Protein ID: KKO97118) of Trichoderma harzianum. These -tubulins have amino acid sequence identities of 68% to 89% with the Tubulin alpha chain 1 (TRIREDRAFT_120830) and amino acid sequence identities of 68% to 93% with Tubulin alpha chain 2 (TRIREDRAFT_120789) of Trichoderma reesei.

[0037] Examples of -tubulin include TUBULIN BETA-1 CHAIN (NCBI-Protein ID: XP_658786) and TUBULIN BETA-2 CHAIN (NCBI-Protein ID: XP_664442) of Aspergillus nidulans; and tubulin beta chain (NCBI-Protein ID: XP_957669) of Neurospora crassa. These -tubulins have amino acid sequence identities of 84% to 91% with Tubulin beta chain 1 (TRIREDRAFT_21742) and amino acid sequence identities of 82% to 91% with Tubulin beta chain 2 (TRIREDRAFT_122886) of Trichoderma reesei.

[0038] Accordingly, preferred examples of -tubulin in the present invention include the followings:

[0039] (A) a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4;

[0040] (B) a protein having an amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0041] (C) a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin.

[0042] Examples of -tubulin include the followings:

[0043] (D) a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14;

[0044] (E) a protein having an amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0045] (F) a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin.

[0046] Examples of the amino acid sequence having an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, 12 or 14 include amino acid sequences having an identity of preferably 90% or more, more preferably 95% or more, further preferably 97%, further preferably 98%, and further preferably 99% or more.

[0047] Tubulin is a protein forming a microtubule and a centrosome; and -tubulin and -tubulin form a heterodimer, which forms a protofilament by polymerization. Protofilaments are arranged in parallel to form a microtubule. A protein having a function as -tubulin and a protein having a function as -tubulin in the present invention are proteins having abilities of forming a heterodimer and a protofilament by polymerization, as in -tubulin and -tubulin.

[0048] In the present invention, the function of tubulin is reduced or lost may be that the expression of tubulin is reduced compared to that in the parent strain or lost, preferably that the expression of one or more of - and -tubulins is reduced compared to that in the parent strain or lost to inhibit formation of a heterodimer of - and -tubulins, and further preferably that the expression of -tubulin is reduced compared to that in the parent strain or lost to inhibit formation of a heterodimer of - and -tubulins.

[0049] In the present invention, the expression of tubulin means that a translation product is produced from a gene encoding the protein and is localized at the site of action in a functional state. A reduction or loss in the expression of tubulin means a state in which the amount of tubulin present in the filamentous fungus mutant strain cells is significantly reduced compared to that in the parent strain or lost as a result of modification at a genetic level, transcriptional level, posttranscriptional regulation level, translational level, or posttranslational modification level.

[0050] The reduction in the expression of tubulin compared to that in the parent strain means that the expression amount of tubulin in filamentous fungi is reduced compared to that of the parent strain, more specifically, the expression amount of tubulin in the cells is reduced to usually 50% or less, preferably 20% or less, and more preferably 10% or less compared to that in the parent strain, and thereby the activity is also similarly reduced. It is most preferred that the expression amount of tubulin is 0%, that is, the expression of tubulin is lost.

[0051] The comparison of expression amounts of tubulin is performed based on the expression amount of the tubulin protein.

[0052] The expression amount of tubulin can be measured by a known immunological method, such as western blotting or immunohistochemical staining.

[0053] The filamentous fungus mutant strain in which tubulin expression is reduced compared to a parent strain or is lost preferably can be acquired by deleting or inactivating the tubulin gene on the chromosomal DNA of the filamentous fungus parent strain. Herein, the tubulin gene refers to a DNA having a transcriptional region including an ORF and a transcriptional regulatory region such as a promoter of the gene.

[0054] In the present invention, examples of the -tubulin gene preferably include any of the following:

[0055] (a) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3;

[0056] (b) a polynucleotide having a nucleotide sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, further preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more with the nucleotide sequence represented by SEQ ID NO: 1 or 3 and encoding a protein having a function as -tubulin;

[0057] (c) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions and encoding a protein having a function as -tubulin;

[0058] (d) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4;

[0059] (e) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0060] (f) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, further preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin.

[0061] Preferred examples of the -tubulin gene includes the followings:

[0062] (g) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13;

[0063] (h) a polynucleotide having a nucleotide sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, further preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more with the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 and encoding a protein having a function as -tubulin;

[0064] (i) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 under stringent conditions and encoding a protein having a function as -tubulin;

[0065] (j) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14;

[0066] (k) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0067] (l) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, further preferably 96% or more, further preferably 97% or more, further preferably 98% or more, and further preferably 99% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin.

[0068] Examples of deletion or inactivation of the tubulin gene include introduction of a mutation into one or more nucleotides on the nucleotide sequence of the gene, that is, deletion of a part or the whole of the nucleotide sequence of the gene, or substitution for or insertion to the nucleotide sequence of another nucleotide sequence (in this case, the amino acid sequence of tubulin may be the same as or different from that of a parent strain).

[0069] Examples of the nucleotide region into which a mutation is introduced include a transcriptional region of the tubulin gene and transcriptional regulatory region, such as a promoter and an enhancer (transcriptional activation region), of the gene, and preferred is the transcriptional region.

[0070] Examples of the transcriptional regulatory region of the tubulin gene include a region of 30 nucleotides upstream of the 5 end of the transcriptional region of the tubulin gene on the chromosomal DNA. Examples of the transcriptional activation region of the tubulin gene include a region corresponding to the nucleotides 1000 to 500 upstream of the gene.

[0071] A nucleotide mutation may be introduced into the transcriptional region with any limitation of the kind or the number of nucleotides as long as it can reduce or lose the tubulin expression. Examples of deletion of nucleotides include deletion of a part of the transcriptional region, preferably 10 nucleotides or more, more preferably 20 nucleotides or more, further preferably 100 nucleotides or more, and further preferably 200 nucleotides or more, and further preferably deletion of the whole of the transcriptional region. Examples of substitution of nucleotides include substitution of nucleotides within a range from the 5 end of the transcriptional region to the 150th nucleotide, preferably to the 100th nucleotide, more preferably to the 50th nucleotide, further preferably to the 30th nucleotide, and further preferably to the 20th nucleotide with a nonsense codon. Examples of insertion of nucleotides include addition of 50 or more nucleotides, preferably 100 or more nucleotides, more preferably 200 or more nucleotides, further preferably 500 or more nucleotides, and further preferably 1 kb or more of a DNA fragment at the position following the nucleotides within a range from the 5 end of the transcriptional region to the 150th nucleotide, preferably to the 100th nucleotide, more preferably to the 50th nucleotide, further preferably to the 30th nucleotide, and further preferably to the 20th nucleotide. Preferred examples of the form of the addition of nucleotides include introduction of a drug resistance gene such as a hygromycin resistance gene and an aureobasidin resistance gene, or an auxotrophic gene such as an acetoamidase gene that is not possessed by the filamentous fungi.

[0072] The method of introducing a nucleotide mutation into the tubulin gene on the chromosomal DNA of filamentous fungi may be, for example, a method of using homologous recombination. In a method of using common homologous recombination, for example, a gene mutated by deletion, substitution, or insertion of nucleotides is inserted between the upstream region and the downstream region of the tubulin gene to produce a DNA fragment including a drug resistance gene or an auxotrophic gene, and the DNA fragment is used to cause homologous recombination in the locus of the tubulin gene in a host cell to which nucleotide deletion or the like is desired to be introduced.

[0073] In the method using homologous recombination, specifically, i) the DNA fragment for homologous recombination is introduced into a filamentous fungus parent strain by a usual manner, and subsequently a transformant into which, as a result of homologous recombination, a plasmid for homologous recombination has been introduced on the chromosomal DNA is selected using drug resistance or auxotrophy as an index; ii) PCR is performed using the chromosomal DNA of the resulting transformant as a template. The primers on this occasion are designed such that the site where the nucleotides of the gene are deleted, substituted, or inserted is amplified. A strain in which a gene having the original length is not amplified, but a gene having a length reflecting the deletion, substitution, or insertion of the nucleotides is amplified is selected; and iii) finally, a strain in which the mutated gene is introduced into only the locus of the chromosomal DNA and not introduced into another site can be obtained by Southern analysis.

[0074] Alternatively, a nucleotide mutation may be introduced into the tubulin gene on the chromosomal DNA of a parent strain by, for example, a method using a bacteriophage or conjugation.

[0075] The filamentous fungus mutant strain of the present invention can also be obtained by subjecting a filamentous fungus parent strain to mutation processing and then selecting a strain in which the tubulin expression is reduced compared to the parent strain or is lost. Examples of the mutation processing include treatment with N-methyl-N-nitro-N-nitrosoguanidine (NTG), ethylnitrosourea, or ultraviolet light (Shinban Biseibutsu Zikken-ho (New Edition, Microorganisms Experimental Methods), 1999, pp. 126-134, Kodansha Scientific Ltd.), and irradiation with radioactive rays. In addition, a variety of alkylating agents and carcinogens can be used as mutagens.

[0076] Alternatively, the tubulin expression can be reduced without introducing a mutation into the tubulin gene. Examples of such a method include introduction of a nucleic acid having an activity of degrading a transcriptional product of a gene encoding a protein or a nucleic acid suppressing translation of the transcriptional product into a protein. Examples of such a nucleic acid include a nucleic acid having a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding the protein or a part of the nucleotide sequence.

[0077] A nucleotide sequence substantially complementary to the nucleotide sequence of mRNA encoding tubulin refers to a nucleotide sequence having complementarity such that the nucleotide sequence binds to the target sequence of the mRNA to inhibit the translation thereof under physiological conditions inside the target filamentous fungus cells, and specifically, for example, a nucleotide sequence having an identity of about 80% or more, preferably about 90% or more, more preferably about 95% or more, and further preferably about 97% or more with the nucleotide sequence completely complementary to the nucleotide sequence of the mRNA (i.e., the nucleotide sequence of a complementary strand of the mRNA) in the overlapping region.

[0078] More specifically, examples of the nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding tubulin include polynucleotides in the above-described (a) to (l).

[0079] Preferred examples of the mRNA encoding tubulin include mRNA encoding -tubulin or -tubulin of Trichoderma reesei having the nucleotide sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, 11 or 13.

[0080] A part of the nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding tubulin may have no limitation of length and position as long as it can specifically binds to the mRNA of tubulin and can inhibit the translation of the mRNA into the protein. From the viewpoint of sequence specificity, the part complementary or substantially complementary to the target sequence includes at least 10 or more nucleotides, preferably about 15 or more nucleotides, and more preferably about 20 or more nucleotides.

[0081] Specifically, preferred examples of the nucleic acid having a nucleotide sequence complementary or substantially complementary to the nucleotide sequence of mRNA encoding tubulin or a part of the nucleotide sequence includes the following (i) to (iii):

[0082] (i) Antisense RNA to mRNA encoding tubulin;

[0083] (ii) Small interfering RNA (siRNA) to mRNA encoding tubulin; and

[0084] (iii) Ribozyme to mRNA encoding tubulin.

[0085] The parent strain in the present invention may be any filamentous fungi that express tubulin, and examples thereof include filamentous fungi belonging to Eumycota or Oomycota. Specifically, the filamentous fungi are, for example, those belonging to Trichoderma, Aspergillus, Penicillium, Neurospora, Fusarium, Chrysosporium, Humicola, Emericella, Hypocrea, Acremonium, Chrysosporium, Myceliophthora, Piromyces, Talaromyces, or Thielavia. The filamentous fungi are preferably those belonging to Trichoderma.

[0086] Examples of the filamentous fungi belonging to Trichoderma include Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma koningii, and Trichoderma viride. The filamentous fungi are preferably Trichoderma reesei and more preferably Trichoderma reesei PCD-10 strain (FERN P-8172) and Trichoderma reesei PC-3-7 strain (ATCC66589).

[0087] The filamentous fungi as the parent strain may be a wild-type strain, a strain artificially bred from the wild-type strain, or a variant strain (variant) or a mutant in which a nucleotide sequence in the genome is substituted, added, deleted, or modified.

[0088] Preferred examples of the filamentous fungus mutant strain of the present invention include filamentous fungi obtained by deleting the -tubulin gene of the Trichoderma reesei PCD-10 strain or the Trichoderma reesei PC-3-7 strain by homologous recombination to lose the -tubulin expression. Specifically, PC-3-7tubB strain and PCD-10tubB strain disclosed in Example described below are examples.

[0089] In the thus-constructed filamentous fungus mutant strain of the present invention, the function of tubulin in the cells is reduced or lost, and the secretory protein productivity is consequently improved compared to that of the parent strain. In addition, inhibition of the production of cellulase by glucose is suppressed compared to that in the parent strain, and even if a high concentration of glucose is present in the culture medium, a reduction in the productivity of cellulase is suppressed.

<Production of Protein>

[0090] A protein can be generated and accumulated in a culture broth by culturing the filamentous fungus mutant strain of the present invention, and the protein can be produced by collecting the protein from the culture product. Since filamentous fungi generate multiple proteins in a culture broth, the protein produced by the present invention may be a mixture of multiple proteins.

[0091] Here, examples of the protein include cellulase, xylanase, protease, lipase, exoglucanase, endoglucanase, -glucosidase, mannase, arabinase, arabinofuranosidase, galactase and amylase.

[0092] For example, when cellulase or xylanase is produced, the filamentous fungus mutant strain of the present invention is cultured in the presence of a cellulase inducer, such as cellulose, sophorose, or a cellooligosaccharide (e.g., cellobiose, cellotriose, cellotetraose, cellopentaose, or cellohexaose), and cellulase or xylanase is collected from the culture product.

[0093] The protein produced by the present invention may be a heterologous protein that is not secretion produced by filamentous fungi originally. In such a case, proteins including a heterologous protein can be obtained by inserting a gene encoding the heterologous protein into the filamentous fungus mutant strain of the present invention to produce a recombinant filamentous fungus and culturing the recombinant filamentous fungus. Furthermore, in order to improve the efficiency of secretory production, it is also possible to modify a gene encoding a desired protein. Specifically, the modification is to modify a gene such that a secretory signal peptide is functionally added to the desired protein. The secretory signal peptide is desirably added to the amino terminus of the desired protein. The addition of the secretory signal peptide can improve the secretory productivity.

[0094] The culture medium used for the production of proteins may be a synthetic culture medium or a natural culture medium that contains nutrients necessary for proliferation of the filamentous fungi of the present invention and production of various proteins, such as a carbon source, a nitrogen source, inorganic salts, and vitamins.

[0095] The carbon source may be any carbon source that can be assimilated by the filamentous fungus mutant strain of the present invention, and examples thereof include carbohydrates such as glucose and fructose; alcohols such as ethanol and glycerol; and organic acids such as acetic acid, in addition to the above-mentioned cellulase inducers. These carbon sources may be used alone or in combination of two or more thereof.

[0096] Examples of the nitrogen source include ammonia; ammonium salts such as ammonium sulfate; nitrogen compounds such as amine; natural nitrogen sources such as peptone and soybean hydrolysates.

[0097] Examples of the inorganic salt include potassium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, and potassium carbonate.

[0098] Examples of the vitamin include biotin and thiamine. The medium can further optionally contain a substance required for growth of the filamentous fungi of the present invention.

[0099] The culture is preferably performed under aerobic conditions such as shake culture or aerated and agitated culture. The culture temperature is preferably 10 C. or more, more preferably 20 C. or more, and more preferably 25 C. or more; and preferably 50 C. or less, more preferably 42 C. or less, and more preferably 35 C. or less. The temperature is preferably from 10 C. to 50 C., more preferably from 20 C. to 42 C., and more preferably from 25 C. to 35 C.

[0100] The pH in the culture is from 3 to 9 and preferably from 4 to 5. The culture time is from 10 hours to 10 days and preferably from 2 to 7 days.

[0101] After the completion of the culture, the culture product is collected, is subjected to cell pulverization by, for example, ultrasonic waves or pressurization as needed, and is solid-liquid separated by, for example, filtration or centrifugation, followed by an appropriate combination of ultrafiltration, salting-out, dialysis, chromatography, and so on to obtain a desired protein. The degree of separation and purification is not particularly limited. The culture supernatant or its roughly separated and purified product itself can also be used as a protein.

<Saccharification of Biomass>

[0102] A monosaccharide can be produced using the culture product obtained by culturing the filamentous fungus mutant strain of the present invention in the presence of a cellulase inducer, as a biomass saccharifying agent and heating the culture product together with a cellulose- or xylan-containing material (biomass) in an aqueous solvent with stirring or shaking to degrade or saccharify the biomass.

[0103] As the cellulose- or xylan-containing material, those exemplified as the cellulase inducers above can be used.

[0104] In the degradation or saccharification of biomass, the reaction solution may have any pH and any temperature within ranges that do not inactivate the cellulase or xylanase. Generally, when the reaction is performed at normal pressure, the temperature is within a range of 5 C. to 95 C., and the pH is within a range of 1 to 11.

[0105] The process of degradation or saccharification of biomass may be a batch system or a continuous system.

[0106] Regarding the above-described embodiments, the present invention further discloses the following aspects:

[0107] <1> A method of producing a protein, the method comprising a step of culturing a filamentous fungus mutant strain in which a function of tubulin is reduced or lost and collecting a protein from a culture product;

[0108] <2> A method of improving secretory protein productivity of a filamentous fungus, the method comprising reducing or losing a function of tubulin in a filamentous fungus;

[0109] <3> The method according to aspect <1> or <2>, wherein the reducing or losing the function of tubulin is reducing or losing an expression of tubulin compared to that in a parent strain;

[0110] <4> The method according to any one of aspects <1> to <3>, wherein the tubulin is -tubulin and/or -tubulin;

[0111] <5> The method according to any one of aspects <1> to <3>, wherein the reducing or losing a function of tubulin is acquired by deleting or inactivating a gene encoding the tubulin;

[0112] <6> The method according to aspect <5>, wherein the gene encoding the tubulin is a gene encoding -tubulin and/or -tubulin;

[0113] <7> The method according to aspect <6>, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (a) to (f):

[0114] (a) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3;

[0115] (b) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 or 3 and encoding a protein having a function as -tubulin;

[0116] (c) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions and encoding a protein having a function as -tubulin;

[0117] (d) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4;

[0118] (e) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0119] (f) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin;

[0120] <8> The method according to aspect <6>, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (g) to (l):

[0121] (g) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13;

[0122] (h) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 and encoding a protein having a function as -tubulin;

[0123] (i) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 under stringent conditions and encoding a protein having a function as -tubulin;

[0124] (j) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14;

[0125] (k) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0126] (l) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin;

[0127] <9> A method according to any one of aspects <1> to <8>, wherein the filamentous fungus is a filamentous fungus belonging to Acremonium, Aspergillus, Chrysosporium, Fusarium, Humicola, Myceliophthora, Neurospora, Penicillium, Piromyces, Talaromyces, Thermoascus, Thielavia, or Trichoderma;

[0128] <10> The method according to aspect <9>, wherein the filamentous fungus is a Trichoderma filamentous fungus;

[0129] <11> The method according to aspect <10>, wherein the filamentous fungus is Trichoderma reesei;

[0130] <12> A mutant strain of a Trichoderma filamentous fungus, wherein a function of tubulin is reduced or lost, wherein secretory protein productivity is improved compared to that of a parent fungal strain;

[0131] <13> The mutant strain according to aspect <12>, wherein the reduction or loss of a function of tubulin is a reduction or loss of an expression of tubulin compared to that in the parent strain;

[0132] <14> The mutant strain according to aspect <12> or <13>, wherein the tubulin is -tubulin and/or -tubulin;

[0133] <15> The mutant strain according to aspect <12> or <13>, wherein the reduction or loss of the function of tubulin is acquired by deleting or inactivating a gene encoding the tubulin;

[0134] <16> The mutant strain according to aspect <15>, wherein the gene encoding the tubulin is a gene encoding -tubulin and/or -tubulin;

[0135] <17> The mutant strain according to aspect <16>, wherein the gene encoding -tubulin is represented by any of the following polynucleotides (a) to (f):

[0136] (a) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3;

[0137] (b) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 1 or 3 and encoding a protein having a function as -tubulin;

[0138] (c) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 1 or 3 under stringent conditions and encoding a protein having a function as -tubulin;

[0139] (d) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4;

[0140] (e) polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 2 or 4 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0141] (f) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 2 or 4 and having a function as -tubulin;

[0142] <18> The mutant strain according to aspect <16>, wherein the gene encoding 1i-tubulin is represented by any of the following polynucleotides (g) to (l):

[0143] (g) a polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13;

[0144] (h) a polynucleotide having a nucleotide sequence with an identity of 80% or more with the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 and encoding a protein having a function as -tubulin;

[0145] (i) a polynucleotide hybridizing to a complementary strand of the polynucleotide having the nucleotide sequence represented by SEQ ID NO: 5, 7, 9, 11, or 13 under stringent conditions and encoding a protein having a function as -tubulin;

[0146] (j) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14;

[0147] (k) a polynucleotide encoding a protein having the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 in which one or several amino acids are deleted, substituted, added or inserted and having a function as -tubulin; and

[0148] (l) a polynucleotide encoding a protein having an amino acid sequence with an identity of 80% or more with the amino acid sequence represented by SEQ ID NO: 6, 8, 10, 12, or 14 and having a function as -tubulin;

[0149] <19> The mutant strain according to any one of aspects <12> to <18>, wherein the filamentous fungus is Trichoderma reesei;

[0150] <20> A method of producing a saccharide from biomass, the method comprising using, as a biomass saccharifying agent, a culture product obtained by culturing a filamentous fungus mutant strain in which a function of tubulin is reduced or lost in the presence of a cellulase inducer;

[0151] <21> A method of saccharifying biomass, the method comprising using, as a biomass saccharifying agent, a culture product obtained by culturing a filamentous fungus mutant strain in which a function of tubulin is reduced or lost in the presence of a cellulase inducer;

[0152] <22> The method according to any one of aspects <1> to <11>, wherein the protein is one or more selected from the group consisting of cellulase, xylanase, protease, lipase, exoglucanase, endoglucanase, --glucosidase, mannase, arabinase, arabinofuranosidase, galactase, and amylase;

[0153] <23> The method according to aspect <22>, wherein the protein is cellulase and/or xylanase; and

[0154] <24> The method according to aspect <23>, wherein the filamentous fungus mutant strain is cultured in the presence of a cellulase inducer selected from the group consisting of cellulose, sophorose, and cellooligosaccharides (e.g., cellobiose, cellotriose, cellotetraose, cellopentaose, and cellohexaose), and cellulase or xylanase is collected from the culture product.

EXAMPLES

[0155] The present invention will now be described more specifically by Examples.

Example 1

Production of Gene Disruption Strain

(1) Construction of Plasmid DNA for Gene Disruption

[0156] Using a plasmid pUC-tubB obtained by inserting a sequence from the upstream to the downstream (SEQ ID NO: 20) of the tubB gene (TRIREDRAFT_120830) derived from Trichoderma reesei into the HincII restriction endonuclease cutting site of pUC118 (Takara Bio Inc.) as a template and using forward primer 1 (SEQ ID NO: 15) and reverse primer 1 (SEQ ID NO: 16) shown in Table 1, PCR was carried out to amplify a fragment (A) of about 5.2 kbp. Separately, using acetamidase amdS (SEQ ID NO: 17) derived from Aspergillus nidulans as a template and using forward primer 2 (SEQ ID NO: 18) and reverse primer 2 (SEQ ID NO: 19) shown in Table 1, PCR was carried out to amplify a fragment (B) of about 3.1 kbp. The resulting DNA fragments (A) and (B) were treated in accordance with the protocol of In-Fusion HD Cloning Kit (Takara Bio Inc.) to construct a plasmid carrying amdS gene inserted into the tubB gene. This plasmid was transformed into E. coli DH5 competent Cells (Takara Bio Inc.), and a strain retaining the plasmid carrying the target gene was selected from the transformants obtained as ampicillin resistance strains by colony PCR. The selected transformant was cultured (at 37 C. for 1 day) using an ampicillin-containing LB medium, and the plasmid was then collected from the resulting cells and purified with High Pure Plasmid Isolation kit (Roche Diagnostics K.K.). Herein, the resulting vector is referred to as pUC-tubB-amdS.

(2) Production of Transformant

[0157] Trichoderma reesei PC-3-7 strain (ATCC66589) and PCD-10 strain (FERM P-8172) were transformed with the vector constructed in the above (1). The introduction was performed by a protoplast PEG method (Biotechnol Bioeng. 2012, January 109(1): 92-99). The transformant was selected with a selection medium (2% glucose, 1.1 M sorbitol, 2% agar, 0.2% KH.sub.2PO.sub.4 (pH 5.5), 0.06% CaCl.sub.2.2H.sub.2O, 0.06% CsCl.sub.2, 0.06% MgSO.sub.4.7H.sub.2O, 0.06% acetamide, 0.1% Trace element 1, wherein every % means w/v %) containing acetamide as a single nitrogen source. Trace element 1 has the following composition: 0.5 g FeSO.sub.4.7H.sub.2O, 0.2 g CoCl.sub.2, 0.16 g MnSO.sub.4.7H.sub.2O, and 0.14 g ZnSO.sub.4.7H.sub.2O were diluted with distilled water to 100 mL total. Among the resulting transformants, a transformant in which amdS had been inserted into the tubB gene site to cause gene disruption was selected by colony PCR. Transformants having gene disruption were named PC-3-7tubB and PCD-10tubB, respectively.

TABLE-US-00001 TABLE1 Primer Sequence SEQIDNO Forwardprimer1 CGTTTCCAGTGCGCAAAGTACCGCGCGCTTGACAA 15 Reverseprimer1 CCAATGATGTGCGCATCTGGGAAATGTTCTTTGGC 16 Forwardprimer2 TGCGCACATCATTGGATAGG 18 Reverseprimer2 TGCGCACTGGAAACGCAACC 19

Example 2

Study 1 on Culture of Transformant

[0158] The protein productivity of a transformant was evaluated as follows. For pre-culture, spores of Trichoderma reesei PC-3-7 and PCD-10, and PC-3-7tubB, PCD-10tubB produced in Example 1 were each inoculated at 110.sup.5 cells/mL in 50 mL of a culture medium placed in a 500-mL flask and were shake-cultured at 28 C. and at 220 rpm (PRXYg-98R manufactured by Preci Co., Ltd.). The composition of the medium was as follows: 1% glucose, 0.14% (NH.sub.4).sub.2SO.sub.4, 0.2% KH.sub.2PO.sub.4, 0.03% CaCl.sub.2.2H.sub.2O, 0. 03% MgSO.sub.4.7H.sub.2O, 0.1% Bacto Peptone(BD Difco), 0.05% Bacto Yeast extract(BD Difco), 0.1% Tween 80, 0.1% Trace element 2, and 50 mM tartaric acid buffer (pH 4.0). The composition of Trace element 2 was as follows: 6 mg H.sub.3BO.sub.3, 26 mg (NH.sub.4).sub.6Mo.sub.7O.sub.24.4H.sub.2O, 100 mg FeCl.sub.3.6H.sub.2O, 40 mg CuSO.sub.4.5H.sub.2O, 8 mg MnCl.sub.2.4H.sub.2O, and 200 mg ZnCl.sub.2 were diluted with distilled water to 100 mL total.

[0159] After the pre-culture for 2 days, main culture was performed using BTR-25NA1S-8M (manufactured by Biott Corporation) as a jar fermentor. Ten percent (v/v %) of the pre-culture broth was inoculated and was cultured for 5 days. Crystalline cellulose, Avicel PH-101 (Sigma-Aldrich), was used as a carbon source at a concentration of 10%, and other culture medium components used were as follows: 0.42% (NH.sub.4).sub.2SO.sub.4, 0.2% KH.sub.2PO.sub.4, 0.03% CaCl.sub.2.2H.sub.2O, 0.03% MgSO.sub.4.7H.sub.2O, 0.1% Bacto Peptone, 0.05% Bacto Yeast extract, 0.1% Tween 80, 0.1% Trace element 2, and 0.2% Antifoam PE-L. The jar fermentor was set as follows: a temperature of 28 C., an air flow rate of 0.5 vvm, and a pH of 4.5 (adjusted with 5% ammonia water). The agitation rate was varied to maintain a constant DO of 3.0 ppm. The culture was performed for 5 days.

Example 3

Study 2 on Culture of Transformant

[0160] The protein productivity of a transformant in the case of using another carbon source was evaluated as follows. In this investigation, PC-3-7 and PC-3-7tubB were evaluated. The pre-culture was performed as in Example 2. The main culture was performed using BMZ-01KP2 (Biott Corporation) as the jar fermentor and using 10% Avicel PH-101+2.5% glucose or 10% Avicel PH-101+2% Xylan from Beechwood (Tokyo Chemical Industry Co., Ltd.) as the carbon source. Other conditions were the same as those in Example 2.

Example 4

Measurement of Protein Concentration

[0161] The concentration of a protein was measured by a Bradford method. In the Bradford method, Quick Start Protein Assay (Bio-Rad Laboratories, Inc.) was used, and the protein concentration was calculated based on a standard curve drawn using bovine -globulin as a standard protein.

[0162] The results of measurement of protein concentration are shown in FIGS. 1 to 4. Since the transformant having tubB gene disruption showed protein productivity higher than that of the parent strain under every conditions, the effectiveness of tubB gene disruption on protein production was demonstrated.