NOVEL MULTIPLY BACKBONE N-METHYL TRANSFERASES AND USES THEREOF

20190112583 ยท 2019-04-18

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention is directed to all aspects of novel methyl transferase enzymes that methylate backbone amides of (poly)peptides. The present invention also relates to nucleic acids encoding these enzymes as well as corresponding vectors and host cells comprising these. Moreover, the present invention encompasses the use of said enzymes for modifying (poly)peptides as well as corresponding methods. Also, the present invention pertains to further novel enzymes for modifying (poly)peptides derived from the omphalotin gene cluster of O. olearius and the homologous gene clusters from D. bispora, L. edodes and F. mediterranea as well as related aspects.

    Claims

    1. An isolated and purified complementary deoxyribonucleic nucleic acid (cDNA), comprising a nucleic acid sequence selected from the group consisting of: (i) a nucleic acid sequence selected from the group consisting of nucleic acid sequences listed in SEQ ID NOs: 1 to 14 and 108 to 111; (ii) a nucleic acid sequence of at least 80% identity with a nucleic acid sequence listed in SEQ ID NO 1 to 14 or 108 to 111; (iii) a nucleic acid sequence that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; (iv) a fragment of any of the nucleic acid sequences of (i) to (iii), that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; and (v) a nucleic acid sequence, wherein said nucleic acid sequence is derivable by at least one of substitution, addition, deletion, or combination thereof of one of the nucleic acids of (i) to (iv) that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions, wherein the nucleic acid sequence encodes a polypeptide having N-methyl transferase activity.

    2. The cDNA according to claim 1, wherein said nucleic acid is a DNA, RNA or PNA.

    3. The cDNA according to claim 1, wherein said nucleic acid encodes a polypeptide having N-methyl transferase activity for methylating peptidic backbone amides.

    4. The cDNA according to claim 1, wherein the nucleic acid further comprises a nucleic acid sequence encoding a (poly)peptide for N-methylation by the N-methyl transferase encoded by the nucleic acid.

    5. A recombinant vector comprising the cDNA of claim 1.

    6. A host cell comprising a cDNA according to claim 1, or a recombinant vector comprising the nucleic acid.

    7. A modified polypeptide selected from the group consisting of: (a) polypeptides having an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 to 28 and 112 to 115, (b) polypeptides encoded by the nucleic acid of claim 1, (c) polypeptides having an amino acid sequence identity of at least 80% with the polypeptides of at least one of (a), (b), or a combination thereof, (d) at least one of a functional fragment, functional derivative, or a combination thereof, of (a), (b) or (c), wherein the polypeptide has N-methyl transferase activity, and the modification is a histidine tag.

    8. The polypeptide according to claim 7, wherein said polypeptide has N-methyl transferase activity for methylating peptidic backbone amides.

    9. A fusion polypeptide comprising a first polypeptide sequence according to claim 7, and at least a second polypeptide sequence for N-methylation by the N-methyl transferase activity of the first polypeptide sequence.

    10. An antibody or antigen binding fragment thereof that specifically binds the polypeptide of claim 7.

    11. (canceled)

    12. A method for producing an N-methylated (poly)peptide comprising the steps of: (a) providing a polypeptide having methyl transferase activity according to claim 7, (b) providing a (poly)peptide for N-methylation, (c) contacting the polypeptide having methyl transferase activity of (a) and the (poly)peptide for N-methylation of (b) under conditions that allow for N-methylation, (d) optionally cyclisation of the methylated peptide, (e) optionally further modifying the N-methylated (poly)peptide, (f) optionally cleaving the methylated peptide from the precursor, and (g) optionally at least partially purifying the N-methylated (poly)peptide.

    13. The method according to claim 12, wherein the polypeptide having methyl transferase activity of step (a) and/or the (poly)peptide for N-methylation of step (b) are provided by at least one of: a recombinant vector comprising a nucleic acid sequence selected from the group consisting of: (i) a nucleic acid sequence selected from the group consisting of nucleic acid sequences listed in SEQ ID NOs: 1 to 14 and 108 to 111; (ii) a nucleic acid sequence of at least 80% identity with a nucleic acid sequence listed in SEQ ID NO 1 to 14 or 108 to 111; (iii) a nucleic acid sequence that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; (iv) a fragment of any of the nucleic acid sequences of (i) to (iii), that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; and (v) a nucleic acid sequence, wherein said nucleic acid sequence is derivable by at least one of substitution, addition, deletion, or a combination thereof of one of the nucleic acids of (i) to (iv) that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions, wherein the nucleic acid sequence encodes a polypeptide having N-methyl transferase activity; a host cell including the nucleic acid or the recombinant vector; or a combination thereof.

    14. The method according to claim 12, wherein the polypeptide having methyl transferase activity of step (a) and the (poly)peptide for N-methylation of step (b) are provided as a single fusion protein comprising: a first polypeptide sequence selected from the group consisting of: (a) polypeptides having an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 to 28 and 112 to 115, (b) polypeptides encoded by a nucleic acid sequence selected from the group consisting of: (i) a nucleic acid sequence selected from the group consisting of nucleic acid sequences listed in SEQ ID NOs: 1 to 14 and 108 to 111; (ii) a nucleic acid sequence of at least 80% identity with a nucleic acid sequence listed in SEQ ID NO 1 to 14 or 108 to 111; (iii) a nucleic acid sequence that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; (iv) a fragment of any of the nucleic acid sequences of (i) to (iii), that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions; and (v) a nucleic acid sequence, wherein said nucleic acid sequence is derivable by at least one of substitution, addition, deletion, or a combination thereof of one of the nucleic acids of (i) to (iv) that hybridizes to a nucleic acid sequence of (i) or (ii) under stringent conditions, wherein the nucleic acid sequence encodes a polypeptide having N-methyl transferase activity (c) polypeptides having an amino acid sequence identity of at least 70% with the polypeptides of at least one of (a), (b), or a combination thereof, (d) at least one of a functional fragment, a functional derivative, or a combination thereof, of (a), (b) or (c), wherein the polypeptide has N-methyl transferase activity; and at least a second polypeptide sequence for N-methylation by the N-methyl transferase activity of the first polypeptide sequence.

    15. The method according to claim 12, wherein in at least one of step (d), step (e), or a combination thereof, at least one further enzyme, protein, or combination thereof.

    16. The method according to claim 15, wherein the further enzyme or protein is selected from the group consisting of prolyl oligopeptidase (POP), monooxygenase, preferably P450 monooxygenase, O-acyl transferase and oxidoreductase

    17. The cDNA according to claim 1, wherein the nucleic acid sequence has at least 90% identity with the nucleic acid sequence listed in SEQ ID NO 1 to 14 and 108-111.

    18. The host cell according to claim 6, wherein the host cell selected from the group consisting of a yeast cell, E. coli, B. subtilis, plant cell, NIH-3T3 mammalian cell, and insect cell.

    19. The recombinant vector according to claim 5, wherein the vector is a viral vector or plasmid derived vector.

    20. The recombinant vector according to claim 5, wherein the vector is selected from a baculovirus vector, lentivirus vector, adenovirus vector, yeast vector or bacterial vector

    21. The method of claim 12, wherein the N-methylated (poly)peptide is a backbone N-methylated (poly)peptide

    Description

    FIGURES

    [0127] FIG. 1 is a schematic overview of the natural N-methylation pattern of the nematicidal cyclic peptide omphalotin A (left) and its omphalotin variants B to I (right) (adapted from Bchel et al., (1998) Tetrahedron 54:5345-5352).

    [0128] FIG. 2 shows a schematic bar (top) and corresponding sequence listing (below) illustrating the amino acid sequence of the omphalotin precursor according to SEQ ID NO: 15. The amino acids of the methyl transferase domain (underlined) show homology towards the tetrapyrrole (Corrin/Porphyrin) methylases (pfam: 00590), the amino acids in italic letters show weak homology towards the conserved domains of unknown function TrbG and YabN (PRK13885 and COG3956) and the amino acids in bold letters form omphalotin. Bold and underlined residues are involved in S-Adenosyl methionine (SAM) binding and compromise methylation when mutated to an alanine. For the protein sequence, see SEQ ID NO 15 and protein ID number: 2087 on the JGI website (http://genome.jgi.doe.gov/Ompol1/Ompol1.home.html)

    [0129] FIG. 3A is a comparative schematic overview of the OmpA gene cluster of O. olearius with further fungal homologous omphalotin gene clusters in D. bispora. The gene cluster of O. olearius consists of (i) the methyltransferase (MT) encoding the omphalotin peptide (2087, SEQ ID NOs: 1 and 15), the prolyl oligopeptidase (POP) (2090, SEQ ID NO: 29 and 36), which is involved in cleavage of the omphalotin peptide from the precursor and the cyclisation reaction. In addition, two monooxygenases (2085, SEQ ID NOs: 31, 38; and 2089, SEQ ID NOs: 33, 40; and 2089 Late start, SEQ ID NOs: 34, 41), an O-acyl transferase (2088, SEQ ID NOs: 32, 39), and an oxidoreductase (2091, SEQ ID NOs: 35, 42) are shown that are involved in the modifications of omphalotin variants B to I. The protein sequence of the OmpA gene cluster with the respective protein ID numbers can be found on the JGI website (http://genome.jgi.doe.gov/Ompol1/Ompol1.home.html). FIG. 3B is a tabular overview of the details of genes located in the O. olearius and D. bispora borosin gene clusters. The asterisk denotes that the protein sequences corresponding to the respective protein ID numbers can be found on the JGI website (http://genome.jgi.doe.gov/Ompol1/Ompol1.home.html and http://genome.jgi.doe.gov/Denbi1/Denbi1.home.html).

    [0130] FIG. 4 is a comparative schematic overview of the OmpA gene cluster of O. olearius with further fungal homologous omphalotin gene clusters in F. mediterranea. The protein sequences corresponding to the respective protein ID numbers can be found on the JGI website (http://genome.jgi.doe.gov/programs/fungi/index.jsf).

    [0131] FIG. 5A shows an alignment of the methyltransferase domain of the omphalotin precursor with other fungal homologues. Residues in black boxes highlight conserved residues and residues with similar properties are high-lighted in bolt. Sequence identity with the omphalotin precursor (2087) ranges from 89.42% (765759) to 54.36% (32310). Sequences of all homologues are according to SEQ ID NO: 15, 17, 19, 21, 23, 25 and 27 (aa MT only). FIG. 5B shows an alignment of the peptidase domain of the omphalotin prolyl oligopeptidase with the prolyl oligopeptidase of D. bispora. Sequence identity of the prolyl oliopeptidase from omphalotin with the peptidase from D. bispora is 87.86%. Sequences according to SEQ ID NOs: 37 and 54 (aa protease domains only). Alignment created with clustal Omega (Sievers F et al., (2011) Mol. Sys. Bio. 7: 539) and visualized using ESPript 3 (Robert X et al., (2014) Nucl. Acids Res. 42(W1):W320-W324).

    [0132] FIG. 6 shows SDS-PAGE gels and immuno detections for confirming the expression and solubility of the omphalotin precursor in E. coli BL21. Gel A shows a whole cell extract (WCE) of E. coli BL21 that was not induced (lane 1), expressing the non-tagged omphalotin precursor (lanes 2, 4 and 6), or the N-terminally HIS-tagged omphalotin precursor (lanes 3, 5 and 7), when separated on a 12% SDS PAGE gel. Lanes 2 and 3 show the WCE before centrifugation, lane 4 and 5 the WCE after low spin (LS) centrifugation (5000g 5 min) and lanes 6 and 7 after high spin (HS) centrifugation (15000g 30 min). Gel B shows immuno-detection of the omphalotin precursor with an anti-HIS antibody (Qiagen, Switzerland). A WCE of E. coli BL21 expressing an empty vector (EV) was used as a control. Lane 2 shows the WCE after low spin centrifugation and lane 3 after high spin centrifugation. E. coli BL21 was induced for 24 hr with 0.2 mM IPTG at 16 C.

    [0133] FIG. 7 shows SDS-PAGE gels and immuno detections for confirming the expression and solubility of the omphalotin precursor in S. cerevisiae. Gel A shows WCEs of S. cerevisiae W303 MAT (lane 1-3) or MAT/a (lane 3-6) grown for 3 hrs on YP galactose to induce expression of the N-terminally HIS-tagged omphalotin precursor. Lanes 1 and 4 show the WCE before centrifugation, lanes 2 and 5 the WCE after high spin centrifugation (16000 g for 30 min) and lanes 3 and 6 the purified protein after HIS tag purification. Gel B shows the immuno-detection of the omphalotin precursor with an anti-HIS tag antibody on a WCE of S. cerevisiae W303 MAT/a grown for 24 hr on galactose at 25 C. (lane 2). S. cerevisiae W303 MAT/a grown on glucose was used as a control (lane 1).

    [0134] FIGS. 8A, 8B, 8C and 8D lists methylated fragments of different variants of the omphalotin precursor (SEQ ID NOs: 99, 101 and 102) and the ten times methylated fragment of the D. bispora 765750 homologue (SEQ ID NO 100) observed by MS/MS data after different expression times in E. coli BL21. The omphalotin precursor was expressed for 1 or 5 days in E. coli BL21. The purified protein was digested by trypsin and subjected to LC-MS/MS. The MS-identified trypsin fragments containing the omphalotin core peptide are listed. The top fragment shows where methylations (underlined) are expected in the peptide (bold) of the naturally isolated omphalotins. The fragments below were found experimentally, the third fragment (italic letters) was the most abundant after 1 day of expression. Underlining means that this amino acid was found to be methylated according to the MS/MS data.

    [0135] FIG. 9 shows the N-methylation pattern of therapeutic peptides produced with the methyltransferase of O. olearius. The top line (1) illustrates the natural N-methylation pattern of the cyclic non-ribosomal immunosuppressant cyclosporine A, and the natural N-methylation pattern of the cyclin-dependent kinase 4 inhibitor dictyonamide A. Line (7) shows the natural N-methylated synthetic antimalarial R1 peptide and kendarimide which reverses P-glycoprotein-mediated multidrug resistance in tumor cells. The following bottom columns (2) to (6) and (8) to (10) show the patterns of N-methylation observed after 5 days of in vivo E. coli expression at 16 C. when the omphalotin encoding peptide in the precursor was exchanged with the peptide sequences that resembled cyclosporin A (line (1) left, SEQ ID NO: 103), dictyanomide A (line (1) middle, SEQ ID NO: 104), R1 (line (7) left, SEQ ID NO: 105) or kendarimide, (line (7) right, SEQ ID NOs: 106) thus demonstrating general substrate applicability for methylation by the methyl transferase.

    EXAMPLES

    Example 1cDNA Synthesis and Cloning of the Omphalotin Precursor

    [0136] O. olearius strain DSM3398 (DSMZ, Germany) was used for RNA extraction and cDNA synthesis. O. olearius mycelium was grown on cellophane disks (Celloclair, Switzerland) on 1.5% (w/v) agar plates containing yeast maltose agar (0.4% (w/v) yeast extract (Oxoid AG, England), 1% (w/v) malt extract (Oxoid AG, England), 0.4% (w/v) glucose) for 5 days at 28 C. in the dark. To extract RNA, 8.2 mg of lyophilized mycelium was lysed with 8 mg of 0.5 mm glass beads in three FastPrep steps of 45 s at 4.5, 5.5 and 6.5, cooling the sample for 5 min on ice between each step. RNA was extracted with 1 ml Qiazol (Qiagen, Germany) and 0.2 ml chloroform. After a centrifugation at 12000g and 4 C. for 15 min, RNA was recovered in the aqueous phase, washed on-column using the RNeasy Lipid Tissue Mini Kit (Qiagen, Germany) and eluted in RNase-free water, cDNA was synthesized from 1 g of extracted RNA using the Transcriptor-first strand cDNA synthesis kit (Roche Applied Science, Germany) following the instructions of the manufacturer. The coding sequence of the omphalotin precursor was amplified from cDNA by PCR using Phusion high-fidelity DNA polymerase using standard protocols (Sambrook J, Russell D, 2001, Molecular cloning 3.sup.rd edition) using primers:

    TABLE-US-00001 Forwardprimer: (SEQIDNO:64) 5-ATGGAGACTTCCACTCAGAC-3 Reverseprimer: (SEQIDNO:65) 5-TTATTCCGTGCTCATGACTG-3.
    An A-tailing reaction was performed on the PCR product after which it was cloned into the pGEM-T-easy vector (Promega, USA) and transformed to E. coli DH5. A PCR on a plasmid containing the right cDNA sequence was performed using primers:

    TABLE-US-00002 Forwardprimer: (SEQIDNO:66) 5-GGGGGGCATATGGAGACTTCCACTCAGAC-3 Forwardprimer: (SEQIDNO:67) 5-TTTTTTCATATGGAGCATCATCATCATCATCATCATCATACT TCCACTCAGACCAAAGCTGGCTCA-3 Reverseprimer: (SEQIDNO:68) 5-CCCCCCGCGGCCGCTTATTCCGTGCTCATGACT-3
    after which the PCR products were cloned into pET24 (Novagen, Germany) using the restriction sites NdeI and NotI (Thermo Scientific, USA) and transformed to E. coli BL21 or cloned into the S. cerevisiae expression vector pRS426 (Sikorski R. S. el al., (1989) Genetics 122: 19-27S) using the restriction sites SpeI and EcoRI.

    Example 2 Cloning of the CycD, DicA, KenA and No Follower Omphalotin Variants

    [0137] An adapter ligation was performed to introduce a BsaI restriction site in the omphalotin precursor gene using primers:

    TABLE-US-00003 Forwardprimer: (SEQIDNO:69) 5-CATGAGACCTAGTCATGAGCACGGAATAAGC-3 Reverseprimer: (SEQIDNO:70) 5-GGCCGCTTATTCCGTGCTCATGACTAGGTCT-3
    10 l of each primer (100 M) was added to 80 l of 10 mM Tris pH 7.5. Primer annealing was performed with the following program: 5 min at 98 C. with cooling rate at 4 C./s, 30 seconds at 80 C. with cooling rate 0.01 C./s and 30 seconds at 40 C. with cooling rate 0.02 C./s. The annealed primers were phosphorylated and ligated into a pET24 vector containing the omphalotin precursor restricted with NcoI and NotI (Thermo Scientific, USA) at a vector-to-insert molar ratio of 1:7. To introduce the sequence encoding for CycD, DicA, KenA and to remove the follower an adapter ligation was performed with the following primers:

    TABLE-US-00004 CycDforwardprimer: (SEQIDNO:71) 5-AGGTCTCACCCACTGGTGCTGGCTGCACTGCTCGTCATCGTTGGTTC AGTCATGAGCACGGAATAAGCGGCCGCA-3 CycDreverseprimer: (SEQIDNO:72) 5-TGCGGCCGCTTATTCCGTGCTCATGACTGAACCAACGATGACGAGCA GTGCAGCCAGCACCAGTGGGTGAGACCT-3 DicAforwardprimer: (SEQIDNO:73) 5-AGGTCTCACCCAGCAACGACCGTAGTAGTTGTTGTTATTGTGGGTTA AGCGGCCGCA-3 DicAreverseprimer: (SEQIDNO:74) 5-TGCGGCCGCTTAACCCACAATAACAACAACTACTACGGTCGTTGCTG GGTGAGACCT-3 KenAforwardprimer: (SEQIDNO:75) 5-AGGTCTCACCCACAGTTCATTGCCGTTGTAGTTGTGGCAGTCGTGTG CTGTTTCTAAGCGGCCGCA-3 KenAreverseprimer: (SEQIDNO:76) 5-TGCGGCCGCTTAGAAACAGCACACGACTGCCACAACTACAACGGCAA TGAACTGTGGGTGAGACCT-3 Nofollowerforwardprimer: (SEQIDNO:77) 5-AGGTCTCACCCATGGGTCATCGTCGTTGGTGTTATCGGTGTCATCGG ATAAGCGGCCGCA-3 Nofollowerreverseprimer: (SEQIDNO:78) 5-TGCGGCCGCTTATCCGATGACACCGATAACACCAACGACGATGACCC ATGGGTGAGACCT-3

    [0138] Primer annealing was performed as described above, restricted using BsaI and NotI, purified using a Nucleospin gel and PCR cleanup kit (Macherey Nagel, Switzerland) and ligated in pET24 containing the omphalotin precursor that was restricted with BsaI.

    Example 3 Cloning of OMP TEV, R1 and 765759

    [0139] For replacement of the omphalotin peptide with that of R1 and to introduce a TEV cleavage site the following sequences were synthesized by Genscript (USA):

    TABLE-US-00005 OMPTEV (SEQIDNO79) 5-GGATCCCAAGGCACTCGCCGACTACAAAGCTGATCACCGCGCCTTTG CTCAATCTGTCCCCGACTTGACGCCTCAGGAGCGTGCGGCTTTGGAGCTC GGTGATTCGTGGGCTATTCGTTGCGCGATGAAGAATATGCCCTCGTCGCT CTTGGACGCTGCTCGTGAATCCGGCGAAAACTTGTACTTCCAAGGTTTCC CATGGGTCATCGTCGTTGGTGTTATCGGTGTCATCGGATAAGAATTC- 3 OMPR1 (SEQIDNO80) 5-GGATCCCAAGGCACTCGCCGACTACAAAGCTGATCACCGCGCCTTTG CTCAATCTGTCCCCGACTTGACGCCTCAGGAGCGTGCGGCTTTGGAGCTC GGTGATTCGTGGGCTATTCGTTGCGCGATGAAGAATATGCCCTCGTCGCT CTTGGACGCTGCTCGTGAATCCGGCGAAGAGGCATCCCAAAACGGTTTCC CAGTCTTTGCAGAATTTCTGCCTCTGTTCAGCAAATTCGGTTCGCGGATG CACATTCTGAAATAAGCGGCCGC-3

    [0140] The synthesized sequences were restricted with BamHI and EcoRI for OMP TEV and BamHI and NotI for R1, purified using a Nucleospin gel and PCR cleanup kit (Macherey Nagel, Switzerland) and ligated into pET24 containing the omphalotin precursor.

    [0141] The sequence of 765759 from D. bispora was codon optimized for expression in E. coli and synthesized by Genscript (USA) SEQ ID NO 107. The synthesized sequence was restricted with HindIII and NdeI, purified using a Nucleospin gel and PCR cleanup kit (Macherey Nagel, Switzerland) and ligated into pET24 containing the omphalotin precursor.

    Example 4Expression and Purification of the Omphalotin Precursor and Variants from E. coli BL21

    [0142] The omphalotin precursor, the different variants and the N-terminal HIS-tagged precursor were expressed in E. coli BL21 in TB medium (2.4% (w/v) yeast extract (Oxoid AG, England), 1.2% (w/v) tryptone (Oxoid AG, England), 0.4% (w/v) glycerol, 0.17 M KH.sub.2PO.sub.4 and 0.72 M K.sub.2HPO.sub.4) containing 50 g/ml kanamycin. For protein purification of the HIS-tagged precursor cultures were grown at 37 C. to an OD.sub.600 nm between 1.5-2 after which cultures where cooled down on ice for 30 min and 0.2 mM IPTG was added. Further incubation was performed at 16 C. for the indicated expression times. Bacterial cell pellets were resuspended in ice-cold buffer (50 mM HEPES pH8, 0.1% triton X-100, 10% glycerol) containing 20 mM Imidazole and lysed using a French press. Cell debris was removed by centrifugation at 16000 g for 30 min. For protein purification the supernatant was incubated with Ni-NTA beads (Thermo Scientific, USA) at 4 C. for 1 h and the protein was finally eluted in buffer containing 400 mM Imidazole. Purified protein was concentrated on an Amicon Ultra-4 centrifugal filter device (Millipore, USA) with a molecular weight cut off of 30 kDa, desalted using a PD-10 column (Amersham Biosciences, UK) and flash frozen with liquid nitrogen before storage at 20 C. Protein concentrations were measured using the Pierce BCA protein assay (Thermo Scientific, USA) using a standard curve derived from bovine albumin.

    Example 5Expression and Purification of the Omphalotin Precursor from S. cerevisiae

    [0143] S. cerevisiae W303 MAT and W303 MAT/a containing the omphalotin precursor or the N-terminal HIS-tagged precursor were grown at 30 C. in synthetic dropout (SD) media containing raffinose and without histidine to the exponential phase. Cells were harvested and washed once with YP containing galactose and diluted to OD.sub.600=0.2. Cells were grown till OD=1, washed with ice-cold buffer (50 mM HEPES pH8, 0.1% triton X-100, 10% glycerol) and lysed using glass beads. Cell debris was removed by centrifugation at 16000g for 30 min, Ni-NTA beads (Thermo Scientific, USA) were added and the protein was purified according to the instructions of the manufacturer. Proteins were desalted and stored as described in example 4.

    Example 6Confirmation of Backbone N-Methylation of Omphalotin Peptide and Variants by LC-MS/MS

    [0144] An Amicon ultra column (30 kDa cutoff) was washed 2 times with ddH.sub.2O. 100 g protein and ddH.sub.2O to a final volume of 400 L was added. The sample was centrifuged (11000g for 5 min) and washed with 500 l of ddH.sub.2O. 50 mM NH.sub.4HCO.sub.3 pH 8 was added and the sample was concentrated to 4 g/l. 25 l was transferred to a glass vial, trypsin (Promega, USA) was added to a molar ratio of 1:70 and the sample incubated for 3 h at 37 C. 3 l of each sample was used for mass spectrometry analysis. Electrospray ionization-LC-MS data was recorded on a Thermo Scientific Q Exactive mass spectrometer equipped with a Dionex Ultimate 3000 UHPLC system using a Phenomenex Kinetex 2.6 m C18 100 (1504.6 mm) column heated at 50 C. Elution was performed with a linear gradient using water with 0.1% (v/v) formic acid (solvent A) and acetonitrile with 0.1% (v/v) formic acid (solvent B) at a flow rate of 0.8 mL/min. The column was equilibrated with 5% solvent B for 2 min followed by a linear increase of solvent B to 85% over 15 min and a final elution step with 98% solvent B for 5 min. Mass spectra were acquired in positive ion mode with the following settings; spray voltage 3500V, capillary temperature at 268.75 C., probe heater at 437.5 C. and an S-lens level at 50. Full MS was done at a resolution of 35000 (AGC target 1e6, maximum IT 100 ms, range between 500-1800 m/z) and data-dependent MSMS was performed at a resolution of 17500 (AGC target at 2e5, maximum IT of 300 ms isolation window 1.2) using a stepped NCE of 16, 20 and 24. The inclusion list contained the mass of the trypsin fragment encoding for the omphalotin peptide (or one of the variants) and its different methylation states.

    Example 7In Vitro Methylation of the Omphalotin Precursor and Variants

    [0145] Omphalotin precursor and variants were purified from E. coli induced for only 4 hours to obtain non-methylated protein. To 5 M of protein 1 M S-adenosyl methionine (Sigma-Aldrich, USA) was added and samples were incubated overnight at room temperature. Reactions were performed in 50 l of 50 mM HEPES pH8, 0.1% triton X-100 and 10% glycerol. Methylation of the omphalotin precursor or variants were asses by LC-MS as described in example 6.

    Example 8In Vitro Methylation of Omphalotin Peptide with and without Follower

    [0146] The syntheses of peptides were performed by automated Fmoc solid-phase peptide synthesis using the following conditions. Fmoc deprotections were performed using 20% piperidine in DMF for 8 min, repeated another cycle to ensure complete removal. For each coupling, Fmoc-amino acid (4.0 equiv), HCTU (3.9 equiv), and NMM (8.0 equiv) in DMF were coupled to free amine on-resin for 45 min. After coupling, resin was treated with 20% acetic anhydride in DMF and NMM (1 equiv to acetic anhydride) for 10 min to cap any unreacted free amine. Synthesis of omphalotin A: Due to the highly hydrophobic sequence of omphalotin A, the synthesis was performed on ChemMatrix Rink amide resin using hexa-arginine tag with a base labile linker at the C-terminal. The first arginine coupling was performed manually on ChemMatrix Rink amide resin (0.1 mmole scale). Afterwards, five subsequent arginine residues and the basic-labile linker (4-hydroxymethyl-benzoic acid, HMBA) were coupled on synthesizer to form the Arg.sub.6 tag (SEQ ID NO: 108) to enhance the solubility. The C-terminal residue (Glu.sup.18 or Gly.sup.12) was introduced by pre-formed symmetrical anhydride of the corresponding Fmoc-amino acid (5.0 equiv) in the presence of DMAP (0.1 equiv) for 6 hours. The rest of the sequence was introduced by standard automated Fmoc SPPS protocol resulting in the following peptides:

    TABLE-US-00006 Withfollower,1a: SEQIDNO:83 [00001]embedded image Withoutfollower,1b: SEQIDNO:84 [00002]embedded image

    [0147] Upon the completion of synthesis, the full peptide on-resin with the final Fmoc was cleaved by treatment with a mixture of 94:2:2:2 TFA/TIPS/DODT/H.sub.2O for 1a and 95:2.5:2.5 TFA/TIPS/H.sub.2O for 1b respectively for 2.5 hours. The solid support was filtered off and the filtrate was evaporated under vacuum. The residue was triturated with Et.sub.2O and centrifuged to obtain the crude peptides. The crude peptides were purified by reverse phase HPLC (RP-HPLC) using a gradient of 40% CH.sub.3CN to 90% CH.sub.3CN over 30 min. The fractions containing the product was pooled and lyophilized. The final Fmoc was removed by treatment the peptides with 5% diethylamine in DMSO (2 mM) for 5 min. The solution was neutralized with equal volume of cold TFA (10% in 1:1 CH.sub.3CN/H.sub.2O) and the resulting mixture was purified by RP-HPLC and lyophilized to obtain N-terminal free amine of 1a and 1b. For the final removal of the Arg.sub.6 tag, 1a and 1b were dissolved in DMSO/H.sub.2O (9:1) to the concentration of 10 mM and treated with one-tenth volume of 1.0 M NaOH.sub.(aq) for 90 min. The reaction mixture was cooled in an ice bath, neutralized with TFA, purified by RP-HPLC, and lyophilized to afford the final products:

    TABLE-US-00007 OmphalotinA(withfollower): SEQIDNO:85 WVIVVGVVGV.sup.10IGSVMSTE.sup.18 OmphalotinA(withoutfollower): SEQIDNO:86 WVIVVGVVGV.sup.10IG.sup.12

    [0148] 5 M of omphalotin precursor, 1 M S-adenosyl methionine (Sigma-Aldrich, USA) and 1 mM peptide was added to 200 l of 50 mM HEPES pH8, 0.1% triton X-100 and 10% glycerol. Samples were incubated overnight at room temperature after which they were run over an Amicon ultra column (30 kDa cutoff). The supernatant was collected and methylation of the peptide was assessed by LC-MS as described in example 6.

    Example 9 In Vitro Cleavage of Omphalotin Precursor by TEV Protease

    [0149] TEV protease (Sigma-Aldrich, USA) was added to purified omphalotin precursor containing a TEV cleavage site at a molar ratio of 1:100 and incubated overnight at 4 C. Cleavage of the precursor was assessed by LC-MS/MS as described in example 6.

    Example 10 In Vitro Proteolysis and Cyclisation of the Omphalotin Precursor by the Prolyl Oligopeptidase

    [0150] Proteolysis of the peptide from the omphalotin precursor and cyclisation reactions were performed as described by Luo et al., (2014) Chemistry and Biology 21, 1610-1617. In short, 2 g of omphalotin precursor together with 10 g of POP was dissolved in 50 mM Tris-HCl (pH7.5) in a reaction volume of 50 l and incubated at 37 C. for 4 hr. For POP activity on peptides, 1 mM of omphalotin peptide with or without follower (see above) were dissolved in 50 mM Tris-HCl (pH7.5) containing 1 mM dithiothreitol, or 0.1% trifluoroacetic acid and incubated together with 2 g of POP. After the incubation reactions were quenched with 50 l of methanol and the samples were centrifuged for 5 min. The supernatant was analyzed by HPLC (see Luo et al., (2014) Chemistry and Biology 21:1610-1617) or LC-MS as described in example 6.

    Example 11 In Vivo Proteolysis and Cyclisation of the Omphalotin Precursor by the Prolyl Oligopeptidase

    [0151] STREP-tagged POP and HIS-tagged OMP where co-expressed in E. coli BL21 using the pCDFDUET-1 vector (Merck Millipore, Germany) and brought to expression as described in Example 4. For analysis of proteolysis of the omphalotin precursor protein was purified as described in Example 4 and send for analysis by whole protein LC/TOF-MS by the Functional Genomics Center (University Zurich). To assess cyclisation and cleavage the supernatant of the whole cell extract after high spin centrifugation was run over an Amicon Ultra-4 centrifugal filter device (Millipore, USA) with a molecular weight cut off of 10 kDa. The supernatant was analyzed by HPLC (see Luo et al., (2014) Chemistry and Biology 21:1610-1617) or LC-MS as described in example 6.