Recombinant microorganism for the production of useful metabolites

Abstract

Described are recombinant microorganisms characterized by having phosphoketolase activity, having a diminished or inactivated Embden-Meyerhof-Parnas pathway (EMPP) by inactivation of the gene(s) encoding phosphofructokinase or by reducing phosphofructokinase activity as compared to a non-modified microorganism and having a diminished or inactivated oxidative branch of the pentose phosphate pathway (PPP) by inactivation of the gene(s) encoding glucose-6-phosphate dehydrogenase or by reducing glucose-6-phosphate dehydrogenase activity as compared to a non-modified microorganism. These microorganisms can be used for the production of useful metabolites such as acetone, isobutene or propene.

Claims

1. A genetically modified prokaryotic microorganism comprising the following characteristics: (A) increased phosphoketolase activity as compared to a non-genetically modified microorganism; and (B) (1) diminished or inactivated phosphofructokinase activity as compared to a non-genetically modified microorganism; or (2) not possessing phosphofructokinase activity; and (C)(1) diminished or inactivated glucose-6-phosphate dehydrogenase activity as compared to a non-genetically modified microorganism; or (2) not possessing glucose-6-phosphate dehydrogenase activity.

2. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified microorganism is E. coli comprising the genotype ?zwf_edd_eda ?pfkA ?pfkB.

3. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified microorganism is E. coli.

4. The genetically modified prokaryotic microorganism of claim 1, wherein the non-genetically modified microorganism does not have phosphoketolase activity.

5. The genetically modified prokaryotic microorganism of claim 4, wherein the non-genetically modified microorganism is genetically modified so as to comprise a nucleotide sequence encoding a phosphoketolase.

6. The genetically modified prokaryotic microorganism of claim 5, wherein the genetically modified prokaryotic microorganism is further genetically modified by mutation and selection for increased phosphoketolase activity as compared to the non-genetically modified microorganism.

7. The genetically modified prokaryotic microorganism of claim 1, wherein the non-genetically modified microorganism has phosphoketolase activity.

8. The genetically modified prokaryotic microorganism of claim 7, wherein the non-genetically modified microorganism is genetically modified by mutation and selection for increased phosphoketolase activity as compared to the non-genetically modified microorganism.

9. The genetically modified prokaryotic microorganism of claim 7, wherein the non-genetically modified microorganism is genetically modified so as to comprise a nucleotide sequence allowing for the increased expression of a phosphoketolase as compared to the non-genetically modified microorganism.

10. The genetically modified prokaryotic microorganism of claim 9, wherein the nucleotide sequence encodes a phosphoketolase.

11. The genetically modified prokaryotic microorganism of claim 9, wherein the nucleotide sequence comprises a heterologous expression control sequence.

12. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to reduce phosphofructokinase activity as compared to a non-genetically modified microorganism.

13. The genetically modified prokaryotic microorganism of claim 12, wherein a gene encoding a phosphofructokinase is genetically modified so as to reduce phosphofructokinase activity as compared to the non-genetically modified microorganism.

14. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to inactivate phosphofructokinase activity as compared to the non-genetically modified microorganism.

15. The genetically modified prokaryotic microorganism of claim 14, wherein a gene encoding a phosphofructokinase is inactivated.

16. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to reduce glucose-6-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

17. The genetically modified prokaryotic microorganism of claim 16, wherein a gene encoding a glucose-6-phosphate dehydrogenase is genetically modified so as to reduce glucose-6-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

18. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to inactivate glucose-6-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

19. The genetically modified prokaryotic microorganism of claim 18, wherein a gene encoding a glucose-6-phosphate dehydrogenase is inactivated.

20. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to reduce glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-genetically modified microorganism.

21. The genetically modified prokaryotic microorganism of claim 20, wherein a gene encoding a glyceraldehyde 3-phosphate dehydrogenase is genetically modified so as to reduce glyceraldehyde 3-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

22. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is genetically modified so as to inactivate glyceraldehyde 3-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

23. The genetically modified prokaryotic microorganism of claim 22, wherein a gene encoding a glyceraldehyde 3-phosphate dehydrogenase is inactivated.

24. The genetically modified prokaryotic microorganism of claim 1, further comprising fructose-1,6-bisphosphate phosphatase activity.

25. The genetically modified prokaryotic microorganism of claim 24, wherein said genetically modified prokaryotic microorganism has increased fructose-1,6-bisphosphate phosphatase activity when grown on glucose as compared to a non-genetically modified microorganism.

26. The genetically modified prokaryotic microorganism of claim 25, wherein said genetically modified prokaryotic microorganism has been genetically modified to have increased fructose-1,6-bisphosphate phosphatase activity as compared to a non-genetically modified microorganism when grown on glucose.

27. The genetically modified prokaryotic microorganism of claim 26, wherein the genetically modified prokaryotic microorganism is further genetically modified so as to reduce glyceraldehyde 3-phosphate dehydrogenase activity as compared to a non-genetically modified microorganism.

28. The genetically modified prokaryotic microorganism of claim 27, wherein a gene encoding a glyceraldehyde 3-phosphate dehydrogenase is genetically modified so as to reduce glyceraldehyde 3-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

29. The genetically modified prokaryotic microorganism of claim 26, wherein the genetically modified prokaryotic microorganism is genetically modified so as to inactivate glyceraldehyde 3-phosphate dehydrogenase activity as compared to the non-genetically modified microorganism.

30. The genetically modified prokaryotic microorganism of claim 29, wherein a gene encoding a glyceraldehyde 3-phosphate dehydrogenase is inactivated.

31. The genetically modified prokaryotic microorganism of claim 26, wherein said genetically modified prokaryotic microorganism has been transformed with a nucleic acid encoding a fructose-1,6-bisphosphate phosphatase so as to have fructose-1,6-bisphosphate phosphatase activity when grown on glucose as compared to the non-genetically modified microorganism.

32. The genetically modified prokaryotic microorganism of claim 1, wherein said genetically modified prokaryotic microorganism is a bacterium.

33. The genetically modified prokaryotic microorganism of claim 1, wherein a gene encoding a PEP-dependent PTS transporter has been inactivated.

34. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is capable of converting acetyl-CoA into acetone.

35. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is capable of converting acetyl-CoA into isobutene.

36. The genetically modified prokaryotic microorganism of claim 1, wherein the genetically modified prokaryotic microorganism is capable of converting acetyl-CoA into propene.

37. The genetically modified prokaryotic microorganism of claim 1 wherein the genetically modified prokaryotic microorganism is capable of converting glucose into acetyl-CoA.

38. A method for producing acetyl-CoA from glucose comprising: (a) culturing a genetically modified prokaryotic microorganism in a suitable media, wherein the prokaryotic microorganism comprises the following characteristics: (1) increased phosphoketolase activity as compared to a non-genetically modified microorganism; and (2) (a) diminished or inactivated phosphofructokinase activity as compared to a non-genetically modified microorganism; or (b) not possessing phosphofructokinase activity; and (3) (a) diminished or inactivated glucose-6-phosphate dehydrogenase activity as compared to a non-genetically modified microorganism; or (b) not possessing glucose-6-phosphate dehydrogenase activity; and (b) recovering said acetyl-CoA.

39. A method for producing acetone, isobutene, or propene comprising: (a) culturing a genetically modified prokaryotic microorganism in a suitable media, wherein the prokaryotic microorganism comprises: (1) increased phosphoketolase activity as compared to a non-genetically modified microorganism; and (2) (a) diminished or inactivated phosphofructokinase activity as compared to a non-genetically modified microorganism; or (b) not possessing phosphofructokinase activity; and (3) (a) diminished or inactivated glucose-6-phosphate dehydrogenase activity as compared to a non-genetically modified microorganism; or (b) not possessing glucose-6-phosphate dehydrogenase activity; and (b) recovering said acetone, isobutene, or propene from the culture medium.

40. The method of claim 39, wherein acetone is recovered.

41. The method of claim 39, wherein isobutene is recovered.

42. The method of claim 39, wherein propene is recovered.

Description

(1) The present invention is further described by reference to the following non-limiting FIGURES and examples.

(2) FIG. 1 shows two schemes for the production of acetyl-CoA from glucose-6-phosphate via the phosphoketolase pathway using either one or both phosphoketolase activities EC 4.1.2.9 and EC 4.1.2.22.

EXAMPLES

General Methods and Materials

(3) Procedure for ligations and transformations are well known in the art. Techniques suitable for use in the following examples may be found in Sambrook J., et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y., 1989, and Sambrook J., supra.

(4) Materials and methods suitable for the maintenance and growth of bacterial cultures are well known in the art. Techniques suitable for use in the following examples may be found in Manual of Methods for General Bacteriology (Philipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Philips, eds).

(5) All reagents and materials used for the growth and maintenance of bacterial cells were obtained from Sigma-Aldrich Company (St. Louis, Mo.) unless otherwise specified.

(6) TABLE-US-00001 TABLE 1 Plasmids used and constructed Plasmid Name Description pKD46 Datsenko KA. And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645 pCP20 Datsenko KA. And Wanner BL., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645 pGBE0687 Plasmid pGBE0687 presents a resistance gene to apramycin placed under the control of its own promoter pGBE0688 Plasmid pGBE0688 presents a resistance gene to spectinomycin placed under the control of its own promoter pGBE0421 Plasmid from GeneArt? (Invitrogen) that encodes for L. lactis phosphoketolase pGBE0123 A modified version of the plasmid pUC18 (New England Biolabs) which contains a modified Multiple Cloning Site (MCS) pGBE0457 Plasmid that allows expression of the L. lactis phosphoketolase pGBE0689 pBluescript II phagemids, Agilent Technologies pGBE0690 ctfA and ctfB genes from Clostridium acetobutylicum cloned into pGBE0689 pGBE0691 adc gene from Clostridium acetobutylicum cloned into pGBE0690 pGBE0051 pUC19, New England Biolabs pGBE0692 ctfA, ctfB and adc genes from Clostridium acetobutylicum cloned into pGBE0051 pGBE0693 thl gene from from Clostridium acetobutylicum cloned into pGBE0692 pGBE0124 A modified version of the plasmid pSU18 (Borja Bartolom?, Yolanda Jubete, Eduardo Martinez and Fernando de la Cruz, Gene, 1991, Vol. 102, Issue 1, pp. 75-78) pGBE0096 thl, ctfA, ctfB and adc genes from Clostridium acetobutylicum cloned into pGBE0124 pGBE0928 Plasmid that allows expression of the L. lactis phosphoketolase pGBE1020 Plasmid that allows expression of the L. lactis phosphoketolase and acetone production pGBE1021 Plasmid that allows acetone production

(7) TABLE-US-00002 TABLE 2 Strains used and constructed. Strain of Strain origin name Genotype Construction GBE0129 F-lambda-ilvG-rfb-50 rph-1 Escherichia coli K12 wild- type MG1655 GBE0170 pKD46 GBE0129 Transformation of the strain GBE0129 with the pKD46 plasmid GBE0329 pGBE0096 GBE0129 Transformation of the strain GBE0129 with the pGBE0096 plasmid GBE0901 ?ptsHI::FRT GBE0129 GBE0902 ?ptsHI::FRT pKD46 GBE0901 Transformation of the strain GBE0901 with the pKD46 plasmid GBE0903 ?ptsHI::FRT ?zwf_edd_eda::aad.sup.+ GBE0902 GBE0929 ?ptsHI::FRT GBE0901 Selection of the strain GBE0901 on MS medium with glucose as the source of carbon. GBE1000 ?ptsHI::FRT ?zwf_edd_eda:: GBE0903. Selection of the strain aad.sup.+ GBE0903 on MS medium with glucose as the source of carbon. GBE1001 ?ptsHI::FRT ?zwf_edd_eda:: GBE1000 Transformation of the strain aad.sup.+ pKD46 GBE1000 with the pKD46 plasmid GBE1005_pKD46 ?ptsHI::FRT ?zwf_edd_eda:: GBE1001 aad.sup.+ ?pfkA::aac.sup.+ GBE1005 ?ptsHI::FRT ?zwf_edd_eda:: GBE1005_pKD46. The loss of the pKD46 aad.sup.+ ?pfkA::aac.sup.+ plasmid has been verified. GBE1005_p ?ptsHI::FRT ?zwf_edd_eda:: GBE1005 Transformation of the strain aad.sup.+ ?pfkA::aac.sup.+ pCP20 GBE1005 with the pCP20 plasmid GBE1006 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1005_p The loss of the pCP20 ?pfkA::FRT plasmid has been verified. GBE1010 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1006 Transformation of the strain ?pfkA::FRT pKD46 GBE1006 with the pKD46 plasmid GBE1014_pKD46 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1010 ?pfkA::FRT ?pfkB::aad.sup.+ GBE1014 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1014_pKD46. The loss of the pKD46 ?pfkA::FRT ?pfkB:: aad.sup.+ plasmid has been verified. GBE1283 ?ptsHI::FRT GBE0929 Successive cultures of the GBE0929 in MS medium with glucose as the source of carbon. GBE1284 ?ptsHI::FRT pKD46 GBE1283 Transformation of the strain GBE1283 with the pKD46 plasmid GBE1287 ?ptsHI::FRT ?zwf_edd_eda::aad.sup.+ GBE1284 GBE1337 ?ptsHI::FRT ?zwf_edd_eda::aad.sup.+ GBE1287 Transformation of the strain pKD46 GBE1287 with the pKD46 plasmid GBE1339 ?zwf_edd_eda::aac.sup.+ GBE0170 GBE1340 ?zwf_edd_eda::aac.sup.+ pKD46 GBE1339 Transformation of the strain GBE1339 with the pKD46 plasmid GBE1341_pKD46 ?zwf_edd_eda::aac.sup.+ ?pfkA:: aad.sup.+ GBE1340 GBE1341 ?zwf_edd_eda::aac.sup.+ ?pfkA:: aad.sup.+ GBE1341_pKD46 The loss of the pKD46 plasmid has been verified. GBE1341_p ?zwf_edd_eda::aac.sup.+ ?pfkA:: aad.sup.+ GBE1341 Transformation of the strain pCP20 GBE1341 with the pCP20 plasmid GBE1342 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1341_p The loss of the pCP20 plasmid has been verified. GBE1343 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1342 Transformation of the strain pKD46 GBE1342 with the pKD46 plasmid GBE1344_pKD46 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1343 ?pfkB:: aad.sup.+ GBE1344 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1344_pKD46 The loss of the pKD46 ?pfkB:: aad.sup.+ plasmid has been verified. GBE1345 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1344 Transformation of the strain ?pfkB:: aad.sup.+ pGBE457 GBE1344 with both pGBE96 pGBE0096 and pGB457 plasmids GBE1346 pGBE0096 GBE0329 Adaptation of the strain GBE0329 to the MS medium + glucose (2 g/L) + Chloramphenicol (25 ug/ml) GBE1347 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1345 Adaptation of the strain ?pfkB:: aad.sup.+ pGBE457 pGBE96 GBE1345 to the MS medium + glucose (2 g/L) + Chloramphenicol (25 ug/ml) GBE1348 ?ptsHI::FRT pGB96 GBE0929 Transformation of the strain GBE0929 with both pGBE96 and pGB457 plasmids GBE1349 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1014 Transformation of the strain ?pfkA::FRT ?pfkB:: aad.sup.+ GBE1014 with both pGBE96 pGBE457 pGBE0096 and pGB457 plasmids GBE1350 ?ptsHI::FRT pGB96 GBE1348 Adaptation of the strain GBE1348 to the MS medium + glucose (2 g/L) + Chloramphenicol (25 ug/ml) GBE1351 ?ptsHI::FRT ?zwf_edd_eda::FRT GBE1349 Adaptation of the strain ?pfkA::FRT ?pfkB:: aad.sup.+ GBE1349 to the MS medium + pGBE457 pGBE0096 glucose (2 g/L) + Chloramphenicol (25 ug/ml) GBE1353_pKD46 ?ptsHI::FRT GBE1337 ?zwf_edd_eda::aad+ ?pfkA:: aac+ GBE1353 ?ptsHI::FRT GBE1353_pKD46 The loss of the pKD46 ?zwf_edd_eda::aad+ ?pfkA:: plasmid has been verified. aac+ GBE1353_p ?ptsHI::FRT GBE1353 Transformation of the strain ?zwf_edd_eda::aad+ ?pfkA:: GBE1353 with the pCP20 aac+ pCP20 plasmid GBE1368 ?ptsHI::FRT ?zwf_edd_eda:: GBE1353_p The loss of the pCP20 FRT ?pfkA:: FRT plasmid has been verified. GBE1371 ?ptsHI::FRT ?zwf_edd_eda:: GBE1368 Transformation of the strain FRT ?pfkA:: FRT pKD46 GBE1368 with the pKD46 plasmid GBE1420_pKD46 ?ptsHI::FRT ?zwf_edd_eda:: GBE1371 FRT ?pfkA:: FRT ?pfkB:: aad+ GBE1420 ?ptsHI::FRT ?zwf_edd_eda:: GBE1420_pKD46 The loss of the pKD46 FRT ?pfkA:: FRT ?pfkB:: aad+ plasmid has been verified. GBE1433 ?ptsHI::FRT ?zwf:: aad+ GBE1284 GBE1436 ?ptsHI::FRT ?zwf:: aad+ pKD46 GBE1433 Transformation of the strain GBE1433 with the pKD46 plasmid GBE1441_pKD46 ?ptsHI::FRT ?zwf:: aad+ ?pfkA:: GBE1436 aac+ GBE1441 ?ptsHI::FRT ?zwf:: aad+ ?pfkA:: GBE1441_pKD46 The loss of the pKD46 aac+ plasmid has been verified. GBE1441_p ?ptsHI::FRT ?zwf:: aad+ ?pfkA:: GBE1441 Transformation of the strain aac+ pCP20 GBE1441 with the pCP20 plasmid GBE1448 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE1441_p The loss of the pCP20 FRT plasmid has been verified. GBE1449 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE1448 Transformation of the strain FRT pKD46 GBE1448 with the pKD46 plasmid GBE1518_pKD46 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE1449 FRT ?pfkB:: aad+ GBE1518 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE1518_pKD46 The loss of the pKD46 FRT ?pfkB:: aad+ plasmid has been verified. GBE2252_pKD46 ?ptsHI::FRT ?pfkA:: aad+ GBE1284 GBE2252 ?ptsHI::FRT ?pfkA:: aad+ GBE2252_pKD46 The loss of the pKD46 plasmid has been verified. GBE2253 ?ptsHI::FRT ?pfkA:: aad+ pKD46 GBE2252 Transformation of the strain GBE2252 with the pKD46 plasmid GBE2256_pKD46 ?ptsHI::FRT ?pfkA:: aad+ ?pfkB:: GBE2253 aac+ GBE2256 ?ptsHI::FRT ?pfkA:: aad+ ?pfkB:: GBE2256_pKD46 The loss of the pKD46 aac+ plasmid has been verified. GBE2262 F-lambda-ilvG-rfb-50 rph-1 GBE0129 Transformation of the strain pGB1021 GBE0129 with pGB1021 plasmid GBE2263 ?zwf_edd_eda::FRT ?pfkA::FRT GBE1344 Transformation of the strain ?pfkB:: aad+ pGB1020 GBE1344 with pGB1020 plasmid GBE2264 F-lambda-ilvG-rfb-50 rph-1 GBE2262 Adaptation of the strain pGB1021 GBE2262 to the MS medium + glucose (2 g/L) + ampicilline (100 ug/ml). GBE2265 ?zwf_edd_eda::FRT ?pfkA::FRT GBE2263 Adaptation of the strain ?pfkB:: aad+ pGB1020 GBE2263 to the MS medium + glucose (2 g/L) + ampicilline (100 ug/ml). GBE2266 ?ptsHI::FRT pGB1021 GBE1283 Transformation of the strain GBE1283 with pGB1021 plasmid GBE2267 ?ptsHI::FRT ?zwf_edd_eda:: GBE1420 Transformation of the strain FRT ?pfkA:: FRT ?pfkB:: aad+ GBE1420 with pGB1020 pGB1020 plasmid GBE2268 ?ptsHI::FRT pGB1021 GBE2266 Adaptation of the strain GBE2266 to the MS medium + glucose (2 g/L) + ampicilline (100 ug/ml). GBE2269 ?ptsHI::FRT ?zwf_edd_eda:: GBE2267 Adaptation of the strain FRT ?pfkA:: FRT ?pfkB:: aad+ GBE2267 to the MS medium + pGB1020 glucose (2 g/L) + ampicilline (100 ug/ml). GBE2270 ?ptsHI::FRT ?pfkA:: aad+ ?pfkB:: GBE2256 Transformation of the strain aac+ pGB1020 GBE2256 with pGB1020 plasmid GBE2271 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE1518 Transformation of the strain FRT ?pfkB:: aad+ pGB1020 GBE1518 with pGB1020 plasmid GBE2272 ?ptsHI::FRT ?pfkA:: aad+ ?pfkB:: GBE2270 Adaptation of the strain aac+ pGB1020 GBE2270 to the MS medium + glucose (2 g/L) + ampicilline (100 ug/ml). GBE2273 ?ptsHI::FRT ?zwf:: FRT ?pfkA:: GBE2271 Adaptation of the strain FRT ?pfkB:: aad+ pGB1020 GBE2271 to the MS medium + glucose (2 g/L) + ampicilline (100 ug/ml). FRT: FLP recognition target

(8) TABLE-US-00003 TABLE3 Sequencesofbacterialchromosomalregions,genesused,plasmidsregions. SEQ Name Nucleotidesequence Description IDNO nucleotide Aggctagactttagttccacaacactaaacctataagttggggaaat FRTregion SQ sequencefrom acagtgtaggctggagctgcttcgaagttcctatactttctagagaa is 0001 strainGBE0901, taggaacttcggaataggaactaaggaggatattcatag underlined frombasepairs 2531736to 2531870 Spectinomycin agagcggccgccaccgcgggaagttcctatactttctagagaatagg FRT SQ resistance aacttcagctgatagaaacagaagccactggagcacctcaaaaacac regionsare 0002 cassette catcatacactaaatcagtaagttggcagcatcaccgacgcactttg underlined cgccgaataaatacctgtgacggaagatcacttcgcagaataaataa atcctggtgtccctgttgataccgggaagccctgggccaacttttgg cgaaaatgagacgttgatcggcacgtaagaggttccaactttcacca taatgaaataagatcactaccgggcgtattttttgagttatcgagat tttcaggagctaaggaagctacatatgagtgaaaaagtgcccgccga gatttcggtgcaactatcacaagcactcaacgtcatcgggcgccact tggagtcgacgttgctggccgtgcatttgtacggctccgcactggat ggcggattgaaaccgtacagtgatattgatttgctggtgactgtagc tgcaccgctcaatgatgccgtgcggcaagccctgctcgtcgatctct tggaggtttcagcttcccctggccaaaacaaggcactccgcgccttg gaagtgaccatcgtcgtgcacagtgacatcgtaccttggcgttatcc ggccaggcgggaactgcagttcggagagtggcagcgcaaagacatcc ttgcgggcatcttcgagcccgccacaaccgattctgacttggcgatt ctgctaacaaaggcaaagcaacatagcgtcgtcttggcaggttcagc agcgaaggatctcttcagctcagtcccagaaagcgatctattcaagg cactggccgatactctgaagctatggaactcgccgccagattgggcg ggcgatgagcggaatgtagtgcttactttgtctcgtatctggtacac cgcagcaaccggcaagatcgcgccaaaggatgttgctgccacttggg caatggcacgcttgccagctcaacatcagcccatcctgttgaatgcc aagcgggcttatcttgggcaagaagaagattatttgcccgctcgtgc ggatcaggtggcggcgctcattaaattcgtgaagtatgaagcagtta aactgcttggtgccagccaataagaagttcctatactttctagagaa taggaacttcgcatgcacgcagcatatgc Apramycin agagcggccgccaccgcgggaagttcctatactttctagagaatagg FRT SQ resistance aacttcgggttcatgtgcagctccatcagcaaaaggggatgataagt regionsare 0003 cassette ttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgat underlined cgactgatgtcatcagcggtggagtgcaatgtcgtgcaatacgaatg gcgaaaagccgagctcatcggtcagcttctcaaccttggggttaccc ccggcggtgtgctgctggtccacagctccttccgtagcgtccggccc ctcgaagatgggccacttggactgatcgaggccctgcgtgctgcgct gggtccgggagggacgctcgtcatgccctcgtggtcaggtctggacg acgagccgttcgatcctgccacgtcgcccgttacaccggaccttgga gttgtctctgacacattctggcgcctgccaaatgtaaagcgcagcgc ccatccatttgcctttgcggcagcggggccacaggcagagcagatca tctctgatccattgcccctgccacctcactcgcctgcaagcccggtc gcccgtgtccatgaactcgatgggcaggtacttctcctcggcgtggg acacgatgccaacacgacgctgcatcttgccgagttgatggcaaagg ttccctatggggtgccgagacactgcaccattcttcaggatggcaag ttggtacgcgtcgattatctcgagaatgaccactgctgtgagcgctt tgccttggcggacaggtggctcaaggagaagagccttcagaaggaag gtccagtcggtcatgcctttgctcggttgatccgctcccgcgacatt gtggcgacagccctgggtcaactgggccgagatccgttgatcttcct gcatccgccagaggcgggatgcgaagaatgcgatgccgctcgccagt cgattggctgagctcatgagcggagaacgagatgacgttggaggggc aaggtcgcgctgattgctggggcaacacgtggagcggatcggggatt gtctttcttcagctcgctgatgatatgctgacgctcaatgccgaagt tcctatactttctagagaataggaacttcgcatgcacgcagcatatg c MCSofthe AAGCTTGCGGCCGCGGGGTTAATTAACCTCCTTAGTTTAAACCTAGG The SQ pGB0123 CATGCCTCTAGAGGATCCCCGGGTACCGAGCTCGAAttaCCTGCAGG restriction 0004 plasmid AATTC sitesfor HindIIIand EcoRIare underlined. Optimized TTAATTAATGCATCATCACCACCATCACATGACCGAATATAACAGCG The SQ Lactococcus AAGCCTATCTGAAAAAACTGGATAAATGGTGGCGTGCAGCAACCTAT restriction 0005 lactis CTGGGTGCAGGTATGATTTTTCTGAAAGAAAATCCGCTGTTTAGCGT sitefor phosphoketolase TACCGGCACCCCGATTAAAGCAGAAAATCTGAAAGCCAATCCGATTG PacIand geneflankedby GTCATTGGGGCACCGTTAGCGGTCAGACCTTTCTGTATGCACATGCA NotIare PacIandNotI AATCGCCTGATTAACAAATATAACCAGAAAATGTTTTATATGGGTGG underlined. restriction TCCGGGTCATGGTGGTCAGGCAATGGTTGTTCCGAGCTATCTGGATG sites GTAGCTATACCGAAGCATATCCGGAAATTACCCAGGATCTGGAAGGT ATGAGCCGTCTGTTTAAACGTTTTAGCTTTCCGGGTGGTATTGGTAG CCACATGACCGCACAGACACCGGGTAGCCTGCATGAAGGTGGTGAAC TGGGTTATGTTCTGAGCCATGCAACCGGTGCAATTCTGGATCAGCCG GAACAAATTGCATTTGCAGTTGTTGGTGATGGTGAAGCAGAAACCGG TCCGCTGATGACCAGCTGGCATAGCATCAAATTTATCAACCCGAAAA ACGATGGTGCCATTCTGCCGATTCTGGATCTGAATGGCTTTAAAATC AGCAATCCGACCCTGTTTGCACGTACCAGTGATGTTGATATCCGCAA ATTTTTCGAAGGTCTGGGTTATAGTCCGCGTTATATTGAAAACGATG ACATCCATGACTACATGGCCTATCATAAACTGGCAGCAGAAGTTTTT GACAAAGCCATTGAAGATATCCATCAGATTCAGAAAGATGCCCGTGA AGATAATCGCTATCAGAATGGTGAAATTCCGGCATGGCCGATTGTTA TTGCACGTCTGCCGAAAGGTTGGGGTGGTCCTCGTTATAATGATTGG AGCGGTCCGAAATTTGATGGTAAAGGTATGCCGATCGAACATAGCTT TCGTGCACATCAGGTTCCGCTGCCGCTGAGCAGCAAAAACATGGGCA CCCTGCCGGAATTTGTTAAATGGATGACCAGCTATCAGCCGGAAACC CTGTTTAATGCAGATGGTAGCCTGAAAGAAGAACTGCGCGATTTTGC ACCGAAAGGTGAAATGCGTATGGCAAGCAATCCGGTTACCAATGGTG GTGTTGATTATAGCAATCTGGTTCTGCCGGATTGGCAAGAATTTGCA AATCCGATTAGCGAAAACAATCGTGGTAAACTGCTGCCGGATACCAA TGATAATATGGATATGAACGTGCTGAGCAAATATTTCGCCGAAATTG TTAAACTGAACCCGACCCGTTTTCGTCTGTTTGGTCCGGATGAAACC ATGAGCAATCGTTTTTGGGAGATGTTTAAAGTGACCAATCGTCAGTG GATGCAGGTTATCAAAAATCCGAACGATGAGTTTATTAGTCCGGAAG GTCGCATTATTGATAGCCAGCTGAGCGAACATCAGGCAGAAGGTTGG CTGGAAGGTTATACCCTGACCGGTCGTACCGGTGTTTTTGCAAGCTA TGAAAGTTTTCTGCGTGTTGTTGATAGCATGCTGACCCAGCACTTTA AATGGATTCGTCAGGCAGCAGATCAGAAATGGCGTCATGATTATCCG AGCCTGAATGTTATTAGCACCAGCACCGTTTTTCAGCAGGATCATAA TGGTTATACCCATCAAGATCCGGGTATGCTGACCCATCTGGCAGAGA AAAAAAGCGATTTTATTCGTCAGTATCTGCCTGCAGATGGTAATACC CTGCTGGCCGTTTTTGATCGTGCATTTCAGGATCGCAGCAAAATTAA CCATATTGTTGCAAGCAAACAGCCTCGTCAGCAGTGGTTTACCAAAG AAGAAGCAGAAAAACTGGCCACCGATGGTATTGCAACCATTGATTGG GCAAGCACCGCAAAAGATGGTGAAGCCGTTGATCTGGTTTTTGCAAG TGCCGGTGCAGAACCGACCATTGAAACCCTGGCAGCACTGCATCTGG TTAATGAAGTTTTTCCGCAGGCCAAATTTCGCTATGTTAATGTTGTT GAACTGGGTCGTCTGCAGAAAAAGAAAGGTGCACTGAATCAAGAACG CGAACTGAGTGATGAAGAGTTCGAAAAATACTTTGGTCCGAGCGGTA CACCGGTTATTTTTGGTTTTCATGGCTATGAAGATCTGATCGAGAGC ATCTTTTATCAGCGTGGTCATGATGGTCTGATTGTTCATGGTTATCG TGAAGATGGTGATATTACCACCACCTATGATATGCGTGTTTATAGCG AACTGGATCGTTTTCATCAGGCAATTGATGCAATGCAGGTTCTGTAT GTGAATCGTAAAGTTAATCAGGGTCTGGCCAAAGCATTTATTGATCG TATGGAACGTACCCTGGTGAAACATTTTGAAGTTACCCGTAATGAAG GCGTTGATATTCCGGAATTTACCGAATGGGTTTGGAGCGATCTGAAA AAGTAATGAGCGGCCGC MCSofthe GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGGCATGCCTAGGTT SQ0006 pGB0124plasmid TAAACTAAGGAGGTTAATTAACCCCGCGGCCGCAAGCTT

(9) TABLE-US-00004 TABLE4 Primersequence SEQ Name Sequence Description IDNO: 0635 Ggttcaattcttcctttagcggc PrimerforsequencingtheE.coli RC0001 chromosomalregionincludingthe ptsHIgenes. 0638 Ccgcaaaaacgacatccggcacg PrimerforsequencingtheE.coli RC0002 chromosomalregionincludingthe ptsHIgenes. 0633 caagtataccctggcttaagtaccgggttagttaa Primerfordeletionofthe RC0003 cttaaggagaatgacAGAGCGGCCGCCACCGCGGG zwf_edd_edagenes. 0634 gcaaaaaaacgctacaaaaatgcccgatcctcgat Primerfordeletionofthe RC0004 cgggcattttgacttGCATATGCTGCGTGCATGCG zwf_edd_edagenes 1036 Ccgcactttgcgcgcttttccc PrimerforsequencingtheE.coli RC0005 chromosomalregionincludingthe zwf_edd_edagenes. 1037 Ggtgattttcagtgaggtctcccc PrimerforsequencingtheE.coli RC0006 chromosomalregionincludingthe zwf_edd_edagenes. 0629 agacttccggcaacagatttcattttgcattccaa PrimerfordeletionofthepfkA RC0007 agttcagaggtagtcAGAGCGGCCGCCACCGCGGG gene 0630 gcttctgtcatcggtttcagggtaaaggaatctgc PrimerfordeletionofthepfkA RC0008 ctttttccgaaatcaGCATATGCTGCGTGCATGCG gene. 0619 Ggcgctcacgatcttcgcacgcggc PrimerforsequencingtheE.coli RC0009 chromosomalregionincludingthe pfkAgene. 0620 Ccgcctcatattgctgacaaagtgcgc PrimerforsequencingtheE.coli RC0010 chromosomalregionincludingthe pfkAgene. 0631 actttccgctgattcggtgccagactgaaatcagc PrimerfordeletionofthepfkB RC0011 ctataggaggaaatgAGAGCGGCCGCCACCGCGGG gene. 0632 gttgccgacaggttggtgatgattcccccaatgct PrimerfordeletionofthepfkB RC0012 gggggaatgtttttgGCATATGCTGCGTGCATGCG gene. 0621 Ccacagcgaccaggcagtggtgtgtcc PrimerforsequencingtheE.coli RC0013 chromosomalregionincludingthe pfkBgene. 0622 Gcactttgggtaagccccgaaacc PrimerforsequencingtheE.coli RC0014 chromosomalregionincludingthe pfkBgene. pUC18_246 Ccattcaggctgcgcaactg Primerforsequencingthe RC0015 phosphoketolasegenefrom Lactococcuslactisclonedintothe pGB0123. pUC18_3800_ Gcgcgttggccgattcattaatgc Primerforsequencingthe RC0016 rev phosphoketolasegenefrom Lactococcuslactisclonedintothe pGB0123. Pkt CAATCCGACCCTGTTTGCACGTAC Primerforsequencingthe RC0017 lacto phosphoketolasegenefrom 700_dir Lactococcuslactisclonedintothe pGB0123. Pkt_lacto_ GCTGCCGGATACCAATGATAATATGG Primerforsequencingthe RC0018 mil_dir phosphoketolasegenefrom Lactococcuslactisclonedintothe pGB0123. Pkt_lacto_ CCATATTATCATTGGTATCCGGCAGC Primerforsequencingthe RC0019 mil_rev phosphoketolasegenefrom Lactococcuslactisclonedintothe pGB0123. 0070 CCCGGGGGATCCAGAATTTAAAAGGAGGGATT PrimerforamplifyingthectfAand RC0020 ctfBgenesfromClostridium acetobutylicumATCC824strain. 0071 CTCGAGGATATCAAGAATTCTTTTTAAACAGCCAT PrimerforamplifyingthectfAand RC0021 GGGTC ctfBgenesfromClostridium acetobutylicumATCC824strain. 1066 TGTAAAACGACGGCCAGT Generalprimerforsequencing RC0022 1067 CAGGAAACAGCTATGACC Generalprimerforsequencing RC0023 0072 CTCGAGGATATCAGGAAGGTGACTTTTATGTTAAA Primerforamplifyingtheadcgene RC0024 GG fromtheClostridium acetobutylicumATCC824strain. 0073 GCATGCGTCGACATTAAAAAAATAAGAGTTACC Primerforamplifyingtheadcgene RC0025 fromClostridiumacetobutylicum ATCC824strain 1068 CCTCACGGCAAAGTCTCAAGC PrimerforsequencingthectfAand RC0026 ctfBgenes 1069 GCCATGGGTCTAAGTTCATTGG PrimerforsequencingthectfAand RC0027 ctfBgenes 0074 CATGATTTTAAGGGGGGTACCATATGCATAAGTTT Primerforamplifyingthethlgene RC0028 AA fromClostridiumacetobutylicum ATCC824strain 0075 GTTATTTTTAAGGATCCTTTTTAGCACTTTTCTAG Primerforamplifyingthethlgene RC0029 C fromClostridiumacetobutylicum ATCC824strain 1070 GGCAGAAAGGGAGAAACTGTAG Primerforsequencingtheacetone RC0030 operonfromClostridium acetobutylicum(ATCC824) 1071 TGGAAAGAATACGTGCAGGCGG Primerforsequencingtheacetone RC0031 operonfromClostridium acetobutylicum(ATCC824) 1072 GATTACGCCAAGCTTGCATGCC Primerforsequencingtheacetone RC0032 operonfromClostridium acetobutylicum(ATCC824) 1073 CCGGCCTCATCTACAATACTACC Primerforsequencingtheacetone RC0033 operonfromClostridium acetobutylicum(ATCC824) 1074 CCCATTATTGCTGGGTCAACTCC Primerforsequencingtheacetone RC0034 operonfromClostridium acetobutylicum(ATCC824) 1516 CCCGGTACCTCATTACTTTTTCAGATCGCTCCAAA Primerforamplifyingthe RC0035 CCC phosphoketolasegene (YP_003354041.1)from Lactococcuslactis. 1517 GGGGAATTCAGGAGGTGTACTAGATGCATCATCAC Primerforamplifyingthe RC0036 CACCATCACATGACC phosphoketolasegene (YP_003354041.1)from Lactococcuslactis. 1994 CCATAGCTCCACCCATACCAGAGAGC Primerforsequencingtheacetone RC0037 operonfromClostridium acetobutylicum(ATCC824) 1995 GCTATTATTACGTCAGCATCTCCTGC Primerforsequencingtheacetone RC0038 operonfromClostridium acetobutylicum(ATCC824) 1996 GCAGGCGAAGTTAATGGCGTGC Primerforsequencingtheacetone RC0039 operonfromClostridium acetobutylicum(ATCC824) 1997 GATACGGGGTAACAGATAAACCATTTC Primerforsequencingtheacetone RC0040 operonfromClostridium acetobutylicum(ATCC824) 1998 CCCTTTCTGCCTTTAATTACTACAGG Primerforsequencingtheacetone RC0041 operonfromClostridium acetobutylicum(ATCC824) 1999 GCATCAGGATTAAATGACTGTGCAGC Primerforsequencingtheacetone RC0042 operonfromClostridium acetobutylicum(ATCC824) 2000 GGACTAGCGCCCATTCCAACTATTCC Primerforsequencingtheacetone RC0043 operonfromClostridium acetobutylicum(ATCC824) 2001 GCTGCAAGGCGATTAAGTTGGGTAACGCC Primerforsequencingtheacetone RC0044 operonfromClostridium acetobutylicum(ATCC824) 2002 GCATTGCGTGTACAAGAGTAACGAG Primerforsequencingtheacetone RC0045 operonfromClostridium acetobutylicum(ATCC824) 2003 CCTGTCCAAGCTTCATGTACGG Primerforsequencingtheacetone RC0046 operonfromClostridium acetobutylicum(ATCC824) 1109 GCGCAAGATCATGTTACCGGTAAAATAACCATAAA Primerfordeletionofthezwfgene. RC0047 GGATAAGCGCAGATAGCATATGCTGCGTGCATGCG 1110 CGCCTGTAACCGGAGCTCATAGGG PrimerforsequencingtheE.coli RC0048 chromosomalregionincludingthe zwfgene.

(10) Chromosomal Integration for Gene Knockouts.

(11) To integrate DNA into a specific region of the chromosome, homology of the inserting DNA to the targeted chromosomal site and a selectable marker are required. It is advantageous if the marker can be easily removed after integration. The FRT/Flp recombinase system provides a mechanism to remove the marker. The FRT sites are recognition sites for the Flp recombinases. Flp is a site specific recombinase, which excises the intervening DNA from the directly repeated recognition sites.

(12) The integration cassette containing homologous arms to the targeted chromosomal site and encoding a selectable marker flanked by FRT (Datsenko K A. And Wanner B L., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) sites is transformed into target cells harboring pKD46 (Datsenko K A. And Wanner B L., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645). Successful integrants are selected by growth of the cells in the presence of the antibiotic. Subsequently, pKD46 is cured from the cells and the recombinase plasmid is then introduced into the integrants for removal of the antiobiotic gene. Strains containing a FRT cassette are transformed with the pCP20 plasmid that encodes Flp recombinase (Datsenko K A. And Wanner B L., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645). After removal of the integrated marker, the recombinase plasmids are cured from the strain.

Example 1: Construction of Strain GBE1014

(13) The purpose of this section is to describe the construction of an Escherichia coli strain, named GBE1014, for which the PEP-dependent glucose uptake is inactivated by deletion of the PTS transport genes, the ATP-dependent glucose uptake is enabled, the Embden-Meyerhof-Parnas pathway (EMPP) is inactivated by deletion of the phosphofructokinase genes, and the pentose phosphate pathway (PPP) is inactivated by deletion of the glucose-6-phosphate dehydrogenase gene.

(14) Construction started with strain GBE0901. GBE0901 is an Escherichia coli, (Migula) Castellani and Chalmers, strain MG1655 (ATCC #700926) where the original nucleotidic sequence, from by 2531736 to 2533865 (NCBI genome database), included the ptsH and ptsl genes, was replaced by SEQ SQ0001. This deletion affects the PEP-dependent phosphotransferase system (PTS), resulting in the PEP-dependent glucose uptake to be inactivated in strain GBE0901. Deletion of the ptsHI genes was verified by PCR and oligonucleotides 0635 and 0638 (given as SEQ RC0001 and RC0002, respectively) were used as primers. The resulting 0.4 Kbp PCR product was sequenced using the same primers.

(15) Strain GBE0901 was cultivated in LB medium and GBE0901 cells were made electrocompetent. Electrocompetent GBE0901 cells were transformed with a plasmid named pKD46 (Datsenko K A. And Wanner B L., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) and then plated on LB plates containing ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. Transformation of GBE0901 cells with plasmid pKD46 generated strain GBE0902. The plasmid pGBE0688 presents a resistance gene to spectinomycin placed under the control of its own promoter. The sequence of this resistance cassette is indicated in table 3 (SEQ SQ0002).

(16) Plasmid pGBE0688 was used as a template with primers 0633 and 0634 (given as SEQ RC0003 and RC0004, respectively) to generate a 1.3 Kbp PCR product. This 1.3 Kbp PCR product was transformed into electrocompetent GBE0902 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (50 ug/ml) and incubated overnight at 37? C. to generate strain GBE0903. In strain GBE0903 the DNA sequence composed by the zwf, edd, and eda genes were deleted. These genes respectively code for a glucose-6-phosphate dehydrogenase, a 6-phosphogluconate dehydratase, and a 2-keto-3-deoxy-6-phosphogluconate aldolase. This deleted DNA sequence including the zwf, edd, and eda genes was replaced by a spectinomycin resistance cassette. In order to check the effective deletion of the zwf, edd, and eda genes, a PCR amplification was performed with primers 1036 and 1037 (given as SEQ RC0005 and RC0006, respectively). A final 1.9 Kbp PCR product was obtained. This 1.9 Kbp PCR product was sequenced with the same primers 1036 and 1037.

(17) Strain GBE0903 was then plated on LB plates, incubated at 37? C. and isolated colonies were screened on MS plates (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and MarHere P; The Journal of Biological Chemistry; 1993; Vol. 268; No. 36; pp. 26827-26835) with glucose as the source of carbon (2 g/L). After 48 hours of incubation at 37? C., colonies became visible and were transferred to an MS liquid medium supplied with glucose (2 g/L). This overnight incubation at 37? C. induced the loss of the pKD46 plasmid. One isolate had a doubling time of 7 hours and was named GBE1000.

(18) Strain GBE1000 was made electrocompetent. GBE1000 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. Transformation of GBE1000 cells with plasmid pKD46 generated strain GBE1001.

(19) The plasmid pGBE0687 presents a resistance gene to apramycin placed under the control of its own promoter. The sequence of this resistance cassette is indicated in table 3 (SEQ SQ0003).

(20) The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product. The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1001 bacteria and the transformation mixture was plated on LB plates containing apramycin (50 ug/ml). Plates were then incubated overnight at 37? C. to generate a new strain named GBE1005_pKD46. In Strain GB1005_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette. To check that the deletion of the pfkA gene occurred, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively). This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620. In order to check the loss of the plasmid pKD46, the strain GBE1005_pKD46 was plated on LB plates and incubated overnight at 42? C. The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1005. GBE1005 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

(21) The spectinomycin cassette was located at the corresponding loci of the zwf_edd_eda genes and the apramycin cassette was located at the corresponding loci of the pfkA genes. In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1005 was transformed with the plasmid pCP20 (Datsenko K A. And Wanner B L., Proceedings of the National Academy of Sciences, 2000, Vol. 97, No. 12, pp. 6640-6645) to obtain the strain GBE1005_p. After overnight incubation on LB plates containing ampicilline (100 ug/ml) at 30? C., isolated colonies were restreaked on LB plates supplied with ampicilline (100 ug/ml) and incubated overnight at 30? C. Isolated colonies were then plated on LB plates and incubated overnight at 42? C. which caused the loss of the pCP20 plasmid. Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing apramycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C. and on LB plates, incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1006. GBE1006 cells did not grow on LB plates containing spectinomycin (50 ug/ml), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (100 ug/ml).

(22) Strain GBE1006 was made electrocompetent, and GBE1006 electrocompetent cells were transformed with plasmid pKD46. Transformant cells were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to obtain a new strain named GBE1010. A PCR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ RC0011 and RC0012, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1010 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml). Plates were incubated overnight at 37? C. to generate strain GBE1014.sub. pKD46. In Strain GBE1014.sub. pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene. To check that the deletion of the pfkB gene occurred, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively). This final 2.2 Kbp PCR product was sequenced by using the same primers 0621 and 0622.

(23) In order to induce the loss of the plasmid pKD46, strain GBE1014.sub. pKD46 was plated on LB plates and plates were incubated overnight at 42? C. The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain growing on LB plates incubated at 37? C. was named GBE1014. GBE1014 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

Example 2: Construction of Strain GBE0929

(24) Strain GBE0901 was plated on LB plates at 37? C. and isolated colonies were screened on MS plates with glucose as the source of carbon (2 g/L). After 48 hours of incubation at 37? C., colonies became visible. One isolate had a doubling time of 5 hours and was named GBE0929.

Example 3: Construction of Strain GBE1344

(25) Construction started with the strain named GBE0129. GBE0129 is an MG1655 Escherichia coli bacteria (ATCC #700926).

(26) Strain GBE0129 was cultivated in LB medium and GBE0129 cells were made electrocompetent. Electrocompetent GBE0129 cells were transformed with plasmid pKD46, and then transformants were plated on LB plates containing ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. to generate a new strain named GBE0170.

(27) A PCR product was generated using plasmid pGBE0687 as a template and oligonucleotides 0633 and 0634 (given as SEQ RC0003 and RC0004, respectively) as primers. The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE0170 bacteria and the transformation mixture was plated on LB plates containing apramycin (50 ug/ml). Plates were incubated overnight at 37? C. This incubation triggered the loss of the pKD46 plasmid and led to the creation of a new strain named GBE1339. In Strain GBE1339 the glucose-6-phosphate dehydrogenase encoded by the zwf gene, the 6-phosphogluconate dehydratase encoded by the edd gene and the 2-keto-3-deoxy-6-phosphogluconate aldolase encoded by the eda gene were inactive. The sequential zwf, edd, and eda genes were deleted and replaced by a cassette containing the apramycin resistance gene. To check that the deletion of the zwf, edd, and eda genes was effective, a PCR amplification was performed with primers 1036 and 1037 (given as SEQ RC0005 and RC0006, respectively). This 1.8 Kbp PCR product was sequenced with the same primers 1036 and 1037.

(28) Strain GBE1339 was made electrocompetent, and GBE1339 electrocompetent cells were transformed with plasmid pKD46. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. to generate strain GBE1340. A PCR product was performed by using plasmid pGBE0688 as a template and oligonucleotides 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1340 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml). Plates were incubated overnight at 37? C. to generate strain GBE1341_pKD46. In Strain GB1341_pKD46 the pfka gene coding for a phosphofructokinase was replaced by the spectinomycin resistance gene. To check that the deletion of the pfkA gene was effective, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively). This 1.8 Kbp PCR product was sequenced with the same primers 0619 and 0620. In order to induce the loss of the plasmid pKD46 for the strain GBE1341_pKD46, GBE1341_pKD46 cells were plated on LB plates and incubated at 42? C. The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates supplied with ampicilline (100 ug/ml), incubated overnight at 30? C. and on LB plates incubated overnight at 37? C. The resulting strain growing on LB plates incubated at 37? C. was GBE1341. GBE1341 did not grow on LB plates supplied with ampicilline (100 ug/ml).

(29) In order to excise the resistant cassettes containing the apramycin and spectinomycin resistance genes, which were respectively located in the former loci of the zwf_edd_eda and pfkA genes, the strain GBE1341 was transformed with plasmid pCP20 to obtain a new strain named GBE1341_p. After overnight incubation on LB plates containing ampicilline (100 ug/ml) at 30? C., isolated colonies were restreaked on LB plates supplied with ampicilline (100 ug/ml) for another overnight incubation at 30? C. Isolated colonies were then plated on LB plates and incubated overnight at 42? C. This incubation at 42? C. triggered the loss of the pCP20 plasmid. Eventually in order to check excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (50 ug/ml) and incubated overnight at 37? C., on LB plates supplied with apramycin (50 ug/ml) and incubated overnight at 37? C., on LB plates containing ampicilline (100 ug/ml) and incubated overnight at 30? C. and on LB plates incubated overnight at 37? C. The generated strain growing on LB plates incubated at 37? C. was named GBE1342. GBE1342 cells did not grow on LB plates supplied with spectinomycin (50 ug/ml), on LB plates supplied with apramycin (50 ug/ml) and on LB plates containing ampicilline (100 ug/ml).

(30) Strain GBE1342 was made electrocompetent, and GBE1342 cells were transformed with plasmid pKD46. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml) and incubated overnight at 30? C. to obtain strain GBE1343. A PCR product was performed and used the plasmid pGBE0688 as a template and oligonucleotides 0631 and 0632 (given as SEQ RC0011 and RC0012, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1343 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml) followed by an overnight incubation at 37? C. A new strain was generated and named GBE1344.sub. pKD46. In Strain GBE1344.sub. pKD46 the pfkb gene coding for a phosphofructokinase was deleted and replaced by the spectinomycin resistance cassette. To check that the deletion of the pfkB gene was effective, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively). The 2.2 Kbp PCR product obtained was sequenced with the same primers 0621 and 0622.

(31) In order to induce the loss of the plasmid pKD46, the strain GBE1344.sub. pKD46 was plated on LB plates and incubated overnight at 42? C. The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates containing ampicilline (100 ug/ml) and incubated overnight at 30? C. and on LB plates incubated overnight at 37? C. The generated strain growing on LB plates incubated at 37? C. was named GBE1344. GBE1344 cells did not grow on LB plates containing ampicilline (100 ug/ml).

Example 4: Construction of Plasmid pGBE0457

(32) The purpose of this section is to describe the construction of a plasmid that allows the expression of phosphoketolase YP_003354041.1 from Lactococcus lactis in E. coli strains.

(33) The plasmid pGBE0123 is a modified version of the plasmid pUC18 (New England Biolabs) and contains a modified Multiple Cloning Site (MCS). The original MCS from pUC18 (from HindIII restriction site to EcoRI restriction site) was replaced by the sequence SQ0004 (table 3). The plasmid pGB0123 allows expression of two recombinant proteins under the control of the Plac promoter.

(34) TABLE-US-00005 Plasmid from Phosphoketolase Phosphoketolase Organism of GeneArt? gene ID protein ID origin (Invitrogen) 8679043 YP_003354041.1 Lactococcus pGBE0421 lactis subsp. lactis KF147

(35) The L. lactis phosphoketolase gene was codon-optimized by GeneArt? (Invitrogen) for optimal expression in Escherichia coli. In addition, a His-tag was added at the 5 position of the gene and an additional stop codon was added at the 3 position (SQ0005). The gene construction is flanked by PacI and NotI restriction sites and provided within plasmid pGBE0421.

(36) For cloning experiment, PCR products and restriction fragments were gel purified using QIAquick gel Extraction kit (Qiagen). Restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, Mass.) were used according to manufacturer's recommendations.

(37) Plasmid pGBE0421 was digested with the restriction enzymes PacI and NotI to create a 2.6 Kbp product. The pGB0123 plasmid was digested as well with restriction enzymes, PacI and NotI and ligated to the 2.6 Kbp restriction fragment. The resulting plasmid (pGBE0457) was sequenced with primers 1061, 1062, 1063, 1064 and 1065 (given as SEQ RC0015, RC0016, RC0017, RC0018 and RC0019 respectively).

(38) The expression of the phosphoketolase from Lactococcus lactis was checked on a protein gel, after purification of the recombinant protein using a His trap (Protino Ni-IDA 1000 kit, Macherey Nagel). Purification was processed according to the manufacturer's recommendations. Enzymatic assay, with purified enzyme, was also performed in order to detect phosphoketolase activity on two different substrates: xylulose-5-phosphate and fructose-6-phosphate. The experimental procedure was the same than the one used by Leo Meile et al., (Journal of Bacteriology, May 2001, p. 2929-2936), except that the pH of the solution was 7.5 and 1 mM of MgCl2 was added. For this enzymatic assay, 10 ?g of purified protein was added to the 75 ?l of the reaction. The specific activity (?mol of Acetyl-P formed/min/mg protein) was 2815 ?mol/min/mg protein and 1941 ?mol/min/mg protein for D-xylulose-5-phosphate and D-fructose-6-phosphate, respectively.

Example 5: Construction of Plasmid pGBE0096

(39) The construction of the plasmids responsible for acetone production in E. coli was based on the plasmid construction described in Bermejo L L., Welker N E. and Papoutsakis E T., Applied and Environmental Microbiology, 1998, Vol. 64, No. 3, pp. 1076-1085.

(40) The strain Clostridium acetobutylicum was ordered (ATCC 824). The genomic DNA from this strain is made up of a bacterial chromosome and a plasmid named pSOL1. The ctfA and ctfB genes were PCR amplified from the pSOL1 plasmid with primers 0070 and 0071 (given as SEQ RC0020 and RC0021, respectively). A BamHI restriction site at the 5 end of the PCR product and an EcoRV restriction site at the 3 end of the PCR product were introduced. The resulting 1.3 Kbp PCR product was digested with the restriction enzymes BamHI and EcoRV, then ligated with the pGB0689 (pBluescript II phagemids, Agilent Technologies) which was digested as well with restriction enzymes, BamHI and EcoRV. The resulting plasmid (pGBE0690) was sequenced with primers 1066 and 1067 (given as SEQ RC0022 and RC0023, respectively).

(41) The adc gene and the gene terminator were PCR amplified from the pSOL1 plasmid with primers 0072 and 0073 (given as SEQ RC0024 and RC0025, respectively). PCR amplification allowed inserting an EcoRV restriction site at the 5 end and a SalI restriction site at the 3 end. The resulting 0.8 Kbp PCR product was digested with the restriction enzymes EcoRV and SalI. The pGBE0690 plasmid was digested as well with restriction enzymes, EcoRV and SalI and then ligated with the 0.8 Kbp PCR product. The resulting plasmid (pGBE0691) was sequenced with primers 1066, 1067, 1068 and 1069 (given as SEQ RC0022, RC0023, RC0026 and RC0027, respectively).

(42) Plasmid pGBE0691 was digested with the restriction enzymes BamHI and SalI to create a 2.2 Kbp product. The 2.2 Kbp restriction fragment contained the ctfA, ctfB and adc genes. The pGBE0051 plasmid (pUC19, New England Biolabs) was digested as well with restriction enzymes, BamHI and SalI, and was then ligated with the 2.2 Kbp restriction fragment. The resulting plasmid (pGBE0692) was sequenced with primers 1066, 1067, 1068 and 1069 (given as SEQ RC0022, RC0023, RC0026 and RC0027, respectively).

(43) The thl gene and its corresponding thl promoter from Clostridium acetobutylicum (ATCC 824) genomic DNA were PCR amplified with primers 0074 and 0075 (given as SEQ RC0028 and RC0029, respectively). PCR amplification allowed inserting a KpnI restriction site at the 5 end and a BamHI restriction site at the 3 end. The resulting 1.4 Kbp PCR product was digested with the restriction enzymes KpnI and BamHI, and likewise for the plasmid pGBE0692. The digested pGBE0692 plasmid was ligated with the 1.4 Kbp PCR product. The resulting plasmid, pGBE0693, was sequenced with primers 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073 and 1074 (given as SEQ RC0022, RC0023, RC0026 RC0027, RC0030, RC0031, RC0032, RC0033 and RC0034, respectively).

(44) The plasmid pGBE0124 is a modified version of the plasmid pSU18 (Borja Bartolom?, Yolanda Jubete, Eduardo Martinez and Fernando de la Cruz, Gene, 1991, Vol. 102, Issue 1, pp. 75-78) and it contains a modified Multiple Cloning Site (MCS). The original MCS from pSU18 (from EcoRI restriction site to HindIII restriction site) was replaced by the sequence SEQ SQ0006 (table 3). The plasmid pGB0124 allows expression of two recombinant proteins under the control of the Plac promoter. Plasmid pGBE0693 was digested with the restriction enzymes KpnI and SalI to create a 3.5 Kbp product. The pGBE0124 plasmid was digested as well with restriction enzymes KpnI and SalI, and then ligated to the 3.5 Kbp restriction fragment. The resulting plasmid (pGBE0096) was sequenced with primers 1066, 1067, 1068, 1069, 1070, 1071, 1072, 1073 and 1074 (given as SEQ RC0022, RC0023, RC0026 RC0027, RC0030, RC0031, RC0032, RC0033 and RC0034, respectively).

Example 6: Acetone Production by the Strains GBE1346 and GBE1347

(45) Description of Plasmid Transformation into Relevant Strains

(46) The strain GBE0129 was made electrocompetent, and GBE0129 electrocompetent cells were transformed with plasmid pGBE0096. Transformants were then plated on LB plates containing chloramphenicol (25 ug/ml) and plates were incubated overnight at 30? C. to generate strain GBE0329.

(47) Strain GBE1344 was made electrocompetent, and GBE1344 electrocompetent cells were transformed with both plasmids pGBE0457 and pGBE0096. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml) and chloramphenicol (25 ug/ml). Plates were incubated overnight at 30? C. to obtain strain GBE1345.

(48) Isolated colonies from strains GBE0329 and GBE1345 were screened on MS plates containing glucose as the source of carbon (2 g/L) and chloramphenicol (25 ug/ml). These plates were incubated at 30? C. to obtain strains GBE1346 and GBE1347 respectively. After 4 days of incubation at 30? C., colonies were transferred to MS liquid medium containing glucose (2 g/L) and chloramphenicol (25 ug/ml) and incubated 3 days at 30? C.

(49) Description of Flasks Conditions

(50) For the fermentation experiments, a MS medium with 200 mM of dipotassium phosphate was used instead of 50 mM dipotassium phosphate. The resulted medium was named MSP.

(51) 400 ml of MSP liquid medium containing glucose (10 g/L) and chloramphenicol (25 ug/ml), were inoculated either with pre culture of strain GBE1346 or with pre culture of strain GBE1347. The initial OD.sub.600 was 0.1. The 400 ml of culture were incubated in 500 ml bottles, sealed with a screw cap, at 30? C., 170 rpm of speed. 2 ml aliquots were taken after 1 day, 2 days, 3 days, 6 days, 7 days and 8 days. For each aliquot samples, bottles were open during 10 seconds.

(52) Description of Analytical Methods

(53) Aliquots were filtered and the glucose concentration was determined with the glucose (HK) Assay kit (GAHK20-1KT, Sigma) according to manufacturer's recommendations. The acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program: Column: DB-WAX (123-7033, Agilent Technologies) Injector Split/Splitless: T?=250? C. Oven: 80? C. for 6 minutes 10? C. per minutes until 220? C. 220? C. for 7 minutes Column flow: 1.5 ml/minute (Nitrogen) Detector FID: T?=300? C.

(54) Results

(55) The ratio [acetone] produced (mM)/[glucose] consumed (mM) is higher for the strain GBE1347 than for the strain GBE1346.

Example 7: Acetone Production by the Strains GBE1350 and GBE1351

(56) Description of Plasmid Transformation into Relevant Strains

(57) Strain GBE0929 was made electrocompetent, and GBE0929 electrocompetent cells were transformed with a plasmid named pGBE0096. Transformants were then plated on LB plates supplied with chloramphenicol (25 ug/ml) and plates were incubated overnight at 30? C. to obtain strain GBE1348.

(58) Strain GBE1014 were made electrocompetent, transformed with both plasmids pGBE0457 and pGBE0096. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml) and chloramphenicol (25 ug/ml) and plates were incubated overnight at 30? C. to obtain strain GBE1349.

(59) Isolated colonies from strains GBE1348 and GBE1349 were screened on MS plates containing glucose as the source of carbon (2 g/L) and chloramphenicol (25 ug/ml). These plates were incubated 4 days at 30? C. to obtain strain GBE1350 and GBE1351 respectively. Isolated colonies were then transferred to MS liquid medium containing glucose (2 g/L) and chloramphenicol (25 ug/ml). GBE1350 and GBE1351 Cells were incubated at 30? C.

(60) Description of Flasks Conditions

(61) 400 ml of MSP medium containing glucose (10 g/L) and chloramphenicol (25 ug/ml) were inoculated either with pre-culture of strain GBE1350 or with pre-culture of strain GBE1351. The initial OD.sub.600 was 0.1. The 400 ml of culture were incubated in 500 ml bottles, sealed with a screw cap, at 30? C., 170 rpm of speed. 2 ml aliquots were taken after 1 day, 2 days, 3 days, 6 days, 7 days and 8 days. For each aliquot samples, bottles were opened during 10 seconds.

(62) Description of Analytical Methods

(63) Aliquots were filtered and the glucose concentration was determined with the glucose (HK) Assay kit (GAHK20-1KT, Sigma) according to manufacturer's recommendations. The acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program: Column: DB-WAX (123-7033, Agilent Technologies) Injector Split/Splitless: T?=250? C. Oven: 80? C. for 6 minutes 10? C. per minutes until 220? C. 220? C. for 7 minutes Column flow: 1.5 ml/minute (Nitrogen) Detector FID: T?=300? C.

(64) Results

(65) The ratio [acetone] produced (mM)/[glucose] consumed (mM) was higher for the strain GBE1351 than for the strain GBE1350.

(66) TABLE-US-00006 TABLE OF RESULTS I GBE1346 GBE1347 GBE1350 GBE1351 PEP dependent glucose + + ? ? uptake (ptsHI) Heterologous ? + ? + phosphoketolase (pkt) EMPP (pfkAB) + ? + ? PPP (zwf edd eda) + ? + ? Heterologous fructose ? ? ? ? bisphosphatase (fbp) Heterologous acetone + + + + pathway (thl ctfAB adc) [acetone].sub.produced/ 0.02 >0.02 0.04 0.14 [glucose].sub.consumed

Example 8: Construction of the Plasmid pGBE1020

(67) The purpose of this section is to describe the construction of a plasmid that allows the expression of phosphoketolase YP_003354041.1 from Lactococcus lactis and also allows the production of acetone in E. coli strains.

(68) The L. Lactis phosphoketolase gene was PCR amplified from the pGBE0421 plasmid with primers 1516 and 1517 (given as SEQ RC0035 and RC0036, respectively).

(69) PCR amplification allowed inserting an EcoRI restriction site and a Ribosome Binding Site (RBS) at the 5 end and a KpnI restriction site at the 3 end. The resulting 2.5 Kbp PCR product was digested with the restriction enzymes EcoRI and KpnI. The pGBE0123 plasmid was digested as well with restriction enzymes, EcoRI and KpnI and then ligated with the 2.5 Kbp PCR product. The resulting plasmid (pGBE0928) was sequenced with primers 1061, 1062, 1063, 1064 and 1065 (given as SEQ RC0015, RC0016, RC0017, RC0018 and RC0019, respectively).

(70) Plasmid pGBE0096 was digested with the restriction enzymes KpnI and NotI to create a 3.6 Kbp product. The pGBE0928 plasmid was digested as well with restriction enzymes, KpnI and NotI and ligated to the 3.6 Kbp restriction fragment. The resulting plasmid (pGBE1020) was sequenced with primers 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002 and 2003 (given as SEQ RC0037, RC0038, RC0039, RC0040, RC0041, RC0042, RC0043, RC0044, RC0045 and RC0046, respectively).

Example 9: Construction of the Plasmid pGBE1021

(71) The purpose of this section is to describe the construction of a plasmid that allows the production of acetone in E. coli strains.

(72) Plasmid pGBE0096 was digested with the restriction enzymes KpnI and NotI to create a 3.6 Kbp product.

(73) The pGBE0123 plasmid was digested as well with restriction enzymes, KpnI and NotI and then ligated with the 3.6 Kbp PCR product. The resulting plasmid (pGBE1021) was sequenced with primers 1994, 1995, 1996, 1997, 1998, 1999, 2000, 2001, 2002 and 2003 (given as SEQ RC0037, RC0038, RC0039, RC0040, RC0041, RC0042, RC0043, RC0044, RC0045 and RC0046, respectively).

Example 10: Acetone Production by the Strains GBE2264 and GBE2265

(74) Description of Plasmid Transformation into Relevant Strains

(75) The strain GBE0129 was made electrocompetent, and GBE0129 electrocompetent cells were transformed with plasmid pGB1021. Transformants were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to generate strain GBE2262.

(76) Strain GBE1344 was made electrocompetent, and GBE1344 electrocompetent cells were transformed with the plasmid pGBE1020. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. to obtain strain GBE2263.

(77) Isolated colonies from strains GBE2262 and GBE2263 were screened on MS plates containing glucose as the source of carbon (2 g/L) and ampicilline (100 ug/ml). These plates were incubated at 30? C. to obtain strains GBE2264 and GBE2265, respectively. After 4 days of incubation at 30? C., colonies were transferred to MS liquid medium containing glucose (2 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml) and incubated 3 days at 30? C.

(78) Description of Flasks Conditions

(79) MSP liquid medium (200 ml) containing glucose (10 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml), were inoculated either with pre culture of strain GBE2264 or with pre culture of strain GBE2265. The initial OD.sub.600 was 0.1. The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30? C., 170 rpm of speed. Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days and 6 days. For each aliquot sample, the bottle was open for 10 seconds.

(80) Description of Analytical Methods

(81) Aliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Plex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Plex H Guard Column, PL1170-1830). Volume of injection: 20 ?l Solvent composition: [H.sub.2SO.sub.4]: 5.5 mM Temperature of the columns: 65? C. RID (G1362A): temperature set: 35? C.

(82) Acetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot). Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program: Column: DB-WAX (123-7033, Agilent Technologies) Injector: Split ratio: 10 T?=250? C. Oven: 50? C. for 9 minutes 20? C. per minute until 180? C. 180? C. for 5 minutes Column flow: 1.5 ml/minute (Nitrogen) Detector FID: T?=300? C.

(83) Results

(84) The ratio [acetone] produced (mM)/[glucose] consumed (mM) was higher for the strain GBE2265 than for the strain GBE2264.

Example 11: Construction of the Strain GBE1283

(85) Strain GBE0929 was plated on MS plates containing glucose as the source of carbon (2 g/L). An isolated colony was transferred to MS liquid medium containing glucose (2 g/L) and incubated 3 days at 30? C. MS liquid medium (100 ml) containing glucose (2 g/L) was inoculated with pre culture of strain GBE0929. The initial OD.sub.600 was 0.1. The 100 ml of culture was incubated in a 1 L erlenmeyer, at 30? C., 170 rpm of speed. When the OD.sub.600 was superior to 1, an aliquot of the culture was taken and used as inoculum for a fresh culture (100 ml of culture incubated in 1 L erlenmeyer, at 30? C., 170 rpm of speed). Strain GBE0929 was sub-cultured 10 times to obtain strain GBE1283.

Example 12: Construction of the Strain GBE2256

(86) Strain GBE1283 was cultivated in LB medium and GBE1283 cells were made electrocompetent. Electrocompetent GBE1283 cells were transformed with the pKD46 plasmid and then plated on LB plates containing ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. Transformation of GBE1283 cells with plasmid pKD46 generated strain GBE1284.

(87) The plasmid pGBE0688 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product. The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1284 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml). Plates were then incubated overnight at 37? C. to generate a new strain named GBE2252_pKD46. In Strain GB2252_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the spectinomycin resistance cassette. To check that the deletion of the pfkA gene occurred, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively). This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620. In order to check the loss of the plasmid pKD46, the strain GBE2252_pKD46 was plated on LB plates and incubated overnight at 42? C. The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE2252. GBE2252 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

(88) Strain GBE2252 was made electrocompetent, and GBE2252 electrocompetent cells were transformed with plasmid pKD46. Transformant cells were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to obtain a new strain named GBE2253.

(89) A PCR product was generated by using the plasmid pGBE0687 as a template and the oligonucleotides 0631 and 0632 (given as SEQ RC0011 and RC0012, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE2253 bacteria and the transformation mixture was plated on LB plates containing apramycin (50 ug/ml). Plates were incubated overnight at 37? C. to generate strain GBE2256_pKD46. In Strain GBE2256_pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the apramycin resistance gene. To check that the deletion of the pfkB gene occurred, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively). This final 2.2 Kbp PCR product was sequenced by using the same primers 0621 and 0622.

(90) In order to induce the loss of the plasmid pKD46, strain GBE2256.sub. pKD46 was plated on LB plates and plates were incubated overnight at 42? C. The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain growing on LB plates incubated at 37? C. was named GBE2256. GBE2256 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

Example 13: Construction of the Strain GBE1518

(91) Plasmid pGBE0688 was used as a template with primers 0633 and 1109 (given as SEQ RC0003 and RC0047, respectively) to generate a 1.3 Kbp PCR product. This 1.3 Kbp PCR product was transformed into electrocompetent GBE1284 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (50 ug/ml) and incubated overnight at 37? C. to generate strain GBE1433. In strain GBE1433 the DNA sequence composed by the zwf gene were deleted. This deleted DNA sequence including the zwf gene was replaced by a spectinomycin resistance cassette. In order to check the effective deletion of the zwf gene, a PCR amplification was performed with primers 1036 and 1110 (given as SEQ RC0005 and RC0048, respectively). A final 1.5 Kbp PCR product was obtained. This 1.5 Kbp PCR product was sequenced with the same primers 1036 and 1110.

(92) Strain GBE1433 was made electrocompetent. GBE1433 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. Transformation of GBE1433 cells with plasmid pKD46 generated strain GBE1436.

(93) The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product. The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1436 bacteria and the transformation mixture was plated on LB plates containing apramycin (50 ug/ml). Plates were then incubated overnight at 37? C. to generate a new strain named GBE1441_pKD46. In Strain GB1441_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette. To check that the deletion of the pfkA gene occurred, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively). This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620. In order to check the loss of the plasmid pKD46, the strain GBE1441_pKD46 was plated on LB plates and incubated overnight at 42? C. The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1441. GBE1441 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

(94) The spectinomycin cassette was located at the corresponding loci of the zwf gene and the apramycin cassette was located at the corresponding loci of the pfkA gene. In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1441 was transformed with the plasmid pCP20 to obtain the strain GBE1441_p. After overnight incubation on LB plates containing ampicilline (100 ug/ml) at 30? C., isolated colonies were restreaked on LB plates supplied with ampicilline (100 ug/ml) and incubated overnight at 30? C. Isolated colonies were then plated on LB plates and incubated overnight at 42? C. which caused the loss of the pCP20 plasmid. Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing apramycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C. and on LB plates, incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1448. GBE1448 cells did not grow on LB plates containing spectinomycin (50 ug/ml), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (100 ug/ml).

(95) Strain GBE1448 was made electrocompetent, and GBE1448 electrocompetent cells were transformed with plasmid pKD46. Transformant cells were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to obtain a new strain named GBE1449. A PCR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ RC0011 and RC0012, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1449 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml). Plates were incubated overnight at 37? C. to generate strain GBE1518.sub. pKD46. In Strain GBE1518.sub. pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene. To check that the deletion of the pfkB gene occurred, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively). This final 2.2 Kbp PCR product was sequenced by using the same primers 0621 and 0622.

(96) In order to induce the loss of the plasmid pKD46, strain GBE1518.sub. pKD46 was plated on LB plates and plates were incubated overnight at 42? C. The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain growing on LB plates incubated at 37? C. was named GBE1518. GBE1518 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

Example 14: Construction of the Strain GBE1420

(97) Plasmid pGBE0688 was used as a template with primers 0633 and 0634 (given as SEQ RC0003 and RC0004, respectively) to generate a 1.3 Kbp PCR product. This 1.3 Kbp PCR product was transformed into electrocompetent GBE1284 bacteria and the transformation mixture was then plated on LB plates containing spectinomycin (50 ug/ml) and incubated overnight at 37? C. to generate strain GBE1287. In strain GBE1287 the DNA sequence composed by the zwf, edd, and eda genes were deleted. This deleted DNA sequence including the zwf, edd, and eda genes was replaced by a spectinomycin resistance cassette. In order to check the effective deletion of the zwf, edd, and eda genes, a PCR amplification was performed with primers 1036 and 1037 (given as SEQ RC0005 and RC0006, respectively). A final 1.9 Kbp PCR product was obtained. This 1.9 Kbp PCR product was sequenced with the same primers 1036 and 1037.

(98) Strain GBE1287 was made electrocompetent. GBE1287 electrocompetent cells were transformed with plasmid pKD46, and then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. Transformation of GBE1287 cells with plasmid pKD46 generated strain GBE1337.

(99) The plasmid pGBE0687 was used as a template along with primers 0629 and 0630 (given as SEQ RC0007 and RC0008, respectively) to generate a 1.2 Kbp PCR product. The resulting 1.2 Kbp PCR product was transformed into electrocompetent GBE1337 bacteria and the transformation mixture was plated on LB plates containing apramycin (50 ug/ml). Plates were then incubated overnight at 37? C. to generate a new strain named GBE1353_pKD46. In Strain GB1353_pKD46 the phosphofructokinase gene pfkA, was deleted and was replaced by the apramycin resistance cassette. To check that the deletion of the pfkA gene occurred, a PCR amplification was performed with primers 0619 and 0620 (given as SEQ RC0009 and RC0010, respectively). This 1.7 Kbp PCR product was sequenced with the same primers 0619 and 0620. In order to check the loss of the plasmid pKD46, the strain GBE1353_pKD46 was plated on LB plates and incubated overnight at 42? C. The loss of the plasmid pKD46 was verified by plating isolated colonies on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1353. GBE1353 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

(100) The spectinomycin cassette was located at the corresponding loci of the zwf_edd_eda genes and the apramycin cassette was located at the corresponding loci of the pfkA genes. In order to excise the resistant cassettes containing the spectinomycin and apramycin resistance genes, the strain GBE1353 was transformed with the plasmid pCP20 to obtain the strain GBE1353_p. After overnight incubation on LB plates containing ampicilline (100 ug/ml) at 30? C., isolated colonies were restreaked on LB plates supplied with ampicilline (100 ug/ml) and incubated overnight at 30? C. Isolated colonies were then plated on LB plates and incubated overnight at 42? C. which caused the loss of the pCP20 plasmid. Then, in order to check the effective excision of the two resistant cassettes and the loss of the pCP20 plasmid, isolated colonies were streaked out on LB plates containing spectinomycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing apramycin (50 ug/ml), incubated overnight at 37? C., on LB plates containing ampicilline (100 ug/ml), incubated overnight at 30? C. and on LB plates, incubated overnight at 37? C. The resulting strain grew on LB plates incubated at 37? C. and was named GBE1368. GBE1368 cells did not grow on LB plates containing spectinomycin (50 ug/ml), on LB plates containing apramycin (50 ug/ml), and on LB plates supplied with ampicilline (100 ug/ml).

(101) Strain GBE1368 was made electrocompetent, and GBE1368 electrocompetent cells were transformed with plasmid pKD46. Transformant cells were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to obtain a new strain named GBE1371. A PCR product was generated by using the plasmid pGBE0688 as a template and the oligonucleotides 0631 and 0632 (given as SEQ RC0011 and RC0012, respectively) as primers. The resulting 1.3 Kbp PCR product was transformed into electrocompetent GBE1371 bacteria and the transformation mixture was plated on LB plates containing spectinomycin (50 ug/ml). Plates were incubated overnight at 37? C. to generate strain GBE1420.sub. pKD46. In Strain GBE1420.sub. pKD46 the phosphofructokinase gene pfkB, was deleted and the deleted DNA sequence was replaced by a cassette containing the spectinomycin resistance gene. To check that the deletion of the pfkB gene occurred, a PCR amplification was performed with primers 0621 and 0622 (given as SEQ RC0013 and RC0014, respectively). This final 2.2 Kbp PCR product was sequenced by using the same primers 0621 and 0622.

(102) In order to induce the loss of the plasmid pKD46, strain GBE1420.sub. pKD46 was plated on LB plates and plates were incubated overnight at 42? C. The loss of the plasmid pKD46 was checked by plating isolated colonies on LB plates supplied with ampicilline (100 ug/ml), incubated overnight at 30? C., and on LB plates incubated overnight at 37? C. The resulting strain growing on LB plates incubated at 37? C. was named GBE1420. GBE1420 cells did not grow on LB plates supplied with ampicilline (100 ug/ml).

Example 15: Acetone Production by the Strains GBE2268 and GBE2269

(103) Description of Plasmid Transformation into Relevant Strains

(104) The strain GBE1283 was made electrocompetent, and GBE1283 electrocompetent cells were transformed with plasmid pGB1021. Transformants were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to generate strain GBE2266.

(105) Strain GBE1420 was made electrocompetent, and GBE1420 electrocompetent cells were transformed with the plasmid pGBE1020. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. to obtain strain GBE2267.

(106) Isolated colonies from strains GBE2266 and GBE2267 were screened on MS plates containing glucose as the source of carbon (2 g/L) and ampicilline (100 ug/ml). These plates were incubated at 30? C. to obtain strains GBE2268 and GBE2269 respectively. After 4 days of incubation at 30? C., colonies were transferred to MS liquid medium containing glucose (2 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml) and incubated 3 days at 30? C.

(107) Description of Flasks Conditions

(108) MSP liquid medium (200 ml) containing glucose (10 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml), were inoculated either with pre culture of strain GBE2268 or with pre culture of strain GBE2269. The initial OD.sub.600 was 0.1. The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30? C., 170 rpm of speed. Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days, 6 days, 7 days and 8 days. For each aliquot sample, the bottle was open for 10 seconds.

(109) Description of Analytical Methods

(110) Aliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Plex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Plex H Guard Column, PL1170-1830). Volume of injection: 20 ?l Solvent composition: [H.sub.2SO.sub.4]: 5.5 mM Temperature of the columns: 65? C. RID (G1362A): temperature set: 35? C.
Acetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot). Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program: Column: DB-WAX (123-7033, Agilent Technologies) Injector: Split ratio: 10 T?=250? C. Oven: 50? C. for 9 minutes 20? C. per minute until 180? C. 180? C. for 5 minutes Column flow: 1.5 ml/minute (Nitrogen) Detector FID: T?=300? C.

(111) Results

(112) The ratio [acetone] produced (mM)/[glucose] consumed (mM) was higher for the strain GBE2269 than for the strain GBE2268.

Example 16: Acetone Production by the Strains GBE2272 and GBE2273

(113) Description of Plasmid Transformation into Relevant Strains

(114) The strain GBE2256 was made electrocompetent, and GBE2256 electrocompetent cells were transformed with plasmid pGB1020. Transformants were then plated on LB plates containing ampicilline (100 ug/ml) and plates were incubated overnight at 30? C. to generate strain GBE2270.

(115) Strain GBE1518 was made electrocompetent, and GBE1518 electrocompetent cells were transformed with the plasmid pGBE1020. Transformants were then plated on LB plates supplied with ampicilline (100 ug/ml). Plates were incubated overnight at 30? C. to obtain strain GBE2271.

(116) Isolated colonies from strains GBE2270 and GBE2271 were screened on MS plates containing glucose as the source of carbon (2 g/L) and ampicilline (100 ug/ml). These plates were incubated at 30? C. to obtain strains GBE2272 and GBE2273, respectively. After 4 days of incubation at 30? C., colonies were transferred to MS liquid medium containing glucose (2 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml) and incubated 3 days at 30? C.

(117) Description of Flasks Conditions

(118) MSP liquid medium (200 ml) containing glucose (10 g/L), yeast extract (0.1 g/L) and ampicilline (100 ug/ml), were inoculated either with pre culture of strain GBE2272 or with pre culture of strain GBE2273. The initial OD.sub.600 was 0.1. The 200 ml of culture was incubated in 250 ml bottles, sealed with a screw cap, at 30? C., 170 rpm of speed. Aliquots (2 ml) were taken after 1 day, 2 days, 4 days, 5 days and 6 days. For each aliquot sample, the bottle was open for 10 seconds.

(119) Description of Analytical Methods

(120) Aliquots were filtered and the glucose concentration was determined by HPLC analysis using the Agilent HPLC (1260 Infinity) and a Hi-Plex Colomn (Agilent, PL1170-6830) with a guard column (Agilent, PL Hi-Plex H Guard Column, PL1170-1830). Volume of injection: 20 ?l Solvent composition: [H.sub.2SO.sub.4]: 5.5 mM Temperature of the columns: 65? C. RID (G1362A): temperature set: 35? C.
Acetone was extracted from the filtered aliquots by mixing with methyl acetate (1 volume of methyl acetate for 2 volumes of filtered aliquot). Acetone concentration was determined by gas chromatography using Gas chromatograph 450-GC (Bruker) and the following program: Column: DB-WAX (123-7033, Agilent Technologies) Injector: Split ratio: 10 T?=250? C. Oven: 50? C. for 9 minutes 20? C. per minute until 180? C. 180? C. for 5 minutes Column flow: 1.5 ml/minute (Nitrogen) Detector FID: T?=300? C.

(121) Results

(122) The ratio [acetone] produced (mM)/[glucose] consumed (mM) was higher for the strain GBE2273 than for the strain GBE2272.

(123) TABLE-US-00007 TABLE OF RESULTS II GBE2264 GBE2265 GBE2268 GBE2269 GBE2268 GBE2273 GBE2272 GBE2273 PEP dependent glucose + + ? ? ? ? ? ? uptake (ptsHI) Heterologous ? + ? + ? + + + phosphoketolase (pkt) EMPP (pfkAB) + ? + ? + ? ? ? PPP (zwf) + ? + ? + ? + ? EDP (edd eda) + ? + ? + + + + Heterologous acetone + + + + + + + + pathway (thl ctfAB adc) [acetone].sub.produced (mM)/ 0.03 0.21 0.01 0.22 0.01 0.51 0.05 0.51 [glucose].sub.consumed (mM) the reported ratio was the maximum observed